Compositions and methods for treating RAS mutant cancers

Abstract

This disclosure generally relates to compositions and methods for treating RAS mutant cancers. In particular, the invention relates to administering a therapeutically effective amount of one or more TXNRD1 inhibitors to a subject diagnosed with or at risk of developing RAS mutant cancer (e.g., RAS mutant pancreatic cancer).

Description

[0001] Cross-references to related applications

[0002] This application claims the benefit and priority of U.S. Provisional Patent Application No. 62 / 838,065, filed April 24, 2019, the entire contents of which are incorporated herein by reference. Technical Field

[0003] This invention generally relates to compositions and methods for treating, preventing, and / or improving RAS-mutant pancreatic cancer in subjects of need. In particular, this invention relates to methods for treating, preventing, and / or improving RAS-mutant pancreatic cancer by administering a therapeutically effective amount of a TXNRD1 inhibitor. Background Technology

[0004] The following description of the technical background of the present invention is provided only to help understand the technical aspects of the present invention, and does not constitute prior art to the present invention.

[0005] Approximately 90% of all pancreatic cancers are pancreatic ductal adenocarcinoma (PDAC), one of the deadliest types of cancer. PDAC has a 5-year survival rate of only 7%. Detailed genomic profiling has revealed significant variability among the cancers. For example, genome sequencing has revealed frequently mutated genes in PDAC, including KRAS, TP53, CDKN2A, SMAD4, MLL3, TGFBR2, ARID1A and SF3B1, EPC1 and ARID2, ATM, ZIM2, MAP2K4, NALCN, SLC16A4, MAGEA6, ROBO2, KDM6A, PREX2, ERBB2, MET, FGFR1, CDK6, PIK3R3, PIK3CA, BRCA1, BRCA2, PALB2, and others. Despite this variability, KRAS is mutated in 95% of PDAC cases. See, for example, Biankin et al., Nature 491(7424):399-405(2012); Waddell et al., Nature 518(7540):495-501(2015); and Jones et al., Science 321(5897):1801-1806(2008).

[0006] KRAS proteins are GTPases that play a crucial role in cellular signal transduction pathways. KRAS proteins are thought to act as binary on / off switches, cycling between active guanosine triphosphate (GTP)-bound and inactive guanosine diphosphate (GDP)-bound states. In normal dormant cells, KRAS is mostly found in its GDP-bound inactive state. In response to extracellular stimuli, cell surface receptors temporarily promote the formation of active KRAS-GTP. KRAS mutations in PDAC and other cancer types are often missense mutations that cause constitutive GTP binding of the KRAS protein, leading to overstimulation of signaling pathways driving cancer growth. Oncogenic mutant KRAS proteins drive tumor progression in a variety of cancer types. For example, in the case of PDAC, mutant KRAS proteins regulate the reprogramming of pancreatic acinar cells into ductal intraepithelial neoplasia. KRAS is also required for the growth and maintenance of PDAC and other cancers. See, for example, Ying et al., Cell 149(3):656-70 (2012). In fact, PDAC is considered one of the most "KRAS-addictive" types of cancer.

[0007] Therefore, KRAS is considered an important therapeutic target for PDAC and other KRAS-mutant cancers. See, for example, Waters and Der, Cold Spring Harb Perspect Med. 8(9):a031435 (2018). Summary of the Invention

[0008] In one aspect, this disclosure provides a method for treating RAS-mutant cancer in a subject of need, the method comprising administering to the subject a therapeutically effective amount of a TXNRD1 inhibitor selected from: auronoxine, piracetam, D9, TRi-1, TRi-2, myricetin, PMX464, PX12, diflubenzuron-2, cymoxanone A, ethaneselenoline, aurantium thioglucose, protoporphyrin IX, anti-TXNRD1 antibody, and any derivative thereof. This document also discloses a method for treating RAS-mutant cancer in a subject of need, the method comprising administering to the subject a therapeutically effective amount of an inhibitory nucleic acid that inhibits TXNRD1 expression. In some embodiments, the inhibiting nucleic acid comprises a sequence selected from the following: TCTAATATCATTAACACCATGG (SEQ ID NO:1; human shTXNRD1), TAAATAAAACTGAATATGGTCA (SEQ ID NO:2; human shTXNRD1), TTATAATAA CTTATGATATTA (SEQ ID NO:3; human shTXNRD1), TTTGTAACAAAAATACATGGAA (SEQ ID NO:4; human shTXNRD1), TTTAAATGAAAATCCTTCACAT (SEQ ID NO:5; human shTXNRD1), TTTTAAATGAAAATCCTTCACA (SEQ ID NO:6; human shTXNRD1), TAAGAAAAGAGAATCACAACAT (SEQ ID NO:7; human shTXNRD1), TTTTCATTTATCTTCACCCCTA (SEQ ID NO:8; human shTXNRD1), TTAGAAAGAAATAGATACCCAA (SEQ ID NO:8). NO:9; human shTXNRD1), TAATAATAACTTATGATATTAA (SEQ ID NO:10; human shTXNRD1), TTTAGTCACAGGGTAATTCGTC (SEQ ID NO:11; mouse shTxnrd1), and TTCGTCACTGACAACGTTGTGA (SEQ ID NO:12; mouse shTxnrd1) or any of their complements. The RAS mutant cancer can be lung cancer (e.g., lung adenocarcinoma), mucin adenoma, pancreatic cancer (e.g., PDAC), colorectal cancer, skin cancer (e.g., melanoma), endometrial cancer, testicular germ cell carcinoma, or adrenal cancer.In some embodiments, the RAS mutant cancer comprises a KRAS, NRAS, or HRAS mutation selected from G12C, G12D, G12V, G12A, G12S, G12R, G13D, G13C, G13S, G13R, G13A, G13V, Q61H, Q61L, Q61R, Q61K, Q61P, and Q61E. Alternatively or additionally, in some embodiments, the KRAS, NRAS, or HRAS mutation is detected via DNA sequencing.

[0009] Alternatively or additionally, in some embodiments of the methods disclosed herein, the subject exhibits elevated expression levels of RAS proteins (e.g., KRAS, HRAS, NRAS) in cancer cells prior to treatment. In any embodiment of the methods disclosed herein, the subject exhibits one or more signs or symptoms selected from: upper abdominal pain radiating to the back, loss of appetite or unintentional weight loss, depression, new-onset diabetes, blood clots, fatigue, yellowing of the skin and whites of the eyes (jaundice), flatulence, nausea, and vomiting.

[0010] Alternatively or concurrently, in some embodiments of the methods disclosed herein, the subject has one or more point mutations in TP53, CDKN2A, SMAD4, MLL3, TGFBR2, ARID1A, SF3B1, EPC1, ARID2, ATM, ZIM2, MAP2K4, NALCN, SLC16A4, MAGEA6, ROBO2, KDM6A, PREX2, ERBB2, MET, FGFR1, CDK6, PIK3R3, PIK3CA, BRCA1, BRCA2, or PALB2. In some embodiments, the subject is a human.

[0011] In any embodiment of the methods disclosed herein, the TXNRD1 inhibitor or the inhibitory nucleic acid that inhibits TXNRD1 expression may be administered orally, topically, intranasally, systemically, intravenously, subcutaneously, intraperitoneally, intradermally, intraocularly, iontophoretally, transmucosally, or intramuscularly. In some embodiments, the TXNRD1 inhibitor or the inhibitory nucleic acid is administered daily for 6 weeks or longer. In other embodiments, the TXNRD1 inhibitor or the inhibitory nucleic acid is administered daily for 12 weeks or longer.

[0012] Additionally or alternatively, in some embodiments, the method further includes administering one or more additional therapeutic agents to the subject, alone, sequentially, or simultaneously. Examples of such additional therapeutic agents include, but are not limited to, paclitaxel, gemcitabine, AMG 510, 5-FU (fluorouracil), and irinotecan.

[0013] In another aspect, this disclosure provides a method for monitoring the therapeutic efficacy of a TXNRD1 inhibitor in a subject diagnosed with RAS mutant cancer, the method comprising: (a) detecting TXNRD1 protein levels in a test sample obtained from the subject after administration of the TXNRD1 inhibitor to the subject; and (b) determining that the TXNRD1 inhibitor is effective when the TXNRD1 protein level in the test sample is lower than that observed in a control sample obtained from the subject before administration of the TXNRD1 inhibitor. Examples of TXNRD1 inhibitors include aurinolone, piracetam, D9, TRi-1, TRi-2, myricetin, PMX464, PX12, diflubenzuron-2, cymoxanone A, ethaneselenoline, aurothioglucose, protoporphyrin IX, anti-TXNRD1 antibodies, inhibitory nucleic acids that inhibit TXNRD1 expression, or any derivative thereof. In some embodiments, the inhibitory RNA is shRNA, antisense oligonucleotide, or sgRNA.

[0014] In one aspect, this disclosure provides a method for inhibiting the proliferation of RAS mutant cells in a subject in need, the method comprising administering to the subject a therapeutically effective amount of at least one TXNRD1 inhibitor, wherein the at least one TXNRD1 inhibitor is selected from aurinolone, piracetam, D9, TRi-1, TRi-2, myricetin, PMX464, PX12, diflubenzuron-2, cytosine A, ethaneselenoline, aurthioglucose, protoporphyrin IX, anti-TXNRD1 antibody, inhibitory nucleic acid that inhibits TXNRD1 expression, or any derivative thereof, and wherein the subject suffers from a disease or condition characterized by elevated expression levels and / or increased activity of RAS (e.g., KRAS, HRAS, NRAS) and / or TXNRD1. In some embodiments, the inhibiting nucleic acid comprises a nucleic acid sequence selected from the following: TCTAATATCATTAACACCATGG (SEQ ID NO:1; human shTXNRD1), TAAATAAAACTGAATATGGTCA (SEQ ID NO:2; human shTXNRD1), TTAATAATAACTTATGATATTA (SEQ ID NO:3; human shTXNRD1), TTTGTAACAAAAATACATGGAA (SEQ ID NO:4; human shTXNRD1), TTTAAATGAAAATCCTTCACAT (SEQ ID NO:5; human shTXNRD1), TTTTAAATGAAAATCCTTCACA (SEQ ID NO:6; human shTXNRD1), TAAGAAAAGAGAATCACAACAT (SEQ ID NO:7; human shTXNRD1), TTTTCATTTATCTTCACCCCTA (SEQ ID NO:8; human shTXNRD1), TTAGAAAGAAATAGATACCCAA (SEQ ID NO:8). NO:9; human shTXNRD1), TAATAATAACTTATGATATTAA (SEQ ID NO:10; human shTXNRD1), TTTAGTCACAGGGTAATTCGTC (SEQ ID NO:11; mouse shTxnrd1), and TTCGTCACTGACAACGTTGTGA (SEQ ID NO:12; mouse shTxnrd1).

[0015] In any and all embodiments of the methods disclosed herein, the expression levels of TXNRD1 and / or RAS (e.g., KRAS, HRAS, NRAS) are detected by: RNA-seq, northern blotting, microarray, dot or narrow-line blotting, fluorescence in situ hybridization, reverse transcription polymerase chain reaction (RT-PCR), ribonuclease protection assay (RPA), real-time quantitative RT-PCR, high performance liquid chromatography (HPLC), liquid chromatography-mass spectrometry (LC / MS), enzyme-linked immunosorbent assay (ELISA), immunoprecipitation, immunoelectrophoresis, immunostaining, immunohistochemistry, or Western blotting.

[0016] Alternatively or additionally, in some embodiments of the method disclosed herein, the method further includes administering a therapeutically effective amount of gemcitabine to the subject. In any of the foregoing embodiments of the method disclosed herein, the method further includes administering a therapeutically effective amount of KRAS to the subject. G12C Inhibitors, optionally the KRAS mentioned above G12C The inhibitor is AMG 510. Attached Figure Description

[0017] Figure 1A illustrates a pipeline used in this disclosure for discovering therapeutic targets in KRAS-mutant pancreatic cancer. The pipeline includes low-multiple-infection (MOI) transduction of KRAS-mutant pancreatic cancer cells using a CRISPRi-based interference library of regularly clustered, spaced short palindromic repeats (see, for example, Gilbert et al., Cell 154:442-451 (2013)), single-cell RNA sequencing (scRNA-seq), genome alignment and generation of counting matrices (see, for example, Tang et al., Nature Methods 6:377–382 (2009)), supervised dimensionality reduction, and machine learning algorithms for identifying novel targets, where inhibition is maximally and selectively targeted at cancer cells.

[0018] Figure 1B shows a scatter plot of treatment scores for z-transformations of several CRISPR target candidates. The treatment index was scored across two negative guide RNAs using a machine learning algorithm, which together established a negative control benchmark for identifying therapeutic targets.

[0019] Figure 2A shows the distribution of cell type populations along a single dimension after supervised dimensionality reduction using a machine learning algorithm. The following populations are shown: 1) Cancer cells: cancer cells targeted by non-targeted guide RNA genes (N=120), 2) Invalid targets: cancer cells targeted by negative control genes (N=122), 3) TXNRD1: cancer cells targeted by TXNRD1 (N=87), and 4) Healthy cells: healthy ductal cells (N=600).

[0020] Figure 2B shows a heatmap of treatment scores for z-conversions for the top 20 candidate targets. Candidate targets are displayed in descending order based on their average ranking among four indicator decision functions derived from a machine learning algorithm. As shown, TXNRD1 exhibits the highest average ranking.

[0021] Figure 2C shows a graph depicting the weighted average decision function score of the treatment index among a set of candidate targets. TXNRD1 appears as the highest-ranking target.

[0022] Figure 3A shows the results of cross-analysis of shRNA-mediated pooled negative selection screening. shRNA-mediated pooled negative selection screening was performed in the following cell types: (1) KrasG12D;Myc;shp53 mouse pancreatic ductal adenocarcinoma (mPDAC) cells and (2) Myc;p53. - / - Mouse hepatocellular carcinoma (mHCC) cells. For comparative purposes, the results of shRNA-mediated pooled negative selection screening from the two cell types were cross-analyzed.

[0023] Figure 3B shows a bar chart illustrating the validation of candidate genes obtained from Figure 3A. Competitive proliferation assays were performed in mPDAC cells, mHCC cells, and non-transformed immortalized mouse embryonic fibroblasts (iMEF). Venus cells carrying inducible shRNA were used. + Viral transduction was performed on these cells. The following control shRNAs were used: Ren.713 (a non-targeting shRNA serving as a negative control), Rpa3.561 (a positive control for growth inhibition in all proliferating cells), and Kras.247 (a positive control for mPDAC-specific growth inhibition). G418-selected Venus cells were then... + Cells were mixed with untransduced cells and cultured in the presence of doxycycline to induce shRNA. Venus was identified at different time points (T0: day 0; T12: day 12). + and dsRed + Percentage of cells expressing shRNA. Readings showing altered growth-inhibiting effects of expressed shRNA.

[0024] Figure 3C shows an immunoblot illustrating TXNRD1 knockdown in mPDAC, mHCC, and iMEF cells.

[0025] Figure 3D illustrates the pharmacological inhibitory effect of TXNRD1 on pancreatic cancer cells. mPDAC cells were treated with escalating doses of auronorfen for 72 hours. Relative proliferation was calculated by measuring the number of viable cells and normalized to the number of viable cells in DMSO-treated cells (set to 1). Relative proliferation was then plotted as a function of auronorfen concentration and fitted to an exponential curve.

[0026] Figure 3E shows the pharmacological inhibition of TXNRD1 in human pancreatic cancer cells, as measured by changes in the number of viable cells in cultures with escalating doses of auronorfen over 72 hours. Relative proliferation was calculated by measuring the number of viable cells and normalized to the number of viable cells in DMSO-treated cells (set to 1). Relative proliferation was then plotted as a function of auronorfen concentration and fitted to an exponential curve. L3.3, Colo357, and BXPC3 possess wild-type KRAS, while the remaining cell lines have KRAS mutations.

[0027] Figure 4A illustrates the IC50 of the TXNRD1 inhibitor aurinophene in human pancreatic cancer cell lines (n=12). 50 Bar chart showing the correlation between values ​​and KRAS status.

[0028] Figure 4B illustrates the IC50 of aurinophene in human pancreatic cancer cell lines (n=9). 50 Bar graph showing the correlation with the p53 state.

[0029] Figure 4C illustrates the IC50 of aurinophene in human pancreatic cancer cell lines (n=9). 50 Scatter plot of correlation with Myc expression levels.

[0030] Figure 4D shows the pharmacological inhibition of TXNRD1 as measured by treating pancreatic cancer cells with piracetam (another TXNRD1 inhibitor) for 72 hours. Cancer cells containing different KRAS mutations (G12C, G12D, G12V) or wild-type alleles were measured. Relative proliferation was calculated by measuring the number of viable cells and normalized to the number of viable cells in DMSO-treated cells (set to 1). Relative proliferation was then plotted as a function of auronoxine concentration and fitted to an exponential curve.

[0031] Figure 4E shows a scatter plot illustrating the correlation between TXNRD1 and KRAS expression levels in TCGA human pancreatic cancer tumors (n=149).

[0032] Figures 4F-4H illustrate the evaluation of changes in gene tags when TXNRD1 is knocked down in mPDAC cells. Gene set enrichment analysis (GSEA) was used to evaluate changes in KRAS-dependent gene tags (Figure 4F), pancreatic cancer (Figure 4G), and amino acid transporter / ferroptosis (Figure 4H) when TXNRD1 is knocked down in mPDAC cells compared to cells with shRen (a non-targeting shRNA that serves as a negative control).

[0033] Figure 5A shows a schematic diagram of the conditional RNAi experiment. Tet-On competent mouse PDAC cells were transduced using TRMPV-Neo-miR-E shRNA and a luciferase-hygro vector. Transduced cells were selected for G418 and hygromycin resistance and transplanted into the pancreas of recipient mice. shRNA expression was induced in a subset of mice after disease onset, as determined using bioluminescence imaging (typically occurring after seven days), by supplementing drinking water and food with doxycycline (dox).

[0034] Figure 5B shows a scatter plot illustrating tumor weight in animals (n=4–5) treated with or without doxycycline that can induce the corresponding shRNA.

[0035] Figure 5C shows bioluminescence imaging of representative mice orthotopically transplanted with mPDAC cells containing TRMPV-Neo-miR-E shRNA in the presence and absence of doxycycline treatment for 7 days. Doxycycline was administered after disease onset. Bioluminescence images are shown at day 0 (D0) and day 7 (D7).

[0036] Figure 5D shows a bar graph illustrating the reduction in tumor weight in vivo induced by auronoxine treatment. KRas G12D p53 - / - Organoid transplantation was performed in recipient mice, and the mice (n=3–4) were treated with either the medium alone or aurinolone for one week. Tumor weight was measured and plotted.

[0037] Figure 5E shows a bar graph illustrating the in vivo effect of auronoflavin treatment on tumor weight in human pancreatic cancer cell lines. MIAPaCa-2 (KRAS mutant) or Colo357 (KRAS wild-type) organoids were transplanted into the pancreas of recipient mice. Mice (n=5) were treated with either the vector alone or auronoflavin for 2 weeks. Tumor weight was measured and plotted.

[0038] Figures 6A-6B show heatmaps illustrating the survival dependence of indicative cell lines on the listed genes. Each column represents the cell line exhibiting the highest average ranking, and each row represents one gene. Gene dependence scores were calculated by averaging the log2FC (fold change in abundance relative to disease-free tissue) for all corresponding sgRNAs (Figure 6A) or shRNAs (Figure 6B). Zero indicates no change, negative indicates depletion, and positive indicates enrichment in the indicative cell line. Genes with similar phenotypes were clustered using unsupervised clustering. As shown, knockout or knockdown of the replication genes RAP1 or PCNA resulted in general lethality for almost all cell lines. In contrast, some cell lines exhibiting similar dependence on KRAS, HRAS, and NRAS conditionally required TXNRD1.

[0039] Figures 7A-7D illustrate the antiproliferative effect of the TXNRD1 inhibitor aurinol in KRAS mutant pancreatic cancer cells and its potential synergistic inhibitory effect when combined with gemcitabine. Figure 7A shows the effects of aurinol, gemcitabine, and their combination on MIAPaCa-2 (KRAS) mutant pancreatic cancer cells. G12C ) and PSN1 (KRAS G12R Dose-dependent effects of auronorfen and gemcitabine at each concentration from Figure 7A on MIAPaCa-2 (KRAS) cancer cell lines. Figure 7B shows the dose-dependent effects of auronorfen and gemcitabine at each concentration from Figure 7A on MIAPaCa-2 (KRAS) cancer cell lines. G12C ) and PSN1 (KRAS G12R The percentage of growth inhibition in cells. Data are presented as the average of three independent experiments (n=3). Figure 7C shows the percentage of growth inhibition in MIAPaCa-2 (KRAS) cells treated with a combination of aureophen and gemcitabine. G12C ) and PSN1 (KRAS G12R The combination index (CI) plot of cells. According to Figure 7C, a CI value <1 indicates a synergistic effect between auronorfen and gemcitabine. Figure 7D shows MIAPaCa-2 (KRAS) cells treated with a combination of auronorfen and gemcitabine to indicate concentrations. G12C ) and PSN1 (KRAS G12R The combined index (CI) score of the cells. Each CI score represents data from at least three independent experiments.

[0040] Figures 8A-8D illustrate the antiproliferative effect of the TXNRD1 inhibitor aurinophene in KRAS mutant pancreatic cancer cells and its interaction with KRAS. G12C The potential synergistic inhibitory effect of combining AMG 510 with the inhibitor. Figure 8A shows the effect of aurinolone, AMG 510 and their combination on MIAPaCa-2 (KRAS). G12C ) and PSN1 (KRAS G12RDose-dependent effects of auronorfen and AMG 510 at each concentration from Figure 8A on MIAPaCa-2 (KRAS) cancer cell lines. Figure 8B shows the dose-dependent effects of auronorfen and AMG 510 at each concentration from Figure 8A on MIAPaCa-2 (KRAS) cancer cell lines. G12C ) and PSN1 (KRAS G12R The percentage of growth inhibition in cells. Data are presented as the average of three independent experiments (n=3). Figure 8C shows the CI plot, which shows CI values ​​<1, indicating a synergistic effect between auronorfen and AMG 510. Figure 8D shows the concentration of MIAPaCa-2 (KRAS) treated with a combination of auronorfen and AMG 510 to indicate the effect. G12C ) and PSN1 (KRAS G12R The combined index (CI) score of the cells. Each CI score represents data from at least three independent experiments.

[0041] Figure 9 shows the overall survival in patients with pancreatic adenocarcinoma who had upregulated TXNRD1 mRNA. 178 patients were divided into two groups: low TXNRD1 and high / intermediate TXNRD1. The proportion cutoff values ​​(0–100%) for high / intermediate and low were >15.87% (Z score >-1, n=145) and <=15.87% (Z score <=-1, n=33), respectively. Data analysis was based on available TCGA data.

[0042] Figure 10 shows the plasma and pancreatic gold concentrations in NCR nu / nu mice following a single intraperitoneal injection of a 10 mg / kg auronoxine suspension. Three series of samples were collected over 24 hours (2 h, 4 h, 24 h) (n = 3). Detailed Implementation

[0043] It should be understood that certain aspects, modes, implementations, variations and features of the methods of the present invention are described below with varying degrees of detail in order to provide a substantive understanding of the technology of the present invention.

[0044] In practicing the methods of this invention, many conventional techniques from molecular biology, protein biochemistry, cell biology, microbiology, and recombinant DNA were used. See, for example, Sambrook and Russell, eds. (2001), *Molecular Cloning: A Laboratory Manual*, 3rd edition; Ausubel et al., eds. (2007), *Current Protocols in Molecular Biology* series; and *Methods in Enzymology* (Academic Press, Inc., NY).Series; MacPherson et al., (1991) PCR 1: A Practical Approach (IRL Press at Oxford University Press); MacPherson et al., (1995) PCR 2: A Practical Approach; Harlow and Lane (eds.), (1999) Antibodies, A Laboratory Manual; Freshney (2005) Culture of Animal Cells: A Manual of Basic Technique, 5th Edition; Gait et al. (1984) Oligonucleotide Synthesis; US Patent No. 4,683,195; Hames and Higgins (eds.), (1984) Nucleic Acid Hybridization; Anderson (1999) Nucleic Acid Hybridization; Hames and Higgins (eds.), (1984) Transcription and Translation; Immobilized Cells and Enzymes (IRL Press (1986)); Perbal (1984) A Practical Guide to Molecular Cloning; Miller and Calos (eds.) (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory); Makrides et al. (2003) Gene Transfer and Expression in Mammalian Cells; Mayer and Walker (eds.) (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London); and Herzenberg et al. (eds.) (1996) Weir's Handbook of Experimental Immunology.

[0045] This disclosure is based in part on the finding that TXNRD1 is a therapeutic target for treating RAS mutant pancreatic cancer and that pharmacological inhibition of TXNRD1 in pancreatic cancer cells is effective in treating RAS mutant pancreatic cancer.

[0046] definition

[0047] Unless otherwise defined, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural indicators unless the context clearly specifies otherwise. For example, a reference to “a cell” includes a combination of two or more types of cells, etc. Generally, the nomenclature used herein and the laboratory procedures in cell culture, molecular genetics, organic chemistry, analytical chemistry, nucleic acid chemistry, and hybridization described below are those well-known and commonly used in the art.

[0048] Unless the context otherwise indicates or is otherwise obvious, as used herein, the term “about” with respect to numbers is generally considered to include numbers falling within the range of 1%, 5%, or 10% in either direction (greater or less than) of the number (except where such numbers are less than 0% or more than 100% of the possible value).

[0049] As used herein, “administering” a drug or medicine to a subject includes any route by which a compound is introduced or delivered to the subject to perform its intended function. Administration can be performed via any suitable route, including oral, intranasal, parenteral (intravenous, intramuscular, intraperitoneal, or subcutaneous), or local administration. Administration includes self-administration and administration by another person.

[0050] As used herein, the term “antibody” generally refers to immunoglobulins or immunoglobulin-like molecules, including, but not limited to, IgA, IgD, IgE, IgG, and IgM, combinations thereof, and similar molecules produced in any vertebrate species, such as mammals (e.g., humans, goats, rabbits, and mice), and non-mammalian species, during an immune response (e.g., shark immunoglobulins). As used herein, “antibody” (including intact immunoglobulins) and “antigen-binding fragment” specifically bind to a target molecule (or a group of highly similar target molecules) and substantially excludes binding to other molecules (e.g., the binding constant for the target molecule is at least 10 greater than the binding constant for other molecules in the biological sample). 3 M -1 At least 10 4 M -1 Or at least 10 5 M -1(Antibodies and antibody fragments). The term "antibody" also includes genetically engineered forms such as chimeric antibodies (e.g., humanized mouse antibodies) and heteroconjugated antibodies (e.g., bispecific antibodies). See also Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, Ill.); Kuby, J., Immunology, 3rd ed., WH Freeman & Co., New York, 1997.

[0051] More specifically, an antibody is a polypeptide ligand that specifically recognizes and binds to an antigenic epitope, containing at least a light chain immunoglobulin variable region or a heavy chain immunoglobulin variable region. Antibodies are composed of heavy and light chains, each possessing a variable region, called a heavy chain variable region (VLCR). H ) region and light chain variable (V L ) area. V H District and V L Immunoglobulins are responsible for binding to antigens recognized by antibodies. Typically, immunoglobulins have heavy (H) chains and light (L) chains interconnected by disulfide bonds. There are two types of light chains: λ (lambda) and κ (kappa). There are five main heavy chain classes (or isotypes): IgM, IgD, IgG, IgA, and IgE, which determine the functional activity of antibody molecules. Each heavy and light chain contains constant and variable regions (also called “domains”). Together, the heavy chain variable regions and light chain variable regions specifically bind to antigens. The light chain variable regions and heavy chain variable regions contain “framework” regions broken by three hypervariable regions (also called “complementarity-determining regions” or “CDRs”). The extent of the framework regions and CDRs has been defined (see Kabat et al., Sequences of Proteins of Immunological Interest, USDapartment of Health and Human Services, 1991, which is hereby incorporated by reference). The Kabat database is currently maintained online. The sequences of the framework regions of different light or heavy chains are relatively conserved within a species. The framework region of an antibody (i.e., the combined framework region of the constitutive light and heavy chains) primarily adopts a β-sheet conformation, and the CDR forms loops connecting the β-sheet structures, and in some cases, these loops form part of the β-sheet structure. Therefore, the framework region acts as a scaffold, which allows the CDR to be correctly oriented through non-covalent interchain interactions.

[0052] CDRs are primarily responsible for binding to antigenic epitopes. Each chain's CDRs are typically designated CDR1, CDR2, and CDR3, numbered sequentially starting from the N-terminus, and are often further identified by the chain from which a specific CDR is located. Therefore, V HCDR3 is located in the variable domain of the heavy chain of the antibody in which it was found, while V L CDR1 is derived from the variable domain of the light chain of the antibody in which it is found. Antibodies that bind to the TXNRD1 protein will have a specific V H District and V L Antibodies have specific CDR sequences, meaning they have different binding sites for different antigens. Antibodies with different specificities (i.e., different binding sites for different antigens) have different CDRs. Although the CDRs differ between different antibodies, only a limited number of amino acid positions within the CDR directly participate in antigen binding. These positions within the CDR are called specificity-determining residues (SDRs). As used herein, "immunoglobulin-associated composition" refers to antibodies (including monoclonal antibodies, polyclonal antibodies, humanized antibodies, chimeric antibodies, recombinant antibodies, multispecific antibodies, bispecific antibodies, etc.) and antibody fragments. Antibodies or their antigen-binding fragments bind specifically to antigens.

[0053] As used herein, the term "antibody-associated polypeptide" refers to an antigen-binding antibody fragment, including a single-chain antibody, which may contain one or more variable regions alone or in combination with all or some of the following polypeptide elements: hinge region of the antibody molecule, CH1, CH2, and CH3 domains. The technique also includes any combination of one or more variable regions and hinge region, CH1, CH2, and CH3 domains. Antibody-associated molecules that can be used in this method are, for example, but not limited to, Fab, Fab', and F(ab')2, Fd, single-chain Fv (scFv), single-chain antibodies, disulfide-linked Fv (sdFv), and peptides containing V... L or V H Fragments of a structural domain. Examples include: (i) Fab fragments, i.e., fragments formed by V L V H C L (ii) a monovalent segment consisting of a CH1 domain; (iii) a F(ab')2 segment, i.e., a divalent segment containing two Fab segments connected by a disulfide bridge in the hinge region; and (iv) a segment consisting of V... H (iv) The Fd fragment composed of the CH1 domain; and the V-shaped structure of the antibody single arm. L and V H The Fv segment, composed of structural domains; the (v)dAb segment (Ward et al., Nature 341:544-546, 1989), which is composed of V HThe structure consists of domains; and (vi) separate complementarity-determining regions (CDRs). Therefore, an "antibody fragment" or "antigen-binding fragment" can contain a portion of a full-length antibody, typically its antigen-binding region or variable region. Examples of antibody fragments or antigen-binding fragments include Fab, Fab', F(ab')2, and Fv fragments; biantibodies; linear antibodies; single-chain antibody molecules; and multispecific antibodies formed from antibody fragments.

[0054] The term "antigen-binding fragment" refers to a fragment of a complete immunoglobulin structure having a polypeptide moiety responsible for binding to an antigen. Examples of antigen-binding fragments that can be used in this art include, but are not limited to, scFv, (scFv)2, scFvFc, Fab, Fab', and F(ab')2.

[0055] As used herein, the term "biantibody" refers to a small antibody fragment having two antigen-binding sites, said fragment being contained within the same polypeptide chain and a light chain variable domain (V). L ) connected heavy chain variable structural domain (V H (V) H V L By using a linker that is too short to allow pairing between two domains on the same strand, the domain is forced to pair with a complementary domain on another strand, resulting in two antigen-binding sites. Biantibodies are described more fully in, for example, the following literature: EP404,097; WO 93 / 11161; and Hollinger et al., Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993).

[0056] As used herein, the terms "single-chain antibody" or "single-chain Fv (scFv)" refer to the two V domains of the Fv fragment. L and V H Antibody fusion molecules. Single-chain antibody molecules can contain polymers with multiple individual molecules, such as dimers, trimers, or other polymers. Furthermore, although F... v The two structural domains V of the fragment L and V H Encoded by separate genes, but they can be linked together via synthetic linkers using recombination methods, allowing them to become a single protein chain, in which V L and V H Partition pairing forms monovalent molecules (called single-chain F) v (scF vBird et al. (1988) Science 242:423-426 and Huston et al. (1988) Proc. Natl. Acad Sci. USA 85:5879-5883. These single-chain antibodies can be prepared using recombinant techniques or by enzymatic or chemical cleavage of intact antibodies.

[0057] Any of the antibody fragments described above were obtained using conventional techniques known to those skilled in the art, and were screened for binding specificity and neutralizing activity in the same manner as for intact antibodies.

[0058] As used herein, the terms “complementary” or “complementarity” for polynucleotides (i.e., nucleotide sequences, such as oligonucleotides or target nucleic acids) refer to the base pairing principle. As used herein, a complementary nucleic acid sequence is an oligonucleotide that exhibits “antiparallel association” when aligned with a nucleic acid sequence to pair the 5' end of one sequence with the 3' end of another. For example, the sequence “5'-AGT-3'” is complementary to the sequence “3'-TCA-5'”. Nucleic acids described herein may include certain bases not typically present in naturally occurring nucleic acids. These bases include, for example, inosine, 7-denitroguanine, locked nucleic acids (LNA), and peptide nucleic acids (PNA). Complementarity does not need to be perfect; stable duplexes may contain mismatched base pairs, denatured, or unmatched bases. Those skilled in the art of nucleic acid technology can empirically determine duplex stability after considering several variables, including, for example, the length of the oligonucleotide, its base composition and sequence, ionic strength, and the incidence of mismatched base pairs. The complementary sequence can also be an RNA sequence that is complementary to a DNA sequence or its complementary sequence, and it can also be cDNA.

[0059] As used herein, the term "shared FR" refers to a shared frame (FR) antibody region within an immunoglobulin sequence. The FR region of an antibody does not come into contact with the antigen.

[0060] As used herein, a “control” is a substitute sample used in an experiment for comparative purposes. A control can be “positive” or “negative.” For example, in experiments where the purpose is to determine the efficacy relevance of a therapeutic agent for treating a specific type of disease or condition, a positive control (a compound or composition known to exhibit the desired therapeutic effect) and a negative control (a subject or sample that does not receive the therapy or receives a placebo) are typically used.

[0061] As used herein, the term "effective amount" means an amount sufficient to achieve the desired therapeutic and / or preventive effect, such as an amount resulting in the prevention or reduction of one or more signs or symptoms associated with the disease or condition described herein. In the case of therapeutic or preventive application, the amount of composition administered to a subject will vary depending on the composition, the degree, type, and severity of the disease, and individual characteristics such as general health status, age, sex, weight, and drug tolerance. A technician will be able to determine the appropriate dosage based on these and other factors. The composition may also be administered in combination with one or more other therapeutic compounds. In the methods described herein, the therapeutic composition may be administered to a subject suffering from one or more signs or symptoms of RAS mutant cancer. As used herein, a "therapeutic effective amount" of a composition refers to the level of composition in which the physiological effects of the disease or condition are improved or eliminated. A therapeutic effective amount may be administered in one or more administrations.

[0062] As used herein, “expression” includes one or more of the following: gene transcription into precursor mRNA; splicing and other processing of precursor mRNA to produce mature mRNA; mRNA stability; translation of mature mRNA into protein (including codon use and tRNA availability); and glycosylation and / or other modifications to the translation product (if appropriate for expression and function).

[0063] As used herein, the term “gene” refers to a segment of DNA containing all the information for the regulated biosynthesis of RNA products, including promoters, exons, introns, and other untranslated regions that control expression.

[0064] "Homology," "identity," or "similarity" refers to the sequence similarity between two peptides or two nucleic acid molecules. Homology can be determined by comparing positions in each sequence, which can be aligned for comparative purposes. Molecules are homologous at that position when a position in the compared sequences is occupied by the same nucleobase or amino acid. The degree of homology between sequences varies with the number of matching or homologous positions shared by the sequences. "Sequence identity" of a polynucleotide or polynucleotide region (or polypeptide or polypeptide region) with another sequence at a certain percentage (e.g., at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99%) means that, when aligned, that percentage of bases (or amino acids) are the same in the compared sequences. This alignment and the percentage of homology or sequence identity can be determined using software programs known in the art. In some embodiments, default parameters are used for alignment. One alignment program is BLAST, which uses default parameters. Specifically, the programs are BLASTN and BLASTP, using the following default parameters: genetic code = standard; filter = none; strands = two; cutoff value = 60; expected value = 10; matrix = BLOSUM62; description = 50 sequences; sorting method = high score; database = non-redundant, GenBank+EMBL+DDBJ+PDB+GenBank CDS translation+SwissProtein+SPupdate+PIR. Detailed information on these programs can be found at the National Center for Biotechnology Information. Biologically equivalent polynucleotides are those that have a specified percentage of homology and encode polypeptides with the same or similar biological activities. Sequences that share less than 40% or less than 25% identity with each other are considered "irrelevant" or "non-homologous".

[0065] As used herein, the term "hypervariate region" refers to the amino acid residues in an antibody responsible for antigen binding. Hypervariate regions typically contain amino acid residues from the "complementarity-determining region" or "CDR" (e.g., V...). L Before and after residues 24-34 (L1), 50-56 (L2), and 89-97 (L3), and V HThe residues before and after 31-35B (H1), 50-65 (H2), and 95-102 (H3) (Kabat et al., Sequences of Proteins of Immunological Interest, 5th ed. Public Health Service, National Institutes of Health, Bethesda, MD. (1991)) and / or those residues from the “hypervariate ring” (e.g., V) L Residues 26-32 (L1), 50-52 (L2), and 91-96 (L3) in the group, as well as V H 26-32(H1), 52A-55(H2), and 96-101(H3) (Chothia and Lesk J.Mol.Biol.196:901-917(1987)).

[0066] As used herein, the term "hybridization" refers to the process by which two substantially complementary nucleic acid chains (at least about 65%, 75%, or 90% complementary over at least 14 to 25 nucleotide extensions) anneal to each other under appropriately stringent conditions to form a duplex or heteroduplex by hydrogen bonding between complementary base pairs. Nucleic acid hybridization techniques are well known in the art. See, for example, Sambrook et al., 1989, *Molecular Cloning: A Laboratory Manual*, 2nd ed., Cold Spring Harbor Press, Plainview, NY. Hybridization and hybridization strength (i.e., the strength of association between nucleic acids) are influenced by factors such as the degree of complementarity between the nucleic acids, the stringency of the conditions involved, and the thermal melting point (T0) of the resulting hybrid. m Factors such as […] can influence hybridization. Those skilled in the art understand how to estimate and adjust the stringency of hybridization conditions so that sequences with at least the required level of complementarity will hybridize stably, while sequences with lower complementarity will not hybridize. Examples of hybridization conditions and parameters can be found, for example, Sambrook et al., 1989, *Molecular Cloning: A Laboratory Manual*, 2nd ed., Cold Spring Harbor Press, Plainview, NY; Ausubel, FM et al., 1994, *Current Protocols in Molecular Biology*, John Wiley & Sons, Seculus, NJ. In some embodiments, specific hybridization occurs under stringent hybridization conditions. Oligonucleotides or polynucleotides specific to the target nucleic acid (e.g., probes or primers) will “hybridize” with the target nucleic acid under appropriate conditions.

[0067] As used herein, an "oligonucleotide" is a molecule having a nucleic acid base sequence on a backbone primarily consisting of identical monomeric units spaced at defined intervals. The arrangement of the bases on the backbone allows it to bind to nucleic acids having a base sequence complementary to the oligonucleotide's bases. The most common oligonucleotides have a backbone with phosphate sugar units. Oligodeoxyribonucleotides without a hydroxyl group at the 2' position can be distinguished from oligoribonucleotides with a hydroxyl group at the 2' position. Oligonucleotides may also include derivatives in which the hydrogen in the hydroxyl group is replaced by an organic group (e.g., allyl). One or more bases of an oligonucleotide may also be modified to include a thiophosphate bond (e.g., one of the two oxygen atoms in the phosphate backbone that do not participate in nucleotide bridging is replaced by a sulfur atom) to increase resistance to nuclease degradation. The exact size of the oligonucleotide will depend on many factors, which in turn depend on the oligonucleotide's final function or use. Oligonucleotides can be produced in any manner, including, for example, chemical synthesis, DNA replication, restriction endonuclease digestion of plasmid or phage DNA, reverse transcription, PCR, or combinations thereof. For example, oligonucleotides can be modified by adding methyl, biotin or digoxigenin moiety, fluorescent tagging, or by using radioactive nucleotides.

[0068] As used herein, the term "pharmaceuticalally acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal compounds, isotonic compounds, and absorption-delaying compounds compatible with drug administration. Pharmaceutically acceptable carriers and formulations thereof are known to those skilled in the art and are described, for example, in Remington's Pharmaceutical Sciences (20th edition, A. Gennaro, 2000, edited by Lippincott, Williams & Wilkins, Philadelphia, Pa.).

[0069] As used herein, the term "polynucleotide" or "nucleic acid" means any RNA or DNA, which may be unmodified or modified. Polynucleotides include, but are not limited to, single-stranded and double-stranded DNA, DNA as a mixture of single-stranded and double-stranded regions, single-stranded and double-stranded RNA, RNA as a mixture of single-stranded and double-stranded regions, and hybrid molecules comprising DNA and RNA, which may be single-stranded or more typically double-stranded or a mixture of single-stranded and double-stranded regions. Additionally, a polynucleotide refers to a triple-stranded region comprising RNA or DNA, or both RNA and DNA. The term polynucleotide also includes DNA or RNA containing one or more modified bases, and DNA or RNA whose backbone has been modified for stability or other reasons.

[0070] As used herein, “prevention,” “prevent,” or “preventing” of a disorder or condition means, in a statistically significant sample, a reduction in the incidence of the disorder or condition relative to an untreated control sample, or a delay in the onset of one or more symptoms of the disorder or condition relative to an untreated control sample. As used herein, prevention of RAS mutant cancer includes preventing or delaying the onset of symptoms of RAS mutant cancer. As used herein, prevention of RAS mutant cancer also includes preventing the recurrence of one or more signs or symptoms of RAS mutant cancer.

[0071] As used herein, the term “sample” refers to a clinical sample obtained from a subject. Biological samples may include tissues, cells, protein or membrane extracts of cells, mucus, sputum, bone marrow, bronchoalveolar lavage fluid (BAL), bronchial lavage fluid (BW), and biological fluids (e.g., ascites or cerebrospinal fluid (CSF)) isolated from the subject, as well as tissues, cells, and fluids (blood, plasma, saliva, urine, serum, etc.) present in the subject.

[0072] As used in this article, the term “separate” therapeutic use refers to the simultaneous or substantially simultaneous administration of at least two active ingredients via different routes.

[0073] As used herein, the term "sequential" therapeutic use refers to the administration of at least two active ingredients at different times, via the same or different routes of administration. More specifically, sequential use means the entire administration of one active ingredient precedes the administration of another one or more active ingredients. Therefore, an active ingredient may be administered minutes, hours, or days before the administration of another one or more active ingredients. In this case, there is no concurrent treatment.

[0074] As used in this article, the term “simultaneous” therapeutic use refers to the application of at least two active ingredients via the same route and simultaneously or substantially simultaneously.

[0075] As used herein, the terms “subject,” “individual,” or “patient” are used interchangeably and refer to a single organism, vertebrate, mammal, or human. In some embodiments, the individual, patient, or subject is a human.

[0076] As used herein, the terms “target sequence” and “target nucleic acid sequence” refer to the specific nucleic acid sequence to be regulated (e.g., suppressed or downregulated).

[0077] As used herein, the term "TXNRD1 inhibitor" refers to an agent that inhibits the gene expression or biological activity of TXNRD1. Examples of TXNRD1 biological activity include, but are not limited to, enzymatic activity, substrate-binding activity, homodimerization or heterodimerization activity, and binding to cellular structures. Several different isoforms of thioredoxin reductase 1 exist. The TXNRD1 inhibitors of this disclosure inhibit at least one biological activity of at least one isoform. Examples of TXNRD1 inhibitors include, but are not limited to, aurinolone, piracetam, D9, TRi-1, TRi-2, myricetin, PMX464, PX12, diflubenzuron toxin-2, cytosine A, ethaneselenoline, aurthioglucose, protoporphyrin IX, shRNA or siRNA targeting TXNRD1, antisense oligonucleotides targeting TXNRD1, anti-TXNRD1 antibodies, or any derivative thereof.

[0078] As used herein, “treating” (“treat” or “treatment”) encompasses treating a subject (e.g., a person) with the disease or disorder described herein, and includes: (i) suppressing the disease or disorder, i.e., preventing its development; (ii) alleviating the disease or disorder, i.e., causing the disorder to subside; (iii) slowing the progression of the disorder; and / or (iv) suppressing, alleviating, or slowing the progression of one or more symptoms of the disease or disorder. In some embodiments, treatment means bringing disease-related symptoms, such as easing, reducing, curing, or bringing them to a state of remission.

[0079] It should also be understood that the various treatments or preventive measures for medical diseases and conditions described herein are intended to mean "fundamentally," which includes both complete and less-than-complete treatments or preventive measures, and in which some biologically or medically relevant outcome is achieved. The treatment may be a continuous, prolonged course of treatment for a chronic disease, or a single or several applications of treatment for an acute condition.

[0080] The TXNRD1 inhibitor of the present invention

[0081] TXNRD1 protein (also known as thioredoxin reductase 1, GRIM-12, TR, TR1, TRXR1, or TXNR) is a member of the pyridine nucleotide oxidoreductase family and a component of the thioredoxin (Trx) system. TXNRD1 is a flavinase that reduces thioredoxins and other matrix components, playing a crucial role in redox homeostasis and selenium metabolism. TXNRD1 functions as a homodimer containing FAD and has a selenocysteine ​​residue (Sec) at its active site.

[0082] In one aspect, this disclosure provides compositions for treating RAS mutant cancers. In some embodiments, the TXNRD1 inhibitor reduces the gene expression and / or activity level of TXNRD1. In some embodiments, the TXNRD1 inhibitor reduces TXNRD1 activity selected from: enzyme activity, substrate binding activity, homodimerization activity, and binding to cellular structures.

[0083] In one aspect, this disclosure provides pharmacological inhibitors, including but not limited to auronoxamine, piracetam, D9, TRi-1, TRi-2, myricetin, PMX464, PX12, diflubenzuron-2, cytosine A, ethaneselenoline, aurantium thioglycolate, and protoporphyrin IX. Anti-TXNRD1 antibodies or any derivatives thereof may also be used in the methods disclosed herein.

[0084] In another aspect, this disclosure provides repressive RNAs (e.g., sgRNA, antisense RNA, or shRNA) that inhibit TXNRD1 expression and / or activity levels. Examples of such repressive RNAs include those having the following sequences: TCTAATATCATTAACACCATGG (SEQ ID NO:1; human shTXNRD1), TAAATAAAACTGAATATGGTCA (SEQ ID NO:2; human shTXNRD1), TTAATAATAACTTATGATATTA (SEQ ID NO:3; human shTXNRD1), TTTGTAACAAAAATACATGGAA (SEQ ID NO:4; human shTXNRD1), TTTAAATGAAAATCCTTCACAT (SEQ ID NO:5; human shTXNRD1), TTTTAAATGAAAATCCTTCACA (SEQ ID NO:6; human shTXNRD1), TAAGAAAAGAGAATCACAACAT (SEQ ID NO:7; human shTXNRD1), TTTTCATTTATCTTCACCCCTA (SEQ ID NO:8; human shTXNRD1), TTAGAAAGAAATAGATACCCAA (SEQ ID NO:1). NO:9; human shTXNRD1), TAATAATAACTTATGATATTAA (SEQ ID NO:10; human shTXNRD1), TTTAGTCACAGGGTAATTCGTC (SEQ ID NO:11; mouse shTxnrd1), and TTCGTCACTGACAACGTTGTGA (SEQ ID NO:12; mouse shTxnrd1) or any of their complements.

[0085] This disclosure provides an antisense nucleic acid comprising a nucleic acid sequence that is complementary to and specifically hybridizes with a portion of any of the following:

[0086] NM_182729.2 Homo sapiens thioredoxin reductase 1 (TXNRD1), transcript variant 1, mRNA (SEQ ID NO:13)

[0087]

[0088]

[0089]

[0090] NM_182742.2 Homo sapiens thioredoxin reductase 1 (TXNRD1), transcript variant 2, mRNA (SEQ ID NO:14)

[0091]

[0092]

[0093] Human thioredoxin reductase 1 (TXNRD1), transcript variant 3, mRNA NCBI reference sequence: NM_182743.2 (SEQ ID NO:15)

[0094]

[0095]

[0096]

[0097] Human thioredoxin reductase 1 (TXNRD1), transcript variant 4, mRNA NCBI reference sequence: NM_003330.3 (SEQ ID NO:16)

[0098]

[0099]

[0100] Human thioredoxin reductase 1 (TXNRD1), transcript variant 5, mRNA NCBI reference sequence: NM_001261445.1 (SEQ ID NO:17)

[0101]

[0102]

[0103]

[0104] Human thioredoxin reductase 1 (TXNRD1), transcript variant 6, mRNA NCBI reference sequence: NM_001261446.1 (SEQ ID NO:18)

[0105]

[0106]

[0107] Homo sapiens thioredoxin reductase 1 (TXNRD1), transcript variant 7, mRNA NCBI reference sequence: NM_001093771.3 (SEQ ID NO:19)

[0108]

[0109]

[0110]

[0111] The mRNA of thioredoxin reductase 1 (Txnrd1), transcript variant 1, from the house mouse (Mus musculus), is NCBI reference sequence: NM_001042513.1 (SEQ ID NO:20).

[0112]

[0113]

[0114] Mouse thioredoxin reductase 1 (Txnrd1), transcript variant 3, mRNA NCBI reference sequence: NM_001042514.1 (SEQ ID NO:21)

[0115]

[0116]

[0117] Mouse thioredoxin reductase 1 (Txnrd1), transcript variant 2, mRNA NCBI reference sequence: NM_015762.2 (SEQ ID NO:22)

[0118]

[0119]

[0120] Mouse thioredoxin reductase 1 (Txnrd1), transcript variant 4, mRNA NCBI reference sequence: NM_001042523.1 (SEQ ID NO:23)

[0121]

[0122]

[0123] (i.e., TXNRD1 mRNA isotype), thereby reducing or inhibiting TXNRD1 expression. The antisense nucleic acid can be antisense RNA or antisense DNA. Antisense nucleic acids based on known TXNRD1 gene sequences can be readily designed and engineered using methods known in the art. In some embodiments, the antisense nucleic acid comprises a nucleic acid sequence of any one of SEQ ID NO:1-12 or a complement thereof.

[0124] The antisense nucleic acid is a molecule complementary to a sense nucleic acid strand, such as the coding strand of a double-stranded DNA molecule (or cDNA) or the mRNA sequence. Therefore, the antisense nucleic acid can form hydrogen bonds with the sense nucleic acid. The antisense nucleic acid can be complementary to the entire TXNRD1 coding strand or a portion thereof (e.g., all or part of the protein-coding region (or open reading frame)). In some embodiments, the antisense nucleic acid is an oligonucleotide complementary to only a portion of the coding region of the TXNRD1 mRNA. In some embodiments, the antisense nucleic acid molecule can be complementary to the non-coding region of the TXNRD1 coding strand. In some embodiments, the non-coding region refers to the 5′ and 3′ untranslated regions flanking the coding region and not translated into amino acids. For example, the antisense oligonucleotide can be complementary to the region surrounding the translation initiation site of TXNRD1. The length of the antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides.

[0125] Antisense nucleic acids are constructed using procedures known in the art, employing chemical synthesis and enzymatic ligation reactions. For example, antisense nucleic acids (e.g., antisense oligonucleotides) can be chemically synthesized using naturally occurring nucleotides or modified nucleotides designed to increase the biological stability of the molecule or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids (e.g., phosphate thioester derivatives and acridine-substituted nucleotides). Examples of modified nucleotides that can be used to generate antisense nucleic acids include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-hodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminoaminomethyluracil, dihydrouracil, β-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, and 7-methylguanine. Purines, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D-mannosyl queosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), queosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w, and 2,6-diaminopurine. Alternatively, the antisense nucleic acid can be biologically generated using an expression vector, wherein the nucleic acid has been subcloned with an antisense orientation (i.e., the RNA transcribed from the inserted nucleic acid will have an antisense orientation toward the target nucleic acid).

[0126] The antisense nucleic acid molecules can be administered to a subject or generated in situ, causing them to hybridize or bind to cellular mRNA and / or genomic DNA encoding the target protein, thereby inhibiting the expression of the protein, for example, by inhibiting transcription and / or translation. The hybridization can occur either by forming a stable double helix via Watson-Crick base pairing, or, in the case of antisense nucleic acid molecules bound to a DNA double helix, by specific interactions in the major groove of the double helix.

[0127] In some embodiments, the antisense nucleic acid molecule is modified, for example, by linking the antisense nucleic acid molecule to a peptide or antibody that binds to a cell surface receptor or antigen, such that they specifically bind to a receptor or antigen expressed on a selected cell surface. In some embodiments, the antisense nucleic acid molecule is an α-anomeric nucleic acid molecule. α-anomeric nucleic acid molecules form a specific double-stranded hybrid with complementary RNA, wherein, in contrast to the usual β-unit, the two strands extend parallel to each other (Gaultier et al., Nucleic Acids. Res. 15:6625-6641 (1987)). The antisense nucleic acid molecule may also contain 2'-O-methylribonucleotides (Inoue et al., Nucleic Acids Res. 15:6131-6148 (1987)) or chimeric RNA-DNA analogs (Inoue et al., FEBS Lett. 215:327-330 (1987)).

[0128] This disclosure also provides short hairpin RNA (shRNA) or small interfering RNA (siRNA) comprising a nucleic acid sequence that is complementary to and specifically hybridizes to a portion of any of SEQ ID NO:13-23 (TXNRD1 mRNA isotypes), thereby reducing or inhibiting TXNRD1 expression. In some embodiments, the shRNA or siRNA is about 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 base pairs in length. Double-stranded RNA (dsRNA) can induce sequence-specific posttranscriptional gene silencing (e.g., RNA interference (RNAi)) in many organisms, such as *C. elegans*, *Drosophila*, plants, mammals, oocytes, and early embryos. RNAi is a process of interfering with or significantly reducing the number of protein copies produced from mRNA. For example, double-stranded siRNA or shRNA molecules are engineered to be complementary to and hybridize to the mRNA of a target gene. Following intracellular delivery, the siRNA or shRNA molecule is associated with an RNA-induced silencing complex (RISC), which then binds to and degrades a complementary target mRNA (e.g., TXNRD1 mRNA). In some embodiments, the shRNA or siRNA comprises a nucleic acid sequence of any one of SEQ ID NO: 1-12.

[0129] This disclosure also provides riboproteins comprising nucleic acid sequences that are complementary to and specifically hybridize to a portion of any of SEQ ID NO:13-23 (TXNRD1 mRNA isotypes), thereby reducing or inhibiting TXNRD1 expression. Riboproteins are catalytic RNA molecules with ribonuclease activity, capable of cleaving complementary single-stranded nucleic acids, such as mRNA. Therefore, riboproteins (e.g., hammerhead riboproteins (described in Haselhoff and Gerlach, Nature 334:585-591(1988))) can be used to catalyze the cleavage of TXNRD1 transcripts, thereby inhibiting TXNRD1 translation.

[0130] Ribozymes specific to the TXNRD1-encoded nucleic acid can be designed based on the TXNRD1 nucleic acid sequence disclosed herein. For example, derivatives of Tetrahymena L-19IVS RNA can be constructed, wherein the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in the TXNRD1-encoded mRNA. See, for example, U.S. Patent Nos. 4,987,071 and 5,116,742. Alternatively, TXNRD1 mRNA can be used to select catalytic RNAs with specific ribonuclease activity from a pool of RNA molecules. See, for example, Bartel and Szostak (1993) Science 261:1411-1418, incorporated herein by reference.

[0131] This disclosure also provides a synthetic guide RNA (sgRNA) comprising a nucleic acid sequence complementary to and specifically hybridizing with a portion of any of SEQ ID NO:13-23 (TXNRD1 mRNA isotypes). Guide RNAs used in CRISPR-Cas systems are typically generated as a single guide RNA comprising a crRNA segment and a tracrRNA segment. The crRNA segment and tracrRNA segment may also be generated as separate RNA molecules. The crRNA segment comprises a targeting portion that binds to a portion of any of SEQ ID NO:13-23 (TXNRD1 mRNA isotypes) and a stem portion that hybridizes with the tracrRNA. The tracrRNA segment comprises a nucleotide sequence that is either completely complementary to the stem sequence portion of the crRNA and a nucleotide sequence that binds to the CRISPR enzyme. In some embodiments, the crRNA segment and the tracrRNA segment are provided as a single guide RNA. In some embodiments, the crRNA segment and the tracrRNA segment are provided as separate RNAs. The combination of the CRISPR enzyme with the crRNA and tracrRNA constitutes a functional CRISPR-Cas system. Exemplary CRISPR-Cas systems for targeting nucleic acids are described, for example, in WO2015 / 089465.

[0132] In some implementations, the synthesis guide RNA is represented as a single RNA containing the following elements:

[0133] 5′-X1-X2-YZ-3′

[0134] Wherein X1 and X2 represent crRNA segments, X1 is a target sequence that binds to a portion of any one of SEQ ID NO:13-23, X2 is a stem sequence that hybridizes with tracrRNA, Z represents a tracrRNA segment containing a nucleotide sequence that is partially or completely complementary to X2, and Y represents a linker sequence. In some embodiments, the linker sequence comprises two or more nucleotides and links the crRNA and tracrRNA segments. In some embodiments, the linker sequence comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides. In some embodiments, the linker is a loop of hairpin structure formed when the stem sequence hybridizes with tracrRNA.

[0135] In some embodiments, the synthesis guide RNA is provided as two separate RNAs, one of which represents the crRNA segment: 5'-X1-X2-3', where X1 is a target sequence that binds to a portion of any one of SEQ ID NO: 13-23, X2 is a stem sequence that hybridizes with tracrRNA, and the other RNA represents the tracrRNA segment Z, which is a separate RNA from the crRNA segment and contains a nucleotide sequence that is either complementary to or completely complementary to the X2 portion of the crRNA.

[0136] Exemplary crRNA stem sequences and tracrRNA sequences are provided, for example, in WO / 2015 / 089465, which is incorporated herein by reference. Generally, a stem sequence includes any sequence having sufficient complementarity to a complementary sequence in the tracrRNA to facilitate the formation of a CRISPR complex at a target sequence, wherein the CRISPR complex comprises a stem sequence that hybridizes with the tracrRNA. Generally, the degree of complementarity is about the optimal alignment of the stem sequence and the complementary sequence in the tracrRNA along the shorter of the two sequences. The optimal alignment can be determined by any suitable alignment algorithm, and secondary structures, such as self-complementarity within the complementary sequence in the stem sequence or tracrRNA, can also be considered. In some embodiments, when optimally aligned, the degree of complementarity between the stem sequence and the complementary sequence in the tracrRNA is about or greater than about 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97.5%, 99%, or higher. In some embodiments, the stem sequence is about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50 or more nucleotides long. In some embodiments, the stem sequence and the complementary sequence in the tracrRNA are contained within a single RNA, such that hybridization between the two produces a transcript with secondary structure, such as a hairpin. In some embodiments, the tracrRNA has additional complementary sequences that form hairpins. In some embodiments, the tracrRNA has at least two or more hairpins. In some embodiments, the tracrRNA has two, three, four or five hairpins. In some embodiments, the tracrRNA has a maximum of five hairpins.

[0137] In the hairpin structure, the final "N" of the loop and the upstream 5' end sequence portion correspond to the crRNA stem sequence, and the 3' end sequence portion of the loop corresponds to the tracrRNA sequence. Other non-restrictive examples of single polynucleotides containing a guide sequence, a stem sequence, and a tracr sequence are as follows (listed in 5' to 3'), where "N" represents the base of the guide sequence (e.g., the modified oligonucleotide provided herein), the first lowercase letter represents the stem sequence, the second lowercase letter represents the tracr RNA sequence, and the final poly-T sequence represents the transcription terminator: (a) NNNNNNNNNNNNNNNNNNNNNNgtttttgtactctcaagatttaGAAAtaaatcttgcagaagctacaaagataa ggcttcatgccgaaatcaacaccctgtcattttatggcagggtgttttcgttatttaaTTTTTT (SEQ ID NO:24); (b) NNNNNNNNNNNNNNNNNNNNNNNNgtttttgtactctcaGAAAtgcagaagctacaaagataaggcttcatgccg aaatcaacaccctgtcattttatggcagggtgttttcgttatttaaTTTTTT (SEQ ID NO:24) ID NO: 25); (c) NNNNNNNNNNNNNNNNNNNNgtttttgtactctcaGAAAtgcagaagctacaaagataaggcttcatgccg aaatcaacaccctgtcattttatggcagggtgtTTTTTT (SEQ ID NO: 26); (d) NNNNNNNNNNNNNNNNNNNNgttttagagctaGAAAtagcaagttaaaataaggctagtccgttatcaactt gaaaaagtggcaccgagtcggtgcTTTTTT (SEQ ID NO: 27); (e) NNNNNNNNNNNNNNNNNNNNgttttagagctaGAAATAGcaagttaaaataaggctagtccgttatcaac ttgaaaaagtgTTTTTTT (SEQ ID NO: 28); and (f) NNNNNNNNNNNNNNNNNNNNgttttagagctagAAATAGcaagttaaaataaggctagtccgttatcaTTTTTTTT (SEQ ID NO: 29).

[0138] Suitable oligonucleotides used as target sequences in a CRISPR Cas system depend on several factors, including the specific CRISPR enzyme to be used and the presence of a corresponding pre-interstitial sequence adjacent motif (PAM) downstream of the target sequence in the target nucleic acid. The PAM sequence guides the cleavage of the target nucleic acid by the CRISPR enzyme. In some embodiments, suitable PAMs for SpCas9 or SaCas9 enzymes (or their derivatives) are 5'-NRG or 5'-NNGRR (where N is any nucleotide). Typically, the PAM sequence should be present between about 1 and about 10 nucleotides of the target sequence to produce efficient cleavage of the target nucleic acid. Thus, when the guide RNA forms a complex with the CRISPR enzyme, the complex localizes to the target sequence and the PAM sequence, unwinds the DNA double helix, and guides the RNA to anneal to the complementary sequence on the opposing strand. This enables the Cas9 nuclease to produce double-strand breaks. In some embodiments, the sgRNA comprises a nucleic acid sequence of any one of SEQ ID NO: 1-12.

[0139] Various CRISPR enzymes can be used in combination with the disclosed guide RNA of this disclosure. In some embodiments, the CRISPR enzyme is a type II CRISPR enzyme. In some embodiments, the CRISPR enzyme catalyzes DNA cleavage. In some embodiments, the CRISPR enzyme catalyzes RNA cleavage. In some embodiments, the CRISPR enzyme is any Cas9 protein, such as any naturally occurring bacterial Cas9, and any chimera, mutant, homolog, or ortholog. Non-limiting examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, their homologs, or modified variants thereof. In some embodiments, the CRISPR enzyme cleaves both strands of the target nucleic acid at a pre-interstitial adjacent motif (PAM). In some embodiments, the CRISPR enzyme is a nicking enzyme that cleaves only one strand of the target nucleic acid. In some embodiments, the CRISPR enzyme is dCas9 labeled with an additional enzyme activity that inhibits or activates the expression of the target gene.

[0140] Pharmaceutical Composition

[0141] In one aspect, this disclosure provides pharmaceutical compositions comprising a TXNRD1 inhibitor.

[0142] The pharmaceutical compositions disclosed herein can be prepared by any method known in pharmaceutical technology. The amount of active ingredient that can be combined with a carrier material to produce a single dosage form will vary depending on the host being treated and the specific route of administration. The amount of active ingredient that can be combined with a carrier material to produce a single dosage form is typically the amount of the compound that produces the therapeutic effect. Typically, the amount of the active compound will be in the range of about 0.1% to 99%, more typically about 5% to 70%, and more typically about 10% to 30%.

[0143] In some embodiments, the pharmaceutical compositions of the present invention may contain one or more pharmaceutically acceptable carriers, as used herein, which generally refer to pharmaceutically acceptable compositions such as liquid or solid fillers, diluents, excipients, manufacturing aids (e.g., lubricants, talc, magnesium stearate, calcium stearate, or zinc stearate or stearic acid), or solvent encapsulation materials that can be used to introduce active agents into the body.

[0144] Examples of suitable aqueous and non-aqueous carriers that can be used in pharmaceutical compositions of the present invention include, for example, water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, etc.), vegetable oils (such as olive oil), and injectable organic esters (such as ethyl oleate), and suitable mixtures thereof. Appropriate flowability can be maintained, for example, by using coating materials (such as lecithin), by maintaining the desired particle size in the case of dispersions, and by using surfactants.

[0145] In some embodiments, the formulation may comprise one or more of the following: sugars, such as lactose, glucose, and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; powdered astragalus gum; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols, such as propylene glycol; polyols, such as glycerol, sorbitol, mannitol, and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; alginic acid; buffers, such as magnesium hydroxide and aluminum hydroxide; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; pH buffer solutions; polyesters, polycarbonates, and / or polyanhydrides; preservatives; gliding agents; fillers; and other non-toxic and compatible substances used in pharmaceutical formulations.

[0146] Various adjuvants (such as wetting agents, emulsifiers, lubricants (e.g., sodium dodecyl sulfate and magnesium stearate), colorants, release agents, coating agents, sweeteners, flavoring agents, preservatives, and antioxidants) may also be included in the pharmaceutical compositions of the present invention. Some examples of pharmaceutically acceptable antioxidants include: water-soluble antioxidants such as ascorbic acid, cysteine ​​hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite, etc.; oil-soluble antioxidants such as ascorbate palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, α-tocopherol, etc.; and metal chelating agents such as citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, etc. In some embodiments, the pharmaceutical formulation comprises excipients selected from, for example, cellulose, liposomes, lipid nanoparticles, micelle forming agents (e.g., bile acids), and polymer carriers (e.g., polyesters and polyanhydrides). In addition to the active compound, the suspension may contain suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol, dehydrated sorbitol esters, microcrystalline cellulose, aluminum hydroxide, bentonite, agar, astragalus gum, and combinations thereof. The presence of various antibacterial and antifungal agents (e.g., parabens, chlorobutanol, phenolic sorbic acid, etc.) can ensure protection against microbial activity against the active compound. It may also be desirable to include isotonic agents such as sugars and sodium chloride in the composition. Furthermore, delayed absorption of injectable drugs can be achieved by including agents that delay absorption (e.g., aluminum monostearate and gelatin).

[0147] Treatment

[0148] The following discussion is presented by way of example only and is not intended to be restrictive.

[0149] One aspect of the present invention includes methods for treating diseases or conditions characterized by elevated expression levels and / or increased activity of TXNRD1. Additionally or alternatively, in some embodiments, the present invention includes methods for treating RAS mutant cancers. The three major isotypes of RAS (KRAS, NRAS, and HRAS) are collectively mutated in approximately 20% of human cancers, primarily at active sites near the g-phosphate residues G12, G13, and Q61 of the guanosine triphosphate (GTP) substrate (see Marcus and Mattos, Clin Cancer Res 21(8):1810-1818(2015)). In some embodiments, the RAS mutant cancer comprises a KRAS, NRAS, or HRAS mutation selected from G12C, G12D, G12V, G12A, G12S, G12R, G13D, G13C, G13S, G13R, G13A, G13V, Q61H, Q61L, Q61R, Q61K, Q61P, and Q61E.

[0150] In some embodiments, the present invention includes a method for treating RAS mutant pancreatic cancer. In one aspect, this disclosure provides a method for inhibiting the proliferation of RAS mutant cancer in a subject of need, the method comprising administering to the subject a therapeutically effective amount of at least one TXNRD1 inhibitor disclosed herein, wherein the subject suffers from RAS mutant cancer characterized by elevated expression levels and / or increased activity of TXNRD1.

[0151] In some embodiments, the subject is diagnosed with, suspected of having, or at risk of having a disease or condition characterized by elevated expression levels and / or increased activity of TXNRD1. Alternatively or additionally, in some embodiments, the subject is diagnosed with RAS mutant cancer. In some embodiments, the RAS mutant cancer comprises a KRAS, NRAS, or HRAS mutation selected from G12C, G12D, G12V, G12A, G12S, G12R, G13D, G13C, G13S, G13R, G13A, G13V, Q61H, Q61L, Q61R, Q61K, Q61P, and Q61E. In some embodiments, the subject is diagnosed with lung cancer (e.g., lung adenocarcinoma), mucin adenoma, pancreatic cancer (e.g., PDAC), colorectal cancer, skin cancer (e.g., melanoma), endometrial cancer, testicular germ cell cancer, or adrenal cancer. In some embodiments, the subject is diagnosed with pancreatic cancer. In some embodiments, the subject is diagnosed with RAS mutant pancreatic cancer.

[0152] In therapeutic applications, a composition or drug comprising the TXNRD1 inhibitor disclosed herein is administered in an amount sufficient to a subject who is suspected of having or has already had such a disease or condition (e.g., a subject diagnosed with a disease or condition characterized by elevated expression levels and / or increased activity of TXNRD1 and / or a subject diagnosed with RAS mutant cancer and / or a subject diagnosed with pancreatic cancer), said amount being sufficient to cure or at least partially prevent symptoms of said disease, including its complications and intermediate pathological phenotypes in the development of said disease.

[0153] Subjects suffering from a disease or condition characterized by elevated expression levels and / or increased activity of TXNRD1 and / or diagnosed with RAS mutant cancer can be identified by any one or a combination of diagnostic or prognostic assays known in the art.

[0154] In some implementations, the subject may exhibit one or more mutations in KRAS. Additionally, the subject may exhibit one or more mutations in at least one of the following genes: TP53, CDKN2A, SMAD4, MLL3, TGFBR2, ARID1A and SF3B1, EPC1 and ARID2, ATM, ZIM2, MAP2K4, NALCN, SLC16A4, MAGEA6, ROBO2, KDM6A, PREX2, ERBB2, MET, FGFR1, CDK6, PIK3R3, PIK3CA, BRCA1, BRCA2, PALB2, etc. (Biankin et al., Nature 491(7424):399-405 (2012); and Waddell et al., Nature 518(7540):495-501 (2015). Alternatively or additionally, the subject may exhibit at least one mutation in one or more of the core groups of twelve cellular signaling pathways and processes. Jones et al., Science 321(5897):1801-1806 (2008).

[0155] In some implementations, subjects with a disease or condition characterized by elevated expression levels and / or increased activity of TXNRD1 and / or subjects with RAS mutant pancreatic cancer treated with the TXNRD1 inhibitor will show improvement or elimination of one or more of the following symptoms: upper abdominal pain radiating to the back, loss of appetite or unintentional weight loss, depression, new-onset diabetes, blood clots, fatigue, yellowing of the skin and whites of the eyes (jaundice), flatulence, nausea, and vomiting.

[0156] In some embodiments, subjects treated with the TXNRD1 inhibitor who have a disease or condition characterized by elevated TXNRD1 expression levels and / or increased TXNRD1 activity levels and / or who have RAS mutant cancer and / or who have pancreatic cancer will show reduced RAS mutant cell proliferation and / or increased survival compared to untreated subjects with RAS mutant cancer. In some embodiments, subjects treated with the TXNRD1 inhibitor who have a disease or condition characterized by elevated TXNRD1 expression levels and / or increased TXNRD1 activity levels and / or who have RAS mutant cancer and / or who have pancreatic cancer will show reduced TXNRD1 and / or RAS expression levels and / or reduced TXNRD1 and / or RAS activity levels compared to untreated subjects with RAS mutant cancer.

[0157] In one aspect, this disclosure provides a method for monitoring the therapeutic efficacy of a TXNRD1 inhibitor in a subject diagnosed with RAS mutant cancer, the method comprising: (a) detecting TXNRD1 protein levels in a test sample obtained from the subject after administration of the TXNRD1 inhibitor to the subject; and (b) determining that the TXNRD1 inhibitor is effective when the TXNRD1 protein level in the test sample is lower than that observed in a control sample obtained from the subject before administration of the TXNRD1 inhibitor. The TXNRD1 inhibitor may be aurinolone, piracetam, D9, TRi-1, TRi-2, myricetin, PMX464, PX12, diflubenzuron-2, cymoxanone A, ethaneselenoline, aurthioglucosamine, protoporphyrin IX, TXNRD1-inhibiting RNA, anti-TXNRD1 antibody, or any derivative thereof. The test sample may be tissue, cells, or biological fluid (blood, plasma, saliva, urine, serum, etc.) present in the subject. Alternatively, the efficacy of the TXNRD1 inhibitor in the subject can be determined using RAS (e.g., KRAS, HRAS, NRAS) and / or TXNRD1 expression levels (see Example 6 described herein). Therefore, in some embodiments, the method further includes detecting RAS (e.g., KRAS, HRAS, NRAS) and / or TXNRD1 expression levels in the subject, wherein a decrease in RAS (e.g., KRAS, HRAS, NRAS) and / or TXNRD1 expression levels relative to those observed in the subject prior to treatment indicates therapeutic efficacy of the TXNRD1 inhibitor. Additionally or alternatively, in some embodiments, the method further includes detecting the activity of RAS (e.g., KRAS, HRAS, NRAS) and / or TXNRD1 proteins in the subject, wherein a decrease in RAS (e.g., KRAS, HRAS, NRAS) and / or TXNRD1 activity relative to those activities observed in the subject prior to treatment indicates therapeutic efficacy of the TXNRD1 inhibitor. In some embodiments, the RAS mutant cancer comprises a KRAS, NRAS, or HRAS mutation selected from G12C, G12D, G12V, G12A, G12S, G12R, G13D, G13C, G13S, G13R, G13A, G13V, Q61H, Q61L, Q61R, Q61K, Q61P, and Q61E. In some embodiments, the KRAS, NRAS, or HRAS mutation is detected via DNA sequencing.

[0158] In any and all embodiments of the methods disclosed herein, the expression levels of TXNRD1 and / or RAS (e.g., KRAS, HRAS, NRAS) are detected by: RNA-seq, northern blotting, microarray, dot or narrow-line blotting, fluorescence in situ hybridization, reverse transcription polymerase chain reaction (RT-PCR), ribonuclease protection assay (RPA), real-time quantitative RT-PCR, high performance liquid chromatography (HPLC), liquid chromatography-mass spectrometry (LC / MS), enzyme-linked immunosorbent assay (ELISA), immunoprecipitation, immunoelectrophoresis, immunostaining, immunohistochemistry, or Western blotting.

[0159] Prevention methods

[0160] In one aspect, the present invention provides a method for preventing or delaying the onset of a disease or condition characterized by elevated expression levels and / or increased activity of TXNRD1. Additionally or alternatively, in some aspects, the present invention provides a method for preventing or delaying the onset of RAS mutant cancer. In some embodiments, the RAS mutant cancer comprises a KRAS, NRAS, or HRAS mutation selected from G12C, G12D, G12V, G12A, G12S, G12R, G13D, G13C, G13S, G13R, G13A, G13V, Q61H, Q61L, Q61R, Q61K, Q61P, and Q61E. The RAS mutant cancer can be lung cancer (e.g., lung adenocarcinoma), mucin adenoma, pancreatic cancer (e.g., PDAC), colorectal cancer, skin cancer (e.g., melanoma), endometrial cancer, testicular germ cell cancer, or adrenal cancer.

[0161] Subjects at risk of developing or being susceptible to a disease or condition characterized by elevated expression levels and / or increased activity of TXNRD1 and / or subjects at risk of developing or being susceptible to RAS mutant cancers and / or subjects at risk of developing or being susceptible to pancreatic cancer include subjects exhibiting one or more mutations in RAS (e.g., KRAS, HRAS, NRAS). Additionally, the subjects may exhibit one or more point mutations in one or more of the following genes: TP53, CDKN2A, SMAD4, MLL3, TGFBR2, ARID1A and SF3B1, EPC1 and ARID2, ATM, ZIM2, MAP2K4, NALCN, SLC16A4, MAGEA6, ROBO2, KDM6A, PREX2, ERBB2, MET, FGFR1, CDK6, PIK3R3, PIK3CA, BRCA1, BRCA2, PALB2, etc. Biankin et al., Nature 491(7424):399-405 (2012); and Waddell et al., Nature 518(7540):495-501 (2015). Alternatively or additionally, the subject may exhibit mutations in at least one of one or more core groups of twelve cellular signaling pathways and processes. Jones et al., Science 321(5897):1801-1806 (2008). Such subjects can be identified by any or a combination of diagnoses or prognoses known in the art, for example. In some embodiments, the RAS mutant cancer comprises a KRAS, NRAS, or HRAS mutation selected from G12C, G12D, G12V, G12A, G12S, G12R, G13D, G13C, G13S, G13R, G13A, G13V, Q61H, Q61L, Q61R, Q61K, Q61P, and Q61E.

[0162] In preventative applications, a pharmaceutical composition or drug comprising a TXNRD1 inhibitor disclosed herein is administered in an amount sufficient to a subject who is susceptible to or at risk of developing a disease or condition characterized by (a) elevated expression levels and / or increased activity of TXNRD1 and / or (b) susceptible to or at risk of developing RAS mutant cancer and / or susceptible to or at risk of developing pancreatic cancer, said amount being sufficient to eliminate or reduce the risk of disease onset or delay disease onset, including biochemical, histological, and / or behavioral symptoms of the disease, its complications, and intermediate pathological phenotypes in the course of the disease. The administration of a prophylactic TXNRD1 inhibitor can be performed before the onset of symptoms characteristic of the disease or disorder, thereby preventing the disease or disorder or delaying its progression.

[0163] In some embodiments, treatment with the TXNRD1 inhibitor will prevent or delay the onset of one or more of the following symptoms: upper abdominal pain radiating to the back, loss of appetite or unintentional weight loss, depression, new-onset diabetes, blood clots, fatigue, yellowing of the skin and whites of the eyes (jaundice), flatulence, nausea, and vomiting. In some embodiments, subjects treated with the TXNRD1 inhibitor who (a) have a disease or condition characterized by elevated levels of TXNRD1 expression and / or increased activity and / or who (b) have RAS mutant cancer and / or pancreatic cancer will exhibit TXNRD1 and / or RAS expression levels similar to those observed in healthy control subjects.

[0164] For therapeutic and / or preventative use, a composition comprising the TXNRD1 inhibitor disclosed herein is administered to the subject. In some embodiments, the TXNRD1 inhibitor is administered once, twice, three times, four times, or five times daily. In some embodiments, the TXNRD1 inhibitor is administered more than five times daily. Alternatively or additionally, in some embodiments, the TXNRD1 inhibitor is administered once daily, every other day, every three days, every four days, every five days, or every six days. In some embodiments, the TXNRD1 inhibitor is administered once weekly, every two weeks, every three weeks, or monthly. In some embodiments, the TXNRD1 inhibitor is administered for a period of one week, two weeks, three weeks, four weeks, or five weeks. In some embodiments, the TXNRD1 inhibitor is administered for six weeks or longer. In some embodiments, the TXNRD1 inhibitor is administered for twelve weeks or longer. In some embodiments, the TXNRD1 inhibitor is administered for a period of less than one year. In some embodiments, the TXNRD1 inhibitor is administered for a period of more than one year. In some embodiments, the TXNRD1 inhibitor is administered throughout the subject's entire lifespan.

[0165] In some embodiments of the method of the present invention, the TXNRD1 inhibitor is administered daily for one week or longer. In some embodiments of the method of the present invention, the TXNRD1 inhibitor is administered daily for two weeks or longer. In some embodiments of the method of the present invention, the TXNRD1 inhibitor is administered daily for three weeks or longer. In some embodiments of the method of the present invention, the TXNRD1 inhibitor is administered daily for four weeks or longer. In some embodiments of the method of the present invention, the TXNRD1 inhibitor is administered daily for six weeks or longer. In some embodiments of the method of the present invention, the TXNRD1 inhibitor is administered daily for 12 weeks or longer. In some embodiments, the TXNRD1 inhibitor is administered daily for the entire lifespan of the subject.

[0166] Determination of the biological effects of TXNRD1 inhibitors

[0167] In various embodiments, suitable in vitro or in vivo assays are performed to determine the efficacy of the specific TXNRD1 inhibitor and whether its administration indicates therapeutic applicability. In various embodiments, in vitro assays can be performed using representative animal models to determine whether a given TXNRD1 inhibitor produces the desired effect in reducing or eliminating signs and / or symptoms of RAS mutant cancer. Compounds for therapy can be tested in suitable animal model systems, including but not limited to rats, mice, chickens, cows, monkeys, rabbits, etc., prior to testing in human subjects. Similarly, for in vivo testing, any animal model system known in the art can be used prior to administration to human subjects. In some embodiments, in vitro or in vivo testing relates to the biological function of one or more TXNDR1 inhibitors of the present invention.

[0168] Animal models of RAS mutant cancer and / or pancreatic cancer can be generated using techniques known in the art (see Example 7 described herein). Such models can be used to demonstrate the biological effects of TXNRD1 inhibitors in the prevention and treatment of conditions caused by the disruption of specific genes and / or the inhibition of the activity of specific proteins, as well as to determine the therapeutically effective amount of one or more TXNRD1 inhibitors disclosed herein in a given context.

[0169] Application mode and effective dose

[0170] Any method known to those skilled in the art for contacting cells, organs, or tissues with one or more TXNRD1 inhibitors disclosed herein may be used. Suitable methods include in vitro, ex vivo, or in vivo methods. In vivo methods typically involve administering one or more TXNRD1 inhibitors to a mammal (suitably a human). When a therapy is used in vivo, one or more TXNRD1 inhibitors described herein are administered to the subject in an effective amount (i.e., an amount with the desired therapeutic effect). The dosage and dosing regimen will depend on the severity of the subject's disease state, the characteristics of the specific TXNRD1 inhibitor used (e.g., its therapeutic index), and the subject's medical history.

[0171] Effective doses can be determined during preclinical and clinical trials using methods familiar to physicians and clinicians. Effective doses of one or more TXNRD1 inhibitors suitable for these methods can be administered to the desired mammal via any of many well-known methods for administering the pharmaceutical composition. The TXNRD1 inhibitors can be administered systemically or locally.

[0172] One or more TXNRD1 inhibitors described herein can be incorporated into pharmaceutical compositions for administration, alone or in combination, to subjects for the treatment or prevention of RAS-mutant cancers and / or for the treatment or prevention of pancreatic cancer. Such compositions typically include an active agent and a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable carrier" includes saline, solvent, dispersion medium, coating, antibacterial and antifungal agents, isotonic agents, and absorption delay agents compatible with drug administration. Complementary active compounds may also be incorporated into the composition.

[0173] Pharmaceutical compositions are typically formulated to be compatible with their intended route of administration. Examples of routes of administration include parenteral (e.g., intravenous, intradermal, intraperitoneal, or subcutaneous), oral, inhalation, transdermal (topical), intraocular, iontophoresis, and transmucosal administration. Solutions or suspensions intended for parenteral, intradermal, or subcutaneous administration may include the following components: sterile diluents, such as water for injection, saline solution, non-volatile oils, polyethylene glycol, glycerol, propylene glycol, or other synthetic solvents; antimicrobial agents, such as benzyl alcohol or methylparaben; antioxidants, such as ascorbic acid or sodium bisulfite; chelating agents, such as ethylenediaminetetraacetic acid; buffers, such as acetates, citrates, or phosphates; and agents for adjusting tension, such as sodium chloride or dextran. The pH may be adjusted with an acid or base (such as hydrochloric acid or sodium hydroxide). Parenteral formulations may be packaged in ampoules, disposable syringes, or multi-dose vials made of glass or plastic. To facilitate patients or treating physicians, medication preparations can be provided in kits containing all the necessary equipment (e.g., vials of medication, vials of diluent, syringes, and needles) for the treatment process (e.g., 7 days of treatment).

[0174] Suitable pharmaceutical compositions for injection include sterile aqueous solutions (water-soluble) or dispersions, as well as sterile powders for the ad hoc preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, antibacterial water, and CREMOPHOR EL. TM (BASF, Parsipani, New Jersey) or phosphate-buffered saline (PBS). In all cases, the composition for parenteral administration must be sterile and should be a fluid of easily injectable consistency. It should be stable under manufacturing and storage conditions and must be preserved against contamination by microorganisms such as bacteria and fungi.

[0175] Pharmaceutical compositions having one or more TXNRD1 inhibitors disclosed herein may include a carrier, which may be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.) and suitable mixtures thereof. Appropriate flowability can be maintained, for example, by using a coating (e.g., lecithin), by maintaining a desired particle size in the case of a dispersion, and by using a surfactant. Antimicrobial activity can be achieved by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, ascorbic acid, thiomerasol, etc. Glutathione and other antioxidants may be included to prevent oxidation. In many cases, it is advantageous to include an isotonic agent in the composition, such as sugars, polyols (e.g., mannitol, sorbitol), or sodium chloride. Prolonged absorption of the injectable composition can be achieved by including a delayed-absorption agent, such as aluminum monostearate or gelatin, in the composition.

[0176] Sterile injectable solutions can be prepared by incorporating the active compound in the desired amount into a suitable solvent having one or a combination of the components listed above, followed by filtration and sterilization. Typically, dispersions are prepared by incorporating the active compound into a sterile medium containing an alkaline dispersion medium and other desired components from those listed above. In the case of sterile powders used to prepare sterile injectable solutions, typical preparation methods include vacuum drying and freeze-drying, which can produce powders of the active ingredient and any other desired components from a previously sterile filtered solution.

[0177] Oral compositions typically include an inert diluent or an edible carrier. For oral therapeutic administration, the active compound may be incorporated with excipients and used in the form of tablets, lozenges, or capsules (e.g., gelatin capsules). Oral compositions may also be prepared using fluid carriers used in mouthwashes. Pharmaceutically compatible binders and / or excipients may be included as part of the composition. Tablets, pills, capsules, lozenges, etc., may contain any of the following ingredients or compounds with similar properties: binders, such as microcrystalline cellulose, astragalus gum, or gelatin; excipients, such as starch or lactose; disintegrants, such as alginate, Primogel, or corn starch; lubricants, such as magnesium stearate or sterotes; flow aids, such as silica gel; sweeteners, such as sucrose or saccharin; or flavoring agents, such as peppermint, methyl salicylate, or orange flavoring.

[0178] For administration by inhalation, the compound can be delivered as an aerosol spray from a pressurized container or dispenser containing a suitable propellant, such as a gas (e.g., carbon dioxide) or a nebulizer. Such methods include those described in U.S. Patent No. 6,468,798.

[0179] Systemic administration of the therapeutic compounds described herein can also be performed via transmucosal or transdermal devices. For transmucosal or transdermal administration, a penetrant suitable for the barrier to be penetrated is used in the formulation. Such penetrants are generally known in the art and, for transmucosal administration, include, for example, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished using a nasal spray. For transdermal administration, the active compound is formulated as an ointment, cream, gel, or lotion as generally known in the art. In one embodiment, transdermal administration can be performed via iontophoresis.

[0180] Therapeutic agents can be formulated in a carrier system. The carrier can be a colloidal system. The colloidal system can be liposomes, phospholipid bilayers, or lipid nanoparticles. In one embodiment, the therapeutic agent is encapsulated in liposomes while maintaining the structural integrity of the agent. Those skilled in the art will understand that there are various methods for preparing liposomes. (See Lichtenberg et al., Methods Biochem. Anal., 33:337-462 (1988); Anselem et al., Liposome Technology, CRC Press (1993)). Liposome formulations can delay clearance and increase cellular uptake (see Reddy, Ann. Pharmacother., 34(7-8):915-923 (2000)). Active agents can also be loaded into particles prepared from pharmaceutically acceptable ingredients, including but not limited to soluble, insoluble, permeable, impermeable, biodegradable, or gastric-retention polymers or liposomes. Such particles include, but are not limited to, nanoparticles, biodegradable nanoparticles, microparticles, biodegradable microparticles, nanospheres, biodegradable nanospheres, microspheres, biodegradable microspheres, capsules, emulsions, liposomes, micelles, and viral vector systems.

[0181] The carrier may also be a polymer, such as a biodegradable, biocompatible polymer matrix. In one embodiment, the therapeutic agent may be encapsulated in a polymer matrix while maintaining the structural integrity of the agent. The polymer may be natural (e.g., peptides, proteins, or polysaccharides) or synthetic (e.g., polyalphahydroxy acids). Examples include carriers made from, for example, collagen, fibronectin, elastin, cellulose acetate, cellulose nitrate, polysaccharides, fibroin, gelatin, and combinations thereof. In one embodiment, the polymer is polylactic acid (PLA) or polylactic acid / glycolic acid (PGLA). The polymer matrix may be prepared and isolated in various forms and sizes, including microspheres and nanospheres. Polymer formulations can result in prolonged duration of therapeutic effect. (See Reddy, Ann. Pharmacother., 34(7-8):915-923(2000)). Polymer formulations for human growth hormone (hGH) have been used in clinical trials. (See Kozarich and Rich, Chemical Biology, 2:548-552(1998)).

[0182] Examples of sustained-release formulations of polymer microspheres are described in PCT Publication WO 99 / 15154 (Tracy et al.), U.S. Patents 5,674,534 and 5,716,644 (both patents by Zale et al.), PCT Publication WO 96 / 40073 (Zale et al.), and PCT Publication WO 00 / 38651 (Shah et al.). U.S. Patents 5,674,534 and 5,716,644 and PCT Publication WO 96 / 40073 describe polymer matrices containing erythropoietin particles that are stable against salt aggregation.

[0183] In some embodiments, the therapeutic compound is prepared using a carrier that protects the therapeutic compound from rapid clearance from the body, such as controlled-release formulations, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydride, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Such formulations can be prepared using known techniques. The materials can also be commercially available, for example, from Alza Corporation and Nova Pharmaceuticals, Inc. Liposome suspensions (including liposomes targeting specific cells with monoclonal antibodies against cell-specific antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, such as those described in U.S. Patent No. 4,522,811.

[0184] The therapeutic compounds can also be formulated to enhance intracellular delivery. For example, liposome delivery systems are known in the art; see, for example, Chonn and Cullis, “Recent Advances in Liposome Drug Delivery Systems,” Current Opinion in Biotechnology 6:698-708 (1995); Weiner, “Liposomes for Protein Delivery: Selecting Manufacture and Development Processes,” Immunomethods, 4(3):201-9 (1994); and Gregoriadis, “Engineering Liposomes for Drug Delivery: Progress and Problems,” Trends Biotechnol., 13(12):527-37 (1995). Mizguchi et al., Cancer Lett., 100:63-69 (1996) describe the use of fusion-promoting liposomes to deliver proteins to cells in vivo and in vitro.

[0185] The dosage, toxicity, and therapeutic efficacy of any therapeutic agent can be determined in cell cultures or laboratory animals using standard pharmaceutical procedures, such as those used to determine the LD50 (the dose that is lethal to 50% of the population) and ED50 (the dose that is therapeutically effective in 50% of the population). The dose ratio between toxicity and therapeutic effect is the therapeutic index, and it can be expressed as the ratio LD50 / ED50. Compounds exhibiting a high therapeutic index are advantageous. Although compounds exhibiting toxic side effects can be used, delivery systems should be carefully designed to target such compounds to the site of tissue involvement to minimize potential damage to uninfected cells, thereby reducing side effects.

[0186] Data obtained from cell culture assays and animal studies can be used to formulate a range of doses for human use. Doses of such compounds can be formulated within a range of circulating concentrations, including the ED50, with little or no toxicity. Doses may vary within this range depending on the dosage form used and the route of administration employed. For any compound used in the described method, the therapeutically effective dose can initially be estimated from cell culture assays. Doses can be formulated in animal models to achieve a range of circulating plasma concentrations, including the IC50 (i.e., the half-maximal inhibitory concentration at which the test compound achieves symptom relief) as determined in cell cultures. This information can be used to accurately determine the useful dose for humans. Plasma levels can be measured, for example, by high-performance liquid chromatography.

[0187] Typically, an effective amount of one or more TXNRD1 inhibitors disclosed herein sufficient to achieve a therapeutic or preventative effect ranges from about 0.000001 mg / kg body weight per day to about 10,000 mg / kg body weight per day. Suitably, the dosage range is from about 0.0001 mg / kg body weight / day to about 100 mg / kg body weight / day. For example, the dosage may be 1 mg / kg body weight or 10 mg / kg body weight per day, every two or three days, or in the range of 1-10 mg / kg per week, every two or three weeks. In one embodiment, a single dose of the therapeutic compound is in the range of 0.001-10,000 micrograms per kg body weight. In one embodiment, the concentration of one or more TXNRD1 inhibitors in the carrier is in the range of 0.2 to 2000 micrograms per milliliter delivered. Exemplary treatment regimens require administration once daily or once weekly. In therapeutic applications, sometimes relatively high doses at relatively short intervals are required until disease progression is reduced or terminated, or until the subject shows partial or complete improvement in disease symptoms. Thereafter, a prophylactic regimen may be administered to the patient.

[0188] In some implementations, a therapeutically effective amount of one or more TXNRD1 inhibitors can be defined as 10 at the target tissue. -32 Up to 10 -6 Moore (e.g., about 10) -7 The inhibitor concentration is (in moles). This concentration can be delivered via a systemic dose of 0.001 to 100 mg / kg or an equivalent dose based on body surface area. The dosing schedule will be optimized to maintain the therapeutic concentration at the target tissue, for example by single daily or weekly administration, but also includes continuous administration (e.g., parenteral infusion or transdermal administration).

[0189] Those skilled in the art will understand that certain factors may influence the dosage and timing required for effective treatment of a subject, including but not limited to, the severity of the disease or disorder, prior treatment, the subject's overall health and / or age, and any other pre-existing conditions. Furthermore, treatment of a subject with a therapeutically effective amount of the therapeutic composition described herein may comprise a single treatment or a series of treatments.

[0190] The mammals treated according to the method of the present invention can be any mammal, including, for example, farm animals such as sheep, pigs, cattle, and horses; pet animals such as dogs and cats; and laboratory animals such as rats, mice, and rabbits. In some embodiments, the mammal is a human.

[0191] Combination therapy

[0192] In some implementations, one or more TXNRD1 inhibitors disclosed herein may be combined with one or more additional therapies for the prevention or treatment of RAS-mutant cancers or pancreatic cancer. These additional therapeutic agents include, but are not limited to, those mentioned above. (Audin-bound paclitaxel) (Gemcitabine), 5-FU (fluorouracil) (Irinotecan liposome injection), surgery, radiation, or a combination thereof.

[0193] In some embodiments, one or more TXNRD1 inhibitors disclosed herein may be administered alone, sequentially, or simultaneously with at least one additional therapeutic agent selected from the following: immunotherapeutic agents, alkylating agents, topoisomerase inhibitors, endoplasmic reticulum stress inducers, antimetabolites, mitotic inhibitors, nitrogen mustard, nitrosourea, alkyl sulfonates, platinum agents, taxanes, vinca extract, antiestrogens, aromatase inhibitors, ovarian inhibitors, VEGF / VEGFR inhibitors, EGF / EGFR inhibitors, RAS inhibitors, PARP inhibitors, cell growth-inhibiting alkaloids, cytotoxic antibiotics, antimetabolites, endocrine / hormonal agents, bisphosphonate therapeutic agents, phenformin, and targeted biological therapeutic agents (e.g., therapeutic peptides described in US 6306832, WO 2012007137, WO 2005000889, WO 2010096603). In some embodiments, the at least one additional therapeutic agent is a chemotherapeutic agent.

[0194] Specific chemotherapy agents include, but are not limited to, cyclophosphamide, fluorouracil (or 5-fluorouracil or 5-FU), methotrexate, edaraxa (10-ethyl-10-deazo-aminopterin), thiotepa, carboplatin, cisplatin, taxane, paclitaxel, protein-bound paclitaxel, docetaxel, vinorelbine, tamoxifen, raloxifene, toremifene, fulvestrant, gemcitabine, irinotecan, ixaprone, temozolomide, topotecan, vincristine, vinblastine, elebulin, mutant mycotoxin, capecitabine, and anastrozole. Exemestane, letrozole, leuprorelin, abaricicliz, busherin, goserelin, megestrol acetate, risedronate, pamidronate, ibandronate, alendronate, denosumab, zoledronic acid, trastuzumab, talexanthelin, anthracyclines (e.g., doxorubicin and doxorubicin), cladribine, midotutolin, bevacizumab, oxaliplatin, melphalan, etoposide, nitrogen mustard, bleomycin, microtubule toxins, anechoic acid lactone, chlorambucil, ifosfamide, streptozotocin, carmustine, lomustine, and buprofen. Aminocarbazine, temozolomide, hexamethylmelamine, 6-mercaptopurine (6-MP), cytarabine, fluorouracil, fludarabine, hydroxyurea, pemetrexed, epirubicin, demethoxydaunorubicin, SN-38, ARC, NPC, camptothecin, 9-nitrocamptothecin, 9-aminocamptothecin, rubifen, gematotecan, diflutecan, BN80927, DX-8951f, MAG-CPT, aminoacridine, etoposide phosphate, teniposide, zazacytidine (Vidaza), decitabine, Gibberellin III, 10-deacetylated paclitaxel, 7-xylosyl-10-deacetylated paclitaxel, cephalotaxine, 10-deacetylated-7-epitaxel, 7-epitaxel, 10-deacetylated gibberellin III, 10-deacetylated cephalotaxine, streptozotocin, nimustine, ramustine, bendamustine, uramustine, estrustine, mannosulfan, camptothecin, eczetidine, letopecan, spirotinic acid D9-aminocamptothecin, acridine, roserine, gold tricarboxylic acid, HU-331 or combinations thereof.

[0195] Examples of antimetabolites include 5-fluorouracil (5-FU), 6-mercaptopurine (6-MP), capecitabine, cytarabine, fluorouridine, fludarabine, gemcitabine, hydroxyurea, methotrexate, pemetrexed, and mixtures thereof.

[0196] Examples of taxanes include berry gibberellin III, 10-deacetylated paclitaxel, 7-xylosyl-10-deacetylated paclitaxel, cephalotaxine, 10-deacetylated-7-epitaxel, 7-epitaxel, 10-deacetylated berry gibberellin III, 10-deacetylated cephalotaxine, and mixtures thereof.

[0197] Examples of DNA alkylating agents include cyclophosphamide, chlorambucil, melphalan, bendamustine, uramustine, estradiol, carmustine, lomustine, nimustine, ramustine, streptozotocin, busulfan, mannosulfan, and mixtures thereof.

[0198] Examples of topoisomerase I inhibitors include SN-38, ARC, NPC, camptothecin, topotecan, 9-nitrocamptothecin, eczetidine, letopotecan, spirotin D9-aminocamptothecin, rubifen, gemmatocan, diflutecan, BN80927, DX-8951f, MAG-CPT, and mixtures thereof. Examples of topoisomerase II inhibitors include acridine, etoposide, etoposide phosphate, teniposide, donomycin, mitoxantrone, acridine, roserine, ginsenoside tricarboxylic acid, doxorubicin, and HU-331, and combinations thereof.

[0199] Examples of immunotherapeutic agents include immune checkpoint inhibitors (e.g., antibodies targeting CTLA-4, PD-1, PD-L1), ipilimumab, 90Y-Titan-Krituzumab, pembrolizumab, nivolumab, trastuzumab, cetuximab, ganituzumab, densizumab, cetuximab, nimotuzumab, dalotuzumab, ciproxetine-T, CRS-207, and GVAX.

[0200] Examples of RAS inhibitors include AMG 510, MRTX849, ARS-3248, BI 1701963, ARS-1620, ARS-853, thiol-reactive GDP analogs, BBP-454, mRNA-5671, KRAS G12D inhibitors, etc.

[0201] In any case, multiple therapeutic agents can be administered in any order or even simultaneously. If administered simultaneously, multiple therapeutic agents can be provided in a single, uniform form or in multiple forms (by way of example only, as a single pill or as two separate pills). One of the therapeutic agents can be administered in multiple doses, or both can be administered in multiple doses. If not administered simultaneously, the time between multiple doses may vary from more than zero weeks to less than four weeks. Furthermore, the methods of combination, compositions, and formulations described are not limited to using only two agents.

[0202] Reagent test kit

[0203] This disclosure also provides kits for the prevention and / or treatment of RAS mutant cancers (e.g., RAS mutant pancreatic cancer), comprising one or more TXNRD1 inhibitors. Optionally, the above-described components of the kits of the present invention are packaged in suitable containers and labeled for the prevention and / or treatment of RAS mutant cancers (e.g., RAS mutant pancreatic cancer).

[0204] The components described above can be stored as aqueous solutions (preferably sterile solutions) or as lyophilized (preferably sterile) formulations for reconstitution in single-unit or multi-dose containers (e.g., sealed ampoules, vials, bottles, syringes, and test tubes). The kit may also include a second container containing a diluent suitable for diluting the pharmaceutical composition to a larger volume. Suitable diluents include, but are not limited to, pharmaceutically acceptable excipients of the pharmaceutical composition and saline solutions. Furthermore, the kit may include instructions for diluting the pharmaceutical composition and / or instructions for administering the diluted or undiluted pharmaceutical composition. The containers may be made of various materials (e.g., glass or plastic) and may have a sterile inlet (e.g., the container may be an intravenous solution bag or a vial with a stopper that can be punctured by a hypodermic needle). The kit may also include further containers containing pharmaceutically acceptable buffers, such as phosphate-buffered saline, Ringer's solution, and dextran solution. The kit may also include other materials desirable from a commercial and user perspective, including additional buffers, diluents, filters, needles, syringes, and culture media for one or more suitable hosts. The kit may optionally include instructions for use typically included in the commercial packaging of a therapeutic or diagnostic product, which contain information such as indications, usage, dosage, manufacturing, administration, contraindications, and / or warnings regarding the use of such a therapeutic or diagnostic product.

[0205] The kit may also contain, for example, buffers, preservatives, or stabilizers. The kit may also contain a control sample or a series of control samples that can be measured and compared with the test sample. Each component of the kit may be packaged in a separate container, and all the different containers may be placed in a single package along with instructions for interpreting the results of measurements performed using the kit. The kit may contain a written description on or within the kit container. The written description explains how to use the reagents included in the kit. In some embodiments, the reagents may be used according to the methods of this technology.

[0206] Example

[0207] The following examples further illustrate the present technology and should not be construed as limiting it in any way. The examples provided herein are intended to illustrate the advantages of the present invention and to further assist those skilled in the art in preparing or using the compositions and systems of the present invention. The examples should in no way be construed as limiting the scope of the present invention as defined by the appended claims. The examples may include or incorporate any variations, aspects, or embodiments of the present invention described above. The variations, aspects, or embodiments described above may further each include or incorporate any and all other variations, aspects, or embodiments of the present invention. The following examples demonstrate the preparation, characterization, and use of illustrative compositions of the present invention that inhibit TXNRD1 expression and / or activity.

[0208] Example 1: Experimental Materials and Methods

[0209] Preprocessing of scRNA-seq counting data. The UMI counting matrix from the raw HGNC alignment generated via 10× sequencing was preprocessed and transformed before analysis in the downstream analysis pipeline. Low-abundance genes (e.g., average count <0.25) and genes with reads in <10% of cells, as well as cells with non-zero reads in <10% of all genes, were removed from the counting matrix. To adjust for differences in sequencing depth between individual cells, the counting matrix was normalized in some cases and transformed before subsequent analysis. Normalization methods included, but were not limited to: 1) globally transforming cell-level counts to match the median depth across all cells (scalar adjustment) and 2) solving a linear system to obtain a unique transformation factor for each individual cell. In some cases, inter-batch effects were corrected via a mutual nearest neighbor algorithm.

[0210] Supervised dimensionality reduction. To computationally identify therapeutic targets, high-dimensional counting data is mapped to a low-dimensional latent space. The latent space is constructed via supervised dimensionality reduction over a collection of pure cell types (e.g., pancreatic adenocarcinoma, ductal cells, and acinar cells), where cell types act as supervisory markers for dimensionality reduction. In this way, the latent space maximizes the separability between cancer cells and primary cells. In some cases, cells targeted with essential genes (e.g., PCNA or MCM6 via RNAi or CRISPR) are also included in the construction of the latent space to define “toxic” regions. Toxicity manifests, for example, as apoptosis induced by gene knockdown in primary cells. Based on model training, cells queried by CRISPR target candidates are mapped to the same latent space constructed from pure cell types to quantify their transcriptional shift toward a wild-type expression profile (therapeutic index).

[0211] Several algorithms have been used for supervised dimensionality reduction. In some cases, the elbow method (Richards et al., J Shoulder Elbow Surg 8(4):351-354(1999)) is used to determine the optimal dimension of the latent space.

[0212] Therapeutic index scoring. The ability (therapeutic index) of target genes queried via the merged CRISPRi library to revert the transcriptional profile of cancer cells back to a wild-type-like expression state is quantified. Genes are scored via machine learning algorithms. In short, separate single-class machine learning algorithms are trained based on the potential expression profiles of different cell types, including but not limited to: 1) pancreatic ductal cells; 2) pancreatic acinar cells; 3) pancreatic adenocarcinoma; and 4) pancreatic adenocarcinoma targeted (via CRISPR / RNAi) with essential genes as toxicity models (e.g., PCNA or MCM6). Each trained machine learning model is then used to score candidate genes based on the output of a decision function applied to the potential expression profile of a single cell targeted with the CRISPRi library. In some cases, cells are repeatedly sampled with replacement to construct bootstrap confidence intervals for the estimates of the decision function.

[0213] Two-dimensional pooled negative selection RNAi screening was performed. A custom shRNA library (2245 shRNAs, five to six per gene) focused on 442 drug target genes was designed and constructed as previously described (Huang et al., Genes Dev. 28(16):1800–1814(2014)). The library was cloned into the TRMPV-Neo vector and transduced into Tet-On mouse pancreatic ductal adenocarcinoma (mPDAC) cells (Kras). G12D In Myc; shp53). Lito et al., Cancer Cell 25(5):697-710 (2014). The conditions for library transduction were primarily to result in the integration of a single retrovirus and the presentation of each shRNA in a calculated number of at least 1000 cells. Transduced cells were selected using 1 mg / mL G418 (Invitrogen) for 5 days. At each passage, >20 million cells were maintained to preserve library presentation throughout the experiment. After drug selection, T0 samples (20 million cells per repeat experiment) were obtained and targeted to Venus + Cells were sorted. After 12 days (six passages, T12), 20 million shRNA expression (dsRed) cells were sorted for each replicate using FACSAriaII (BD Biosciences). + Venus +Cells. Genomic DNA was isolated from T0 and T12 samples by two rounds of phenol extraction using PhaseLock tubes (5 Prime), followed by isopropanol precipitation.

[0214] Then the results obtained from filtering from mPDAC will be compared with those from Myc; p53 - / - Results obtained from mouse hepatocellular carcinoma (mHCC) were compared (Huang et al., Genes Dev. 28(16):1800–1814(2014)), and a two-dimensional RNAi screening map was constructed. See, for example, Figure 3A.

[0215] Plasmids. For conditional RNAi experiments, shRNA was expressed using the TRMPV-Neo vector derived from the previously described miR-E or miR-30 backbone (Zuber et al., Nat Biotechnol. 29(1):79-83 (2011); Fellmann et al., Cell Rep 5(6):1704-1713 (2013)). Knockdown efficiency or overexpression was evaluated by Western blotting.

[0216] Immunoblotting. Cell pellets were lysed in Laemmli buffer (100 mM Tris-HCl (pH 6.8), 5% glycerol, 2% SDS, 5% 2-mercaptoethanol). Equal volumes of protein were dissolved on a 12% SDS-polyacrylamide gel and transferred to a PVDF membrane, incubated at 90 V for 120 min. β-actin abundance was monitored to ensure equal loading. Images were analyzed using AlphaView software (ProteinSimple). Immunoblotting was performed using antibodies against TXNRD1 (TrxR1) (1:1000, sc-28321, Santa Cruz Biotechnology), KRAS (1:200, WH0003845M1, Sigma-Aldrich), or β-actin-HRP (1:10000, A3854, Sigma).

[0217] Proliferation assays. Competitive proliferation assays were performed using shRNA in the TRMPV-Neo vector (with a miR-30 or miR-E backbone) as previously described (Huang et al., Genes Dev. 28(16):1800-1814(2014)). In vitro growth inhibition by auronorphene or piracetam was determined after incubation of cells for 72 h in the presence of progressively increasing concentrations of auronorphene or piracetam by counting viable cells using a CellTiter-Glo luminescent cell viability assay (Promega). The proliferation rate was calculated by dividing the number of viable cells at 72 h by the number of viable cells at 0 h. The relative proliferation rate was calculated by normalizing the proliferation rate for cells treated with the medium.

[0218] Animal research. All experimental procedures described in this study were approved by the Institutional Animal Care and Use Committee (IACUC) of Kettering Cancer Center (New York) under protocol numbers 11-06-016 and 11-06-018. Mice were maintained under specific pathogen-free conditions and provided with unlimited food and water.

[0219] In vivo conditional RNAi experiments. Tet-On mouse PDAC cells were transduced using luciferase-hygro and TRMPV-Neo-miR-E shRNA constructs. One million mouse PDAC cells were orthotopically transplanted into female naked recipient mice (NCR nu / nu, purchased from Charles River Laboratories and Harlan Laboratories). For whole-body bioluminescence imaging, mice were injected intraperitoneally with 50 mg / kg D-luciferin (Goldbio) and analyzed using the IVIS Spectrum system (CaliperLifeSciences) after 10 min. Quantification was performed using Living Image software (CaliperLifesciences) with a target-normalized circular region covering the mouse tail, trunk, and limbs. For shRNA induction, animals were treated with doxycycline in drinking water (2 mg / ml with 2% sucrose; Sigma-Aldrich) and food (625 mg / kg, Harlan Laboratories).

[0220] In vivo drug treatment experiments. For the aurinofen treatment experiment, 16 mg of aurinofen was first dissolved in 4 mL of ethanol, and then diluted with 12 mL of PBS to a final concentration of 1 mg / mL. Mice were administered aurinofen (10 mg / kg) or a similar volume of the medium daily via intraperitoneal injection. Sick animals were euthanized, and pancreatic tissue and tumors were used for further analysis.

[0221] RNA sequencing and gene set enrichment analysis (GSEA) were performed. For RNA sequencing, total RNA was isolated from mPDAC cells containing shRNA targeting the control Renalis luciferase or TXNRD1 using the RNeasy Mini Kit, QIAshredder Columns, and RNase-Free DNase Set (Qiagen). RNA-Seq libraries were constructed and sequenced according to the protocol used by the MSKCC Integrated Genome Run (IGO) core. 5-10 million reads were obtained from each replicate sample. After trimmomatic (Bolger et al., 2014) removal of adaptor sequences, RNA-seq reads were aligned to GRCh37.75 (hg19) using the STAR alignment tool (Dobin et al., 2013). Whole-genome transcript counting was performed using HTSeq to generate the FPKM matrix (Anders et al., 2015 Bioinformatics). Gene set enrichment analysis was performed using GSEA v2.07 software (Subramanian et al., 2005).

[0222] Statistical analysis. Unless otherwise specified, data are presented as mean ± standard deviation. Statistical significance between groups was calculated using a two-tailed Student's t-test. Correlation was calculated using a Pearson test. IC50 was calculated using Prism 7 software. 50 Significance values ​​are P<0.05 (*), P<0.01 (**), and P<0.001 (***). Volcano plots are created in some cases.

[0223] Gene dependence analysis. Data for genome-wide sgRNA screening of human cancer cell lines used in all heatmaps were obtained from http: / / genomecrispr.dkfz.de / . Gene dependence scores for each gene in each experiment were calculated using Log2FC (fold change in abundance obtained using logarithmic transformation). Gene dependence scores were calculated by averaging the Log2FC values ​​for all sgRNAs targeting the same gene. Unsupervised clustering using the Pheatmap R package was used to cluster genes with similar phenotypes for visualization.

[0224] Determining the fold change in sensitivity to aurinol and quantifying drug synergistic effects. CompuSyn software (version 1.0) (http: / / www.combosyn.com) is used based on the intermediate-effect principle and employs the combination index-equivalence line theorem to analyze drug synergistic effects. Combination index (CI) values: CI > 1 indicates antagonistic effect; CI = 0.75-1.25 indicates additive effect; and < 1 indicates synergistic effect. Each GI (growth inhibition) or CI score represents data from at least three independent experiments.

[0225] Pharmacokinetics of auronoflavone. Plasma and pancreatic pharmacokinetics of auronoflavone were analyzed in nine NCR nu / nu mice following a single intraperitoneal injection of a 10 mg / kg auronoflavone suspension. Plasma and pancreatic samples were obtained at 2, 4, and 24 hours after auronoflavone administration to determine gold concentrations. The collected plasma and pancreatic samples were analyzed using inductively coupled plasma mass spectrometry (ICPMS) to quantify gold concentrations.

[0226] Example 2: Computational discovery and validation of novel targets in Kras mutant pancreatic cancer

[0227] Figures 1A-1B illustrate a pipeline for computationally discovering therapeutic targets in RAS mutant pancreatic cancer. As shown in Figure 1A, Kras mutant pancreatic cancer cell lines were screened using a CRISPRi library transduced with low multiple of infection (MOI). Transcriptomes of individual cells were isolated and converted into DNA libraries using a 10X Genomics instrument and an enzyme kit, and sequenced using a HiSeq 4000 system (Illumina). Single-cell RNA sequencing (scRNA-seq) profiles of individual cells were sequenced via paired ends and barcoded to their respective CRISPR targets. Raw reads in FASTQ format were aligned to the whole genome and mapped to the appropriate genomic coordinates for each gene and the HGNC gene, resulting in a counting matrix of N cells × M genes (see Figure 1A). This N×M matrix was further reduced to an N×50 matrix via supervised dimensionality reduction (see Figure 1A). This dimensionality reduction model was trained to identify pure cell types (e.g., cancer cells, ductal cells, acinar cells, or cancer cells expressing non-targeted guide RNA, which act as negative controls), allowing the lower-dimensional potential space to maximize the separation of healthy cells from cancer cells (see Figures 1A-2A). Using this algorithm to identify cells expressing CRISPR targets, which maximally differentiates mRNA expression patterns from negative controls and tends towards healthy cells (ductal cells or acinar cells), and which constitute the most promising targets sought in preclinical development, demonstrates this approach.

[0228] As shown in Figures 1A-1B, machine learning algorithms were used to quantify the therapeutic index. In short, individual machine learning models were trained to identify different cell populations, including: 1) pancreatic ductal cells (positive control for the therapeutic index); 2) pancreatic acinar cells (positive control for the therapeutic index); 3) Kras mutant PDAC cells expressing non-target guide RNA (negative control for the therapeutic index); and 4) Kras mutant PDAC cells expressing the targeted essential gene (positive control for the toxicity target). As shown in Figures 1A-1B, the trained machine learning models were then applied to RNA-seq data from Kras mutant PDAC cells expressing the CRISPRi target to detect cells exhibiting RNA-seq profiles similar to pancreatic acinar cells and distinct from Kras mutant PDAC cells (negative control representing the therapeutic index). The identity of the CRISPRi target expressed by these cells was identified based on paired-end sequencing and barcoding. Targets with the highest therapeutic index were selected for preclinical development.

[0229] Example 3: Calculation and identification of TXNRD1 as a therapeutic target in KRAS mutant pancreatic cancer

[0230] As shown in Figure 1B, the scRNA-seq profiles of individual Kras mutant PDAC cells expressing the CRISPRi target were analyzed using a decision function derived from a machine learning algorithm trained as described above on two non-target guide RNAs, a toxic target, and a healthy ductal cell line. The output of the decision function was further transformed using various methods, including but not limited to: effect size, KS statistics, z-scores, or p-values ​​relative to the control population. Scores across multiple machine learning algorithms and replicate experiments were further aggregated using various methods, including but not limited to: mean, weighted mean, ranked aggregation, weighted ranked aggregation, Stouffer method (z-score), and Fischer method (p-value).

[0231] As shown in Figure 2A, TXNRD1 was identified as a CRISPRi target that transforms Kras mutant PDAC cells to exhibit an RNA-seq profile similar to that of pancreatic acinar cells. After supervised dimensionality reduction using a machine learning algorithm, the distribution of cell type populations along a single dimension was analyzed and plotted. As shown in Figure 2A, Kras mutant PDAC cells (N=87) expressing the guide RNA targeting TXNRD1 showed migration toward healthy ductal cells (N=600). In contrast, Kras mutant PDAC cells (N=122) expressing the null CRISPRi target (non-targeted guide RNA) largely overlapped with the cancer cell profile. As shown in Figure 2B, the treatment index for TXNRD1's z-transformation, averaged across four decision functions of the machine learning algorithm, was the highest among the top 20 candidate targets. Similarly, as shown in Figure 2C, TXNRD1 exhibited the highest weighted average decision function score for treatment index among a set of over fifty candidate targets.

[0232] Example 4: Identification of TXNRD1 as a therapeutic target using a 2D RNAi screening method

[0233] To selectively identify drug targets essential for maintaining PDAC in the KRAS mutant, a genetically defined mouse HCC model (KRAS) was used. G12D A custom library of short hairpin RNAs (shRNAs) targeting known drug targets was screened for negative selection in Myc; p53. The results were cross-analyzed with existing negative selection results in a mouse HCC model (Myc; p53). - / - (Huang et al., Genes Dev. 28(16):1800–1814(2014)). As shown in Figure 3A, compared with the negative control shRNA which remained unchanged in both cell lines, shRNA targeting Txnrd1, Accp, and Amt was selectively depleted in Kras mutant PDAC cells. In contrast, the positive control shRNA was depleted in mouse HCC and mouse HCC (see Figure 3A).

[0234] To detect the depletion of cells expressing specific siRNAs in mPDAC, mHCC, and iMEF, these cells were transduced with viruses carrying inducible shRNAs targeting Txnrd1, Accp, and Amt, as well as controls: Ren.713 (a non-targeting shRNA serving as a negative control), Rpa3.561 (a positive control for growth inhibition in all proliferating cells), and Kras.247 (a positive control for mPDAC-specific growth inhibition). The percentage of cells expressing these shRNAs was determined on days 0 and 12 of shRNA induction. A decrease in the percentage of cells expressing shRNAs indicated the inhibitory effect of the shRNAs. As shown in Figure 3B, the non-targeting negative control (targeting Renal luciferase) Ren.713 had no effect in any cells, and the positive control shRNA Rpa3.561 was depleted in all cell types tested. In mPDAC, the mPDAC-specific positive control Kras.247 was depleted compared to mHCC and iMEF. As shown in Figure 3B, compared with the negative control, shRNAs targeting Txnrd1, Accp, and Amt showed efficacy in Kras mutant PDAC cells (Kras). G12D Inhibitory effect in Myc p53 cells, but in mHCC cells (Myc p53 cells) - / - No inhibitory effect was observed in either 1,000 or untransformed immortalized mouse embryonic fibroblasts (iMEF). The effect of Txnrd1 shRNA was more significant than that of shRNAs targeting Acpp or Amt. The Western blot shown in Figure 3B indicates that the shRNAs reduced the amount of the proteins they targeted. Therefore, this assay also identifies Txnrd1 as a promising target. Given that RAS functionally enhanced mutations (e.g., at codons 12, 13, or 61) occur in regions that share 100% amino acid sequence identity among KRAS, NRAS, and HRAS isotypes (see Prior et al., Cancer Research 72(10)(2012)), inhibition of TXNRD1 is expected to treat cancers associated with KRAS, NRAS, and HRAS mutations.

[0235] TXNRD1 dependence was further investigated in various cell lines. As shown in Figures 6A-6B, knockout or knockdown of the replication genes RAP1 or PCNA resulted in general lethality in almost all cell lines. In contrast, some cell lines exhibiting similar dependence on KRAS, HRAS, and NRAS conditionally required TXNRD1.

[0236] These results indicate that the TXNRD1 inhibitor composition of the present invention can be used as a method for treating diseases or conditions characterized by elevated RAS expression levels and / or elevated TXNRD1 expression levels in subjects in need.

[0237] Example 5: KRAS mutant PDAC growth is sensitive to pharmacological inhibition by TXNRD1.

[0238] To evaluate the pharmacological inhibitory effects of small molecule drugs on TXNRD1 in pancreatic cancer, inhibitors of myricetin, cholecystokinin A, protoporphyrin IX, and aurinophene were investigated.

[0239] Aurnofen is an inhibitor of the enzyme activity of TXNRD1 (see Gromer et al., J Biol Chem 273(32):20096-20101). Myricetin, cholecystokinin A, and protoporphyrin IX are also inhibitors of the enzyme activity of TXNRD1. mPDAC cells were treated with the TXNRD1 inhibitor aurnofen or DMSO for 72 h and viability was measured. DMSO treatment served as a negative control resulting in the absence of growth inhibition. The number of viable cells in DMSO-treated cells was set to 1. The viability of aurnofen-treated cells was normalized against the viability of DMSO-treated cells, plotted as a function of aurnofen concentration, and fitted to an exponential growth curve. Myricetin, cholecystokinin A, and protoporphyrin IX were treated similarly.

[0240] As shown in Figure 3D, aurinophene inhibits the growth of mPDAC cells at submicromolar concentrations. These results indicate that the TXNRD1 inhibitor composition of the present invention can be used in methods for treating diseases or conditions characterized by RAS mutations, elevated RAS expression levels, and / or elevated TXNRD1 expression levels in subjects of need.

[0241] Example 6: Response of KRAS state prediction to TXNRD1 inhibition

[0242] Since the screening system discussed above and in Figures 1A-3B is driven by mutant Kras, p53 loss, and Myc overexpression, it was investigated whether alterations in any of these genes could affect sensitivity to TXNRD1 inhibition. Twelve pancreatic cancer cell lines were treated with increasing concentrations of auronorfen or DMSO. The cell lines L3.3, Colo357, and BXPC3 used in this experiment contained wild-type KRAS. The cell lines PANC0327, MIAPaCa-2, PANC0213, ASPC1, 8898, CFPAC-1, L3.6pl, PANC1, and SU8686 contained KRAS mutations. As shown in Figure 3E, despite variability among cell lines, KRAS mutant cells were generally more sensitive than wild-type KRAS cells.

[0243] To determine whether the observed difference in sensitivity between wild-type KRAS cells and KRAS mutant cells was statistically significant, the IC50 values ​​of the relative sensitivity of human PDAC cell lines to auronoxine-induced TXNRD1 inhibition were compared. 50 As shown in Figure 4A, a significant correlation was found between the antiproliferative response to TXNRD1 inhibition and KRAS mutation status. In contrast, as shown in Figures 4B-4C, no significant correlation was found between the response to TXNRD1 inhibition and p53 mutation status or MYC mRNA expression. To understand the effect of KRAS mutations (G12C, G12D, G12V) on aurinophene sensitivity, human pancreatic cancer cells with different KRAS mutations (G12C, G12D, G12V) or wild-type cells were treated with another TXNRD1 inhibitor, piperazine. As shown in Figure 4D, KRAS mutant cells were more sensitive to piperazine than wild-type KRAS cells, which further reinforced the above findings.

[0244] To investigate the correlation between KRAS and TXNRD1 expression, the expression of these two genes was quantified in 149 pancreatic cancer tumors from the Cancer Genome Atlas Research Network (TCGA), and the results were plotted as a scatter plot. As shown in Figure 4E, a correlation was observed between TXNRD1 expression and KRAS expression levels (r = 0.36, p < 0.0001).

[0245] To understand the molecular mechanism of TXNRD1 inhibition in PDAC cells, RNA-seq analysis was performed on mPDAC cells with shRNAs targeting either control Renalovich or Txnrd1. As shown in Figures 4F-4G, inhibition of Cdk9 led to a reversal of both KRAS-dependent (Figure 4F) and pancreatic cancer markers (Figure 4G), further validating the finding that TXNRD1 is required for KRAS-induced oncogenic signaling. Interestingly, as shown in Figure 4H, TXNRD1 inhibition revealed downregulation of gene markers associated with amino acid transporters and ferroptosis, including a gene called SLC7A11.

[0246] These results indicate that the TXNRD1 inhibitor composition of the present invention can be used as a method for treating diseases or conditions characterized by elevated RAS expression levels and / or elevated TXNRD1 expression levels in subjects in need.

[0247] Example 7: TXNRD1 is required to maintain KRAS mutant pancreatic tumors.

[0248] The correlation between TXNRD1 and in vivo PDAC progression was also investigated. To inhibit Txnrd1 in established pancreatic tumors, mPDAC cells were transduced with a luciferase containing Txnrd1 shRNA or control shRNAs (Hydnocarbazin and Kras) and a doxycycline-inducible TRMPV-Neo-miR-E construct, and then transplanted into the pancreas of recipient mice via orthotopic injection (see Figure 5A). Upon detection of a luminescent signal, the animals were treated with doxycycline or not to induce the expression of the corresponding shRNAs. As shown in Figure 5C, bioluminescent imaging revealed large pancreatic tumors in mice from the untreated group (without doxycycline) by day 7. In contrast, knockdown of Txnrd1 or Kras resulted in a comparable delay in tumor growth. Therefore, RNAi-mediated inhibition of Txnrd1 approximates the effect of Kras inhibition on inducing in vivo antitumor activity in Kras mutant PDACs. Tumor weight was quantified from animals (n=4–5) treated with or without doxycycline to induce the corresponding shRNA. As shown in Figure 5B, tumor weight from untreated mice (without doxycycline) showed larger pancreatic tumors compared to mice with Txnrd1 or Kras knockdown, which resulted in a comparable delay in tumor growth. Tumor weight expressing Ren.713E was not affected by doxycycline treatment (compare two replicates in the Ren.713 column of Figure 5B). Doxycycline treatment comparatively suppressed tumor weight expressing Txnrd1 and KRAS shRNA (compare two replicates between and within each group in the Txnrd1.2057E, Txnrd1.1474E, and KRas.247 columns of Figure 5B).

[0249] These results demonstrate that the TXNRD1 inhibitor compositions of the present invention (such as agents that inhibit TXNRD1 expression) can be used as a method for treating RAS mutant cancers in subjects in need.

[0250] The growth-inhibiting effect of pharmacological TXNRD1 inhibition was also examined in the following additional mouse PDAC model, which was constructed by using KRas G12D p53 - / -Pancreatic cancer organoids were generated by transplantation into the pancreas of recipient mice. Mice were treated with the vector alone as a negative control, or with auronorfen. As shown in Figure 5D, consistent with in vivo RNAi results (Figures 5A-5C), treatment with the TXNRD1 inhibitor auronorfen (10 mg / kg, once daily for 5 days a week) induced a delay in the growth of Kras mutant tumors. Furthermore, as shown in Figure 5E, pharmacological growth inhibition of TXNRD1 was observed in a human xenograft model generated from KRAS mutant PDAC cells (MIAPaCa-2:KRAS mutant), but not in KRAS wild-type cells (Colo357:KRAS wild-type). Therefore, TXNRD1 is required in vivo to maintain and depend on KRAS mutant tumors. Figure 10 shows the delivery of auronorfen into the pancreas.

[0251] Figure 9 shows that patients with pancreatic adenocarcinoma (PDAC) exhibiting upregulated TXNRD1 mRNA showed reduced overall survival compared to PDAC patients expressing low levels of TXNRD1.

[0252] Figures 7A-7D illustrate the antiproliferative effect of the TXNRD1 inhibitor aurinol in KRAS mutant pancreatic cancer cells and its potential synergistic inhibitory effect when combined with gemcitabine. Figures 8A-8D illustrate the antiproliferative effect of the TXNRD1 inhibitor aurinol in KRAS mutant pancreatic cancer cells and its potential synergistic inhibitory effect when combined with gemcitabine. G12C Potential synergistic inhibitory effects when combined with the inhibitor AMG 510.

[0253] These results demonstrate that the TXNRD1 inhibitor composition of the present invention can be used as a method for treating RAS mutant cancers in subjects in need.

[0254] equivalent

[0255] The present invention is not limited to the specific embodiments described herein, which are intended as a single illustration of a particular aspect of the invention. As will be apparent to those skilled in the art, many modifications and alterations can be made to the invention without departing from its spirit and scope. It will be clear to those skilled in the art, based on the foregoing description, that functionally equivalent methods and apparatuses exist within the scope of the invention, in addition to those listed herein. Such modifications and alterations are intended to fall within the scope of the invention. It should be understood that the present invention is not limited to specific methods, reagents, compounds, compositions, or biological systems, which can, of course, be modified. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be restrictive.

[0256] Furthermore, where features or aspects of this disclosure are described in accordance with the Markush group, those skilled in the art will recognize that this disclosure is therefore also described in accordance with any individual member or subgroup of the Markush group.

[0257] Those skilled in the art will understand that, for any and all purposes, particularly for the purpose of providing a written description, all scopes disclosed herein also encompass any and all possible subscopes and combinations thereof. Any listed scope can be readily identified as adequately describing the same scope and such that the same scope can be decomposed into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each scope discussed herein can be readily decomposed into a lower third, a middle third, and an upper third, etc. Similarly, as those skilled in the art will understand, all expressions such as “up to,” “at least,” “greater than,” “less than,” etc., include the stated number and relate to a scope that can subsequently be decomposed into subscopes as described above. Finally, as those skilled in the art will understand, a scope includes each individual member. Thus, for example, a group having 1-3 cells means a group having 1, 2, or 3 cells. Similarly, a group having 1-5 cells means a group having 1, 2, 3, 4, or 5 cells, and so on.

[0258] All patents, patent applications, provisional applications and publications mentioned or cited herein are incorporated in their entirety by reference, including all figures and tables, to such an extent that they do not contradict the express teachings of this specification.

Claims

1. Use of a therapeutically effective amount of a TXNRD1 inhibitor and gemcitabine in the preparation of a medicament for treating KRAS-mutant cancers in subjects of need, wherein the TXNRD1 inhibitor is aurinolone, and wherein the KRAS-mutant cancer comprises a mutation selected from G12C and G12R, wherein the KRAS-mutant cancer is pancreatic cancer.

2. Therapeutic effective doses of TXNRD1 inhibitors and KRAS G12C Use of an inhibitor in the preparation of a medicament for treating KRAS-mutant cancers in subjects of need, wherein the TXNRD1 inhibitor is aurinolone, and wherein the KRAS-mutant cancer comprises a mutation selected from G12C and G12R, wherein the KRAS-mutant cancer is pancreatic cancer, and wherein the KRAS... G12C The inhibitor is AMG 510.

3. The use according to claim 1 or 2, wherein the subject exhibits elevated expression levels of RAS protein in cancer cells prior to treatment.

4. The use according to claim 1 or 2, wherein the subject exhibits one or more signs or symptoms selected from: upper abdominal pain radiating to the back, loss of appetite or unintentional weight loss, depression, new-onset diabetes, blood clots, fatigue, yellowing of the skin and whites of the eyes, flatulence, nausea, and vomiting.

5. The use according to claim 1 or 2, wherein the subject has one or more point mutations in TP53, CDKN2A, SMAD4, MLL3, TGFBR2, ARID1A, SF3B1, EPC1, ARID2, ATM, ZIM2, MAP2K4, NALCN, SLC16A4, MAGEA6, ROBO2, KDM6A, PREX2, ERBB2, MET, FGFR1, CDK6, PIK3R3, PIK3CA, BRCA1, BRCA2, or PALB2.

6. The use according to claim 1 or 2, wherein the subject is a human.

7. The use according to claim 1 or 2, wherein the TXNRD1 inhibitor is administered orally, intranasally, systemically, intravenously, subcutaneously, intraperitoneally, intradermally, intraocularly, by iontophoresis, transmucosal or intramuscular administration.

8. The use according to claim 1 or 2, wherein the TXNRD1 inhibitor is applied topically.

9. Use in the preparation of a medicament for treating KRAS-mutant cancer in a subject in need of a therapeutically effective amount of auronorfen, gemcitabine, and one or more other therapeutic agents, wherein the KRAS-mutant cancer comprises a mutation selected from G12C and G12R, and wherein the KRAS-mutant cancer is pancreatic cancer.

10. Therapeutic doses of auronorgestrel and KRAS G12C Use of inhibitors and one or more additional therapeutic agents in the preparation of a medicament for treating KRAS-mutant cancers in subjects of need, wherein the KRAS-mutant cancer comprises a mutation selected from G12C and G12R, wherein the KRAS-mutant cancer is pancreatic cancer, and wherein the KRAS... G12C The inhibitor is AMG 510.

11. The use according to any one of claims 9-10, wherein the one or more additional therapeutic agents are selected from paclitaxel, 5-FU (fluorouracil), and irinotecan.

Images