A method for directly transdifferentiating foreskin-derived mesenchymal stem cells into sperms using transcription factor id4
By transfecting mesenchymal stem cells with transcription factor ID4 and using specific culture media and screening techniques, the direct transformation from mesenchymal stem cells to male germ cells was achieved, solving the treatment problem of male azoospermia and providing germ cells capable of fertilization.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SHENZHEN CHILDRENS HOSPITAL
- Filing Date
- 2021-10-29
- Publication Date
- 2026-07-21
AI Technical Summary
Current technologies make it difficult to effectively treat male azoospermia, especially testicular failure, through assisted reproductive technology, as it is impossible to obtain male autologous germ cells capable of fertilization.
Mesenchymal stem cells were introduced via transfection using transcription factor ID4. The mesenchymal stem cells were then induced to become sperm using lentiviral transfection, electrotransfection, or liposome transfection. Stable cell lines were obtained by screening and culturing the cells using specific culture media and drugs.
Successfully converting mesenchymal stem cells directly into reproductive cells with male genetic code and fertilization capacity provides an effective solution for treating male infertility caused by spermatogenesis disorders.
Smart Images

Figure CN114015695B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, specifically to a method for using transcription factor ID4 to directly transdifferentiate mesenchymal stem cells derived from the foreskin as sperm. Background Technology
[0002] Infertility is a global medical and social problem, affecting approximately 10%-20% of couples of reproductive age worldwide, with male factors accounting for about 50% of these cases. The World Health Organization predicts that infertility, cancer, and cardiovascular disease will become the three most serious threats to human health in the 21st century.
[0003] Currently, the treatment for human infertility combines assisted reproductive technology (ART) with drug and surgical treatments, fulfilling the dreams of many infertile couples to become parents. However, many male patients with infertility do not receive a fundamental cure, and a significant number of infertile patients cannot resolve their fertility issues through traditional drug treatments or ART.
[0004] Spermatogenesis disorders are a significant factor causing male infertility. Azoospermia accounts for 20% of male infertility cases, including obstructive and non-obstructive azoospermia. With the development and maturation of intracytoplasmic sperm injection (ICSI) technology in recent years, its clinical application has become increasingly widespread, especially for treating severe male infertility, including oligospermia and azoospermia. In some patients with non-obstructive azoospermia, microinjection of haploid sperm cells into oocytes, such as round sperm cell injection or round sperm cell nuclear injection, may result in offspring with complete paternal genetic information. However, most cases of non-obstructive azoospermia, also known as testicular failure, lack sperm for retrieval, limiting this method and making it impossible to obtain the male's own germ cells. Without a male haploid germ cell capable of fertilization, assisted reproductive technology cannot solve the problem of male infertility, especially for men who need offspring with their own genetic material; a more scientific approach is necessary to obtain their own haploid germ cells. Obtaining male haploid germ cells derived from male autologous adult stem cells can fundamentally solve this problem.
[0005] Currently, the technology of differentiating male haploid germ cells from embryonic stem cells is immature and carries the risk of tumorigenesis. While there have been previous studies differentiating adult stem cells into male germ cells, there has been no research utilizing autologous male adult stem cells. Summary of the Invention
[0006] To overcome the shortcomings of the prior art, the present invention provides a method for using transcription factor ID4 to directly transdifferentiate mesenchymal stem cells derived from the foreskin as sperm, thereby obtaining reproductive cells with the male's own genetic code and fertilization capacity.
[0007] To achieve the above objectives, the present invention adopts the following technical solution:
[0008] The first aspect of the present invention is to provide a method for directly transdifferentiating mesenchymal stem cells derived from the foreskin into sperm using transcription factor ID4, wherein transcription factor ID4 is introduced into the mesenchymal stem cells by transfection, and then the mesenchymal stem cells are induced and cultured into the sperm.
[0009] Furthermore, the nucleotide sequence of the aforementioned transcription factor ID4 is SEQ ID No. 1.
[0010] Furthermore, the transfection methods used above include lentiviral transfection, electrotransfection, or liposome transfection.
[0011] Furthermore, the DMEM / F12 medium used in the above-mentioned induction culture was used as the basic medium, and FBS, glutamine, non-essential amino acids, 2-β-mercaptoethanol, leukocyte inhibitory factor, neurotrophic factor, basic fibroblast growth factor, recombinant human stem cell factor and retinoic acid were added.
[0012] Furthermore, the DMEM / F12 medium used in the above-mentioned induction culture was used as the basic medium, with the addition of 15% FBS, 2mM glutamine, 0.1mM non-essential amino acids, 0.1mM 2-β-mercaptoethanol, 10ng / ml leukocyte inhibitory factor, 10ng / ml neurotrophic factor, 10ng / ml basic fibroblast growth factor, 10ng / mL recombinant human stem cell factor, and 2μM retinoic acid.
[0013] Furthermore, transcription factor ID4 was introduced into mesenchymal stem cells via lentiviral transfection, with the specific steps as follows:
[0014] Step 1: Calculate the amount of ID4 overexpressing lentivirus added to each well, then add the lentivirus to the culture medium containing mesenchymal stem cells, add a transfection promoter, and perform transfection.
[0015] Step 2: After 24-48 hours of transfection and when the cells have recovered well, remove the original culture medium and replace it with selection medium for a period of selection culture to obtain a stable cell line.
[0016] Furthermore, in step one, mesenchymal stem cells were transfected with ID4-overexpressing lentivirus with an MOI value of 5.
[0017] Furthermore, the screening medium was a fresh medium containing 6 μg / mL puromycin.
[0018] Furthermore, the aforementioned lentivirus undergoes viral packaging via a three-plasmid lentivirus system, which includes the following plasmids: a vector plasmid carrying the target gene or shRNA, a viral packaging helper plasmid psPAX2 vector, and a viral packaging helper plasmid pMD2G vector.
[0019] The present invention adopts the above technical solution and has the following technical effects compared with the prior art:
[0020] The method provided by this invention utilizes transcription factor ID4 to directly transdifferentiate mesenchymal stem cells cultured from male autologous foreskin into male autologous haploid germ cells, thereby obtaining germ cells with the male's own genetic code and fertilization capacity, providing an effective solution for treating male infertility caused by spermatogenesis disorders. Attached Figure Description
[0021] Figure 1 A schematic diagram of the structure of the lentiviral vector (pHBLV-CMV-MCS-3FLAG-EF1-ZsGreen-T2A-PURO) is shown.
[0022] Figure 2 This demonstrates the efficiency of flow cytometry detection of ID4 lentivirus-transfected FSMSCs in one embodiment of the present invention (total count: 5000); 98.6% of the FSMSCs expressed ZsGreen strong fluorescence;
[0023] Figure 3 This shows the mRNA expression level of ID4 in stable cell line cells after overexpression of ID4 in one embodiment of the present invention;
[0024] Figure 4 The figures show the cell morphology of a stable FSMSC cell line overexpressing ID4 in one embodiment of the present invention, wherein Figure A shows the cell morphology of FSMSCs at the same passage number; and Figure B shows the cell morphology of a stable FSMSC cell line overexpressing ID4.
[0025] Figure 5 This invention illustrates the expression changes of genes (DDX4, Blimp1, TAF4B, MAGEA4, SYCP3, PIWIL2, PRM1, ACR) in eight spermatogenesis stages of stable FSMSCs overexpressing ID4 after induction culture, as detected by Real-time qPCR in one embodiment of the invention.
[0026] Figure 6This invention shows that, in one embodiment of the invention, after 30 days of ID4 transdifferentiated FSMSCs, the haploid cell content accounted for 5.52% of the total viable cell count (total count: 12010). Detailed Implementation
[0027] This invention provides a method for directly transdifferentiating mesenchymal stem cells derived from the foreskin using transcription factor ID4 to produce sperm. The method involves introducing transcription factor ID4 into mesenchymal stem cells via transfection, and then inducing and culturing the mesenchymal stem cells to produce the sperm.
[0028] In a preferred embodiment of the present invention, the nucleotide sequence of the transcription factor ID4 is SEQ ID No.1.
[0029] In a preferred embodiment of the present invention, the transfection method used is lentiviral transfection, electrotransfection, or liposome transfection.
[0030] In a preferred embodiment of the present invention, the DMEM / F12 culture medium used for the above-mentioned induction culture is used as the basic culture medium, and is supplemented with FBS, glutamine, non-essential amino acids, 2-β-mercaptoethanol, leukocyte inhibitory factor, neurotrophic factor, basic fibroblast growth factor, recombinant human stem cell factor and retinoic acid.
[0031] In a preferred embodiment of the present invention, the DMEM / F12 culture medium used for the above-mentioned induction culture is used as the basic culture medium, and 15% FBS, 2mM glutamine, 0.1mM non-essential amino acids, 0.1mM 2-β-mercaptoethanol, 10ng / ml leukocyte inhibitory factor, 10ng / ml neurotrophic factor, 10ng / ml basic fibroblast growth factor, 10ng / mL recombinant human stem cell factor, and 2μM retinoic acid are added.
[0032] In a preferred embodiment of the present invention, transcription factor ID4 is introduced into mesenchymal stem cells via lentiviral transfection, and the specific steps are as follows:
[0033] Step 1: Calculate the amount of ID4 overexpressing lentivirus added to each well, then add the lentivirus to the culture medium containing mesenchymal stem cells, add a transfection promoter, and perform transfection.
[0034] Step 2: After 24-48 hours of transfection and when the cells have recovered well, remove the original culture medium and replace it with selection medium for a period of selection culture to obtain a stable cell line.
[0035] In a preferred embodiment of the present invention, in step one, mesenchymal stem cells are transfected with an ID4-overexpressing lentivirus with an MOI value of 5.
[0036] In a preferred embodiment of the present invention, the screening medium is a fresh medium containing 6 μg / mL puromycin.
[0037] In a preferred embodiment of the present invention, the above-mentioned lentivirus is packaged using a three-plasmid lentivirus system, which includes the following plasmids: a vector plasmid carrying the target gene or shRNA, a viral packaging helper plasmid psPAX2 vector, and a viral packaging helper plasmid pMD2G vector.
[0038] The present invention will now be described in detail with reference to specific embodiments and accompanying drawings to enable a better understanding of the invention. However, the following embodiments do not limit the scope of the invention.
[0039] Unless otherwise specified, the methods used in the embodiments are conventional methods, and the reagents used are commercially available reagents or reagents prepared according to conventional methods, unless otherwise specified.
[0040] The reagents (and their preparation methods) used in the following examples are as follows:
[0041] 1. Human ID4 target gene sequence information
[0042] ATGAAGGCGGTGAGCCCGGTGCGCCCCTCGGGCCGCAAGGCGCCGTCGGGCTGCGGCGGCGGGGAGCTGGCGCTGCGCTGCCTGGCCGAGCACGGCCACAGCCTGGGTGGCTCCGCAGCCGC GGCGGCGGCGGCGGCGGCAGCGCGCTGTAAGGCGGCCGAGGCGGCGGCCGACGAGCCGGCGCTGTGCCTGCAGTGCGATATGAACGACTGCTATAGCCGCCTGCGGAGGCTGGTGCCCACCAT CCCGCCCAACAAGAAAGTCAGCAAAGTGGAGATCCTGCAGCACGTTATCGACTACATCCTGGACCTGCAGCTGGCGCTGGAGACGCACCCGGCCCTGCTGAGGCAGCCACCACCGCCCGCGCCGCCACCACCCGGCCGGGACCTGTCCAGCCGCCGCCGCGGACCCCGCTCACTGCGCTCAACACCGACCCGGCCGGCGCGGTGAACAAGCAGGGCGACAGCATTCTGTGCCGCTGA (SEQ ID NO.1).
[0043] 2. Lentiviral vector plasmid
[0044] like Figure 1 As shown, pHBLV-CMV-MCS-3FLAG-EF1-ZsGreen-T2A-PURO, purchased from Shanghai Hanheng Biotechnology Co., Ltd., was used.
[0045] 3. Main liquids and their preparation methods
[0046] (1) FSMSCs induction medium: DMEM / F12 was used as the basic medium, with the addition of 15% FBS, 2mM glutamine, 0.1mM non-essential amino acids (NEAA), 0.1mM 2-β-mercaptoethanol, 10ng / ml leukocyte inhibitory factor (LIF), 10ng / ml neurotrophic factor (GDNF), 10ng / ml basic fibroblast growth factor (FGF-basic), 10ng / mL recombinant human stem cell factor (SCF) and 2μM retinoic acid (RA).
[0047] (2) Puro stock solution (1 mg / ml): Dissolve 10 mg of puro powder in 10 ml of DPBS, mix by pipetting until the powder is completely dissolved, filter with a 0.22 μm filter to sterilize, dispense into 20 μl tubes, label after dispensing, and store at -20℃; when using, add 6 μl of puro stock solution to every 994 μl of culture medium to ensure that its working concentration is 6 μg / ml.
[0048] (3) 1×TAE solution: Take Tris-acetate, EDTA solution and deionized water to prepare a TAE solution with a concentration of 40mM Tris-acetate and 2mM EDTA, and store it at room temperature.
[0049] (4) LB liquid culture medium: Add 10g tryptic peptone, 5g yeast extract and 10g NaCl to 950ml deionized water, shake the container until the solute is dissolved, adjust the pH to 7.0 with 5mol / L NaOH, bring the volume to 1L with deionized water and autoclave.
[0050] (5) LB solid medium: Add 10g tryptone, 5g yeast extract and 10g NaCl to 950ml deionized water, shake the container until the solute is dissolved, adjust the pH to 7.0 with 5mol / L NaOH, bring the volume to 1L with deionized water, add 15g agar powder, autoclave at 121℃ for 20min, cool to 50-60℃, pour into plates, cool under UV irradiation, seal the edges with sealing film, and store upside down at 4℃. Use within one month.
[0051] (6) 10% separating gel (1 gel): Take 3.94 ml of ultrapure water, 3.33 ml of 30% ACR / Bic, 2.5 ml of 1.5 M Tris HCl (pH 8.8), 100 μl of 10% SDS, 100 μl of 10% AP, and 6 μl of TEMED, dissolve and mix well.
[0052] (7) 5% stacking gel (2 gels): Take 4.13ml ultrapure water, 1.0ml 30% ACR / Bic, 0.75ml 0.5M TrisHCl (pH 6.8), 60μl 10% SDS, 60μl 10% AP, and 6μl TEMED, dissolve and mix well.
[0053] (8) Ampicillin solution: Dissolve 0.5g of ampicillin sodium in 10ml of water to prepare 10mg / ml, filter with a 0.22μm filter to remove bacteria, and store at -20℃.
[0054] Example 1
[0055] This embodiment provides a method for directly transdifferentiating mesenchymal stem cells derived from the foreskin using transcription factor ID4 to produce sperm, which includes the following steps:
[0056] Step 1, LV-hID4-Hygro-puro lentiviral packaging and purification: The viral packaging process is performed using a three-plasmid lentiviral system. The three-plasmid lentiviral system includes the following plasmids: a vector plasmid carrying the target gene or shRNA, a viral packaging helper plasmid (psPAX2 vector), and a viral packaging helper plasmid (pMD2G vector).
[0057] 1.1 Once the 293T cells reach approximately 70% confluence, passage them for transfection. Prepare the cells to be transfected the day before: add 1 ml of 0.25% EDTA trypsin to each 10cm culture dish, gently shake to mix, ensuring all cells are exposed to the trypsin, then place in a 37°C, 5% CO2 incubator for 2 minutes. Observe under an inverted microscope; at this point, the cells should become round and suspended. Immediately stop the digestion with serum-containing culture medium, adjust the cell density, and seed at an appropriate concentration in 10cm cell culture dishes. Mix thoroughly to ensure the cells are evenly distributed on the bottom of the dish, and continue culturing in a 37°C, 5% CO2 incubator.
[0058] 1.2 Observe cell density before transfection. Transfection can be performed when the confluence of 293T cells reaches 70-80%. Change the cell culture medium to fresh 2-4 hours before transfection.
[0059] 1.3 Gently mix the liposome transfection reagent. In a separate clean, sterile centrifuge tube, add 25 μg of DNA and an appropriate amount of DMEM culture medium (without antibiotics and glutamine). Gently pipette to mix the contents until the final volume is 100 μL.
[0060] 1.4 Take another clean, sterile centrifuge tube, add 25 μL of DMEM solution (without antibiotics and glutamine), then add 75 μL of transfection reagent, and gently mix with a pipette; make the final volume 100 μL, and let stand at room temperature for 5 min.
[0061] 1.5 Mix the DNA solution from step 1.3 with the transfection reagent solution from step 1.4 to prepare the lipid transfection mixture for 293T cells, and gently mix by pipetting. The composition of the lipid transfection mixture for transfecting 10cm culture dishes is as follows (Table 1).
[0062] Table 1: Composition of the mixture of lipid-transferred 293T cells
[0063]
[0064] 1.6 Let the mixed solution obtained in step 1.5 stand at room temperature for 20 minutes. If flocculent precipitate appears during the standing process, this is normal and will not affect the transfection efficiency.
[0065] 1.7 200μL Lipofiter TM - Add the DNA mixture evenly to one well of a 12-well plate. After adding, gently shake in a figure-eight motion to mix.
[0066] 1.8 Place the well plate in a constant temperature and humidity incubator at 37℃ with 5% CO2 and incubate for 16 hours. Then remove the plates containing Lipofiter. TM Replace the DNA culture medium with an appropriate amount of fresh culture medium (containing 10% fetal bovine serum FBS) and continue culturing.
[0067] 1.9 Virus Collection: 48 hours post-transfection, collect the viral supernatant. To collect the virus, pipette the culture medium from a 10cm culture dish into a 50mL centrifuge tube, being careful not to let it touch the dish wall to prevent bacterial contamination. After collection, add 10mL of fresh culture medium (containing 10% fetal bovine serum). Incubate at 37°C with 5% CO2 for 72 hours, then collect the viral supernatant 72 hours post-transfection.
[0068] 1.10 Ultracentrifugation: Centrifuge the collected virus supernatant tubes at 4°C, 2000g, for 10 min to remove cell debris; transfer the supernatant to a new ultracentrifuge tube, place the new tube in an ultracentrifuge, centrifuge at 4°C, 82700g, for 120 min, discard the supernatant, add an appropriate amount of fresh culture medium to resuspend the virus pellet, and finally evenly aliquot the ultracentrifuged resuspended solution into sterilized virus tubes.
[0069] 1.11 Virus preservation: Disassemble the virus, label it (virus name, date), and store it in a refrigerator at -80℃.
[0070] Step 2: Construction of ID4-overexpressing human foreskin mesenchymal stem cells
[0071] 2.1 Preparation of human foreskin mesenchymal stem cells
[0072] [1] When the FSMSCs reached a confluence of 80%-90%, the cells were removed and 1 ml of 0.25% EDTA trypsin was added to each 10 cm culture dish for digestion. The mixture was gently shaken to ensure that all cells were in contact with the trypsin. The cells were then placed in a constant temperature and humidity incubator at 37°C with 5% carbon dioxide for 2 min for digestion. The cells were then observed under an inverted microscope. At this time, the cells became round and suspended. The digestion was immediately terminated with DMEM / F-12 medium containing serum. The cell suspension was collected in a 15 ml centrifuge tube.
[0073] [2] 800g, centrifuged for 5min, discarded the supernatant, added fresh culture medium, gently pipetted the cells, counted them, and prepared a cell suspension of appropriate concentration. The number of cells inoculated in each culture system is shown in Table 2. The cells were placed in a 37℃, 5% CO2 incubator for further culture.
[0074] 2.2 Lentiviral infection of target cells
[0075] [1] Calculate the amount of lentivirus used per well (Table 2).
[0076] [2] Take out the FSMSCs plated the day before, observe the cell status and density, ensure that the cell status is good, the plated amount is about 30%, transfect FSMSCs with ID4 overexpression lentivirus with MOI value of 5, and add transfection agent (polyglucan) with a final concentration of 5 μg / mL.
[0077] [3] After FSMSCs were infected with ID4 overexpressing lentivirus for 24-48 hours, the original culture medium was removed and replaced with an equal amount of fresh culture medium.
[0078] Table 2: Infection fluid volume during adherent cell seeding and virus infection
[0079]
[0080] 2.3 Puromycin drug screening
[0081] [1] After FSMSCs were infected with ID4 overexpressing lentivirus for 48 h, the original culture medium was removed, the cells were gently rinsed twice with DPBS, and then the cells were screened for drugs using fresh culture medium containing 6 μg / mL puromycin.
[0082] [2] Discard the original culture medium every 2-3 days and replace it with fresh screening culture medium (containing 6 μg / mL of puro) to ensure that the cells have sufficient nutrition. Observe the cell status and growth status every day. If a large number of cells die or the cell status is not good, the concentration of puro can be reduced to 2-3 μg / mL and observed. When the cell status recovers slightly, the screening concentration (6 μg / mL) is changed again for screening. The entire screening time is about 10-14 days.
[0083] [3] Cryopreserved stable cell lines of FSMSCs overexpressing ID4.
[0084] After 10-14 days of selection, when the cells were in good condition and their growth rate gradually recovered, the stable cell lines were cryopreserved. Fresh cell cryopreservation buffer (fetal bovine serum (FBS) to DMSO ratio 9:1) was prepared in advance. 1 ml of 0.25% EDTA trypsin was added to each 10 cm culture dish for digestion. The mixture was gently shaken to ensure all cells were in contact with the trypsin. The dishes were then placed in a 37°C, 5% CO2 incubator for 2 minutes. The cells were observed under an inverted microscope; at this point, they were rounded and suspended. The dishes were immediately returned to the operating table, and an appropriate amount of fresh culture medium was added. The cells were gently pipetted to detach them completely, and the mixture was stirred to form a cell suspension. The cells were counted and centrifuged at 800g for 5 minutes. The supernatant was discarded, and the prepared cell cryopreservation buffer (fetal bovine serum (FBS) to DMSO ratio 9:1) was added, transferring approximately 1 ml to each cryovial. Label the cryovials with information such as cell type and quantity. Then pack them in a programmed cooling box and place them in a -80°C freezer overnight. The next day, remove the cryovials and store them in liquid nitrogen for long-term preservation.
[0085] Step 3, Induction Culture: Remove the ID4-FSMSCs stable cell line that has adhered to the culture wall, discard the original culture medium, and add fresh FSMSCs induction medium to continue induction culture.
[0086] Verification Example 1
[0087] This embodiment uses real-time quantitative PCR to detect gene expression in male germ cells at different stages. The specific experimental steps are as follows:
[0088] Step 1: Extract total RNA from cells using the Trizol method
[0089] 1.1 Preparation of reagents and consumables:
[0090] RNase-free EP tubes, RNase-free pipette tips, RNase-free glass bottles (autoclaved), RNase-free metal equipment (autoclaved), chloroform, isopropanol, RNase-free water, 75% ethanol (anhydrous ethanol dissolved in RNase-free water).
[0091] 1.2 Sample preparation:
[0092] Pre-culture the cells and observe their good condition under a microscope, with a cell density of 80-90%. Discard the original culture medium and gently rinse twice with DPBS. Add 1 ml of Trizol to each 10 cm culture dish and incubate at room temperature for 10 min to lyse. After 10 min, use a pipette to thoroughly lyse and detach the cells until the lysis buffer in the culture dish becomes clear, transparent, and non-viscous, indicating that the cells have completely dissolved. Transfer the cell lysis buffer obtained in the previous step to a 1.5 ml EP tube, mix well again, and centrifuge at 800 g for 5 min. After centrifugation, transfer the supernatant to a new 1.5 ml EP tube for the next step of RNA extraction.
[0093] 1.3 RNA extraction procedure
[0094] [1] Chloroform extraction: Take the cell lysis buffer containing Trizol, add 200 μl of chloroform per ml, shake the tube vigorously for 20 seconds, let it stand at room temperature for 2-3 minutes, and then centrifuge at 12000 rpm for 15 minutes at 4°C. After centrifugation, the tube separates into three layers: the upper layer is colorless, which is the aqueous phase; the middle layer is the aqueous phase; and the lower layer is bright red, which is the organic phase, with RNA present in the aqueous phase.
[0095] [2] Take aqueous phase: Carefully aspirate the aqueous phase with a pipette and transfer it to a new tube, about 400 μl.
[0096] [3] Isopropanol precipitation: Add 600 μl of isopropanol to the aqueous phase extracted in the previous step, invert and mix thoroughly, let stand at room temperature for 10 min, and centrifuge at 4℃, 12000 rpm for 10 min. RNA that was not visible before centrifugation can be found to form transparent, slightly white precipitates on the sides and bottom of the tube after centrifugation.
[0097] [4] Ethanol washing: Discard the supernatant, add 1 ml of 75% ethanol to each tube for washing, let the RNA precipitate float up, or keep it in place. Do not blow away the precipitate, otherwise the RNA fragments will not be able to gather together and form a visible precipitate after centrifugation. Centrifuge at 4°C and 7500 rpm for 5 min.
[0098] [5] Drying the precipitate and dissolving it in nuclease-free water: Aspirate as much supernatant as possible, and let it stand at room temperature for 5-10 minutes until the RNA precipitate is gel-like and slightly moist. Then add 20-40 μl of nuclease-free water to dissolve the RNA precipitate, gently pipette to mix, label it, and proceed with subsequent reverse transcription. Remember not to dry it completely, as complete drying will greatly reduce the solubility of the RNA precipitate. If you are not in a hurry to reverse transcribe, you can also store it at -80℃.
[0099] [6] Prepare two tubes of EP containing 1.5 μl of RNA solution and measure the RNA concentration.
[0100] Step 2: Detect RNA concentration and integrity.
[0101] 2.1 Nanodrop concentration measurement
[0102] Power on → Rinse twice with nuclease-free water → Open the program, select the unit ng / μl → Add 2.5μl of nuclease-free water → Click blank → Add 1μl of the sample to be tested using a pipette → Click measure.
[0103] 2.2 Agarose gel electrophoresis
[0104] [1] Gel preparation: Take a clean flask, add 100ml of 1×TAE electrophoresis buffer, weigh 1g of agarose and dissolve it in the buffer, shake gently, and then heat in a microwave oven until the agarose is completely dissolved. After dissolving, take out the flask, add 10μl of DNA fluorescent staining solution, and cool to 60℃.
[0105] [2] Prepare the required mold, place it in the gel casting plate, insert the appropriate sample comb, pour in the dissolved agarose (about 50°C), and let it cool and solidify at room temperature.
[0106] [3] After the dissolved agarose has fully solidified, carefully pull out the comb vertically upwards and place the gel in the electrophoresis tank. Then add 1×TAE electrophoresis buffer that can cover the gel by 1-2 mm.
[0107] [4] Use a pipette to draw up the RNA sample (0.5 μl of 5× loading buffer and 2.5 μl of RNA sample), mix well, and carefully add to the sample well.
[0108] [5] Turn on the power switch and start electrophoresis under a voltage of 100-150V. The electrophoresis time is about 30-60 minutes. Then turn off the power.
[0109] [6] Gel imaging.
[0110] 2.3 Reverse transcription into cDNA
[0111] [1] Take out each component of the reverse transcription, thaw it on ice, and then prepare the reaction solution according to the table below. After the reaction solution is prepared, gently mix it and dispense it into 0.2 ml EP tubes, and add template RNA and primers (Table 3).
[0112] Table 3: Components of Reverse Transcription Pre-denaturation
[0113]
[0114] [2] The mixture of template RNA and primers was pre-denatured at 70°C for 5 min. After the denaturation was completed, it was removed and placed on ice.
[0115] [3] Prepare RT-Mix on ice (Table 4 below), gently mix RT-Mix, and add 10 μl to each sample tube after mixing.
[0116] Table 4: Reverse Transcription Components Table
[0117]
[0118]
[0119] [4] Reverse transcription procedure: including three steps: annealing, extension, and reverse transcriptase inactivation, specifically: 25℃ for 8 min → 42℃ for 60 min → 70℃ for 15 min, and finally the temperature is reduced to 4℃.
[0120] 2.4 Real-time quantitative PCR (rt-qPCR)
[0121] [1] Primer sequences are detailed in Table 5. Primer powder was synthesized by Shanghai Sangon Biotech Co., Ltd.
[0122] Table 5: Primer sequences for target genes in Real-Time qPCR
[0123]
[0124]
[0125] [2] First, prepare the PCR reaction mixture (as shown in Table 6 below) and add 2 μl of template to each well.
[0126] Table 6: Components of PCR Reaction Mixture
[0127]
[0128] [3] At room temperature, add the PCR reaction mixture to the qPCR plate, mix by pipetting, centrifuge, and let the reaction solution adhering to the wall settle to the bottom of the reaction tube. Gently place it on the sample plate and perform PCR amplification using the three-step method.
[0129] [4] Data processing and analysis: After Real-Time qPCR amplification, the amplification curve and melting curve were first confirmed. The melting curve showed a single peak, confirming that the primers produced only one amplification product. The average Ct value of the three replicates of each sample was taken, and the expression level of GAPDH was used as an internal control. -ΔΔCt The relative expression level of the target gene is calculated using this method.
[0130] Verification Example 2
[0131] In this embodiment, flow cytometry was used to detect the haploid yield of ID4-FSMSCs-30. The specific experimental steps are as follows:
[0132] 1. ID4-FSMSCs were induced and cultured for 30 days. The original culture medium was discarded, and fresh culture medium was added. Hoechst, a live cell DNA dye, was added to a final concentration of 1 μg / ml. The cells were then placed in a 37°C, 5% CO2 cell culture incubator for 1 hour.
[0133] 2. After staining for 1 hour, remove the cells and wash them twice with PBS for 5 minutes each time.
[0134] 3. Digest cells with 0.25% trypsin, centrifuge at 800 rcf for 5 min, resuspend cells in flow cytometry working solution containing 2% FBS + DPBS and count the cells. Aliquot the cells into 5 ml flow cytometry tubes, 5 × 10⁶ cells per tube. 5 Each cell.
[0135] 4. Centrifuge at 800 rcf for 5 min, and discard the supernatant. Resuspend the cells in 200 μL of flow cytometry working solution and perform flow cytometry analysis using a BDAriaIII flow cytometer.
[0136] result
[0137] 1. Flow cytometry analysis of ID4 transfection efficiency
[0138] Third-generation FSMSCs with suitable growth status and cell density were selected and overexpressed with ID4 at MOI=5. After 48 hours of further culture, normal third-generation FSMSCs were used as a control. Compared with the control group, ID4-FSMSCs showed strong fluorescence expression, and the transfection efficiency was 98.6% (e.g., ...). Figure 2 ).
[0139] 2. RT-qPCR detection of ID4 overexpression status.
[0140] Primers for the target gene ID4 and the internal reference GAPDH were selected, and the expression of ID4 overexpressing lentivirus in MOI 5 was detected by RT-qPCR 48 h after infection with third-generation FSMSCs. The results are as follows: Figure 3The results showed that, 48 hours after lentiviral infection, compared with the control group, the relative expression level of the target gene ID4 mRNA in ID4-FSMSCs was significantly increased after transfection with ID4-overexpressing lentivirus, and the difference was statistically significant (P<0.01). This indicates that ID4-overexpressing FSMSCs were successfully constructed, and the target gene ID4 was significantly expressed in ID4-FSMSCs, with the expression level in ID4-FSMSCs upregulated by 1320.917523±83.49887794 times compared with the normal control.
[0141] 3. Morphological observation of ID4-overexpressing cell lines after drug screening
[0142] Third-generation FSMSCs were infected with an ID4-overexpressing lentivirus of MOI 5 for 48 hours, followed by further culture with a puromycin (puro) concentration of 6 μg / ml. Initially, some cells died and growth slowed; however, after 4-5 days, cells gradually began to recover their proliferative state. Cells were cultured at this concentration for 10-14 days, depending on the recovery of cell proliferation and growth. Afterward, a maintenance concentration of puromycin (puro) of 1 μg / ml was maintained to construct a stable ID4-expressing cell line. Figure 4 As shown, under the microscope, the stable cell line of ID4-FSMSCs was found to be shorter, wider, and flatter, exhibiting a shortened shape and relatively slower growth. In contrast, FSMSCs of the same generation were uniform, long, spindle-shaped, with plump cell morphology and vigorous growth. This indicates that overexpression of the transcription factor ID4 alters the morphology of FSMSCs to some extent, causing the cells to shorten.
[0143] 4. Key gene expression in ID4-mediated transdifferentiation of FSMSCs into male haploid germ cells
[0144] After the ID4 overexpression stable cell line was constructed (d10 days after drug screening, day 0 of the experiment), mRNA was extracted from cells on days 0, 7, 14, and 21 of induction. RT-qPCR was performed to detect genes expressed at different stages during spermatogenesis, including primordial germ cell (PGC) specific markers VASA and LIN28A, spermatogonial stem cell (SSC) specific markers TAF4B and MEGEA4, meiotic markers SYCP3 and PIWIL2, and spermatocyte markers PRM1 and ACR. The results are as follows: Figure 5As shown. After overexpression of ID4, under induced culture conditions, FSMSCs began to express DDX4, a representative gene in spermatogenesis and a marker of primordial germ cells. During the ID4-induced differentiation of FSMSCs, the expression level of DDX4 was relatively low at days 0, 7, and 14, and showed a continuous increase from day 14 to day 21, with an upregulation of 1389.392 ± 376.313 times by day 21. The relative expression level of the spermatogonial marker MAGEA4 showed a slow increase from day 7 to day 14, and a significant increase from day 14 to day 21, with an upregulation of 90% by day 21. The relative expression level of SYCP3, a meiotic marker, increased significantly from day 14 to day 21, reaching an upregulation of 64.933 ± 2.028 times by day 21. The relative expression level of PIWIL2 showed a significant increase starting from day 14 of ID4-induced differentiation of FSMSCs, reaching an upregulation of 59.260 ± 2.272 times by day 21. The relative expression level of sperm cell marker ACR showed a significant increase starting from day 14 of ID4-induced differentiation of FSMSCs, reaching an upregulation of 32.129 ± 9.533 times by day 21. The results are shown in Table 7. These results indicate that overexpression of ID4 can promote the differentiation of FSMSCs into male germ cells, and even break through meiosis to obtain male haploid germ cells, demonstrating that the specific transcription factor ID4 plays an important role in regulating the differentiation of FSMSCs into male haploid germ cells.
[0145] Table 7: Relative expression of spermatogenesis-specific genes in 8 sperm at different time points after induction
[0146]
[0147] 5. The proportion of FSMSCs transdifferentiated into male haploid germ cells mediated by ID4
[0148] After the ID4 overexpression stable cell line was constructed (10 days after drug screening, day 0 of the experiment), the culture medium was changed to FSMSCs induction medium and cultured for another 30 days. On day 30, the cells were stained with live cell DNA dye (Hoechst 33342), and the live cell DNA content was detected by flow cytometry. FSMSCs of the same passage number and normal human sperm were used as controls. Normal FSMSCs of the same passage number showed diploid and tetraploid peaks after staining with Hoechst 33342; normal human sperm showed haploid peaks after staining with Hoechst 33342. After 30 days of ID4-induced differentiation of FSMSCs, in addition to the diploid and tetraploid peaks, a clear haploid peak appeared. Figure 6 As shown, haploid cells accounted for 5.52% of the total number of living cells.
[0149] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to the present invention are also within the scope of the present invention. Therefore, all equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention. sequence list <110> Shenzhen Children's Hospital <120> A method for directly transdifferentiating mesenchymal stem cells derived from the foreskin using transcription factor ID4 to produce sperm. <160> 19 <170> SIPOSequenceListing 1.0 <210> 1 <211> 486 <212> DNA <213> Human (Homo sapiens) <400> 1 atgaaggcgg tgagcccggt gcgcccctcg ggccgcaagg cgccgtcggg ctgcggcggc 60 ggggagctgg cgctgcgctg cctggccgag cacggccaca gcctgggtgg ctccgcagcc 120 gcggcggcgg cggcggcggc agcgcgctgt aaggcggccg aggcggcggc cgacgagccg 180 gcgctgtgcc tgcagtgcga tatgaacgac tgctatagcc gcctgcggag gctggtgccc 240 accatcccgc ccaacaagaa agtcagcaaa gtggagatcc tgcagcacgt tatcgactac 300 atcctggacc tgcagctggc gctggagacg cacccggccc tgctgaggca gccaccaccg 360 cccgcgccgc cacaccaccc ggccgggacc tgtccagccg cgccgccgcg gaccccgctc 420 actgcgctca acaccgaccc ggccggcgcg gtgaacaagc agggcgacag cattctgtgc 480 cgctga 486 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <400> 2 ttcagccaaa cgaccatct 19 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <400> 3 gcttcctcca cccacttct 19 <210> 4 <211> twenty one <212> DNA <213> Artificial Sequence <400> 4 cacccacact cagctccata g 21 <210> 5 <211> twenty one <212> DNA <213> Artificial Sequence <400> 5 ctagtgttgg gactctggct c 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <400> 6 ttcatggtgt gggctaagga 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <400> 7 cccagcatct tgctcaactc 20 <210> 8 <211> 18 <212> DNA <213> Artificial Sequence <400> 8 acttgatgga cgaatgcc 18 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <400> 9 cttctccttg ctcacgct 18 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <400> 10 gtcgcccact gagcaaagat 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <400> 11 acactcccga gcccaacaat 20 <210> 12 <211> twenty three <212> DNA <213> Artificial Sequence <400> 12 ctgcgttctg ctcctactgc ttc 23 <210> 13 <211> twenty three <212> DNA <213> Artificial Sequence <400> 13 tggatggatg gtggagacgg ttc 23 <210> 14 <211> twenty four <212> DNA <213> Artificial Sequence <400> 14 catgcaagca gcttagagga ggtc 24 <210> 15 <211> twenty three <212> DNA <213> Artificial Sequence <400> 15 tgccagtcag aaggtccatc gtc 23 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <400> 16 gccggagcag atattaccgc 20 <210> 17 <211> twenty one <212> DNA <213> Artificial Sequence <400> 17 tgtcttctac atcgcggtct g 21 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <400> 18 actcctccac ctttgacgct 20 <210> 19 <211> twenty one <212> DNA <213> Artificial Sequence <400> 19 ctcttcctct tgtgctcttg c 21
Claims
1. A method for non-therapeutic purposes using transcription factor ID4 to directly transdifferentiate mesenchymal stem cells derived from the foreskin for sperm production, characterized in that, Transcription factor ID4 was introduced into mesenchymal stem cells via lentiviral transfection, and then the mesenchymal stem cells were induced and cultured into sperm. The nucleotide sequence of transcription factor ID4 is SEQ ID No.
1. The induction culture was carried out using DMEM / F12 as the basal medium, supplemented with 15% FBS, 2 mM glutamine, 0.1 mM non-essential amino acids, 0.1 mM 2-β-mercaptoethanol, 10 ng / ml leukocyte inhibitory factor, 10 ng / ml neurotrophic factor, 10 ng / ml basic fibroblast growth factor, 10 ng / mL recombinant human stem cell factor, and 2 μM retinoic acid.
2. The method according to claim 1, characterized in that, The specific steps for introducing transcription factor ID4 into mesenchymal stem cells via lentiviral transfection are as follows: Step 1: Calculate the amount of ID4 overexpressing lentivirus added to each well, then add the lentivirus to the culture medium containing mesenchymal stem cells, add a transfection promoter, and perform transfection. Step 2: After 24-48 hours of transfection and when the cells have recovered well, remove the original culture medium and replace it with selection medium for a period of selection culture to obtain a stable cell line.
3. The method according to claim 2, characterized in that, In step one, mesenchymal stem cells were transfected with ID4-overexpressing lentivirus with an MOI of 5.
4. The method according to claim 2, characterized in that, The screening medium was a fresh medium containing 6 μg / mL puromycin.
5. The method according to claim 2, characterized in that, The lentivirus is packaged using a three-plasmid lentivirus system, which includes the following plasmids: a plasmid carrying the target gene, a viral packaging helper plasmid psPAX2 vector, and a viral packaging helper plasmid pMD2G vector.