A method for improving enzyme thermal stability and catalytic activity by cavity engineering technology

Abstract

The present invention discloses a method for improving the thermal stability and catalytic activity of an enzyme by cavity engineering technology, and belongs to the fields of bioinformatics, computational chemistry, bioengineering, biophysics and protein engineering. The present invention first simulates the movement of protein by molecular dynamics (MD), selects representative conformations by cluster analysis, and then analyzes the simulation trajectory by AQUA‑DUCT and screens out the key cavities inside the protein, and then screens out the amino acid residues near the key internal cavities while excluding the amino acid residues within a certain range of the binding active site, and then combines the multi-scale free energy calculation software to perform saturation mutation on the above residue sites with energy as an indicator, and obtains potential positive mutants after screening. The positive mutation rate obtained by the method of the present invention is as high as 90%, and the thermal stability and catalytic activity of the enzyme are enhanced, which has a very high application potential.

Description

Technical Field

[0001] The invention belongs to the fields of bioinformatics, computational chemistry, bioengineering, biophysics and protein engineering, and specifically relates to a method for improving enzyme thermal stability and catalytic activity by cavity-mediated engineering technology. Background Art

[0002] Enzyme usually refers to a protein or RNA with high specificity and catalytic effect produced by living cells, which is easily affected by many external environmental factors such as temperature and pH. According to the different types of catalytic reactions, enzymes can be divided into six categories: oxidoreductase, transferase, hydrolase, lyase, isomerase and ligase. Due to their good catalytic function, enzymes have been widely used in industrial fields such as food, medicine, oil production and processing, and cosmetics.

[0003] However, in actual industrial production, due to the harsh and complex industrial conditions, enzymes often undergo structural changes under various external disturbances such as temperature, pressure and solution, thereby affecting their stability and catalytic activity. Therefore, enhancing the stability and activity of enzymes is a necessary path in industrial production. However, in the process of enzyme evolution, it is often accompanied by a compromise between thermal stability and catalytic activity, which ultimately leads to the improvement of both, which can only be chosen one. For example, Shi et al. mutated the 189th aspartic acid residue in the lid region of NTU 03 lipase, which resulted in an increase in the enzyme activity, but a decrease in thermal stability (Shih TW, Pan TM. Substitution of Asp189 residue alters the activity and thermostability of Geobacillus sp. NTU 03 lipase [J]. Biotechnology Letters, 2011, 33 (9): 1841-1846.). However, there are also a few reports on the improvement of enzyme stability and catalytic activity at the same time. For example, Wong et al. modified the D-amino acid oxidase from Trigonopsis variabilis by homology modeling and molecular docking, and improved the thermal stability and activity of the mutant Phe54Tr (Kamal MZ, Ahmad S, Molugu TR, et al. In vitro evolved non-aggregating and thermostable lipase: structural and thermodynamic investigation [J]. J Mol Biol, 2011, 413 (3): 726-741.). Although some studies have disclosed methods for improving stability and activity at the same time, there has been no systematic study of the mechanism, which is relatively blind. Therefore, it is necessary to develop a general method for improving enzyme properties.

[0004] For natural proteins with tightly arranged amino acids, their unique atomic stacking has an important influence on the function, stability, activity and selectivity of the protein. Researchers call it "cavity". It can usually be divided into three categories according to its function: interdomain cavity, intradomain cavity, and intersubunit cavity. Among them, the intradomain cavity has been widely regarded as the biggest contributor to the thermal stability and catalytic activity of natural proteins. Its size and spatial arrangement have a huge impact on the stability and catalytic activity of the protein. Therefore, it is crucial to screen the key cavities in the protein that play an important role in stability and catalytic activity. Regarding the use of cavities to improve the stability and catalytic activity of enzymes, the main approach is to create cavities or reduce the volume of cavities by mutating amino acid residues, and there is no systematic screening for cavities.

[0005] Molecular dynamics (MD) simulation refers to a computational method based on Newtonian classical mechanics to simulate the motion trajectory of all atoms in a protein system. It increases our understanding of conformational changes in protein regulatory elements such as gates and rings. It improves our understanding of the role of solvents in protein folding and stability, in shaping enzyme activity and selectivity, or in drug design. At present, the application method of molecular dynamics simulation is mainly to simulate and analyze the motion trajectory of proteins and small molecules under constant temperature and pressure conditions.

[0006] AQUA-DUCT is an open source Python software designed to analyze biomacromolecules from the perspective of intramolecular voids using small ligands as molecular probes, taking into account not only the temporal evolution of tunnel and cavity geometry over time, but also the physicochemical properties of specific amino acids arranged inside the macromolecule. It is currently mainly used to analyze the structure of the entire protein interior (such as cavities and tunnels), as well as the functions of tunnels and cavities in the internal structure.

[0007] Rosetta is a comprehensive set of software for simulating macromolecular structures. As a flexible and multi-purpose application, it includes tools for structural prediction, design, and reconstruction of proteins and nucleic acids. It uses Cartesian space coordinates to search for the side chain conformation with the lowest energy, and combines the experimental thermodynamic data of small molecules with the statistical functions of the high-resolution structural data of macromolecules for saturation mutation (H. Park, P. Bradley, P. Greisen, Y. Liu, VK Mulligan, DE Kim, D. Baker, F. Dimaio, Simultaneous Optimization of Biomolecular Energy Functionson Features from Small Molecules and Macromolecules. Journal of Chemical Theory & Computation, 6201 (2016).). It is currently commonly used in the development of vaccines, new materials, targeted protein binders, and enzyme design.

[0008] The FoldX Suit can already realize advanced protein design functions. It is experience-oriented and performs saturation mutation without changing the amino acid structure around the mutation site (J. Schymkowitz, J. Borg, F. Stricher, R. Nys, F. Rousseau, L. Serrano, The FoldX web server: an online force field. Nucleic Acids Res 33, W382-388 (2005)). It is currently commonly used in protein design and stability prediction. Summary of the invention

[0009] The purpose of the present invention is to provide a method for improving the thermal stability and catalytic activity of enzymes by cavity engineering technology, aiming to solve the problems of low thermal stability and low catalytic activity of enzymes in industrial production. The method of the present invention is highly operable, achieves a high positive rate with less workload, has certain versatility and also has high industrial application potential.

[0010] In order to achieve the above-mentioned invention object, the present invention provides an evolutionary method for improving the thermal stability and catalytic activity of enzymes by cavity engineering technology. First, the molecular dynamics simulation of the enzyme protein structure to be evolved is performed, and then the AQUD-DUCT program is used to analyze the internal cavity / tunnel change process. The internal key cavity is calculated and screened out in combination with the McVol program, and the amino acid residues that contribute more than 30% to the internal key cavity are counted, and the active site is excluded. The residue sites within the range are avoided to have a significant impact on the activity; the remaining amino acid sites are predicted by FoldX5.0 and Rosetta to screen out potential mutants with high stability and catalytic activity. Specifically, the method of the present invention comprises the following steps:

[0011] (1) Molecular dynamics simulations were performed on the enzyme protein. Each protein was simulated 5 times at a random initial speed, and each time lasted 30 ns.

[0012] (2) Screening the key cavities inside the enzyme protein. Specifically, cluster analysis is performed on all parallel molecular dynamics simulation trajectories based on the root mean square deviation (RMSD) matrix and representative conformations (i.e., the average conformation of the protein conformation) are selected to improve the accuracy of the prediction. Then, the McVol program is used to calculate the internal cavities of all representative conformations, and cavities with a frequency of occurrence higher than 80% are counted and screened as the key internal cavities. Such cavities play an important role in the stability and functionality of the protein.

[0013] (3) Virtual screening of potential mutants of enzyme proteins. Specifically, firstly, the amino acid residues with the top 80 B-factor rankings in the representative conformations selected in step (2) are counted. Then, combined with the internal key cavities screened in step (2), the amino acid residues with a frequency of occurrence higher than 30% near each internal key cavity under different parallel conditions are counted. Meanwhile, the active site residues are excluded. The residue sites within the range were kept away from the influence of mutation on catalytic activity as much as possible, and then virtual saturation mutation was performed using Rosetta and FoldX5.0 to construct a mutant library, and the potential mutants with ΔΔG < 0 were screened out;

[0014] (4) In vitro directed evolution experiment and characterization of enzyme properties. Specifically, potential mutants screened by the above method are selected, and the amino acids at the target sites are mutated using site-directed mutagenesis experimental technology. The transformation, sequencing verification, induced expression, separation and purification, enzyme property determination and T m Finally, mutants with significantly improved robustness were identified.

[0015] Furthermore, the molecular dynamics simulation performed in step (1) of the present invention comprises the following specific steps: performing molecular dynamics simulation using Gromacs (a molecular dynamics program package for studying biological molecular systems); selecting the AMBER99 force field during the simulation, creating a cubic box and placing the protein in the center of the box (the protein is at least 1.0 nm away from the edge of the box), adding solvent using a water model (the water model uses TIP4P), and then neutralizing the charge to allow the entire system to reach equilibrium; minimizing the energy of the entire system using the steepest descent method to ensure that the structure is normal, the interatomic distance is appropriate, and the geometric configuration is reasonable; then, performing a 400 ps position-restricted pre-equilibrium (NVT, NPT) under periodic boundary conditions, and heating the system temperature to 313 K using Berendsen temperature coupling; finally, performing a finished product simulation, integrating the entire simulation process using the Leap-frog algorithm, calculating the long-range electrostatic potential energy using the Particle-Mesh Ewald (PME) method, and executing five times with a random initial velocity for a simulation time of 30 ns.

[0016] Furthermore, the cluster analysis in step (2) of the present invention is performed using the Gromacs built-in tool gmx_cluster. The gromos algorithm is selected for cluster analysis, and the test is performed to adjust the cutoff and the minimum value of the root mean square deviation (rmsd) to ensure that the clustering result is 3-5 categories, and the most representative conformation (the average conformation under each cluster) is selected.

[0017] Furthermore, when the McVol program is used to calculate the internal cavities of all representative conformations in step (2) of the present invention, the probe radius is set to The minimum volume of the cavity is not less than (less than The cavity is discarded), and the volume of the water molecule is set to

[0018] Furthermore, the temperature factor B-factor in step (2) of the present invention is calculated by a B-fitter program.

[0019] Furthermore, the Rosetta and FoldX virtual saturation mutation process in step (3) of the present invention is as follows:

[0020] FoldX (http: / / foldxsuite.crg.eu / ) prediction: Before the enzyme was subjected to virtual saturation mutation, it was first corrected and optimized by Repairpdb and Optimize modules. The number of runs was set to 3 to obtain the average results, and other settings used the default values;

[0021] Rosetta (https: / / www.rosettacommons.org / ) prediction: Before performing Rosetta calculation of ΔΔG, FastRelax is performed on the protein structure to relax the protein structure to a certain extent, ensuring that the atoms in the crystal structure are as close to their original positions as possible. During relaxation, the backbone and side chains of the protein structure are restricted to avoid excessive deflection. The number of relaxations is set to 40. Then, the protein structure with the lowest energy score (the best side chain arrangement of the wild type and the mutant) is selected from the 40 relaxed structures for the next energy calculation, and the mutant with a free energy difference of ΔΔG < 0 is selected.

[0022] The intersection of the FoldX prediction results and the Rosetta prediction results was taken as potential mutants for in vitro directed evolution experiments.

[0023] Step (4) of the present invention, in vitro directed evolution experiment and characterization of enzymatic properties, specifically comprises the following steps:

[0024] ① Design primer sequences for mutating the target site, mutate the base sequence of the target site through PCR, and after sequencing verification, connect the correctly mutated sequence with the expression vector and transfer it into Escherichia coli or yeast for induced expression. If it is an intracellular protein, the supernatant collected by centrifugation after ultrasonic disruption is the crude protein enzyme solution; if it is an extracellular protein, the supernatant collected by direct centrifugation is the crude protein enzyme solution;

[0025] ② Use nickel ion affinity chromatography column or ion exchange chromatography column and AKTA Avant protein purifier to purify the crude enzyme solution;

[0026] ③ Desalting of pure enzyme solution: Use a 10KDa ultrafiltration tube for ultrafiltration. Ultrafilter each sample at least 3 times and dilute the ultrafiltered enzyme solution to a protein concentration of 0.01-0.1 mg ml -1 The melting temperature (T m ), the temperature gradient was set to 30-90°C.

[0027] The present invention also provides an enzyme mutant with improved activity and thermal stability obtained by applying the above method, including:

[0028] (1) Lipase mutants:

[0029] T17V / S23A / T145I, based on SEQ ID NO: 2, the threonine at position 17 is replaced by valine, the serine at position 23 is replaced by alanine, and the threonine at position 145 is replaced by isoleucine; or,

[0030] T17V / S23A / T194L, based on SEQ ID NO: 2, the threonine at position 17 is replaced by valine, the serine at position 23 is replaced by alanine, and the threonine at position 194 is replaced by leucine; or,

[0031] T17V / S23A, based on SEQ ID NO: 2, the threonine at position 17 is replaced by valine and the serine at position 23 is replaced by alanine; or

[0032] T17V / T194L, based on SEQ ID NO: 2, the threonine at position 17 is replaced by valine and the threonine at position 194 is replaced by leucine; or

[0033] S23A / T145I is based on SEQ ID NO: 2, wherein the serine at position 23 is replaced by alanine and the threonine at position 145 is replaced by isoleucine.

[0034] (2) Laccase mutants:

[0035] T102M, based on SEQ ID NO: 4, the threonine at position 102 is replaced by methionine; or

[0036] S258A: Based on SEQ ID NO: 4, the serine at position 258 is replaced by alanine.

[0037] (3) Glutamine transaminase mutants:

[0038] G263M, based on SEQ ID NO: 6, the glycine at position 263 is replaced by methionine; or

[0039] N284F, based on SEQ ID NO: 6, the asparagine at position 284 is replaced by phenylalanine; or

[0040] T308F is based on SEQ ID NO: 6, with the threonine at position 308 replaced by phenylalanine.

[0041] Beneficial Effects

[0042] In vitro experiments have shown that mutants screened using the method of the present invention can simultaneously improve thermal stability and catalytic activity, and the positive mutant rate is high. The method of the present invention has good application prospects.

[0043] The present invention selects representative conformations by clustering analysis of protein simulation trajectories, which can achieve a more systematic and comprehensive analysis of protein conformation fluctuations and improve the accuracy of virtual predictions.

[0044] The present invention screens the internal key cavities of representative conformations of proteins, then uses the internal key cavities as probes and the amino acid residue sites that form these internal key cavities as potential mutation sites to screen potential positive mutants, thereby more accurately locating the amino acids that have a significant impact on the structure and function of the protein, and further improving the positive rate of the screening results.

[0045] Since FoldX is completely empirically driven, after ensuring that residues other than the mutation site will not move, the empirical formula is used to calculate the free energy. However, Rosetta uses Cartesian space coordinates to find the side chain conformation with the lowest energy, combines empirical thermodynamic data and statistical functions of macromolecular structure data to perform saturation mutations, and predicts by explaining the trunk changes of mutants. The present invention takes the intersection of the prediction results of the two to further improve the accuracy of the prediction results. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 Schematic diagram of the screening process of the entire method.

[0047] Figure 2 This is the screening result diagram of amino acid sites near the cavity, and the amino acids are represented by stick models.

[0048] Figure 3 This is the final screening result of the mutants. The mesh represents the cavity, the mutation site is represented by a black label, the active center is represented by a red label, and the dotted line represents the spatial distance between the cavity and the mutation site.

[0049] Figure 4 The calculation results of the 3D structure and internal cavity of laccase.

[0050] Figure 5 The 3D structure of glutamine aminotransferase and the calculation results of the internal cavity. DETAILED DESCRIPTION

[0051] Example 1: Rhizomucor miehei lipase RML

[0052] 1. Screening of key internal cavities and mutation sites

[0053] This example uses the crystal structure of wild-type RML (PDB ID: 3TGL, The initial model was 9000 Å, and molecular dynamics simulations were performed using Gromacs (version 2019.03). The TIP4P water model was used, and then 9 Na + Neutralize the charge to bring the whole system to equilibrium. Use the steepest descent method for 50,000 steps to minimize the energy of the system to ensure that the structure is normal, the distance between atoms is appropriate, and the geometric configuration is reasonable. Then, a 400ps position-restricted pre-equilibrium (NVT, NPT) is performed under periodic boundary conditions. The system temperature is heated to 313K using Berendsen temperature coupling, and Parrinell-Rahman is used for pressure coupling. After the system is balanced, remove the restrictions and perform the finished product simulation. The entire simulation process is integrated using the Leap-frog algorithm, and the long-range electrostatic potential energy is calculated using the PME method. Select Lincs as the constraint algorithm, and the accuracy is set to 1,4. The truncation method of the neighboring search is Verlet, and the search method is grid search (grid). To ensure the repeatability and fairness of the results, the simulation is performed five times with different initial speeds, and the duration is 30ns.

[0054] The representative conformations were selected by cluster analysis using the gmx_cluster program. Then, the simulation trajectory was analyzed using the AQUA-DUCT program and the cavity was calculated using McVol (the minimum volume of the cavity was limited to no less than ), and 6 key internal cavities were screened. 80 amino acid residues (aa) were screened by B-factor sorting, and then 38 aa sites with a contribution rate of more than 30% to the cavity were screened using the cavity as a medium ( Figure 1 ). Exclude active triplet The aa in the range of 19 aa was screened out. Finally, using the complementarity of FoldX and Rosetta algorithms (i.e., taking the intersection of the calculation results of the two), we obtained 6 aa potential mutation sites. The results are shown in Table 1. 8 potential mutants were designed: S20V / T145L, Y16F / S20V, S23A / T145I, T17V / T194L, T17V / S23A, T145I / T194I, T17V / S23A / T145I, T17V / S23A / T194L.

[0055] 2. Construction of mutants and characterization of enzymatic properties

[0056] Lipase (RML) from Rhizomucor miehei was selected as the research object (Genbank: KP164599.1, the base sequence and amino acid sequence of its coding region are shown in the sequence list). RML was expressed in E. coli using the E. coli expression system, the plasmid pET-28a was selected, and the host was E. coli JM109. First, the recombinant plasmid pET-28a-wt was constructed as a template for the subsequent construction of the T1 lipase mutant. BamH I and EcoR I restriction enzyme sites were added to the 5' and 3' ends of the RML lipase gene, respectively, and the designed gene sequence was sent to Jinweizhi Biotechnology Co., Ltd. for synthesis. The synthetic RML lipase full-length gene and pET-28a vector were double-digested with BamHI and EcoR I, respectively. The reaction system was 50 μL: 20 μL RML lipase gene (or pET-28a plasmid); 5 μL 10x Q Buffer; 2 μL BamHI and EcoR I each; 1 μL dd H2O2. Enzyme digestion conditions: 37°C, 2h. After the digestion, the digestion products were verified by nucleic acid gel electrophoresis, and the gel was cut according to the target band size. The double digestion products of the RML gene and pET-28a plasmid were gel-recovered using a DNA gel recovery kit. Use T4 DNA ligase to connect the RML gene and the vector pET-28a. The reaction system is 10 μL: 6 μL of target fragment; 2 μL of pET-28a plasmid; 1 μL of 10x T4 DNA Ligase Buffer; 1 μL of T4 DNA Ligase. Place in a 16°C metal bath overnight for 10-12 hours. After the connection is completed, use a PCR product purification kit to purify the connection product of the target gene and the vector, transfer to E. coli JM109 and culture at 200 r / min for 7 hours, then coat the transformation liquid with LB plates containing kanamycin sulfate (50 μg / mL) and culture for 12-16 hours. Pick a single colony and shake it in LB medium containing kanamycin for 6-8 hours, perform bacterial liquid PCR verification and sequencing verification, and verify the correct recombinant for subsequent experiments.

[0057] Construction of mutant recombinant plasmid. Primers were designed and sent to Jinweizhi Biotechnology Co., Ltd. for synthesis. The results of primer design are shown in Table 1. After the primers were synthesized, the recombinant plasmid pET-28a-RML was used as a template for full plasmid PCR amplification to construct the mutant recombinant plasmid. The PCR reaction system was 50 μL: ddH2O 18 μL; 2x Max Buffer 25 μL; dNTP Mix (10 mM) 1 μL; pET-28a-wt template 1 μL; upstream and downstream primers (10 mM) 2 μL each; Phanta Max Super-FidelityDNA Ploymerase 1 μL. PCR reaction conditions: 95℃ 30s; 95℃ 15s, 68℃ 15s, 72℃ 5min, 30 cycles; 72℃ 5min, stored at 4℃. After the reaction, the PCR product was digested with Dpn I enzyme and transferred into the plasmid amplification strain E. coli JM109. Finally, the correctly sequenced recombinants were expanded and the plasmids were extracted and transferred into the protein expression strain E. coli BL21 (DE3) and stored at -20°C.

[0058] Table 1 Mutant primer sequences

[0059]

[0060]

[0061] Eight RML mutants were cloned, expressed and purified. The crude enzyme solution was purified using a nickel ion affinity chromatography column (1 ml / 5 ml HisTrap FF) and an AKTA Avant protein purifier. The purification steps are as follows: (1) Flushing the system pipelines: Since the system pipelines are stored in 20% ethanol, ultrapure water should be used to flush the pipelines and pumps. (2) Equilibration of the column: Equilibrate the column with ultrapure water (10 column volumes), and then equilibrate the column with a binding buffer with a final imidazole concentration of 20 mM (10 column volumes). (3) Loading: Use an injection pump to automatically inject the crude enzyme solution at a rate of 1 mL min -1 (or 5ml min -1 ) flow rate. (4) Elution: first rinse 10 column volumes with a buffer solution with a final imidazole concentration of 20mM to remove some impurities, then rinse 30 column volumes with an eluent with a final imidazole concentration of 500mM, collect the eluted product under the target peak type and mark it. (5) Column regeneration: Due to the loss of nickel ions during the purification process, after multiple purifications, the nickel column is regenerated with a pre-prepared regeneration solution to facilitate the next use. (6) The purified and collected enzyme solution is subjected to SDS-PAGE verification, and the enzymatic properties are measured after successful verification.

[0062] The enzyme activity was detected using p-nitrophenyl palmitate (p-npp) as a substrate. The enzyme activity assay system was 3 mL and the assay steps were as follows: first, 1.8 mL of 50 mol·L -1 Mix Tris-HCl buffer solution with 100 μL substrate and react at 45℃ for 10 min. Add 100 μL purified enzyme solution (diluted to appropriate concentration) to the sample tube, add 100 μL inactivated enzyme solution to the control tube, mix well and start timing immediately, react at 45℃ for 10 min. Immediately after the reaction, add 500 μL 10% trichloroacetic acid to terminate the reaction. Add 500 μL 10% Na2CO3 solution for color development, and measure the absorbance at 405 nm.

[0063] Lipase activity calculation formula:

[0064]

[0065] A—enzyme activity of sample (U·mL -1 )

[0066] A1—sample absorbance OD value

[0067] A0—blank absorbance OD value

[0068] k—slope of the p-nitrophenol standard curve

[0069] C0—Intercept of the standard curve of p-nitrophenol

[0070] N—dilution multiple

[0071] V1—Volume of reaction solution (mL)

[0072] V2—Volume of enzyme solution (mL)

[0073] T—reaction time (min)

[0074] Definition of lipase activity unit: Under fixed temperature and pH conditions, the amount of enzyme required to hydrolyze substrate to release 1 μmol of free fatty acid per minute is defined as one enzyme activity unit (U). In the present invention, 1U refers to the amount of enzyme required for wild-type and mutant T1 lipase to hydrolyze p-nitrophenyl palmitate to produce 1 μmol of free p-nitrophenyl per minute at 45°C and pH 8.0.

[0075] Table 2 shows that the specific activities of mutants S20V / T145L, S23A / T145I, T17V / T194L, T17V / S23A, T145I / T194I, T17V / S23A / T145I, and T17V / S23A / T194L were increased by 2.86, 5.56, 4.51, 3.73, 4.95, 5.5, and 9.95 times, respectively, compared with the wild type. Among them, the T of S23A / T145I, T17V / T194L, T17V / S23A, T145I / T194I, T17V / S23A / T145I, and T17V / S23A / T194L were increased by 2.86, 5.56, 4.51, 3.73, 4.95, 5.5, and 9.95 times, respectively. m The values ​​increased by 8.89℃, 8.9℃, 10.47℃, 0.7℃, 11.98℃, and 11.01℃, respectively. The comprehensive positive rate was as high as 75%. At the same time, the results of kinetic parameters showed that the catalytic efficiency of S23A / T145I, T17V / T194L, T17V / S23A, T145I / T194I, T17V / S23A / T145I, and T17V / S23A / T194L increased by 99%, 92%, 113%, 140%, 81%, and 386%, respectively.

[0076] Table 2 Specific enzyme activity, melting temperature, half-life and kinetic parameters of mutants

[0077]

[0078] Example 2: Bacillus subtilis laccase (BSL)

[0079] In order to prove the universality of this method, according to the classification of enzymes, laccase, which is widely used in industry, was selected. It belongs to the category of oxidoreductase (RML belongs to hydrolase) and is widely used in food. For example, it can improve the texture, appearance and taste of bread after baking; remove some unfavorable phenolic compounds in the processing of beer, liquor, apple juice and grape juice, maintain their flavor and reduce their discoloration and deterioration rate.

[0080] 1 Screening of key internal cavities and mutation sites

[0081] This example uses the crystal structure of wild-type laccase (PDB ID: 1W8R, The initial model was 1.34 × 10-thousandths (0.66 × 10-thousandths) and molecular dynamics simulations were performed using Gromacs (version 2019.03). The TIP4P water model was used and Na + / Cl -1Neutralize the charge to bring the entire system to equilibrium. Use the steepest descent method for 50,000 steps to minimize the energy of the system to ensure that the structure is normal, the distance between atoms is appropriate, and the geometric configuration is reasonable. Then perform a 400ps position-restricted pre-equilibrium (NVT, NPT), use Berendsen temperature coupling to heat the system temperature to 313K, and use Parrinell-Rahman to adjust the pressure. After the system is balanced, remove the restrictions and perform the finished product simulation. The entire simulation process is integrated using the Leap-frog algorithm, and the long-range electrostatic potential energy is calculated using the PME method. Select Lincs as the constraint algorithm, and the accuracy is set to 1,4. The cutoff method for the neighboring search is Verlet, and the search method is grid search (grid). To ensure the repeatability and fairness of the results, the simulation is performed five times with different initial speeds, and the duration is 30ns.

[0082] Cluster analysis selects representative conformations of different parallels. Then, protein trajectories are analyzed by AQUC-DUCT and cavity calculations are performed using McVol (the minimum volume of the cavity is limited to no less than range), and screened out 8 key internal cavities ( Figure 4 ). The amino acid residues with cavity contribution greater than 30% were selected by sorting the B-factor values ​​from large to small, combined with the key cavity. 25 amino acid residues were further selected by constraining the active triplet. Finally, six potential mutants, T102V, T102M, S258A, T340L, T102F, and G271M, were identified by using the complementarity of FoldX and Rosetta algorithms.

[0083] 2 Construction of mutants

[0084] Laccase (BSL) from Bacillus subtili was selected as the research object (Genbank: CP053102.1). BSL was expressed in E. coli expression system, plasmid pET-28a was selected, and the host was E. coli JM109 and E. coli BL21 (DE3). First, the recombinant plasmid pET-28a-wt was constructed as a template for the subsequent construction of laccase mutants. BamH I and EcoR I restriction enzyme sites were added to the 5' and 3' ends of the laccase gene, respectively, and the designed gene sequence was sent to Jinweizhi Biotechnology Co., Ltd. for synthesis. The synthesized laccase full-length gene and pET-28a vector were double-digested with BamH I and EcoR I, respectively. The reaction system was 50μL: laccase gene (or pET-28a plasmid) 20μL; 10x Q Buffer 5μL; BamH I and EcoR I 2μL each; dd H2O 21μL. Enzyme digestion conditions: 37℃, 2h. After the digestion, the digestion products were verified by nucleic acid gel electrophoresis, and the gel was cut according to the size of the target band. The double digestion products of the BSL gene and pET-28a plasmid were recovered by gel recovery using a DNA gel recovery kit. The BSL gene and the vector pET-28a were connected using T4 DNA ligase. The reaction system was 10μL: 6μL of the target fragment; 2μL of pET-28a plasmid; 1μL of 10x T4 DNA Ligase Buffer; 1μL of T4 DNA Ligase, placed in a 16℃ metal bath overnight for 10-12h. After the connection was completed, the ligation product of the target gene and the vector was purified using a PCR product purification kit, transferred to E.coli JM109 and cultured at 200r / min for 7h, and then the transformation solution was coated on an LB plate containing kanamycin sulfate (50μg / mL) and cultured for 12-16h. Pick a single colony and shake culture it in LB medium containing kanamycin for 6-8h, perform bacterial liquid PCR verification and sequencing verification, and verify the correct recombinant for subsequent experiments. Construction of mutant recombinant plasmid. Design primers and send them to Jinweizhi Biotechnology Co., Ltd. for synthesis. The primer design results are shown in Table 3. After the primer synthesis is completed, the recombinant plasmid pET-28a-wt is used as a template for full plasmid PCR amplification to construct the mutant recombinant plasmid. The PCR reaction system is 50μL: ddH2O 18μL; 2x Max Buffer 25μL; dNTP Mix (10mM) 1μL; pET-28a-wt template 1μL; upstream and downstream primers (10mM) 2μL each; Phanta Max Super-Fidelity DNA Ploymerase 1μL. PCR reaction conditions: 95°C for 30 s; 95°C for 15 s, 68°C for 15 s, 72°C for 5 min, 30 cycles; 72°C for 5 min, and stored at 4°C.After the reaction, the PCR product was digested with Dpn I enzyme and transferred into the plasmid amplification strain E. coli JM109. Finally, the correctly sequenced recombinants were expanded and the plasmids were extracted and transferred into the protein expression strain E. coli BL21 (DE3) and stored at -20°C.

[0085] Table 3 Mutant primer sequences

[0086]

[0087] 3. Protein induction expression, purification and enzyme property determination

[0088] Protein induction expression conditions: 20℃, 200r·min -1 , 2mM CuSO4, IPTG final concentration 0.5mM, induce for 12-16h. After induction, centrifuge and collect the crude enzyme solution. The vector pET-28a used in this experiment has a His tag, so the crude enzyme solution was purified by nickel ion affinity chromatography. Before purification, the crude enzyme solution was heated at 4°C, 12000r min -1 Centrifuge for 10 minutes, and then filter the supernatant with a 0.22μM water filter to further remove impurities. The six BSL mutants were cloned, expressed and purified, and the crude enzyme solution was purified using a nickel ion affinity chromatography column (1ml / 5ml His Trap FF) and an AKTA Avant protein purifier. The purification steps are as follows: (1) Flushing the system pipes: Since the system pipes are all stored in 20% ethanol, ultrapure water should be used to flush the pipes and pumps. (2) Equilibrate the column: Equilibrate the column with ultrapure water (10 column volumes), and then equilibrate the column with a binding buffer with a final imidazole concentration of 20mM (10 column volumes). (3) Loading: Use an injection pump to automatically inject the crude enzyme solution at a rate of 1mL min -1 (or 5ml min -1 ) flow rate. (4) Elution: first rinse 10 column volumes with a buffer solution with a final imidazole concentration of 20mM to remove some impurities, then rinse 30 column volumes with an eluent with a final imidazole concentration of 500mM, collect the eluted product under the target peak type and mark it. (5) Column regeneration: Due to the loss of nickel ions during the purification process, after multiple purifications, the nickel column is regenerated with a pre-prepared regeneration solution to facilitate the next use. (6) The purified and collected enzyme solution is subjected to SDS-PAGE verification, and the enzymatic properties are measured after successful verification.

[0089] The absorbance after the reaction of laccase and substrate was detected by spectrophotometer, and the activity of laccase was calculated. The activity of the enzyme is defined as the amount of enzyme required to oxidize 1 μmol of substrate per minute as 1 enzyme activity unit (U). The total reaction system is 1.5 ml. When 2-Azino bis (3-ethylbenzothiazoline-6-sulfonate) (ABTS) is the substrate, the system contains a final concentration of 1 mM ABTS, purified enzyme solution and phosphate buffer. The OD value is measured at 420 nm after 30°C water bath for 3 minutes. All reactions are repeated 3 times.

[0090] Table 4 shows that the specific activities of mutants T102V, T102M, S258A, T340L, T102F, and G271M are increased by 37%, 170%, 113%, 97%, 10%, and 73% relative to the wild type, respectively. At the same time, the kinetic constants of all mutants are improved, indicating that the catalytic efficiency of laccase is improved. The half-lives of mutants T102V, T102M, S258A, and G271M at 70°C are increased by 11min, 58min, 16min, and 14min, respectively, indicating that the thermal stability is significantly improved.

[0091] Table 4 Enzyme activity and T of wild type and mutants 1 / 2 And the kinetic parameters

[0092]

[0093] Example 3: Microbial transglutaminase (MTG)

[0094] Similarly, in order to prove the universality of this method, according to the classification of enzymes, we also selected glutamine aminotransferase from microorganisms with strong industrial applications. It belongs to the transferase category and is known as the super adhesive of the 21st century. It is widely used in food. For example, it is most widely used in meat products, which can bind minced meat into blocks, improve food texture, and enhance the taste, flavor structure and nutrition of meat products.

[0095] 1 Screening of key internal cavities and mutation sites

[0096] This example uses the crystal structure of wild-type glutamine aminotransferase (PDB ID: 3IU0, The initial model was 1.34 × 10-thousandths (0.66 × 10-thousandths) and molecular dynamics simulations were performed using Gromacs (version 2019.03). The TIP4P water model was used and Na + / Cl -1Neutralize the charge to bring the entire system to equilibrium. Use the steepest descent method for 50,000 steps to minimize the energy of the system to ensure that the structure is normal, the distance between atoms is appropriate, and the geometric configuration is reasonable. Then perform a 400ps position-restricted pre-equilibrium (NVT, NPT), use Berendsen temperature coupling to heat the system temperature to 313K, and use Parrinell-Rahman to adjust the pressure. After the system is balanced, remove the restrictions and perform the finished product simulation. The entire simulation process is integrated using the Leap-frog algorithm, and the long-range electrostatic potential energy is calculated using the PME method. Select Lincs as the constraint algorithm, and the accuracy is set to 1,4. The cutoff method for the neighboring search is Verlet, and the search method is grid search (grid). To ensure the repeatability and fairness of the results, the simulation is performed five times with different initial speeds, and the duration is 30ns.

[0097] Different parallel simulation structures were selected and representative conformations were selected through cluster analysis. Protein trajectories were analyzed using AQUC-DUCT and cavities were calculated using McVol (the minimum volume of the cavity was limited to no less than range), and screened out 7 key internal cavities ( Figure 5 ). The amino acid residues with cavity contribution greater than 30% were sorted by B-factor value. 36 amino acid residues were further screened by constraining active triplets. Finally, 7 potential mutants were identified by using the complementarity of FoldX and Rosetta algorithms, namely G264F, G264L, G264M, N285F, T309F, T309L, and T367M.

[0098] 2 Construction of mutants

[0099] Transglutaminase (STG) from Streptomyces mobaraensis was selected as the research object (Genbank: Y18315.1). STG was expressed in E. coli expression system, and the plasmid pET-28c was selected. The hosts were E. coli JM109 and E. coli BL21 (DE3). First, the recombinant plasmid pET-28c-wt was constructed as a template for the subsequent construction of laccase mutants. Xba I and EcoR I restriction enzyme sites were added to the 5' and 3' ends of the laccase gene, respectively, and the designed gene sequence was sent to Jinweizhi Biotechnology Co., Ltd. for synthesis. The synthesized STG full-length gene and pET-28c vector were double-digested with Xba I and EcoR I, respectively. The reaction system was 50μL: STG gene (or pET-28c plasmid) 20μL; 10x QBuffer 5μL; Xba I and EcoR I 2μL each; dd H2O 21μL. Enzyme digestion conditions: 37℃, 2h. After the digestion, the digestion products were verified by nucleic acid gel electrophoresis, and the gel was cut according to the size of the target band. The double digestion products of STG gene and pET-28c plasmid were recovered by gel recovery kit. The STG gene and vector pET-28c were connected with T4 DNA ligase. The reaction system was 10μL: 6μL of target fragment; 2μL of pET-28c plasmid; 1μL of 10x T4 DNA Ligase Buffer; 1μL of T4 DNA Ligase, placed in a 16℃ metal bath overnight for 10-12h. After the connection, the ligation product of the target gene and the vector was purified using a PCR product purification kit, transferred to E.coli JM109 and cultured at 200r / min for 7h, and then the transformation solution was coated with LB plates containing kanamycin sulfate (50μg / mL) and cultured for 12-16h. Pick a single colony and shake culture it in LB medium containing kanamycin for 6-8h, perform bacterial liquid PCR verification and sequencing verification, and verify the correct recombinant for subsequent experiments. Construction of mutant recombinant plasmid. Design primers and send them to Jinweizhi Biotechnology Co., Ltd. for synthesis. The primer design results are shown in Table 4. After the primer synthesis is completed, the recombinant plasmid pET-28c-wt is used as a template for full plasmid PCR amplification to construct the mutant recombinant plasmid. The PCR reaction system is 50μL: ddH2O 18μL; 2x Max Buffer 25μL; dNTP Mix (10mM) 1μL; pET-28c-wt template 1μL; upstream and downstream primers (10mM) 2μL each; Phanta Max Super-Fidelity DNA Ploymerase 1μL.PCR reaction conditions: 95℃ 30s; 95℃ 15s, 68℃ 15s, 72℃ 5min, 30 cycles; 72℃ 5min, stored at 4℃. After the reaction, the PCR product was digested with Dpn I enzyme, and the digestion product was transferred into the plasmid amplification strain E.coli JM109. Finally, the correctly sequenced recombinant was expanded and the plasmid was extracted, and then transferred into the protein expression strain E.coli BL21 (DE3) and stored at -20℃.

[0100] Table 5 Mutant primer sequences

[0101]

[0102] 3. Protein induction expression, purification and enzyme property determination

[0103] Protein induction expression conditions: 20℃, 200r·min -1 , IPTG final concentration 0.5mM, induction 12-16h. After induction, centrifuge and collect the crude enzyme solution. The vector pET-28C used in this experiment has a His tag, so the crude enzyme solution was purified using the nickel ion affinity chromatography principle. Before purification, the crude enzyme solution was heated at 4°C, 12000r min -1 Centrifuge for 10 minutes, and then filter the supernatant with a 0.22μM water filter to further remove impurities. Six BSL mutants were cloned, expressed and purified, and the crude enzyme solution was purified using a nickel ion affinity chromatography column (1ml / 5ml His Trap FF) and an AKTA Avant protein purifier. The purification steps are as follows: (1) Flushing the system pipes: Since the system pipes are all stored in 20% ethanol, ultrapure water should be used to flush the pipes and pumps. (2) Equilibrate the column: Equilibrate the column with ultrapure water (10 column volumes), and then equilibrate the column with a binding buffer with a final imidazole concentration of 20mM (10 column volumes). (3) Loading: Use an injection pump to automatically inject the crude enzyme solution at a rate of 1mLmin -1 (or 5ml min -1 ) flow rate. (4) Elution: first rinse 10 column volumes with a buffer solution with a final imidazole concentration of 20mM to remove some impurities, then rinse 30 column volumes with an eluent with a final imidazole concentration of 500mM, collect the eluted product under the target peak type and mark it. (5) Column regeneration: Due to the loss of nickel ions during the purification process, after multiple purifications, the nickel column is regenerated with a pre-prepared regeneration solution to facilitate the next use. (6) The purified and collected enzyme solution is subjected to SDS-PAGE verification, and the enzymatic properties are measured after successful verification.

[0104] The absorbance (600nm) after the reaction of STG and substrate was detected by spectrophotometer to calculate the activity of STG. The enzyme activity unit (U) is defined as the amount of enzyme that catalyzes the substrate to generate 1μmol L-glutamic acid-γ-monohydroxamic acid per minute at 37°C. The specific enzyme activity (U / mg) is defined as the unit of enzyme activity per milligram of protein. The enzyme activity of the sample was determined as follows: 200μL of this appropriately diluted enzyme solution was mixed with 500μL of substrate reagent, and 200μL of 10% trichloroacetic acid was quickly added after 10min of water bath at 37°C, and the reaction solution was centrifuged at 4000r / min for 5min. The absorbance value of the supernatant was measured at a wavelength of 525nm to calculate the enzyme activity. All reactions were repeated 3 times.

[0105] Table 6 shows that the specific activities of mutants G263L, G263M, N284F, T308F, and T366M were increased by 14%, 125%, 78%, 64%, and 44% respectively compared with the wild type. At the same time, the catalytic constants were increased by 7.84%, 2.57%, 64.71%, 49.02%, and 29.41%, respectively, indicating that the catalytic efficiency of glutamine transaminase was improved. The T of G263L, G263M, N284F, T308F, and T366M 1 / 2 The increases were 22%, 214%, 8%, 72% and 48% respectively, indicating that the thermal stability of these mutants was significantly improved.

[0106] Table 6 Wild type and mutant specific enzyme activities and kinetic parameters

[0107]

[0108] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims. SEQUENCE LISTING <110> Jiangnan University <120> A method for improving enzyme thermal stability and catalytic activity by cavity engineering technology <130> BAA211766A <160> 48 <170> PatentIn version 3.3 <210> 1 <211> 795 <212> DNA <213> Mihei root hair <400> 1 ggtatccgtg ctgctacttc ccaggaaata aatgaactta cctactacac cactctttct 60 gcaaattctt actgtaggac agtcattcca ggtgccactt gggactgtat tcattgcgat 120 gctactgagg atttgaaaat catcaagact tggtctactt tgatctatga tacaaacgcc 180 atggttgcca gaggagattc agaaaaca atttacattg tattccgagg atcttcctct 240 attagaaact ggattgccga cttgacattt gtacctgttt cttatccacc tgtttccgga 300 acgaaggtac acaagggttt cctggattct tacggtgagg tccagaacga attagtcgct 360 actgtcctgg accagtttaa agataccca agttaacaaag tggccgtgac tggtcatagt 420 ttgggtgggg caactgctct tttatgtgct ctggatctat atcaaagaga agaaggccta 480 540 gctaactatg ttgtttccac aggtattccc tacaagaa ctgtgaatga aagggatatt 600 gttccccacc taccaccagc agcctttggt ttccttcatg caggagaga gtattggatt 660 accgacaatt ctcccgaaac tgtgcaagtt tgtacctcag atttggaaac gtctgattgt 720 tctaactcaa tagtcccttt tacttcagtg ttagaccact tgagttattt tggaataaat 780 accgggttgt gcacg 795 <210> 2 <211> 265 <212> PRT <213> Rhizomucor miehei <400> 2 Gly Ile Arg Ala Ala Thr Ser Gln Glu Ile Asn Glu Leu Thr Tyr Tyr 1 5 10 15 Thr Thr Leu Ser Ala Asn Ser Tyr Cys Arg Thr Val Ile Pro Gly Ala 20 25 30 Thr Trp Asp Cys Ile His Cys Asp Ala Thr Glu Asp Leu Lys Ile Ile 35 40 45 Lys Thr Trp Ser Thr Leu Ile Tyr Asp Thr Asn Ala Met Val Ala Arg 50 55 60 Gly Asp Ser Glu Lys Thr Ile Tyr Ile Val Phe Arg Gly Ser Ser Ser 65 70 75 80 Ile Arg Asn Trp Ile Ala Asp Leu Thr Phe Val Pro Val Ser Tyr Pro 85 90 95 Pro Val Ser Gly Thr Lys Val His Lys Gly Phe Leu Asp Ser Tyr Gly 100 105 110 Glu Val Gln Asn Glu Leu Val Ala Thr Val Leu Asp Gln Phe Lys Gln 115 120 125 Tyr Pro Ser Tyr Lys Val Ala Val Thr Gly His Ser Leu Gly Gly Ala 130 135 140 Thr Ala Leu Leu Cys Ala Leu Asp Leu Tyr Gln Arg Glu Glu Gly Leu 145 150 155 160 Ser Ser Ser Asn Leu Phe Leu Tyr Thr Gln Gly Gln Pro Arg Val Gly 165 170 175 Asp Pro Ala Phe Ala Asn Tyr Val Val Ser Thr Gly Ile Pro Tyr Arg 180 185 190 Arg Thr Val Asn Glu Arg Asp Ile Val Pro His Leu Pro Pro Ala Ala 195 200 205 Phe Gly Phe Leu His Ala Gly Glu Glu Tyr Trp Ile Thr Asp Asn Ser 210 215 220 Pro Glu Thr Val Gln Val Cys Thr Ser Asp Leu Glu Thr Ser Asp Cys 225 230 235 240 Ser Asn Ser Ile Val Pro Phe Thr Ser Val Leu Asp His Leu Ser Tyr 245 250 255 Phe Gly Ile Asn Thr Gly Leu Cys Thr 260 265 <210> 3 <211> 1539 <212> DNA <213> Bacillus subtilis <400> 3 atgacacttg aaaaatttgt ggatgctctc ccaatcccag atacactaaa gccagtacag 60 caatcaaaag aaaaaacata ctacgaagtc accatggagg aatgcactca tcagctccat 120 cgcgatctcc ctccaacccg cctgtggggc tacaacggct tatttccggg accgaccatt 180 gaggttaaaa gaaatgaaaa cgtatatgta aaatggatga ataaccttcc ttccacgcat 240 ttccttccga ttgatcacac cattcatcac agtgacagcc agcatgaaga gcccgaggta 300 aagactgttg ttcatttaca cggcggcgtc acgccagatg atagtgacgg gtatccggag 360 gcttggtttt ccaaagactt tgaacaaaca ggaccttatt tcaaaagaga ggtttatcat 420 tatccaaacc agcagcgcgg ggctatattg tggtatcacg atcacgccat ggcgctcacc 480 aggctaaatg tctatgccgg acttgtcggt gcatatatca ttcatgaccc aaaggaaaaa 540 cgcttaaaac tgccttcaga cgaatacgat gtgccgcttc ttatcacaga ccgcacgatc 600 aatgaggatg gttctttgtt ttatccgagc gcaccggaaa acccttctcc gtcactgcct 660 aatccttcaa tcgttccggc tttttgcgga gaaaccatac tcgtcaacgg gaaggtatgg 720 ccatacttgg aagtcgagcc aaggaaatac cgattccgtg tcatcaacgc ctccaataca 780 agaacctata acctgtcact cgataatggc ggagatttta ttcagattgg ttcagatgga 840 gggctcctgc cgcgatctgt taaactgaat tctttcagcc ttgcgcctgc tgaacgttac 900 gatatcatca ttgacttcac agcatatgaa ggagaatcga tcattttggc aaacagcgcg 960 ggctgcggcg gtgacgtcaa tcctgaaaca gatgcgaata tcatgcaatt cagagtcaca 1020 aaaccattgg caaaaaaga cgaaagcaga aagccgaagt acctcgcctc atacccttcg 1080 gtacagcatg aaagaataca aaacatcaga acgttaaaac tggcaggcac ccaggacgaa 1140 tacggcagac ccgtccttct gcttaataac aaacgctggc acgatcccgt cacaaaca 1200 ccaaaagtcg gcacaactga aatatggtcc attatcaacc cgacacgcgg aacacatccg 1260 atccacctgc atctagtctc cttccgtgta ttagaccggc ggccgtttga tatcgccccgt 1320 tatcaagaa gcgggggaatt gtcctatacc ggtccggctg tcccgccgcc gccaagtgaa 1380 aagggctgga aagacaccat tcaagcgcat ccaggtgaag tcctgagaat cgcggcgaca 1440 ttcggtccgt acagcggacg atacgtatgg cattgccata ttctagagca tgaagactat 1500 gacatgatga gaccgatgga tataactgat ccccataaa 1539 <210> 4 <211> 510 <212> PRT <213> Bacillus subtilis <400> 4 Met Thr Leu Glu Lys Phe Val Asp Ala Leu Pro Ile Pro Asp Thr Leu 1 5 10 15 Lys Pro Val Gln Gln Ser Lys Glu Lys Thr Tyr Tyr Glu Val Thr Met 20 25 30 Glu Glu Cys Thr His Gln Leu His Arg Asp Leu Pro Pro Thr Arg Leu 35 40 45 Trp Gly Tyr Asn Gly Leu Phe Pro Gly Pro Thr Ile Glu Val Lys Arg 50 55 60 Asn Glu Asn Val Tyr Val Lys Trp Met Asn Asn Leu Pro Ser Thr His 65 70 75 80 Phe Leu Pro Ile Asp His Thr Ile His His Ser Asp Ser Gln His Glu 85 90 95 Glu Pro Glu Val Lys Thr Val Val His Leu His Gly Gly Val Thr Pro 100 105 110 Asp Asp Ser Asp Gly Tyr Pro Glu Ala Trp Phe Ser Lys Asp Phe Glu 115 120 125 Gln Thr Gly Pro Tyr Phe Lys Arg Glu Val Tyr His Tyr Pro Asn Gln 130 135 140 Gln Arg Gly Ala Ile Leu Trp Tyr His Asp His Ala Met Ala Leu Thr 145 150 155 160 Arg Leu Asn Val Tyr Ala Gly Leu Val Gly Ala Tyr Ile Ile His Asp 165 170 175 Pro Lys Glu Lys Arg Leu Lys Leu Pro Ser Asp Glu Tyr Asp Val Pro 180 185 190 Leu Leu Ile Thr Asp Arg Thr Ile Asn Glu Asp Gly Ser Leu Phe Tyr 195 200 205 Pro Ser Ala Pro Glu Asn Pro Ser Pro Ser Leu Pro Asn Pro Ser Ile 210 215 220 Val Pro Ala Phe Cys Gly Glu Thr Ile Leu Val Asn Gly Lys Val Trp 225 230 235 240 Pro Tyr Leu Glu Val Glu Pro Arg Lys Tyr Arg Phe Arg Val Ile Asn 245 250 255 Ala Ser Asn Thr Arg Thr Tyr Asn Leu Ser Leu Asp Asn Gly Gly Asp 260 265 270 Phe Ile Gln Ile Gly Ser Asp Gly Gly Leu Leu Pro Arg Ser Val Lys 275 280 285 Leu Asn Ser Phe Ser Leu Ala Pro Ala Glu Arg Tyr Asp Ile Ile Ile 290 295 300 Asp Phe Thr Ala Tyr Glu Gly Glu Ser Ile Ile Leu Ala Asn Ser Ala 305 310 315 320 Gly Cys Gly Gly Asp Val Asn Pro Glu Thr Asp Ala Asn Ile Met Gln 325 330 335 Phe Arg Val Thr Lys Pro Leu Ala Gln Lys Asp Glu Ser Arg Lys Pro 340 345 350 Lys Tyr Leu Ala Ser Tyr Pro Ser Val Gln His Glu Arg Ile Gln Asn 355 360 365 Ile Arg Thr Leu Lys Leu Ala Gly Thr Gln Asp Glu Tyr Gly Arg Pro 370 375 380 Val Leu Leu Leu Asn Asn Lys Arg Trp His Asp Pro Val Thr Glu Thr 385 390 395 400 Pro Lys Val Gly Thr Thr Glu Ile Trp Ser Ile Ile Asn Pro Thr Arg 405 410 415 Gly Thr His Pro Ile His Leu His Leu Val Ser Phe Arg Val Leu Asp 420 425 430 Arg Arg Pro Phe Asp Ile Ala Arg Tyr Gln Glu Ser Gly Glu Leu Ser 435 440 445 Tyr Thr Gly Pro Ala Val Pro Pro Pro Pro Ser Glu Lys Gly Trp Lys 450 455 460 Asp Thr Ile Gln Ala His Ala Gly Glu Val Leu Arg Ile Ala Ala Thr 465 470 475 480 Phe Gly Pro Tyr Ser Gly Arg Tyr Val Trp His Cys His Ile Leu Glu 485 490 495 His Glu Asp Tyr Asp Met Met Arg Pro Met Asp Ile Thr Asp 500 505 510 <210> 5 <211> 1131 <212> DNA <213> Streptomyces mobaraensis <400> 5 gacaatggcg cgggggaaga gacgaagtcc tacgccgaaa cctaccgcct cacggcggat 60 gacgtcgcga acatcaacgc gctcaacgaa agcgctccgg ccgcttcgag cgccggcccg 120 tcgttccggg cccccgactc cgacgacagg gtcacccctc ccgccgagcc gctcgacagg 180 atgcccgacc cgtaccgtcc ctcgtacggc agggccgaga cggtcgtcaa caactacata 240 cgcaagtggc agcaggtcta cagccaccgc gacggcagga agcag gaccgaggag cagcgggagt ggctgtccta cggctgcgtc ggtgtcacct gggtcaattc gggtcagtac 360 ccgacgaaca gactggcctt cgcgtccttc gacgaggaca ggttcaagaa cgagctgaag aacggcaggc cccggtccgg cgagacgcgg gcggagttcg agggccgcgt cgcgaaggag 480 agcttcgacg aggagaaggg cttccagcgg gcgcgtgagg tggcgtccgt catgaacagg 540 gccctggaga acgcccacga cgagagcgct tacctcgaca acctcaagaa ggaactggcg aacggcaacg acgccctgcg caacgaggac gcccgttccc cgttctactc ggcgctgcgg 660 aacacgccgt ccttcaagga gcggaacgga ggcaatcacg acccgtccag gatgaaggcc gtcatctact cgaagcactt ctggagcggc caggaccggt cgagttcggc cgacaagagg 780 aagtacggcg acccggacgc cttccgcccc gccccgggca ccggcctggt cgacatgtcg 840 agggacagga acattccgcg cagccccacc agccccggtg agggattcgt caatttcgac tacggctggt tcggcgccca gacggagcg gacgccgaca agaccgtctg gacccacgga 960 aatcactatc acgcgcccaa tggcagcctg ggtgccatgc atgtctacga gagcaagttc 1020 cgcaactggt ccgagggtta ctcggacttc gaccgcggag cctatgtgat caccttcatc 1080 cccaagagct ggacaccgc ccccgacaag gtaaagcagg gctggccgtg a 1131 <210> 6 <211> 376 <212> PRT <213> Streptomyces mobaraensis <400> 6 Asp Asn Gly Ala Gly Glu Glu Thr Lys Ser Tyr Ala Glu Thr Tyr Arg 1 5 10 15 Leu Thr Ala Asp Asp Val Ala Asn Ile Asn Ala Leu Asn Glu Ser Ala 20 25 30 Pro Wing Wing To Be Wing Gly Pro To Be Phe Arg Wing Pro Asp To Be Asp 35 40 45 Asp Arg Val Thr Pro Ala Glu Pro Leu Asp Arg Met Pro Asp Pro 50 55 60 Tyr Arg Pro Use Tyr Gly Ala Glu Thr Val Val Asn Asn Tyr Ile 65 70 75 80 Arg Lys Trp Clean Val Tyr Ser His Arg Asp Gly Arg Lys Clean Gln 85 90 95 Met Thr Glu Glu Gln Arg Glu Trp Leu Ser Tyr Gly Cys Val Gly Val 100 105 110 Thr Trp Val Asn Ser Gly Gln Tyr Pro Thr Asn Arg Leu Ala Phe Ala 115 120 125 Ser Phe Asp Glu Asp Arg Phe Lys Asn Glu Leu Lys Asn Gly Arg Pro 130 135 140 Arg Ser Gly Glu Thr Arg Ala Glu Phe Glu Gly Arg Val Ala Lys Glu 145 150 155 160 Ser Phe Asp Glu Glu Lys Gly Phe Gln Arg Ala Arg Glu Val Ala Ser 165 170 175 Val Met Asn Arg Ala Leu Glu Asn Ala His Asp Glu Ser Ala Tyr Leu 180 185 190 Asp Asn Leu Lys Lys Glu Leu Ala Asn Gly Asn Asp Ala Leu Arg Asn 195 200 205 Glu Asp Ala Arg Ser Pro Phe Tyr Ser Ala Leu Arg Asn Thr Pro Ser 210 215 220 Phe Lys Glu Arg Asn Gly Gly Asn His Asp Pro Ser Arg Met Lys Ala 225 230 235 240 Val Ile Tyr Ser Lys His Phe Trp Ser Gly Gln Asp Arg Ser Ser Ser 245 250 255 Ala Asp Lys Arg Lys Tyr Gly Asp Pro Asp Ala Phe Arg Pro Ala Pro 260 265 270 Gly Thr Gly Leu Val Asp Met Ser Arg Asp Arg Asn Ile Pro Arg Ser 275 280 285 Pro Thr Ser Pro Gly Glu Gly Phe Val Asn Phe Asp Tyr Gly Trp Phe 290 295 300 Gly Ala Gln Thr Glu Ala Asp Ala Asp Lys Thr Val Trp Thr His Gly 305 310 315 320 Asn His Tyr His Ala Pro Asn Gly Ser Leu Gly Ala Met His Val Tyr 325 330 335 Glu Ser Lys Phe Arg Asn Trp Ser Glu Gly Tyr Ser Asp Phe Asp Arg 340 345 350 Gly Ala Tyr Val Ile Thr Phe Ile Pro Lys Ser Trp Asn Thr Ala Pro 355 360 365 Asp Lys Val Lys Gln Gly Trp Pro 370 375 <210> 7 <211> 30 <212> DNA <213> Artificial sequence <400> 7 gaactgacct acttcaccct gtctgcgaac 30 <210> 8 <211> 30 <212> DNA <213> Artificial sequence <400> 8 cagggtgaag taggtcagtt cgttgatttc 30 <210> 9 <211> 33 <212> DNA <213> Artificial sequence <400> 9 ctgacctact atgtgaccct gtctgcgaac agc 33 <210> 10 <211> 33 <212> DNA <213> Artificial sequence <400> 10 agacagggtc acatagtagg tcagttcgtt gat 33 <210> 11 <211> 33 <212> DNA <213> Artificial sequence <400> 11 ctgggtggtg cgatcgctct gctgtgcgcg ctg 33 <210> 12 <211> 33 <212> DNA <213> Artificial sequence <400> 12 cagcagagcg atcgcaccac ccagagagtg gcc 33 <210> 13 <211> 30 <212> DNA <213> Artificial sequence <400> 13 accaccctgg ttgcgaacagctactgccgt 30 <210> 14 <211> 30 <212> DNA <213> Artificial sequence <400> 14 gctgttcgca accagggtgg tatagtaggt 30 <210> 15 <211> 33 <212> DNA <213> Artificial sequence <400> 15 tctgcgaacg catactgccg taccgtgatt ccg 33 <210> 16 <211> 33 <212> DNA <213> Artificial sequence <400> 16 acggcagtat gcgttcgcag acagggtggt ata 33 <210> 17 <211> 30 <212> DNA <213> Artificial sequence <400> 17 ggtggtgcgc tcgctctgct gtgcgcgctg 30 <210> 18 <211> 30 <212> DNA <213> Artificial sequence <400> 18 cagcagagcg agcgcaccac ccagagagtg 30 <210> 19 <211> 30 <212> DNA <213> Artificial sequence <400> 19 taccgtcgta tcgttaacga acgtgatatc 30 <210> 20 <211> 30 <212> DNA <213> Artificial sequence <400> 20 ttcgttaacg atacgacggt acgggatacc 30 <210> twenty one <211> 30 <212> DNA <213> Artificial sequence <400> 21 taccgtcgtc tcgttaacga acgtgatatc 30 <210> 22 <211> 30 <212> DNA <213> Artificial sequence <400> 22 ttcgttaacg agacgacggt acgggatacc 30 <210> 23 <211> 34 <212> DNA <213> Artificial sequence <400> 23 cgaggtaaag gttgttgttc atttacacgg cggc 34 <210> 24 <211> 32 <212> DNA <213> Artificial sequence <400> 24 caacaacctt tacctcgggc tcttcatgct gg 32 <210> 25 <211> 34 <212> DNA <213> Artificial sequence <400> 25 cgaggtaaag atggttgttc atttacacgg cggc 34 <210> 26 <211> 32 <212> DNA <213> Artificial sequence <400> 26 caaccatctt tacctcgggc tcttcatgct gg 32 <210> 27 <211> 38 <212> DNA <213> Artificial sequence <400> 27 caacgccgcc aatacaagaa cctataacct gtcactcg 38 <210> 28 <211> 32 <212> DNA <213> Artificial sequence <400> 28 ttgtattggc ggcgttgatg acacggaatc gg 32 <210> 29 <211> 32 <212> DNA <213> Artificial sequence <400> 29 gtcttaaaac cattggcaca aaaagacgaa ag 32 <210> 30 <211> 38 <212> DNA <213> Artificial sequence <400> 30 gccaatggtt ttaagactct gaattgcatg atattcgc 38 <210> 31 <211> 32 <212> DNA <213> Artificial sequence <400> 31 acaaacttta cctcgggctc ttcatgctgg ct 32 <210> 32 <211> 30 <212> DNA <213> Artificial sequence <400> 32 cagcagagcg agcgcaccac ccagagagtg 30 <210> 33 <211> 41 <212> DNA <213> Artificial sequence <400> 33 ctcgataatg gcatggattt tattcagatt ggttcagatg g 41 <210> 34 <211> 32 <212> DNA <213> Artificial sequence <400> 34 tccatgccat tatcgagtga caggttatag gt 32 <210> 35 <211> 32 <212> DNA <213> Artificial sequence <400> 35 aagtacttcg acccggacgc cttccgcccc gc 32 <210> 36 <211> 32 <212> DNA <213> Artificial sequence <400> 36 tccgggtcga agtacttcct cttgtcggcc ga 32 <210> 37 <211> 32 <212> DNA <213> Artificial sequence <400> 37 agaggaagta cctcgacccg gacgccttcc gc 32 <210> 38 <211> 32 <212> DNA <213> Artificial sequence <400> 38 gtcgaggtac ttcctcttgt cggccgaact cg 32 <210> 39 <211> 32 <212> DNA <213> Artificial sequence <400> 39 aagtacatgg acccggacgc cttccgcccc gc 32 <210> 40 <211> 32 <212> DNA <213> Artificial sequence <400> 40 tccgggtcca tgtacttcct cttgtcggcc ga 32 <210> 41 <211> 32 <212> DNA <213> Artificial sequence <400> 41 agggacaggt tcattccgcg cagccccacc ag 32 <210> 42 <211> 32 <212> DNA <213> Artificial sequence <400> 42 ggaatgaacc tgtccctcga catgtcgacc ag 32 <210> 43 <211> 32 <212> DNA <213> Artificial sequence <400> 43 gcccagttcg aagcggacgc cgacaagacc gt 32 <210> 44 <211> 32 <212> DNA <213> Artificial sequence <400> 44 tccgcttcga actgggcgcc gaaccagccg ta 32 <210> 45 <211> 32 <212> DNA <213> Artificial sequence <400> 45 gcccagttag aagcggacgc cgacaagacc gt 32 <210> 46 <211> 32 <212> DNA <213> Artificial sequence <400> 46 tccgcttcta actgggcgcc gaaccagccg ta 32 <210> 47 <211> 34 <212> DNA <213> Artificial sequence <400> 47 aagagctgga acatggcccc cgacaaggta aagc 34 <210> 48 <211> 32 <212> DNA <213> Artificial sequence <400> 48 gccatgttcc agctcttggg gatgaaggtg at 32

Claims

1. A method for simultaneously evolving enzyme thermal stability and catalytic activity, characterized in that: The following steps are involved: (1) Molecular dynamics simulation of the evolving enzyme protein structure, (2) Analyze the internal cavities of the enzyme protein structure and screen out the key internal cavities, which means that all parallel molecular dynamics simulation trajectories are clustered based on the root mean square deviation matrix and representative conformations are selected. Then, the internal cavities of all representative conformations are calculated using the McVol program, and the cavities with a frequency of occurrence higher than 80% are counted and screened as the key internal cavities. The cluster analysis uses the Gromacs built-in tool gmx_cluster, selects the gromos algorithm for cluster analysis, and performs tests to adjust the cutoff and the minimum value of the root mean square deviation to ensure that the clustering results are 3-5 categories, and select representative conformations. (3) Select amino acid residues with a frequency of more than 30% near each internal key cavity, and exclude residues within 5Å of the active site to minimize the effect of mutation on catalytic activity. Then use Rosetta and FoldX5.0 to perform virtual saturation mutagenesis, construct a mutant library, and screen out potential mutants with ΔΔG < 0; Before using FoldX to perform virtual saturation mutation on the enzyme, it was first corrected and optimized using the Repairpdb and Optimize modules. The number of runs was set to 3 to obtain the average results, and other settings used the default values; Before performing Rosetta calculation of ΔΔG, FastRelax was first performed on the protein structure to relax the protein structure to a certain extent, ensuring that the atoms in the crystal structure were as close to their original positions as possible. During relaxation, the backbone and side chains of the protein structure were restricted to avoid excessive deflection, and the number of relaxations was set to 40. Then, the protein structure with the lowest energy score was selected from the 40 relaxed structures for the next energy calculation, and the mutant with a free energy difference of ΔΔG < 0 was selected. (4) Using site-directed mutagenesis technology, the potential mutation site is mutated into the target amino acid, and the mutated sequence is sequenced for verification. It is then expressed using genetically engineered bacteria and the enzyme properties are tested after separation and purification to screen out mutants with improved thermal stability and catalytic activity.

2. The method for simultaneously evolving enzyme thermal stability and catalytic activity according to claim 1, characterized in that: Step (1) molecular dynamics simulation of the enzyme protein was performed, with each protein being simulated 5 times at a random initial speed, and each time lasting 30 ns.

3. The method for simultaneously evolving enzyme thermal stability and catalytic activity according to claim 1, characterized in that: Step (3) first sorts by temperature factor B-factor, and counts the top 80 amino acid residues with B-factor in the representative conformations selected in step (2). Then, combined with the internal key cavities screened out in step (2), count the amino acid residues with a frequency of more than 30% near each internal key cavity under different parallel conditions. At the same time, residue sites within 5 Å of the active site are excluded to avoid the effect of mutation on catalytic activity. Then, Rosetta and FoldX5.0 are used to perform virtual saturation mutation, construct a mutant library, and screen out potential mutants with ΔΔG<0.

4. The method for simultaneously evolving enzyme thermal stability and catalytic activity according to claim 2, characterized in that: The molecular dynamics simulation in step (1) is as follows: Gromacs is used to perform molecular dynamics simulation, AMBER99 force field is selected during the simulation, a cubic box is created and the protein is placed at the center of the box, solvent is added using a water model, and then the charge is neutralized to allow the entire system to reach equilibrium; the steepest descent method is used to minimize the energy of the entire system to ensure that the structure is normal, the distance between atoms is appropriate, and the geometric configuration is reasonable; Then, a position-restricted pre-equilibrium of 400 ps was performed under periodic boundary conditions, and the system temperature was heated to 313 K using Berendsen temperature coupling. Finally, a finished product simulation was performed. The entire simulation process was integrated using the Leap-frog algorithm, and the long-range electrostatic potential energy was calculated using the Particle-Mesh Ewald method. The simulation was executed five times with random initial velocities, and the simulation time was 30 ns.

5. The method for simultaneously evolving enzyme thermal stability and catalytic activity according to claim 1, characterized in that: Step (2) When calculating the internal cavities of all representative conformations using the McVol program, the probe radius was set to 1.1 Å and the minimum volume of the cavity was no less than 7 Å. 3 , the volume of a water molecule is set to 18 Å 3 .

6. The lipase mutant obtained by the method of claim 1, characterized in that: T17V / S23A / T145I, based on SEQ ID NO: 2, the threonine at position 17 is replaced by valine, the serine at position 23 is replaced by alanine, and the threonine at position 145 is replaced by isoleucine; or, T17V / S23A / T194L, based on SEQ ID NO: 2, the threonine at position 17 is replaced by valine, the serine at position 23 is replaced by alanine, and the threonine at position 194 is replaced by leucine; or, T17V / S23A, based on SEQ ID NO: 2, the threonine at position 17 is replaced by valine and the serine at position 23 is replaced by alanine; or T17V / T194L, based on SEQ ID NO: 2, the threonine at position 17 is replaced by valine and the threonine at position 194 is replaced by leucine; or S23A / T145I is based on SEQ ID NO: 2, wherein the serine at position 23 is replaced by alanine and the threonine at position 145 is replaced by isoleucine.

7. The laccase mutant obtained by the method of claim 1, characterized in that: T102M, based on SEQ ID NO: 4, the threonine at position 102 is replaced by methionine; or S258A: Based on SEQ ID NO: 4, the serine at position 258 is replaced by alanine.

8. A glutamine aminotransferase mutant obtained by the method of claim 1, characterized in that: G263M, based on SEQ ID NO: 6, the glycine at position 263 is replaced by methionine; or N284F, based on SEQ ID NO: 6, the asparagine at position 284 is replaced by phenylalanine; or T308F is based on SEQ ID NO: 6, with the threonine at position 308 replaced by phenylalanine.

Images