DNA linker oligonucleotide

Abstract

Methods and compositions related to stabilizing DNBs for sequencing, in particular minimizing loss of DNB fragments, are provided.

Description

[0001] Cross-references to related applications

[0002] This application claims priority to and enjoys the benefits of U.S. Provisional Application No. 62 / 927,060, filed October 28, 2019, which is incorporated herein by reference in its entirety for all purposes.

[0003] sequence list

[0004] This application contains a sequence list that has been electronically submitted in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy was created on October 16, 2020, and is named 092171-1215354_(5078-WOCN)_SL.txt, with a size of 2,923 bytes. Technical Field

[0005] This invention relates to the fields of DNA sequencing, genomics, and molecular biology. Background Technology

[0006] DNA nanospheres (DNBs) can be used in many applications, including DNA sequencing. Chemical cross-linking has been used to stabilize DNBs in these applications. However, existing methods can reduce the overall signal strength and inhibit second-strand formation. Improvements to methods for stabilizing DNBs are valuable. Summary of the Invention

[0007] In some embodiments, this disclosure provides a method for preparing a stabilized DNA template for nucleic acid analysis, the method comprising: hybridizing a plurality of first linker oligonucleotides to a DNA template, wherein the DNA template is a single-stranded multiplex comprising a plurality of monomers, wherein each monomer comprises an adaptor sequence and a DNA target sequence, wherein each first linker oligonucleotide comprises a sequence complementary to and hybridizing with the adaptor sequence of the DNA template, and wherein at least two of the plurality of first linker oligonucleotides hybridizing with the DNA template are linked to each other. In some embodiments, the sequence complementary to and hybridizing with the adaptor sequence of the DNA template may be a primer sequence comprising an extendable 3' end.

[0008] In some embodiments, the method further comprises extending at least two first linker oligonucleotides by one or more DNA polymerases to generate at least two second strands, wherein the at least two first linker oligonucleotides are linked to each other and hybridize with a DNA template to produce at least two second strands with their 5' ends linked.

[0009] In some embodiments, at least two first linker oligonucleotides are linked by DNA hybridization, covalent bonding, or both. In some embodiments, each of the at least two first linker oligonucleotides contains a stapler sequence, wherein the at least two first linker oligonucleotides are linked by hybridization of the respective stapler sequence.

[0010] In some implementations, the linker oligonucleotide includes a cleavage site, wherein cleavage of the linker oligonucleotide releases the stapler sequence.

[0011] In some implementations, the two stapler sequences hybridize with different regions of a shared scaffold, thereby linking at least two first linker oligonucleotides.

[0012] In some implementations, after the primer sequence binds to the DNA template, at least two first linker oligonucleotide sequences bind to each other.

[0013] In some embodiments, the method comprises: 1) hybridizing the blocking oligonucleotide with stapler sequences of at least two first linker oligonucleotides in a reaction to produce a partially double-stranded first linker oligonucleotide comprising a double-stranded region consisting of the blocking oligonucleotide and the stapler sequences, thereby preventing the stapler sequences of the first linker oligonucleotides from hybridizing with each other; 2) adding a DNA template to the reaction with the first linker oligonucleotides, wherein the primer sequences of the partially double-stranded first linker oligonucleotides bind to the DNA template; 3) dissociating the blocking oligonucleotide from the DNA template; 4) washing to remove the blocking oligonucleotide; and 5) lowering the temperature to allow the stapler sequences of the first linker oligonucleotides to hybridize with each other. In embodiments, dissociation is achieved by one or more of the following: increasing the reaction temperature to dissociate the blocking oligonucleotide from the DNA template, enzymatically degrading the blocking oligonucleotide, and chemically degrading the blocking oligonucleotide.

[0014] In some implementations, before the primer sequence binds to the DNA template, at least two first linker oligonucleotides stapler sequences bind to each other to form a linked first linker oligonucleotide.

[0015] In some implementations, the method includes using a first linker oligonucleotide with a concentration below a predetermined threshold, such that both first linker oligonucleotides in the linker pair bind to the same DNB.

[0016] In some embodiments, the stapler sequence is a palindromic stapler sequence. In some embodiments, the palindromic stapler sequence is located at the 5' end of the primer sequence on each of at least two first linker oligonucleotides.

[0017] In some embodiments, at least two first linker oligonucleotides comprise two complementary non-palindromic stapler sequences, one on each first linker oligonucleotide; and wherein at least two first linker oligonucleotides are linked by hybridization of the two complementary non-palindromic stapler sequences.

[0018] In some embodiments, at least two first linker oligonucleotides each comprise a non-palindromic stapler sequence and a palindromic stapler sequence. In some embodiments, a palindromic adapter is inserted between the non-palindromic stapler sequence and the primer sequence on each of the at least two first linker oligonucleotides.

[0019] In some embodiments, at least two first linker oligonucleotides each contain a stapler sequence inserted between two primer sequences, wherein the stapler sequences on the at least two first linker oligonucleotides hybridize with each other. In some embodiments, the stapler sequence is in the range of 8 to 50 nucleotides in length. In some embodiments, the primer sequence is in the range of 15 to 70 nucleotides in length.

[0020] In some embodiments, this document provides a method for preparing a stabilized DNA template for nucleic acid analysis, the method comprising hybridizing a plurality of first linker oligonucleotides to a DNA template, wherein the DNA template is a single-stranded multiplex comprising a plurality of monomers, wherein each monomer comprises an adaptor sequence and a DNA target sequence, wherein each first linker oligonucleotide comprises a primer sequence complementary to and hybridizing with the adaptor sequence of the DNA template, wherein at least one first linker oligonucleotide comprises a blocking group at the 3' end of the primer sequence to prevent elongation, and wherein at least two of the plurality of first linker oligonucleotides hybridized to the DNA template are linked to each other.

[0021] In some embodiments, the blocking group is a reversible blocking group, wherein the method further comprises removing the blocking group from at least one first linker oligonucleotide and extending at least one first linker oligonucleotide to generate at least one second chain.

[0022] In some implementations, the first linker oligonucleotide can be cleaved at a site located in the stapler sequence or primer sequence.

[0023] In some embodiments, the method further includes removing unbound first linker oligonucleotides after the hybridization step and / or heating the reaction mixture containing the DNA template and the first linker oligonucleotides to, for example, 50-65°C.

[0024] In some embodiments, the method further comprises: 1) extending at least two of the first linker oligonucleotides of a plurality of first linker oligonucleotides by a non-displacement DNA polymerase to generate at least two partially extended second strands, including a partially extended upstream second strand and a partially extended downstream second strand, wherein the at least two partially extended second strands are fully hybridized with a DNA template; and 2) extending the fully hybridized upstream and downstream second strands with a strand-displacement DNA polymerase, wherein extending the upstream second strand partially displaces the downstream second strand, thereby generating a partially hybridized downstream second strand.

[0025] This article also discloses a DNA complex comprising a DNA template and a plurality of first linker oligonucleotides, wherein the DNA template is a single-stranded multiplex comprising a plurality of monomers, each monomer comprising an adaptor sequence and a DNA target sequence, wherein each first linker oligonucleotide comprises a primer sequence complementary to and hybridizing with the adaptor sequence of the DNA template, wherein the primer sequence comprises an extendable 3' end, and wherein at least two of the plurality of first linker oligonucleotides hybridizing with the DNA template are linked together.

[0026] This article also provides a DNA complex comprising a DNA template, two or more second strands, wherein each second strand comprises a suspension region and a hybridization region that hybridizes with the DNA template, wherein two or more second strands are complementary to the DNA template, and wherein at least two second strands are joined at their respective 5' ends.

[0027] In some embodiments, the DNA complex further comprises two or more second linker oligonucleotides that hybridize with two or more second strands, each second linker oligonucleotide comprising a second stapler sequence, and at least two second linker oligonucleotides are linked by hybridization of the respective second stapler sequences.

[0028] This article also provides DNA arrays containing any of the DNA complexes disclosed herein.

[0029] This article also provides linker oligonucleotides, each linker oligonucleotide containing a stapler sequence and a primer sequence, with the stapler sequence at the 5' end of the primer sequence, wherein the stapler sequences on the two linker oligonucleotides are complementary to each other, and wherein the two linker oligonucleotides hybridize to each other via the corresponding stapler sequence.

[0030] In some embodiments, the stapler sequences of the two linker oligonucleotides are palindromic sequences. In some embodiments, the primer sequences of the two linker oligonucleotides are identical. In some embodiments, each linker oligonucleotide contains an additional non-palindromic stapler sequence located at the 5' end of the stapler sequence. In some embodiments, the additional non-palindromic stapler sequence in one of the two linker oligonucleotides hybridizes with the stapler sequence in a third linker oligonucleotide. In some embodiments, at least one linker oligonucleotide has a sequence selected from the group consisting of SEQ ID NO:1-10.

[0031] In some embodiments, this disclosure provides a method for preparing a DNA template for nucleic acid analysis, the method comprising immobilizing the DNA template on an array, wherein the DNA template is a DNA multiplex comprising a plurality of monomers, and each monomer comprises an adaptor sequence and a DNA target sequence. A plurality of first linker oligonucleotides hybridize with the DNA template, and each first linker oligonucleotide comprises a sequence complementary to and hybridizing with the adaptor sequence of the DNA template. At least two of the plurality of first linker oligonucleotides hybridizing with the DNA template are linked together. Attached Figure Description

[0032] Figure 1A and 1B The DNB subunit using a "Z-connector" stapler as a primer is shown.

[0033] Figure 2 The DNB subunit using the "X-connector" and possible connector structures are shown.

[0034] Figure 3 The effect of adding X adapters on signal strength across multiple sequencing cycles is shown.

[0035] Figure 4A and 4B The effect of the X connector on mapping rate and error rate is shown.

[0036] Figure 5A and 5B The effect of the Z-connector on the mapping rate and error rate between the first 50 and last 50 bases of the reading is shown.

[0037] Figures 6A to 6E The various adapter configurations formed by hybridization of the adapter oligonucleotides disclosed herein are shown. B and b are complementary stapler sequences. “bB” indicates a palindromic stapler sequence. A indicates a primer sequence that can hybridize with a DNA template.

[0038] Figures 7A to 7BAdditional connection configurations are shown. A represents the primer sequence. B, C, D, and E represent stapler sequences that may have the same or different sequences. Figure 7A This represents a linear scaffold that connects multiple linker oligonucleotides. Figure 7B A circular scaffold connecting multiple linker oligonucleotides is shown. Figure 7C An implementation scheme in which two linker oligonucleotides are linked by chemical bonds is shown. Detailed Implementation

[0039] 1. Overview

[0040] The linker oligonucleotides described in this disclosure can be used to hybridize with long nucleic acid molecules in a predictable manner to crosslink different regions of the long nucleic acid molecule. In some cases, crosslinking transforms spatially distant regions of a nucleic acid into a predefined shape and structure. In some cases, the nucleic acid is a DNA polyp containing multiple monomers, and each linker oligonucleotide contains a primer sequence that binds to a different monomer of the polyp. The linker primer eliminates the need for binding sites of non-primer-linking oligonucleotides in the adaptor, which allows for a relatively short adaptor. Shorter adaptors have several advantages, such as providing a DNB with a greater number of adaptor copies for a given DNB size. Linked primers also allow most denaturing primers to rehybridize without being washed away. At least two of the linker oligonucleotides are linked, such that the different monomers of the polyp are also linked. In addition to primer rehybridization, the cage is likely to prevent mechanical braking and removal of DNB fragments, but will not lose smaller DNB fragments due to other types of DNA cleavage. The linker lengths of both the dsDNA and ssDNA portions can be altered to maximize signal preservation benefits under different sequencing conditions (e.g., cleavage chemistry, reaction temperature, time, pH, polymerase characteristics, etc.).

[0041] The ligating monomers in a DNA polyp stabilize its structure. Sequencing reactions can lead to the cleavage and fragment loss of the DNA polyp. With more sequencing cycles, more DNA polyp cleavage accumulates, and more DNA fragment loss occurs. By ligating two or more monomers, the likelihood of DNA loss due to two cleavages / cuts in the DNA polyp is reduced, thus minimizing DNB quality loss. Furthermore, DNB with ligating primers exhibits less mechanical cleavage due to the imposed structure. For ligated oligonucleotides, typically four or more specific cuts are required to lose fragments of the DNB. Generally, the more ligations provided, the more cuts are required to lose DNB fragments. To maximize DNB quality retention, ligating primers are combined with reduced DNA cleavage / cuts using reagents (adjusted temperature, time, concentration, avoidance of impurities, highly purified enzymes without endonuclease activity, near-zero microbial contamination), ensuring fewer than four cuts per 10, 29, 30, 50, 100, or more sequencing cycles. Additionally, ligating two or more subunits reduces volume and allows for greater deposition of the DNA polyp onto the substrate. Finally, the connection can also provide other advantages, such as protecting DNB from degradation.

[0042] Unlike chemical cross-linking in sequencing, which typically inhibits the generation of the reverse complementary strand of the DNA template and suppresses primer extension, linker oligonucleotides, as a means of cross-linking, do not inhibit the generation of reverse complement or primer extension. Instead, linker oligonucleotides contain one or more primer sequences that can extend to form the reverse complementary strand. Furthermore, since the primer sequences become the 5' end sequences of the second strand, the ligation of the linker oligonucleotide results in the second strand also being ligated at the 5' end. The ligation of the second strand further stabilizes the DNA template (e.g., single-stranded DNA multiply).

[0043] Therefore, the compositions and methods described herein can be used to stabilize DNA templates and minimize structural loss of DNB quality. Sequencing techniques using these compositions and methods extend read length (number of sequencing cycles), reduce error rates, and improve mapping efficiency during sequencing.

[0044] 2. DNA template polynucleotides: multinucleotides and DNB

[0045] In some embodiments, the DNA template used in this invention is a DNA multiply. As used herein, the term "multiply" refers to a continuous DNA molecule containing multiple copies of the same DNA sequence (tandemly linked "monomers" or "subunits"). A "DNA multiply" may contain at least two, at least three, at least four, at least 10, at least 25, at least 50, at least 200, or at least 500 monomers. In some embodiments, the DNA multiply contains 25-1000 monomers (e.g., 50-800 or 300-600 monomers). The DNA multiply used in the methods of this invention may be DNA nanospheres, or "DNB". Without any intention to limit the invention, DNA nanospheres are described in Drmanac et al., U.S. Patent No. 8,592,150 (November 26, 2013), "Methods and compositions for long fragment read sequencing," the entire contents of which are incorporated herein by reference. "DNA nanospheres" or "DNBs" are single-stranded DNA multimers of sufficient length to form random coils that fill a roughly spherical volume in solution (e.g., SSC buffer at room temperature). In some embodiments, DNA nanospheres typically have a diameter of about 100 to 300 nm. Typically, each monomer contains at least one target DNA sequence.

[0046] DNA nanospheres are single-stranded copies of a DNA sequence tandemly arranged into a linear DNA structure. Typically, DNBs are produced by replicating single-stranded circular DNA using a strand displacement polymerase (such as phi29 polymerase or Bst polymerase) in a process called rolling circle replication. The polymerase begins by extending a primer that hybridizes to the single-stranded circle and creates an inverse complementary strand that hybridizes to that circle. Once a complete extension around the circle has been completed, the polymerase continues extending by displacing the newly formed strand in the direction of travel. As the polymerase continues to extend the strand around the circle, multiple inverse complementary copies are created, linked together linearly. This strategy creates a target with numerous probe or primer binding sites.

[0047] DNA multiplies (including DNA nanospheres) can be generated by any suitable method. In one approach, a single genomic fragment is used to generate single-stranded circular DNA, with adaptors scattered between adjacent or closely spaced target sequences in the genome.

[0048] In one embodiment, the monomer of the multiplex comprises an adaptor sequence and a target DNA sequence. Because the monomers are tandemly linked, the target DNA sequence will be flanked by two adaptor sequences. In some methods, the target DNA sequence in the monomer is flanked by two “half-adaptor” sequences, such that each target sequence tandemly linked in the multiplex is flanked by two adaptors. In some methods, the monomer unit comprises one, two, three, or four or more adaptors. In some embodiments, all adaptors of the monomer (and multiplex) have the same sequence. In other embodiments, the adaptors can have different sequences, such as two, three, or four different sequences. It will be appreciated that a single monomer can contain more than one DNA template sequence. For example, the monomer can contain the structure A1-T1-A2-T2, where T1 and T2 are DNA templates having the same or different sequences, and A1 and A2 are adaptors having the same or different sequences. Various configurations of DNA multiplexes that can be used are disclosed in U.S. Patent No. 10,227,647, the relevant disclosure of which is incorporated herein by reference in its entirety. The corresponding polymers will have the structure A1-T1-A2-T2-A1-T1-A2-T2-A1-T1-A2-T2... In relevant embodiments, a monomer may contain the structure A1-T1-A2-T2-A3, where T1 and T2 are DNA templates having the same or different sequences, A2 is an adaptor, and A1 and A3 are "semi-adaptors". The corresponding polymers will include the structures A2-T2-A3 A1-T1-A2-T2-A3 A1-T1-A2-T2-A3A1..., where the A3 and A1 semi-adaptors together function as a single adaptor. For illustrative purposes and not limiting, Table 1 shows exemplary polymer structures. In Table 1, N is greater than 1. Typically, N is at least 3 (at least 3 monomers), and is typically at least 4, at least 10, at least 25, at least 50, at least 200, or at least 500. In some implementations, N is in the range of 25-1000 (e.g., 50-800, or 300-600). When the DNA template polynucleotide is a DNA nanosphere, N is at least 25, typically at least 50, and typically in the range of 50-800 or 300-600.

[0049] Table 1. Exemplary Multi-unit Structures

[0050]

[0051] 3. Target DNA sequence

[0052] As described above, the DNA template (such as a multiply) can contain target DNA. Target DNA can originate from any source, including naturally occurring sequences [e.g., genomic DNA, cDNA, mitochondrial DNA, cell-free DNA, etc.], artificial sequences (e.g., synthetic sequences, products of gene truncation or molecular evolution, etc.) or combinations thereof. Target DNA can originate from sources such as organisms or cells (e.g., from plants, animals, viruses, bacteria, fungi, humans, mammals, insects), forensic sources, etc. Target DNA sequences can originate from biological populations, such as gut bacteria. Target DNA sequences can be obtained directly from a sample or can be products of amplification reactions, fragmentation reactions, etc.

[0053] Target DNA can have a length within a specific size range, such as 50 to 600 nucleotides. Other exemplary size ranges include lengths of 25 to 2000, 50 to 1000, 100 to 600, 50-100, 50-300, 100-300, and 100-400 nucleotides. In DNA template polynucleotide libraries containing two or more different target DNAs, the target DNAs can be of the same or different lengths. In a DNA template polynucleotide library, the members of the library can have similar lengths in some embodiments (e.g., all within the 25 to 2000 nucleotide range, or another range).

[0054] In one approach, target DNA can be prepared by fragmenting a large source DNA (e.g., genomic DNA) to produce fragments within a desired size range. In some approaches, a size selection step is used to obtain a pool of fragments within a specific size range.

[0055] 4. Connector

[0056] The DNA template or DNA template polynucleotide used in the methods disclosed herein includes two or more adaptor sequences. As used herein, an adaptor sequence refers to the nucleic acid sequence of the adaptor. An adaptor may contain elements for immobilizing the DNA template polynucleotide onto a substrate, elements for binding oligonucleotides for sequencing (e.g., binding sites for primers extended in sequencing-by-synthesis methods and / or probes for cPAL-based or other ligation-based sequencing methods), or both elements for immobilization and sequencing. Adaptors may include additional features, such as, but not limited to, restriction endonuclease recognition sites, extension primer hybridization sites (for analysis), barcode sequences, unique molecular identifier sequences, and polymerase recognition sequences.

[0057] The adaptor sequence can have a length, structure, and other characteristics suitable for a specific sequencing platform and intended use. For example, the adaptor can be single-stranded, double-stranded, or partially double-stranded, and can have a length suitable for the intended use. For example, the adaptor can have a length in the range of 10-200 nucleotides, 20-100 nucleotides, 40-100 nucleotides, or 50-80 nucleotides. In some embodiments, the adaptor can contain one or more modified nucleotides containing modifications to the base, sugar, and / or phosphate moieties.

[0058] Those skilled in the art will understand that different members of the library will generally contain common linker sequences, although different species or subgenera in the library may have unique characteristics, such as subgenera-specific barcodes.

[0059] A single adaptor sequence may include multiple functionally distinct subsequences. For example, as discussed in detail in this disclosure, a single adaptor sequence may contain more than two primer stapler sequences (which can be recognized by different complementary primers or probes). The functionally distinct sequences within the adaptor may overlap or not overlap. For illustration, given an adaptor of 40 bases in length, in one embodiment, bases 1-20 are the first primer binding site and bases 21-40 are the second primer binding site. In different embodiments, bases 1-15 are the first primer binding site and bases 21-40 are the second primer binding site. In different embodiments, bases 5-25 are the first primer binding site and bases 15-35 are the second primer binding site. Similarly, given an adaptor of 40 bases in length, bases 1-20 may be a fixed sequence and bases 21-40 may be primer binding sites. Different primer stapler sequences within an adaptor (or different adaptors of a DNA template polynucleotide) may have the same or different lengths.

[0060] An adaptor (e.g., a first adaptor, a second adaptor, a third adaptor, etc.) may contain one, two, or more than two primer stapler sequences. A primer stapler sequence is functionally defined as a site or sequence for primer (or oligonucleotide) specific binding. For example, an adaptor having two primer stapler sequences can be specifically bound by two different primers. In one approach, the two primer stapler sequences in the same adaptor overlap, i.e., they share a portion of the nucleotide sequence. In some embodiments, the overlapping region is no more than 50%, 40%, 30%, 20%, 10%, or 5% of either of the two overlapping primer stapler sequences. In one approach, more than one primer stapler sequence is non-overlapping. In some embodiments, the non-overlapping primer stapler sequences are adjacent to each other; in other embodiments, the non-overlapping primer stapler sequences are separated by 1–10, 10–20, 30–40, or 40–50 nucleotides.

[0061] Clearly, within a given DNA template polynucleotide, different adaptors can have the same or different sequences, and can have the same or different primer stapler sequences. See, for example, Section 7 below. Although certain figures have been provided to illustrate the invention, the use of adaptors with similar crosshairs or the like should not be considered as indicating sequence identity.

[0062] 5. Linker oligonucleotides

[0063] A "linker oligonucleotide" is an oligonucleotide that can be covalently or co-linked to another oligonucleotide. In some embodiments, the linker oligonucleotide is a "first linker oligonucleotide" that hybridizes with the first strand. In some embodiments, the linker oligonucleotide is a "second linker oligonucleotide" that hybridizes with the second strand, as further described below.

[0064] Linker oligonucleotides may contain a primer sequence having an extendable 3' end, said primer sequence being complementary to the adaptor sequence of a DNA template and capable of hybridizing with the DNA template. At least two linker oligonucleotides may be ligated. The term "ligation" refers to both non-covalent and covalent interactions through which two nucleic acid molecules are bound together. In some cases, such ligation occurs via DNA hybridization, chemical bonds, or both. These linker oligonucleotides can link adjacent or non-adjacent monomers of a DNA polyp, thereby stabilizing the DNA polyp. Exemplary linker oligonucleotides are shown in [image / description]. Figures 6A-6E And in Table 2 below, in the direction from 5' to 3'. b and B represent stapler sequences and A represents primer sequences.

[0065]

[0066] Figures 6A-6E The various adapter configurations that the above-mentioned adapter oligonucleotides can form through hybridization are shown. B and b are complementary stapler sequences. “bB” indicates a palindromic stapler sequence. “A” indicates a primer sequence that can hybridize with the DNA template. D and d are complementary. Each component is described in further detail below.

[0067] Figure 7A Additional embodiments of the ligation configuration are shown. A represents the primer sequence, while B, C, D, and E represent stapler sequences. B, C, D, and E may have the same or different sequences. Figure 7A A linear scaffold connecting multiple linker oligonucleotides is shown. Figure 7B A circular scaffold connecting multiple linker oligonucleotides is shown. Figure 7C An embodiment in which two linker oligonucleotides are linked by chemical bonds (i.e., covalent bonds) is shown.

[0068] A. Primer sequence

[0069] The linker oligonucleotides disclosed herein comprise at least one primer sequence and at least one stapler sequence. In some embodiments, at least one primer sequence is located at the 3' end of the stapler sequence. In some embodiments, the linker oligonucleotide hybridizes with single-stranded DNA, and the primer sequence of the linker oligonucleotide includes an extendable 3' end, thereby producing a DNA strand that is reverse complementary to the single-stranded DNA. As used herein, the DNA strand generated by extending the first linker oligonucleotide is referred to as the second strand; and the DNA strand generated by extending the second linker oligonucleotide is referred to as the third strand.

[0070] The number of primer sequences for each linker oligonucleotide can vary. In some embodiments, the linker oligonucleotide contains one primer sequence. In some embodiments, the oligonucleotide contains two primer sequences.

[0071] The primer sequence for the linker oligonucleotide will be of sufficient length to allow for primer hybridization, with the exact length and sequence depending on the intended function of the primer (e.g., extension primer, ligation substrate, index sequence, etc.). The primer sequence binding to DNB will generally be stable under all temperature, salt, and pH conditions used throughout the sequencing run. Dissociation and reassociation of a single oligonucleotide or a region thereof is generally undesirable as it may create heterogeneous reads or result in the loss of the extension primer. For example, the primer sequence length and Tm of the oligonucleotide should be sufficient to ensure that the linker oligonucleotide maintains hybridization under the temperature, salt, and pH conditions used throughout the assay. Primer sequence lengths are typically at least 10, at least 12, at least 15, or at least 18 bases. In some embodiments, the primer sequence length ranges from 8 to 60 nucleotides, for example, 10 to 25 nucleotides, or 40 to 60 nucleotides long.

[0072] B. Linker oligonucleotides

[0073] Linker oligonucleotides are linked in various ways. In some embodiments, they are linked via chemical bonds. In some cases, the chemical bonds used to link the linker oligonucleotides described herein are nonspecific and are formed using chemicals such as nitrogen mustard or chloroethylnitrosourea (CENU) derivatives. In some embodiments, the chemical bonds used in the methods and compositions disclosed herein are targeted cross-links of oligonucleotides, which can be achieved, for example, with thionucleobases (Beilstein J. Org. Chem. 2014, 10, 2293–2306). Generally, any modification that allows oligonucleotide attachment to a surface can be modified to allow oligonucleotide-to-oligonucleotide attachment, and these modifications can be used to link linker oligonucleotides. For example, the NHS (N-hydroxysuccinimide) group can react with the amino group of a second molecule (also allowing cross-linking with proteins). Click chemistry, such as the conjugation between azide-modified oligonucleotides and alkyne-modified oligonucleotides, can also be used to conjugate two oligonucleotides together (Acc.Chem.Res.20124581258-1267).

[0074] In some embodiments, the linker oligonucleotides are joined via DNA hybridization. In some embodiments, the linker oligonucleotides are joined via hybridization of a stapler sequence located on each linker oligonucleotide. For example, the stapler sequence (“A”) in linker oligonucleotide Seq1 is complementary to and can hybridize with the stapler sequence (“a”) in another linker oligonucleotide Seq2. In some embodiments, the stapler sequence is a palindromic sequence. In some embodiments, the stapler sequence is a non-palindromic sequence.

[0075] A palindromic sequence is a sequence in which one half of the sequence is complementary to the other half. For example, the linker oligonucleotides in Table 2 contain the sequence "b" followed by the sequence "B", where b is complementary to B. An exemplary palindromic sequence is GGAACCATGGTTCC (SEQ ID NO:8). Linker oligonucleotides with palindromic sequences can form hairpins with internal complementarity (i.e., forming intramolecular hairpins) or can be complementary to a stapler sequence on another linker oligonucleotide with the same sequence (i.e., forming an intermolecular hybrid). When the palindromic sequence GGAACCATGGTTCC (SEQ ID NO:8) of the first linker oligonucleotide hybridizes to a palindromic sequence on a second oligonucleotide with the same sequence, the linker oligonucleotide pair is linked via the palindromic sequence. See also Figure 2 (Two linker oligonucleotides, “Oligonucleotide linker 1”, hybridize with each other via the palindromic sequence “Bb” to form a first linker oligonucleotide pair, and two linker oligonucleotides, “Oligonucleotide linker 2”, hybridize with each other via the palindromic sequence “Cc” to form a second linker oligonucleotide pair.) Another illustrative example is... Figure 6B In this context, the sequence “bB” is self-complementary and allows hybridization with the second oligonucleotide.

[0076] In one exemplary example, the linker oligonucleotide having sequence 5'GGAACCATGGTTCCAAGTCGGAGGCCAAGCGGTCTUAGGA-3' (SEQ ID NO:1) (belonging to the class of linker oligonucleotide 3 or Seq 3) contains the palindromic sequence GGAACCATGGTTCC (SEQ ID NO:8). SEQ ID NO:1 further contains the sequence AAGTCGGAGGCCAAGCGGTCTUAGGA (SEQ ID NO:10), which can serve as a primer sequence for recognizing part of the DNB adaptor.

[0077] Palindromic sequences in Seq 3 are self-complementary under appropriate conditions and can form hairpins with internal complementarity; alternatively, palindromic sequences can be complementary to a second oligonucleotide of the same sequence. At higher temperatures (e.g., 50°C to 65°C), the internal hairpin structure is unstable and longer intermolecular hybrids will remain hybridized. Therefore, increasing the temperature will favor the formation of intermolecular hybrids on the internal hairpins (which are required to stabilize the DNA templates used in various sequencing applications). Thus, in some embodiments, the adapter oligonucleotide containing the palindromic stapler sequence hybridizes with the DNA template on a solid support. Hybridization is performed at temperatures of 10–30°C. The solid support is then washed to remove unbound primers, and the temperature is then increased to 50–65°C to reduce the formation of intramolecular hybrids.

[0078] The length of the stapler sequence can be varied. The length of the stapler sequence is chosen such that the Tm of the stapler sequence is between 50°C and 72°C. This ensures that the linker oligonucleotide can maintain hybridization throughout the assay procedure. In some embodiments, the length of the stapler sequence can be in the range of 20 to 150 nucleotides (e.g., 40 to 120 nucleotides, 50 to 100 nucleotides).

[0079] The relative positions of the stapler sequence and the template hybridization sequence (e.g., primer sequence) in the linker oligonucleotide can vary. In some embodiments, the stapler sequence is located at 5' relative to the primer sequence (e.g., linker oligonucleotides 1 to 3 in Table 2). In some embodiments, a stapler sequence is inserted between the two template hybridization sequences (e.g., two primer sequences) in the linker oligonucleotide, and the stapler sequence is located at 3' relative to the first primer sequence and 5' relative to the second primer sequence. Illustrative examples are shown in Table 2 (e.g., linker oligonucleotides 4 to 6) and Figure 6C and 6D middle.

[0080] C. Alternative connection options - bracket

[0081] As used herein, a scaffold refers to a molecular structure in which individual oligonucleotides associate with each other. In some embodiments, two or more linker oligonucleotides (e.g., three, four, or five linker oligonucleotides) are linked by hybridization to a sequence in the scaffold that is complementary to the stapler sequence of the linker oligonucleotides. In some embodiments, the stapler sequences of these linker oligonucleotides linked by the scaffold are different. In some embodiments, the stapler sequence is non-palindromic. In some embodiments, the stapler sequences between two or more linker oligonucleotides are identical.

[0082] The scaffolds used in the methods and compositions described herein can be in various forms. In some embodiments, the scaffold is a linear scaffold. In some embodiments, the scaffold is a circular scaffold. In some embodiments, the scaffold is a dendritic polymer scaffold. The scaffold can be linear, circular, or dendritic polymer. In some embodiments, the scaffold is added and the linker oligonucleotide hybridizes with the scaffold after hybridization with a DNA template (e.g., a DNA polynucleotide) via a primer sequence. Figure 7A An illustrative example of a linear scaffold is shown, in which linker oligonucleotides BA, CA, DA hybridize with the linear scaffold. Figure 7B Illustrative examples of circular scaffolds are shown, in which linker oligonucleotides BA, CA, DA, and EA hybridize with the circular scaffold. In both examples, A represents a primer sequence complementary to the DNA template, while B, C, D, and E are stapler sequences. Scaffolds are typically used at relatively low concentrations (e.g., below the concentration of linker oligonucleotides in the reaction), and longer hybridization times with the scaffold will provide more primers for ligation.

[0083] The scaffolds disclosed herein can be made of any material or substrate (e.g., protein or nucleic acid). In some embodiments, the scaffold is a protein scaffold. In some embodiments, the scaffold is a nucleic acid scaffold. Non-limiting examples of nucleic acid scaffolds include DNA, RNA, and peptide nucleic acids (PNA). The scaffold can be covalently or non-covalently attached to a stapler sequence of a linker oligonucleotide. In some embodiments, the scaffold is a nucleic acid containing two or more copies of a sequence complementary to the stapler sequence, such that the linker oligonucleotide is anchored to the scaffold by hybridization. In some embodiments, multiple scaffold molecules are used, each linked to multiple linker oligonucleotides.

[0084] The scaffolds disclosed herein can be generated as linear repeats or circular structures containing multiple repeats. In some embodiments, the scaffold is a nucleic acid polymer (e.g., DNB). In some cases, it is desirable to control the hybridization rate of the scaffold to ensure that each linker oligonucleotide hybridizes not on its own with an independent scaffold molecule (“independent single hybridization event”), but with the same scaffold molecule linked to other linker oligonucleotides (“bridging event”). Promoting bridging events rather than independent single hybridization events can be achieved, for example, by keeping the concentration of the scaffold relatively low. In some embodiments, the molar ratio of linker oligonucleotides to scaffold can be in the range of 2 to 50 (e.g., 3 to 25, 3 to 15, or 4 to 10). The appropriate concentration of the scaffold for this purpose can be determined empirically. For example, for the same scaffold, having multiple (e.g., 3 to 4 or 4 to 6) different stapler sequences increases the chance of linking single DNA templates (e.g., DNB) over long distances.

[0085] D. Specific ligation primer configurations that do not use scaffolds

[0086] In some implementations, two linker oligonucleotides are linked together to form a linker. Linkers and linker oligonucleotides can take different forms and can be classified in different ways. For example, based on the number of subunits in the DNA polynucleotides that the linker can bind, linkers can be classified as 2-armed linkers or 4-armed linkers. According to the relative sequence components of the linker itself, they can be classified as Z-linkers or X-linkers. Z-linkers can be 2-armed or 4-armed linkers. X-linkers are typically 2-armed linkers.

[0087] 2-arm connector vs. 4-arm connector

[0088] In some implementations, each linker oligonucleotide contains only one primer sequence, so two oligonucleotides can link the two subunits of a DNA polyp (“2-arm linker”). As an illustrative example, each of the two linker oligonucleotides, Seq 1 and Seq 2, contains a primer sequence (A) for hybridization with one (or more) subunits of DNB. Seq 1 also contains a stapler sequence (b) and Seq 2 contains a stapler sequence (B), where (b) is complementary to (B). See Figure 6. To form a functional linker, Seq 1 and Seq 2 are added to a reaction containing template DNA (e.g., a DNA polyp).

[0089] In some implementations, a single linker oligonucleotide can link two subunits of a DNA multimer due to having two primer sequences complementary to the adaptor sequence of the multimer. For example, Seq4 or Seq5 in Figure 6 belong to this type of linker oligonucleotide.

[0090] In some embodiments, each linker oligonucleotide has two primer sequences with a stapler sequence inserted between them. Each linker oligonucleotide can hybridize to two subunits of DNB. This conformation allows two linked linker oligonucleotides to bind to four individual sequences of the DNA template, hence the term "4-arm linker." In some embodiments, the stapler sequences of the two linker oligonucleotides in a 4-arm linker are not identical, such as Seq4 and Seq5 in Figure 6. In some embodiments, the stapler sequences of the two linker oligonucleotides in a 4-arm linker are identical and palindromic, which allows hybridization of two linker oligonucleotides with the same sequence.

[0091] In some embodiments, two linker oligonucleotides are joined to form a Z-linker. Each linker oligonucleotide in the Z-linker contains a primer sequence complementary to and capable of hybridizing with a DNA template, such as a linker for a DNA multiply. In some embodiments, each primer sequence contains an extendable 3' end and can be used as a primer to fabricate a second strand based on the DNA template. Each linker oligonucleotide in the Z-linker also contains a stapler sequence complementary to the stapler sequence of the other linker oligonucleotide, and hybridization of the two stapler sequences results in the formation of a partial hybrid between the two linker oligonucleotides. In some embodiments, the stapler sequence of the linker oligonucleotide is palindromic, and the two linker oligonucleotides of the Z-linker have the same sequence. In some embodiments, the stapler sequence of the linker oligonucleotide is non-palindromic, and the two linker oligonucleotides have different sequences.

[0092] The 3' end of each linker oligonucleotide can extend to form a second strand. The two second strands thus formed are joined at the 5' end via a Z-linker.

[0093] Figure 1A An illustrative example of a Z-connector consisting of a pair of linker oligonucleotides, each linker oligonucleotide containing a stapler sequence and a primer sequence, with the stapler sequence located at the 5' end of the primer sequence. The stapler sequences of this pair of linker oligonucleotides are complementary, and their annealing links the linker oligonucleotides at the 5' ends together to form a 2-arm Z-connector. The primer sequence hybridizes to a DNB template (e.g., the first strand), and each linker oligonucleotide extends to form a second strand, resulting in two second strands joining at the 5' ends (bottom right inset). In this case, the extension proceeds via strand displacement DNA polymerase, which forms a branched structure in which each second strand hybridizes with a portion of the DNA template.

[0094] E. Controlling the degree of cross-linking

[0095] In one implementation, the linker oligonucleotide can be cleaved at a defined location to allow removal of the 3-initiator block, thereby forming a primer for polymerization.

[0096] In some embodiments, linker oligonucleotides can be cleaved, for example, by enzymes (e.g., phosphatases or esterases), chemical reactions, heat, light, etc. For applications requiring a low degree of cross-linking between the multiply subunits, cleavage can release the cross-linked structure. That is, the connection between the multiply subunits can be reversed or switched, allowing the performance of a secondary function. For example, a new initiation site can be generated due to the formation of a new 3' hydroxyl group at the cleavage site, thereby allowing extension by polymerase. The cleavage site can be located anywhere on the linker oligonucleotide. In some embodiments, at least one of the two linker oligonucleotides contains two cleavage sites located flanking the stapler sequence, and cleavage at these sites results in the release of the stapler sequence. In some embodiments, the cleavage site is on the stapler sequence of at least two linker oligonucleotides, and cleavage releases a linker oligonucleotide-linker oligonucleotide hybrid or a linker-DNB hybrid. In some embodiments, the cleavage site is on the primer sequence of the linker oligonucleotide, and cleavage at the site creates a shorter, unstable hybrid and results in the release of the cross-linked structure.

[0097] Cleavage can be achieved through enzymatic recognition of nucleotide bases and / or base-free sites, or by modifying phosphodiester bonds to create site-specific breaks. For example, the 3' block of a linker oligonucleotide can be designed by incorporating a 3' phosphate group during oligonucleotide synthesis, and the 3' phosphate group can be cleaved by a kinase or phosphatase.

[0098] In some embodiments, the cleavage site comprises a uracil nucleotide base, which allows the base and phosphodiester bond to be cleaved using uracil DNA glycosylase (UDG) and an endonuclease. In some embodiments, the endonuclease is an enzyme that generates a 3' hydroxyl group upon cleavage at the cleavage site, such as APE1. Cleavage of the phosphodiester backbone at the uracil nucleotide base results in the release of the stapler sequence. This is useful in cases where decrosslinking is required.

[0099] In some implementations, the linker oligonucleotide is A-bB-A. A represents the primer sequence, while bB is a palindromic stapler sequence. Cutting at the dU base and sugar excision with an endonuclease of both primer sequences allows release of the stapler sequence and the second hybridization region. The resulting structure will be in one of two forms. In one example, the first sequence is Seq 11.4, having the sequence AAGTCGGAGGCCAAGCGGTCT (SEQ ID NO:2), which, if a suitable endonuclease is chosen, can maintain hybridization with DNB and can have a 3' hydroxyl group. The second sequence (Seq 11.5) AGGAGGAACCATGGTTCCAAGTCGGAGGCCAAGCGGTCT (SEQ ID NO:3) can also maintain hybridization with DNB and can have a 3' hydroxyl group that allows for extension by polymerase. Seq 11.5 will still have a 5' tail sequence, which can maintain hybridization with the second 5' tail sequence of the second oligonucleotide.

[0100] The remaining cut oligonucleotide sequences Seq 11.4 and Seq 11.5, as described above, can then be used as primers for subsequent polymerase extension (e.g., generation of a second strand using chain substitution polymerase). The dU cleavage step is optional; as in some cases, subsequent second-strand generation can still occur by binding the primers to the substitution region of DNB. The primers can be extended to form a second strand by chain substitution polymerase, and said extension can substitute for a downstream second strand, for example, by extending a linker oligonucleotide as disclosed herein.

[0101] F. Controlling the crosslinking time

[0102] Inhibitor oligonucleotides

[0103] In some cases, to maximize the cross-linking efficiency of the DNA template, it is necessary to ensure that the linker oligonucleotides hybridize with the DNA template before they hybridize with each other. One method to achieve this is to first block hybridization between the linker oligonucleotides during the process, when they come into contact with and hybridize with the DNA template. After hybridization of the linker oligonucleotides with the DNA template is complete, and after an optional step of removing excess linker oligonucleotides from the reaction, the blocking is reversed to allow hybridization between the linker oligonucleotides. In some cases, preventing hybridization of oligonucleotide linkers before hybridization with the DNA template can be achieved by using a blocking oligonucleotide. The blocking oligonucleotide is complementary to the stapler sequence of the linker oligonucleotide but not to the primer sequence. The length of the blocking oligonucleotide can also be similar to the length of the stapler sequence. Thus, the blocking oligonucleotide is incubated together with the linker oligonucleotide to form a double-stranded stapler region, but the primer sequence remains single-stranded. Partial double-stranded linker oligonucleotides are allowed to come into contact with the DNA template, where the primer sequence binds to the complementary sequence in the DNA template. After hybridization with the DNA template, the blocking sequence is then removed so that the linker oligonucleotides can hybridize with each other through the complementary stapler sequence.

[0104] Inhibiting oligonucleotides can be removed via a variety of mechanisms. In some cases, the inhibiting oligonucleotide is designed to hybridize with the stapler sequence of the linker oligonucleotide to form a double-stranded hybrid, and the melting temperature of the double-stranded hybrid is lower than the melting temperature of the double-stranded hybrid formed between the DNA template and the linker oligonucleotide. In those cases, the inhibiting oligonucleotide can be removed by increasing the reaction temperature to dissociate the inhibiting oligonucleotide from the linker oligonucleotide, while the DNA template remains hybridized with the linker oligonucleotide. In some cases, the inhibiting oligonucleotide can be removed by enzymatic cleavage (e.g., uracil-glycosylation enzyme / endonuclease IV or UDG / APEI). In some cases, phosphodiester bonds at different positions in the inhibiting oligonucleotide can be replaced by chemically cleavable bonds (e.g., disulfides, azides), allowing the inhibiting oligonucleotide to be cleaved and removed.

[0105] In some embodiments, the method comprises: 1) hybridizing a blocking oligonucleotide with staple sequences of at least two linker oligonucleotides in a reaction to produce a partially double-stranded linker oligonucleotide comprising a double-stranded region consisting of a blocking oligonucleotide and a stapler sequence, thereby preventing the stapler sequences of the linker oligonucleotides from hybridizing with each other; 2) adding a DNA template to the reaction with the linker oligonucleotides, thereby binding the partially double-stranded primer sequence of the linker oligonucleotide to the DNA template; 3) removing the blocking oligonucleotide by one or more of the following methods: increasing the reaction temperature to dissociate the blocking oligonucleotide or multiple oligonucleotides from the linker oligonucleotides, or subjecting the blocking oligonucleotide to enzymatic or chemical degradation; 4) washing to remove the blocking oligonucleotide; and 5) decreasing the temperature to allow the stapler sequences of the linker oligonucleotides to hybridize with each other.

[0106] In some embodiments, the stapler sequences of at least two linker oligonucleotides bind to each other to form a linker pair before the primer sequence binds to the DNA template. Generally, in some embodiments, the rate at which two linker oligonucleotides from the same linker pair bind to a single DNB is higher than the rate at which two linker oligonucleotides from different linker pairs bind to a single DNB. Therefore, in some embodiments, the linker oligonucleotide pairs (or linker oligonucleotides) are used at an appropriate concentration such that the two linker oligonucleotides in the linker pair bind to the same DNB, rather than two linker oligonucleotides from different linker pairs binding to the same DNB. An appropriate concentration for this purpose can be determined empirically.

[0107] Subunit linkage can occur in solution after DNB deposition on a glass slide or before DNB is loaded onto a surface. Linkage in solution minimizes DNB splitting across multiple surface binding sites. Linkage on a surface minimizes the risk of linking multiple DNBs.

[0108] G. Specific Configuration

[0109] In some implementations, two linker oligonucleotides are linked together to form a linker. As used herein, a linker is a complex consisting of two or more linker oligonucleotides linked covalently or nonvalently. Linkers and linker oligonucleotides can take different forms. For example, based on the number of subunits in a DNA multiplex that the linker can bind, linkers can be classified as 2-armed linkers or 4-armed linkers. Based on the relative sequence components of the linker itself, they can be classified as Z-linkers or X-linkers.

[0110] 2-arm connector and 4-arm connector

[0111] In some implementations, each linker oligonucleotide contains only one primer sequence, so two oligonucleotides can link two subunits of a DNA multiplicon (“2-arm linker”). As an illustrative example, the two linker oligonucleotides, Seq 1 and Seq 2, each contain a primer sequence (A) for hybridization with one (or more) subunits of DNB. Seq 1 also contains a stapler sequence (b), and Seq 2 contains a stapler sequence (B), wherein (b) is complementary to (B). See also Figure 6A To form a functional adapter, Seq 1 and Seq 2 are added to a reaction containing a DNA template (e.g., a DNA polyp). In some embodiments, each of the two-arm adapters contains a palindromic sequence; see [link to related document]. Figure 6B .

[0112] In some implementations, a single linker oligonucleotide, having two primer sequences complementary to the adaptor sequence of the DNA multiplex, can connect two subunits of the multiplex. For example... Figure 6C Seq4 or Seq5 in the code.

[0113] In some embodiments, each linker oligonucleotide has two primer sequences with a stapler sequence inserted between them. Each linker oligonucleotide can hybridize to two subunits of DNB. This conformation allows the two linked linker oligonucleotides to bind to four individual sequences of the DNA template, hence the term "4-arm linker." In some embodiments, the stapler sequences of the two linker oligonucleotides in a 4-arm linker are not identical, for example... Figure 6C Seq 4 and Seq 5 in the example. In some embodiments, the stapler sequences of the two linker oligonucleotides in the 4-arm linker are identical and palindromic, which allows hybridization of two linker oligonucleotides with the same sequence. See, for example, Figure 6D Seq 6 and Figure 6E Seq 7 and Seq 8 in the example.

[0114] Z connector and X connector

[0115] In some embodiments, two linker oligonucleotides are joined to form a Z-linker. Each linker oligonucleotide in the Z-linker contains a primer sequence complementary to and capable of hybridizing with a DNA template, such as a linker for a DNA multiplier. In some embodiments, each primer sequence contains an extendable 3' end and can be used as a primer to create a second strand based on the DNA template. Each linker oligonucleotide in the Z-linker also contains a stapler sequence complementary to the adaptor sequence of the other linker oligonucleotide, such that hybridization of the two stapler sequences results in the formation of a partial hybrid between the two linker oligonucleotides. In some embodiments, the stapler sequence of the linker oligonucleotide is palindromic, and the two linker oligonucleotides of the Z-linker have the same sequence. In some embodiments, the stapler sequence of the linker oligonucleotide is non-palindromic, and the two linker oligonucleotides are different.

[0116] The 3' end of the linker oligonucleotide can extend to form a second strand. In some cases, the two second strands thus formed are joined at the 5' end via a Z-linker.

[0117] Figure 1A An illustrative example of a Z-connector consisting of a pair of linker oligonucleotides, each linker oligonucleotide containing a stapler sequence and a primer sequence, wherein the stapler sequence is located at the 5' end of the primer sequence. The stapler sequences of this pair of linker oligonucleotides are complementary, and their annealing links the 5' end linker oligonucleotides together to form a 2-arm Z-connector. The primer sequence hybridizes to a DNB template (e.g., the first strand), and each linker oligonucleotide extends to form a second strand, resulting in the ligation of two second strands at the 5' end (lower right inset). In this case, the extension is carried out by strand displacement DNA polymerase, which forms a branched structure in which each second strand hybridizes with a portion of the DNA template.

[0118] In some implementations, the linker oligonucleotides form an X-linker, wherein two identical linker oligonucleotides are linked by a palindromic sequence, and each linker oligonucleotide has an additional sequence at its 5' end that can hybridize with another linker oligonucleotide having a non-palindromic stapler sequence. Each linker oligonucleotide also contains a primer sequence (e.g., an adaptor of a DNA multiplier) that is complementary to and can hybridize with the DNA template. Thus, this X-linker structure allows for multiple (potentially four or more) 3' extendable primer sequences.

[0119] For example, such as Figure 2As shown, the X linker may comprise a pair of D-Bb-A linker oligonucleotides (“oligonucleotide linker 1”) and a pair of d-cC-A linker oligonucleotides (“oligonucleotide linker 2”). The two D-Bb-A linker oligonucleotides hybridize to each other via a palindromic stapler sequence Bb, and the two d-cC-A linker oligonucleotides hybridize to each other via a palindromic stapler sequence cC. Each D-Bb-A linker oligonucleotide also hybridizes to one of the d-cC-A linker oligonucleotides via complementary stapler sequences D and d. This produces a structure with four primer sequences capable of hybridizing to a DNA template (“structure 1”, as shown). Figure 2 (As shown in the lower left image). Each of the four primer sequences contains an extendable 3' end that can extend to produce a second strand, which is the reverse complement of the DNA template.

[0120] The X-connector can also be used in a configuration such as "Structure 2" ( Figure 2 The form shown in the bottom right inset is illustrated. Two D-Bb-A linker oligonucleotides are annealed with four d-cC-A linker oligonucleotides, which produces a structure with multiple primer sequences (A) and redundant single-stranded arms (e.g., "D" or "d"). These redundant arms allow for continuous structural growth as a random network. For example, "D" is readily complementary to any "d" region and can be annealed to "d" to extend the structure to any form.

[0121] Example sequences are shown below. A single underlined sequence is a primer sequence (A); bold is a palindromic stapler sequence (Bb); and a double underlined sequence is a non-palindromic stapler sequence (D or d).

[0122]

[0123] as well as

[0124]

[0125] Second linker oligonucleotide

[0126] In some cases, the method further involves hybridizing a linker oligonucleotide with the second strand (these linker oligonucleotides are referred to as second linker oligonucleotides). The second linker oligonucleotides can contain any components arranged in any conformation as described above; that is, they can also contain a stapler sequence and a primer sequence with an extendable 3' end. In some cases, the second linker oligonucleotide is a sequencing primer and is used to generate a sequence readout of the second strand. As described below, the sequence readout of the second strand can be combined with the sequence readout of the first strand to construct the sequence information of the target DNA. See also Figure 1B .

[0127] The Seq 12 below is an example of one implementation of the second linker oligonucleotide. Seq 12 consists of subsequences Seq 12.1, Seq 12.2, and Seq 12.3.

[0128] GTCTCCAGTCGAAGCCCGATCGGAACCATGGTTCCGTCTCCAGTCGAAGCCCGATC,3'blocked(SEQ ID NO:6)

[0129] Seq 12.1

[0130] GTCTCCAGTCGAAGCCCGATC(SEQ ID NO:7)

[0131] Seq 12.2

[0132] GGAACCATGGTTCC(SEQ ID NO:8)

[0133] Seq 12.3

[0134] GTCTCCAGTCGAAGCCCGATC(SEQ ID NO:9)

[0135] Seq 12.1 (SEQ ID NO:7) and Seq 12.3 (SEQ ID NO:9) are identical repeating sequences that hybridize with the region of the second strand (also known as the second strand branch) of DNB (the inverse complementary strand of the original DNB). Seq 12.2 is a region with internal complementarity, which allows two oligonucleotide molecules to aggregate together and hybridize to form a 4-arm structure.

[0136] 6. The second strand is partially substituted through the extension linker oligonucleotide.

[0137] As described above, the linker oligonucleotide of the present invention may contain a primer sequence having an extendable 3' end, thus the linker oligonucleotide can be used as a primer. As described above, the linker oligonucleotide may have a 3'-hydroxyl chemical group, which allows it to be extended using one or more DNA polymerases as a primer. In some embodiments, the linker oligonucleotide contains a reversible 3' blocking group, which can be cleaved to produce an extendable 3' end. Therefore, in some embodiments, at least two linker oligonucleotides are extended to produce two second strands, i.e., strands having sequences that are reverse complementary to the DNA template. Depending on the relative positions of the two second strands, the strand located at the 5' end of the other strand is called the upstream strand, and the other strand is called the downstream strand. For example, Figure 1A This shows how the linker oligonucleotides (in) extend the two connections. Figure 1AThe two second chains (represented as "connected second chain branches") are generated. The chain shown on the left is located at the 5' end of the chain on the right; in this configuration, the chain on the left is the upstream chain, and the chain on the right is the downstream chain.

[0138] Multiple linker oligonucleotides can be extended to generate a series of second strands. Any single second strand in this series can be considered as a downstream second strand (relative to an upstream second strand) and an upstream second strand (relative to a downstream second strand). For example, extending the linker oligonucleotides produces a series of second strands, including second strand #1, second strand #2, and second strand #3. #1, #2, and #3 hybridize or partially hybridize with the DNA template and exist in order from 5' to 3'. #2 is an upstream second strand relative to #3; at the same time, #2 is also a downstream second strand relative to second strand #1.

[0139] In some implementations, the production of the second strand involves at least two steps. The first step includes extending at least two first-strand head oligonucleotides using a DNA polymerase (e.g., a non-strand displacement polymerase or a strand displacement polymerase) to generate at least two partially extended second strands, a partially extended upstream second strand, and a partially extended downstream second strand. Both strands fully hybridize with the DNA template.

[0140] The second step involves further extending the two partially extended second chains with a chain-displacement polymerase, during which the upstream portion of the extended second chain displaces the downstream portion of the extended second chain, thereby producing a partially hybridized downstream second chain.

[0141] These primers can be "extension primers" or "sequencing oligonucleotides." "Extension primers" are used in primer extension reactions to generate the second strand described above. Therefore, extension primers are substrates for DNA polymerase and can be extended by adding nucleotides.

[0142] Under the guidance of this disclosure, the selection or design of primers and probes for use in this invention (e.g., primers known to be capable of extension or ligation under sequencing assay conditions) will be entirely within the capabilities of those skilled in the art. This invention is not intended to limit the scope of the invention; the length of the extending primers is generally in the range of 10-100 nucleotides (typically 12-80 nucleotides, and often 15-80 nucleotides).

[0143] It should be understood that primers and probes can be completely or partially complementary to the stapler sequence in the adaptor they hybridize with. For example, primers can have at least 85%, 90%, 95%, or 100% identity with the sequence they hybridize with.

[0144] The primer may also contain an additional sequence at its 5' end that is not complementary to the primer-binding sequence in the adapter (i.e., the sequence of the primer-binding site). The length of the non-complementary portion of the primer may not interfere with hybridization between the primer and its primer stapler sequence. Typically, the length of the non-complementary portion is 1 to 100 nucleotides. In some embodiments, the length of the non-complementary portion is 4 to 8 nucleotides. The primer may contain DNA and / or RNA portions, and in some methods, the primers used in this invention may have one or more modified nucleotides containing modifications to base, sugar, and / or phosphate ester portions.

[0145] "Sequencing oligonucleotides" can be extension primers used in sequencing-by-synthesis (also known as "extension sequencing") reactions. "Sequencing oligonucleotides" can be oligonucleotides used in ligation sequencing methods, such as the "combined probe-anchored ligation reaction" (cPAL) (including single, dual, and multiple cPALs) described in U.S. Patent Publication 20140213461, which is incorporated herein by reference for all purposes. In short, cPAL comprises a cycle of the following steps: First, the "sequencing oligonucleotide" (or "anchor") hybridizes to a complementary sequence in the adaptor of the second DNA strand described above. Then, an enzymatic ligation reaction is performed between the anchor and a fully degenerate group of probes (e.g., 8-mer probes labeled with a fluorescent dye). The probes may contain, for example, about 6 to about 20 bases in length, or about 7 to about 12 bases in length. In any given cycle, the structure of the 8-mer probe group used is such that the identity of one or more of its positions is associated with the identity of the fluorophore to which it is attached, e.g., an 8-mer probe. In variants of the basic cPAL known in the art (e.g., multiple cPAL), partially or fully degenerate secondary anchors are used to increase the readable sequence.

[0146] In some implementations, a strand displacement polymerase is used to generate a partially replaced second strand (subsequent fragment), wherein both the overhang and the double-stranded portion are attached to the DNA template polynucleotide (e.g., a DNB DNA strand). The extension reaction can be controlled to avoid complete replacement of the second strand (i.e., the "subsequent strand" or "subsequent fragment") and to produce a second strand with an overhang length suitable for sequencing. This can be achieved by selecting one (or more) polymerases with suitable polymerization rates or other properties to control the reaction process, and by using various reaction parameters including (but not limited to) reaction temperature, reaction duration, primer composition, DNA polymerase, primer and dents concentration, additives, and buffer composition. Optimal conditions can be determined empirically.

[0147] 6.1 DNA polymerase

[0148] One method for controlling the extension-displacement reaction is to use a DNA polymerase with suitable strand displacement activity to generate the second strand. DNA polymerases with strand displacement activity include, but are not limited to, Phi29, BstDNA polymerase, the Klenow fragment of DNA polymerase I, and Deep-Vent RDNA polymerase (NEB#M0258). These DNA polymerases are known to have varying degrees of strand displacement activity. See Kornberg and Baker (1992, DNA Replication, 2nd ed., pp. 113-225, Freeman, NY). Following the guidance of this disclosure, those skilled in the art can select a DNA polymerase suitable for carrying out this method.

[0149] 6.2 Polymerase, primers, and dNTP concentrations

[0150] Another way to control the extension-displacement reaction is to use an appropriate concentration of DNA polymerase with strand displacement activity, or to control the concentration of dNTPs, or the concentration of linker oligonucleotides used as primers.

[0151] 6.3 Additives

[0152] In some embodiments, the extension reaction rate is controlled by including reagents in the reaction buffer that affect the formation of double strands between the extension primer and the DNA template, such as DMSO (e.g., 1%-2%), betaine (e.g., 0.5M), glycerol (e.g., 10%-20%), T4 G32 SSB (e.g., 10-20 ng / μl), and size exclusion agents.

[0153] 6.4 Temperature

[0154] The reaction temperature can also be controlled to allow for appropriate rates of polymerization and chain displacement. Higher temperatures generally result in a greater degree of chain displacement. In some embodiments, the reaction temperature is maintained in the range of 20°C–37°C, such as 32°C, 33°C, 34°C, 35°C, 36°C, or 37°C, to avoid complete displacement.

[0155] In some methods, the extension reaction is controlled by using a mixture of conventional (extendable) primers and non-extendable primers (i.e., 3' end-blocking primers). Non-extendable primers block extension via chemical blocking groups, for example, that prevent polymerization by DNA polymerase. By mixing these two different primers in different ratios, the length of the double-stranded (hybridization) portion of the newly synthesized complementary DNA strand (subsequent fragment) can be controlled. For example, in one method, a mixture of first primers is used, wherein 50-70% is non-extendable (“blocking”) and 30-50% is extendable (“unblocking”). Many types of non-extendable primers are known in the art and will be suitable for this invention.

[0156] 6.5 Reaction Time

[0157] In some embodiments, the extension-displacement reaction is controlled by terminating the reaction after a specific period of time following the attainment of the desired second chain length. In some embodiments, the reaction is terminated 5, 10, 20, 30, 40, or 60 minutes after initiation. Methods for terminating the reaction are well known in the art, such as by incorporating ddNTPs or by adding a chemical solution (e.g., Tris buffer containing 1.5 M NaCl). In one embodiment, termination is achieved by incorporating ddNTPs after adding Tris buffer containing 1.5 M NaCl to the reaction.

[0158] 7. Sequencing

[0159] In some embodiments, the claimed invention provides a method for determining the sequence of a second strand produced as described above. The method comprises hybridizing a sequencing oligonucleotide with a sequence in the second strand complementary to at least a portion of an adaptor of a DNA template (e.g., a DNA multiplier), and determining the nucleotide sequence of at least a portion of the sequence complementary to the target DNA sequence. Sequencing can be performed using a sequencing-by-synthesis method, a ligation sequencing method, or both.

[0160] In some implementations, any linker oligonucleotide as described above can be used as a sequencing oligonucleotide.

[0161] In one implementation, the second strand hang-off is sequenced by extending a primer (e.g., a second linker oligonucleotide) that hybridizes to the complementary sequence of the monomeric adaptor, for example, as... Figure 1B As shown.

[0162] In another implementation, primers that hybridize with the monomeric adaptor are also used to sequence the DNA template strand. The sequence information from the second strand is paired with the sequence generated by sequencing the DNA template to determine the entire target DNA sequence.

[0163] It will be apparent to the reader that variations of the specific implementations outlined herein may be used. In one approach, an extension primer (e.g., a first linker oligonucleotide) and a sequencing oligonucleotide (e.g., a second-strand oligonucleotide) bind to different portions of the adaptor sequence. In another approach, the extension primer and the sequencing oligonucleotide bind to the same portion of the adaptor sequence (e.g., a complement of the same portion of the adaptor sequence used for extension and the adaptor sequence used for sequencing).

[0164] The overhanging sequence can be determined using any suitable sequencing method (e.g., SBS, pyrosequencing, ligation sequencing, etc.). In some implementations, more than one sequencing method is used. For example, one method (e.g., cPAL) can be used to sequence the DNA template strand, and a different method (e.g., SBS) can be used to sequence the second strand.

[0165] Sequencing-by-synthesis (SBS) relies on DNA polymerase activity to extend the strand during the sequencing reaction step. SBS is well known in the art. See, for example, U.S. Patent Nos. 6,787,308 and 8241573B2 and Shendure et al., 2005, Science, 309:1728-1739. Sequencing of DNA nanospheres can be performed through a variety of processes. In one method, the loop used to generate the DNB is prepared with a DNA region of known sequence (adaptor) and an adjacent sequence of unknown identity to be determined. One function of the adaptor is to provide a primer hybridization site such that primer extension will result in the addition of a nucleotide to the “unknown” or “to be determined” region. Nucleotides are added at one position each time if reversibly blocked at the 3' position and are complementary to the base position in the DNB. After the 3' blocking group is removed, an additional position can be read in the next cycle. The fluorescent part of the base type is used to detect the incorporated base, thus revealing the base at that position in the DNB.

[0166] Alternatively, ligation sequencing can be used. Primers or anchors can be extended by ligating fluorescent oligonucleotides that extend to unknown sequences. In this sequencing method, a fluorescent oligonucleotide with degenerate bases is ligated to a starting anchor; however, one base of the oligonucleotide is defined and associated with the fluorescent moiety. The ligation of the oligonucleotide probe to the anchor creates stable fluorescence after washing off excess probe and depends on the recognition of the defining base complementary to the base at the same position as the DNB. For example, ligation sequencing is described in, for instance, Shendure et al., 2005, Science, 309:1728-1739.

[0167] Other sequencing methods can also be used, such as pyrosequencing (see, for example, Ronaghi et al., Anal. Biochem. (1996) 242: 84–89) and hybridization sequencing (see, for example, Drmanac et al., Advances in Biochemical Engineering / Biotechnology (2002) 77: 75-101).

[0168] The order of adding primers

[0169] The order in which the extending primers (e.g., the first and second connector oligonucleotides) are added can vary. For example, in some embodiments, the first connector oligonucleotide and polymerase are added, and the second strand is synthesized (at least partially) before the addition of the second connector oligonucleotide. In another approach, the first and second connector oligonucleotides are added approximately simultaneously. For example, they can be added together in the same composition, or they can be added separately, approximately 1 minute apart or approximately 5 minutes apart. The first and second extending primers can be added in any order.

[0170] In methods that use a DNA polymerase without strand displacement activity to generate a second strand, or a DNA polymerase with strand displacement activity to generate the same second strand, primers may need to be added sequentially.

[0171] It should be recognized that a single oligonucleotide can be used as an extension primer for generating the second strand and for sequencing.

[0172] It will be further recognized that multiple different primers and / or multiple different sequencing oligonucleotides can be used in the same sequencing reaction.

[0173] One or more sequencing oligonucleotides for the second strand are typically added after the second strand extension-replacement is terminated using the methods disclosed herein.

[0174] In some embodiments, the second linker oligonucleotide is used as a sequencing oligonucleotide for overhang hybridization with the second strand. In some embodiments, the sequencing oligonucleotide has a sequence complementary to and thus hybridizes with a known sequence within the second strand. In some embodiments, the sequencing oligonucleotide hybridizes with a sequence in the second strand that is complementary to at least a portion of the adaptor in the DNA multiplexer. In some embodiments, the sequencing oligonucleotide is partially or completely complementary to the first linker oligonucleotide.

[0175] 8. DNA polymerase

[0176] The methods of this invention can be performed using methods, tools, and reagents well known to those skilled in the art of molecular biology and MPS sequencing, including nucleic acid polymerases (RNA polymerase, DNA polymerase, reverse transcriptase), phosphatases and phosphorylases, DNA ligases, etc. In particular, certain primer extension steps can be performed using one or more DNA polymerases. Some extension steps are performed using DNA polymerases with strand displacement activity.

[0177] In some embodiments, the methods disclosed herein use one or more DNA polymerases and the strand substitution activity of one (or more) DNA polymerases to generate a DNA strand complementary to a DNA template. In one method, the present invention uses a DNA polymerase having strong 5'→3' strand substitution activity. Preferably, the polymerase does not have 5'→3' exonuclease activity. However, a DNA polymerase having 5'→3' exonuclease activity may be used when the activity does not impede the implementation of the method of the present invention (e.g., by using reaction conditions that inhibit exonuclease activity).

[0178] The term "strand displacement activity" describes the ability of a polymerase to displace downstream DNA encountered during synthesis. Strand displacement activity is described in U.S. Patent No. 20120115145 (incorporated herein by reference) as follows: "Strand displacement activity" refers to the phenomenon where a biological, chemical, or physical agent (e.g., a DNA polymerase) causes a paired nucleic acid to dissociate from its complementary strand in a 5' to 3' direction, binding to and approaching template-dependent nucleic acid synthesis. The strand displacement begins at the 5' end of the paired nucleic acid sequence, thus the enzyme immediately proceeds with nucleic acid synthesis at the 5' displacement site. The newly synthesized nucleic acid and the displaced nucleic acid typically have the same nucleotide sequence complementary to the template nucleic acid strand. Strand displacement activity can be located on the same molecule as the molecule that confers nucleic acid synthesis (particularly DNA synthesis) activity, or it can be a separate and independent activity. DNA polymerases (e.g., E. coli DNA polymerase I, the Klenow fragment of DNA polymerase I, T7 or T5 phage DNA polymerases, and HIV reverse transcriptases) are enzymes that possess both polymerase and strand displacement activities. Reagents such as helicases can be combined with inducers that do not have strand displacement activity to produce a strand displacement effect, that is, a nucleic acid substitution coupled with a synthesized nucleic acid of the same sequence. Similarly, proteins such as Rec A or single-strand binding proteins from E. coli or other organisms can be combined with other inducers to produce or promote strand displacement (Kornberg and Baker, 1992, DNA Replication, 2nd ed., pp. 113-225, Freeman, NY).

[0179] In one method, the polymerase is Phi29 polymerase. Phi29 polymerase exhibits strong displacement activity at moderate temperatures (e.g., 20–37 °C).

[0180] In one method, a large fragment of Bst DNA polymerase (NEB#M0275) is used. Bst DNA polymerase is active at high temperatures (~65°C).

[0181] In one approach, the polymerase is Deep-VentR DNA polymerase (NEB#M0258) (Hommelsheim et al., Scientific Reports 4:5052 (2014)).

[0182] 9. Substrate and compartment

[0183] In some applications, DNA template polynucleotides are immobilized on a substrate. Typically, immobilization occurs prior to the synthesis of the second strand discussed above. Exemplary substrates can be substantially planar (e.g., glass slides) or non-planar and can be single or composed of multiple different units (e.g., beads). Exemplary materials include glass, ceramics, silica, silicon, metals, elastomers (e.g., silicone), and polyacrylamide (e.g., polyacrylamide hydrogel; see WO 2005 / 065814). In some embodiments, the substrate comprises an ordered or disordered array of immobilization sites or pores. In some methods, target DNA polynucleotides are immobilized on a substantially planar substrate (e.g., a substrate comprising an ordered or disordered array of immobilization sites or pores). In some methods, target DNA polynucleotides are immobilized on beads.

[0184] Polynucleotides can be immobilized onto substrates using various techniques, including covalent and non-covalent attachment. In one embodiment, the surface may include a capture probe that forms a complex (e.g., a double-stranded form of a double-stranded nucleotide) with components of the polynucleotide molecule (e.g., an adaptor oligonucleotide). In another embodiment, the surface may have reactive functional groups that react with complementary functional groups on the polynucleotide molecule to form covalent bonds. Long DNA molecules, such as several nucleotides or larger, can also be effectively attached to hydrophobic surfaces, such as clean glass surfaces with low concentrations of various reactive functional groups (e.g., -OH groups). In yet another embodiment, polynucleotide molecules can be adsorbed onto the surface through non-specific interactions with the surface or through non-covalent interactions such as hydrogen bonds, van der Waals forces, etc.

[0185] For example, DNA nanospheres can be immobilized to discrete, spaced-apart regions, as described in U.S. Patent No. 8,609,335 to Drmanac et al. In one approach, DNB is immobilized on a substrate by hybridization with an immobilized probe sequence, and a solid-phase nucleic acid amplification method is used to generate clonal clusters containing DNA template polynucleotides. See, for example, WO 98 / 44151 and WO00 / 18957.

[0186] In some implementations, the DNA template polynucleotides are separated in an emulsion, droplet, bead and / or micropore prior to the primer extension step (Margulies et al. "Genome sequencing in microfabricated high-density picolitre reactors." Nature 437:7057 (2005); Shendure et al. "Accurate multiplex polony sequencing of an evolved bacterial genome." Science 309, 1728–1732 (2005)).

[0187] Typically, DNA nanospheres are arranged in ordered or random arrays on the substrate. In many applications, substrate adsorption is mediated by substrate-protein-DNA interactions. Furthermore, to achieve stable nanosphere arrays via sequencing cycles, post-attachment deposition of protein layers can improve the stability of the DNA array; see WO2013066975A1, the entire contents of which are incorporated herein by reference.

[0188] 10. Array of DNA complexes

[0189] In one aspect, the invention includes an array of DNA complexes. In one aspect, the array is a support comprising an array of discrete regions, wherein a plurality of regions comprise (a) a clonal cluster of a single-stranded DNA template and a plurality of adapter oligonucleotides, wherein the DNA template is a single-stranded multiplex comprising a plurality of monomers, wherein each monomer comprises an adaptor sequence and a DNA target sequence, wherein each adapter oligonucleotide comprises a primer sequence complementary to and hybridizing with the adaptor sequence of the DNA template, wherein the primer sequence comprises an extendable 3' end, and wherein at least two of the plurality of adapter oligonucleotides hybridizing with the DNA template are linked to each other.

[0190] In one aspect, the present invention includes a DNA complex comprising a DNA template, two or more second strands, wherein each second strand includes a suspension region and a hybridization region that hybridizes with the DNA template, wherein two or more second strands are complementary to the DNA template, and wherein at least two second strands are joined at their respective 5' ends.

[0191] In some embodiments, multiple second-connector oligonucleotides are used as primers for primer extension (e.g., sequencing-by-synthesis reactions), or extension products of such primers, or oligonucleotides capable of being used as anchors for ligation sequencing, or ligation products of such oligonucleotides and labeled probes (e.g., labeled cPAL probes). In one method, the second-connector oligonucleotide contains a portion complementary to the adaptor sequence and can be extended to sequence the second strand.

[0192] It should be understood that the DNA complex of the array can contain any properties of the complexes described herein or prepared according to the methods described herein. Furthermore, the complex can have any combination of one or more of the following characteristics: (i) the array contains at least 10 6 (ii) a discrete region, wherein the DNA is single-stranded, (iii) wherein the second adapter oligonucleotide contains at least 10 bases of the adapter sequence, preferably at least 12 bases, optionally at least 15 bases, and (iv) the second adapter oligonucleotide is completely complementary to the second DNA strand to which it is hybridized.

[0193] 10. Composition

[0194] In one aspect, this disclosure provides a composition comprising an array as described in Section 9 above and an enzyme selected from DNA ligases and DNA polymerases. In some embodiments, the composition comprises two DNA polymerases, one with strand substitution activity and the other without. In some embodiments, the composition further comprises fluorescently labeled dNTPs (e.g., dNTP analogs) and / or a pool of labeled oligonucleotide probes.

[0195] 11. Example

[0196] 11.1 Example 1: Z-linker to RhoA [adenosine (“A”) base strength] decrease, mapping rate and

[0197] Impact of error rate

[0198] DNBs were generated using rolling circle amplification of a single-stranded circular library containing fragments of human genomic DNA. The DNBs were immobilized on a DNB array chip and sequenced using a BGIseq500. Sequencing was performed in a cyclic synthesis-while-sequencing process using DNA polymerase with the addition of a reversibly blocking fluorescent terminator. Incorporation and deblocking occurred at a temperature of 50°C to 60°C. Standard primers, such as primers that do not include the stapler sequence and do not link multiple subunits of the DNB, or linker oligonucleotides with a Seq 6 (A-bB-A) conformation, were used as sequencing oligonucleotides. Two Seq 6 linker oligonucleotides hybridized to each other to form a Z-linker. The -500 software provides indications that determine the mapping rate and error rate from a single reading.

[0199] Sequencing oligonucleotides (1 μM) were hybridized with DNB, and SBS was performed for 175 cycles at temperatures ranging from 20°C to 57°C. During each sequencing cycle, reversible termination nucleotides (RTs) labeled with four different fluorescent dyes were incorporated. Additionally, unlabeled nucleotides were incorporated into each sequencing cycle to further incorporate each subunit of each DNB during each cycle. After imaging, the 3' blocking group was removed with a phosphine reagent before the next incorporation event.

[0200] Figure 3 This shows the effect of Z-linker on intensity reduction over multiple sequencing cycles (e.g., more than 175 cycles). The Y-axis represents the intensity measurement of a single base set (A base) (called "Rho"). Rho was processed according to BGIseq500 software to indicate the average intensity of the DNB after allocation to the base set. Lane 1 (AL1) (i.e., the signal from sequencing using Z-linker) showed a faster intensity decrease over 170 sequencing cycles compared to lane 2 (AL2) (i.e., the signal from sequencing using Z-linker). Without being bound by any theory, signal decline as sequencing cycles progress can have a variety of potential causes, such as DNB splicing or structural loss of DNB quality, loss of extended strands, irreversible termination of nucleotides, and heterogeneous base reads within the DNB. Slower signal decline when sequencing using Z-linker indicates less DNB loss.

[0201] A stable DNB structure can help keep the DNB strength much higher than the background, which leads to a lower error rate and a higher mapping rate. Figure 4A The results showed that for the first 66 bases, the flow pool lanes with linker oligonucleotides had a slightly higher mapping rate (82%) than the lanes with standard primers (81.2%). For the last 66 bases, the mapping rate using linker oligonucleotide sequencing was 82%, which was significantly higher than the 72% mapping rate shown by sequencing with standard primers.

[0202] like Figure 4B As shown, the error rate of Z-linked oligonucleotides is generally lower than that of standard primers.

[0203] For example, for the last 66 bases, the error rate is about half when linker oligonucleotides are included—0.57% for linker oligonucleotides and 1.17% for standard primers.

[0204] 11.2 Example 2: The impact of another Z-connector on mapping rate and error rate

[0205] The DNB was generated and sequenced as described in Example 1, except that the linker oligonucleotide was Seq3(bB-A), which contains the palindromic stapler sequence bB and the primer sequence A. Hybridization of the two linker oligonucleotides 3 forms a Z-linker.

[0206] The mapping and inconsistencies between the first 50 bases of the reading and the second 50 bases of the reading were determined. For example... Figure 5A As shown, for the first strand of 50 bases, the mapping rate of the flow-through lane with the Z-linker stapler sequence (94%) was slightly higher than that of the lane with the standard primer (93%). For the second strand of 50 bases, the mapping rate of the sequencing reaction with the Z-linker was 91%, which was significantly higher than the 83% mapping rate of the sequencing reaction with the standard primer.

[0207] like Figure 5B As shown, the error rate of sequencing reactions using Z-adaptors is generally lower than that using standard primers. For example, for 50 bases in the second strand, the error rate of sequencing reactions using Z-adaptors is 0.31%, which is only half of the error rate of sequencing reactions using standard primers (approximately 0.63%).

[0208] Illustrative embodiments of the present invention

[0209] The following are non-limiting embodiments of the present invention.

[0210] Implementation Scheme 1. A method for preparing a DNA template for nucleic acid analysis, the method comprising hybridizing a plurality of first linker oligonucleotides with a DNA template,

[0211] The DNA template is a single-stranded multiplex containing multiple monomers, each of which contains an adaptor sequence and a DNA target sequence.

[0212] Each of the first linker oligonucleotides contains a template hybridization sequence, wherein the template hybridization sequence is complementary to and hybridizes with the adaptor sequence of the DNA template, and

[0213] At least two of the first linker oligonucleotides that hybridize with the DNA template are linked together.

[0214] Implementation Scheme 2. The method as described in Implementation Scheme 1, wherein the template hybridization sequence is a primer sequence, and wherein the primer sequence includes an extendable 3' end.

[0215] Implementation Scheme 3. The method of Implementation Scheme 1, wherein the method further comprises extending at least two first linker oligonucleotides to generate at least two second strands by one or more DNA polymerases.

[0216] At least two first linker oligonucleotides are linked together and hybridize with the DNA template.

[0217] This results in at least two second chains, each chain having a 5' end, wherein the 5' ends of the two second chains are connected.

[0218] Implementation Scheme 4. The method as described in Implementation Scheme 1, 2 or 3, wherein at least two first linker oligonucleotides are linked by DNA hybridization, covalent bond or both.

[0219] Implementation Scheme 5. The method as described in Implementation Scheme 1, 2 or 3, wherein at least two first linker oligonucleotides each contain a stapler sequence, wherein the at least two first linker oligonucleotides are linked by hybridization of the respective stapler sequences.

[0220] Implementation Scheme 6. The method of any one of Implementation Schemes 1-3, wherein at least two first linker oligonucleotides are linked by a shared scaffold.

[0221] Implementation Scheme 7. The method of Implementation Scheme 5, wherein at least one of the first linker oligonucleotides is included in two cleavage sites flanking the stapler sequence, wherein the stapler sequence is cleaved at the cleavage sites.

[0222] Implementation Scheme 8. The method as described in Implementation Scheme 5, wherein at least two first linker oligonucleotides hybridize with different regions of a shared scaffold, thereby linking at least two first linker oligonucleotides.

[0223] Implementation Scheme 9. The method of Implementation Scheme 5, wherein at least two first linker oligonucleotides are bound to the DNA template prior to their binding to each other via corresponding stapler sequences.

[0224] Implementation Scheme 10. The method as described in Implementation Scheme 9, wherein the method comprises:

[0225] 1) In the reaction, the blocking oligonucleotide is hybridized with the stapler sequence of at least two first linker oligonucleotides, thereby forming a partially double-stranded first linker oligonucleotide.

[0226] Each of the double-stranded portions contains i) a double-stranded region consisting of a blocking oligonucleotide and a stapler sequence, thereby preventing the stapler sequences of the first linker oligonucleotides from hybridizing with each other, and ii) a single-stranded region containing a sequence that serves as a template hybridization sequence.

[0227] 2) A DNA template is added to the reaction with the first linker oligonucleotide, where the primer sequence of a portion of the double-stranded first linker oligonucleotide binds to the DNA template.

[0228] 3) Removal of the blocking oligonucleotide through one or more of the following: increasing the reaction temperature to cause the blocking oligonucleotide to dissociate from the DNA template, or enzymatically or chemically degrading the blocking oligonucleotide.

[0229] 4) Washing to remove the blocking oligonucleotide, and

[0230] 5) Adjust the temperature to allow the stapler sequences of the first linker oligonucleotides to hybridize with each other.

[0231] Implementation Scheme 11. The method of Implementation Scheme 5, wherein, prior to the binding of the primer sequence to the DNA template, stapler sequences of at least two first linker oligonucleotides are bound together to form a linked first linker oligonucleotide.

[0232] Implementation Scheme 12. The method of Implementation Scheme 11, wherein the method comprises using first linker oligonucleotides connected at a concentration below a predetermined threshold such that two first linker oligonucleotides bind to a single DNA template molecule.

[0233] Implementation Scheme 13. The method as described in Implementation Scheme 5, wherein the stapler sequence is a palindromic stapler sequence, and

[0234] For each of at least two first linker oligonucleotides, the palindromic stapler sequence is located at the 5' end of the template hybridization sequence.

[0235] Implementation Scheme 14. The method of Implementation Scheme 5, wherein at least two first linker oligonucleotides comprise two complementary non-palindromic stapler sequences, one on each first linker oligonucleotide; and

[0236] At least two of the first linker oligonucleotides are linked by hybridization of two complementary non-palindromic stapler sequences.

[0237] Implementation Scheme 15. The method as described in Implementation Scheme 5, wherein at least two first linker oligonucleotides each comprise a non-palindromic stapler sequence and a palindromic stapler sequence.

[0238] Implementation Scheme 16. The method as described in Implementation Scheme 15, wherein for each of at least two first linker oligonucleotides, a palindromic stapler sequence is inserted between a non-palindromic stapler sequence and a template hybridization sequence.

[0239] Implementation Scheme 17. The method of Implementation Scheme 5, wherein at least two first linker oligonucleotides each contain a stapler sequence inserted between two primer sequences, wherein the stapler sequences on the at least two first linker oligonucleotides hybridize with each other.

[0240] Implementation Scheme 18. The method as described in Implementation Scheme 5, wherein the stapler sequence has a length ranging from 8 to 50 nucleotides.

[0241] Implementation Scheme 19. The method as described in Implementation Scheme 5, wherein the template hybridization sequence has a length ranging from 15 to 70 nucleotides.

[0242] Implementation Scheme 20. A method for preparing a DNA template for nucleic acid analysis, the method comprising hybridizing a plurality of first linker oligonucleotides with a DNA template in a reaction mixture,

[0243] The DNA template is a single-stranded multiplex containing multiple monomers, each of which contains an adaptor sequence and a DNA target sequence.

[0244] Each of the first linker oligonucleotides contains a primer sequence that is complementary to and hybridizes with the adaptor sequence of the DNA template.

[0245] At least one of the first linker oligonucleotides contains a blocking group at the 3' end of the primer sequence to prevent elongation, and

[0246] At least two of the first linker oligonucleotides that hybridize with the DNA template are linked together.

[0247] Implementation Scheme 21. The method of Implementation Scheme 20, wherein the blocking group is a reversible blocking group, wherein the method further comprises:

[0248] Removal of the blocking group from at least one first linker oligonucleotide, and

[0249] Extend at least one first linker oligonucleotide to generate at least one second chain.

[0250] Implementation Scheme 22. The method as described in Implementation Scheme 5, wherein the first linker oligonucleotide can be cleaved at a site located in the stapler sequence or template hybridization sequence.

[0251] Implementation Scheme 23. The method of Implementation Scheme 20, wherein the method further comprises removing unbound first linker oligonucleotides from the reaction mixture from the DNA template.

[0252] Implementation Scheme 24. The method as described in Implementation Scheme 1, wherein the method further comprises

[0253] 1) Extend at least two of a plurality of first linker oligonucleotides using a non-displacement DNA polymerase to generate a second strand with at least two segments fully hybridized to the DNA template.

[0254] At least two fully hybridized second strands include an upstream second strand and a downstream second strand, and

[0255] 2) Further extend the partially extended upstream second chain and downstream second chain, wherein extending the partially extended upstream second chain is to partially replace the partially extended downstream second chain, thereby producing a partially hybridized downstream second chain.

[0256] Implementation Scheme 25. A DNA complex comprising a DNA template and a plurality of first linker oligonucleotides, wherein the DNA template is a single-stranded multiplex comprising a plurality of monomers, wherein each monomer comprises an adaptor sequence and a DNA target sequence.

[0257] Each of the first linker oligonucleotides contains a template hybridization sequence.

[0258] The template hybridization sequence is complementary to the adaptor sequence of the DNA template and hybridizes, and

[0259] At least two of the multiple first linker oligonucleotides that hybridize with the DNA template are linked to each other.

[0260] Implementation Scheme 26. The DNA complex as described in Implementation Scheme 25, wherein the template hybridization sequence is a primer sequence, and wherein the primer sequence includes an extendable 3' end.

[0261] Implementation Scheme 27. A DNA complex comprising a DNA template, two or more second strands, wherein each second strand comprises a suspension region and a hybridization region for hybridizing with the DNA template.

[0262] Two or more of the second strands are complementary to the DNA template, and

[0263] At least two of the second strands are connected at their 5' ends.

[0264] Implementation Scheme 28. The DNA complex as described in Implementation Scheme 27, wherein the DNA complex further comprises two or more second-strand head oligonucleotides that hybridize with two or more second strands.

[0265] Each second linker oligonucleotide containing the second stapler sequence and at least two second linker oligonucleotides are linked by hybridization of the corresponding second stapler sequence.

[0266] Implementation Scheme 29. A DNA array comprising a DNA complex as described in any one of Implementation Schemes 25-28.

[0267] Implementation Scheme 30. Two linker oligonucleotides, each linker oligonucleotide containing a stapler sequence and a primer sequence, wherein the stapler sequence is located at the 5' end of the primer sequence.

[0268] The stapler sequences in the two linker oligonucleotides are complementary to each other and hybridize with each other, thus obtaining two linker oligonucleotides that hybridize with each other.

[0269] Implementation Scheme 31. Two linker oligonucleotides as described in Implementation Scheme 30, wherein the stapler sequence is a palindromic sequence.

[0270] Implementation Scheme 32. Two linker oligonucleotides as in Implementation Scheme 30, wherein the primer sequences on the two linker oligonucleotides have the same sequence.

[0271] Implementation Scheme 33. Two linker oligonucleotides as described in Implementation Scheme 30, wherein each oligonucleotide comprises an additional stapler sequence as a non-palindromic stapler sequence, and wherein the additional non-palindromic stapler sequence is at the 5' end of the stapler sequence.

[0272] Implementation Scheme 34. Two linker oligonucleotides as described in Implementation Scheme 33, wherein an additional non-palindromic stapler sequence in one of the two linker oligonucleotides hybridizes with a stapler sequence in a third linker oligonucleotide.

[0273] Implementation Scheme 35. Two linker oligonucleotides as described in Implementation Scheme 30, wherein at least one comprises a sequence selected from the group consisting of SEQ ID NO:1-10.

[0274] Implementation Scheme 36. A method for preparing a DNA template for nucleic acid analysis, the method comprising immobilizing the DNA template on an array, wherein the DNA template is a DNA multiplex comprising a plurality of monomers, wherein each monomer comprises an adaptor sequence and a DNA target sequence.

[0275] Multiple first-linker oligonucleotides are hybridized to a DNA template, wherein each first-linker oligonucleotide contains a template hybridization sequence.

[0276] The template hybridization sequence is complementary to and hybridizes with the adaptor sequence of the DNA template, and at least two of the first linker oligonucleotides that hybridize with the DNA template are linked to each other.

[0277] Implementation Scheme 37. The method as described in Implementation Scheme 36, wherein the template hybridization sequence is a primer sequence, and wherein the primer sequence includes an extendable 3' end.

[0278] ***

[0279] All publications and patent documents cited herein are incorporated herein by reference as if each such publication or document were specifically and individually indicated to be incorporated herein by reference. Although the invention has been described primarily with reference to specific embodiments, it is also contemplated that other embodiments will become apparent to those skilled in the art upon reading this disclosure, and that it is intended to include such embodiments in the methods of the invention. sequence list <110> Shenzhen BGI Genomics Co., Ltd. <120> DNA linker oligonucleotides <130> 092171-1215354 (5078-WOCN) <140> <141> <150> 62 / 927,060 <151> 2019-10-28 <160> 10 <170> PatentIn version 3.5 <210> 1 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Synthetic oligonucleotides <220> <223> Description of combined DNA / RNA molecules: Synthetic oligonucleotides <400> 1 ggaaccatgg ttccaagtcg gaggccaagc ggtctuagga 40 <210> 2 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Synthetic oligonucleotides <400> 2 aagtcggagg ccaagcggtc t 21 <210> 3 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Synthetic oligonucleotides <400> 3 aggaggaacc atggttccaa gtcggaggcc aagcggtct 39 <210> 4 <211> 94 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Synthetic oligonucleotides <400> 4 cgccgacgca cagggtgcct cgaccgcatg gcgcggaacc atggttccgc gccaactcct 60 tggctcacag aacgacatgg ctacgatccg actt 94 <210> 5 <211> 94 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Synthetic oligonucleotides <400> 5 catgcggtcg aggcaccctg tgcgtcggcg ggctgcatgc cggcatgcag cccaactcct 60 tggctcacag aacgacatgg ctacgatccg actt 94 <210> 6 <211> 56 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Synthetic oligonucleotides <400> 6 gtctccagtc gaagcccgat cggaaccatg gttccgtctc cagtcgaagc ccgatc 56 <210> 7 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Synthetic oligonucleotides <400> 7 gtctccagtc gaagcccgat c 21 <210> 8 <211> 14 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Synthetic oligonucleotides <400> 8 ggaaccatgg ttcc 14 <210> 9 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Synthetic oligonucleotides <400> 9 gtctccagtc gaagcccgat c 21 <210> 10 <211> 26 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Synthetic oligonucleotides <220> <223> Description of combined DNA / RNA molecules: Synthetic oligonucleotides <400> 10 aagtcggagg ccaagcggtc tuagga 26

Claims

1. A method for preparing a DNA template for nucleic acid analysis, the method comprising hybridizing a plurality of first linker oligonucleotides with the DNA template, The DNA template described therein is a single-stranded multiplex containing multiple monomers, each monomer containing an adaptor sequence and a DNA target sequence. Each of the first linker oligonucleotides contains a template hybridization sequence, wherein the template hybridization sequence is complementary to and hybridizes with the adaptor sequence of the DNA template, and In the plurality of first linker oligonucleotides, at least two first linker oligonucleotides are linked to each other by hybridization of stapler sequences located on each linker oligonucleotide or by chemical bonds.

2. The method of claim 1, wherein the at least two first linker oligonucleotides are chemically linked prior to hybridization with the DNA template.

3. The method of claim 1, wherein the template hybridization sequence is a primer sequence, and wherein the primer sequence includes an extendable 3' end.

4. The method of claim 1, wherein the method further comprises extending the at least two first linker oligonucleotides by one or more DNA polymerases to generate at least two second strands. The at least two first linker oligonucleotides are linked together and hybridize with the DNA template. This results in at least two second chains, each chain having a 5' end, wherein the 5' ends of the two second chains are connected.

5. The method of claim 1, 2, 3 or 4, wherein the at least two first linker oligonucleotides are linked by DNA hybridization, covalent bonding or both.

6. The method of claim 1, 2, 3 or 4, wherein each of the at least two first linker oligonucleotides comprises a stapler sequence, wherein the at least two first linker oligonucleotides are linked by hybridization of the respective stapler sequences.

7. The method of claim 5, wherein at least one of the first linker oligonucleotides comprises two cleavage sites located on the flanks of the stapler sequence, wherein the stapler sequence is cleaved and released at the cleavage sites.

8. The method of claim 1, wherein the at least two first linker oligonucleotides bind to the DNA template prior to their binding to each other via the respective stapler sequence.

9. The method of claim 8, wherein the method comprises: 1) In the reaction, the blocking oligonucleotide is hybridized with the stapler sequence of the at least two first linker oligonucleotides, thereby forming a partially double-stranded first linker oligonucleotide. Each of the first linker oligonucleotides in the partially double-stranded oligonucleotide comprises i) a double-stranded region consisting of the blocking oligonucleotide and the stapler sequence, thereby preventing the stapler sequences of the first linker oligonucleotides from hybridizing with each other, and ii) a single-stranded region containing a sequence that serves as a template hybridization sequence. 2) Add a DNA template to the reaction with the first linker oligonucleotide, wherein the template hybridization sequence of the partially double-stranded first linker oligonucleotide binds to the DNA template. 3) The blocking oligonucleotide is removed by one or more of the following methods: increasing the temperature of the reaction to dissociate the blocking oligonucleotide from the DNA template, or enzymatically or chemically degrading the blocking oligonucleotide. 4) Washing to remove the blocking oligonucleotide, and 5) Adjust the temperature to allow the stapler sequences of the first linker oligonucleotides to hybridize with each other.

10. The method of claim 6, wherein prior to the binding of the template hybridization sequence to the DNA template, the stapler sequences of the at least two first linker oligonucleotides bind to each other to form linked first linker oligonucleotides.

11. The method of claim 10, wherein the method comprises using a first linker oligonucleotide of the linker at a concentration below a predetermined threshold such that the two first linker oligonucleotides bind to a single DNA template molecule.

12. The method of claim 6, wherein the stapler sequence is a palindromic stapler sequence, and For each of the at least two first linker oligonucleotides, the palindromic stapler sequence is located at the 5' end of the template hybridization sequence.

13. The method of claim 6, wherein the at least two first linker oligonucleotides comprise two complementary non-palindromic stapler sequences, one on each first linker oligonucleotide; and At least two of the first linker oligonucleotides are linked by hybridization of the two complementary non-palindromic stapler sequences.

14. The method of claim 6, wherein each of the at least two first linker oligonucleotides comprises a non-palindromic stapler sequence and a palindromic stapler sequence.

15. The method of claim 14, wherein for each of the at least two first linker oligonucleotides, the palindromic stapler sequence is inserted between the non-palindromic stapler sequence and the template hybridization sequence.

16. The method of claim 6, wherein each of the at least two first linker oligonucleotides comprises a stapler sequence inserted between the two primer sequences, wherein the stapler sequences on the at least two first linker oligonucleotides hybridize with each other.

17. The method of claim 6, wherein the stapler sequence has a length ranging from 8 to 50 nucleotides.

18. The method of claim 6, wherein the template hybridization sequence has a length ranging from 15 to 70 nucleotides.

19. A method for preparing a DNA template for nucleic acid analysis, the method comprising hybridizing a plurality of first linker oligonucleotides with the DNA template in a reaction mixture. The DNA template described therein is a single-stranded multiplex containing multiple monomers, each monomer containing an adaptor sequence and a DNA target sequence. Each of the first linker oligonucleotides contains a primer sequence that is complementary to and hybridizes with the adaptor sequence of the DNA template. At least one of the first linker oligonucleotides contains a blocking group at the 3' end of the primer sequence to prevent elongation, and At least two of the plurality of first linker oligonucleotides that hybridize with the DNA template are linked to each other by hybridization of a stapler sequence located on each linker oligonucleotide or by chemical bonds.

20. The method of claim 19, wherein the blocking group is a reversible blocking group, and wherein the method further comprises: Remove the blocking group from the at least one first linker oligonucleotide, and The at least one first linker oligonucleotide is extended to generate at least one second chain.

21. The method of claim 6, wherein the first linker oligonucleotide is capable of being cleaved at a site located in the stapler sequence or the template hybridization sequence.

22. The method of claim 19, wherein the method further comprises removing unbound first linker oligonucleotides from the reaction mixture of the DNA template.

23. The method of claim 1, wherein the method further comprises: 1) Extend at least two of the plurality of first linker oligonucleotides using a non-displacement DNA polymerase to generate a second strand with at least two partially extended segments that fully hybridize with the DNA template. The at least two fully hybridized second strands include an upstream second strand and a downstream second strand, and 2) Further extend the partially extended upstream second chain and downstream second chain, wherein extending the partially extended upstream second chain is to partially replace the partially extended downstream second chain, thereby producing a partially hybridized downstream second chain.

24. A DNA complex comprising a DNA template and a plurality of first linker oligonucleotides, wherein the DNA template is a single-stranded multiplex comprising a plurality of monomers, wherein each monomer comprises an adaptor sequence and a DNA target sequence. Each of the first linker oligonucleotides contains a template hybridization sequence. The template hybridization sequence is complementary to and hybridizes with the adaptor sequence of the DNA template, and At least two of the plurality of first linker oligonucleotides that hybridize with the DNA template are linked to each other either by hybridization of a stapler sequence located on each linker oligonucleotide or by a chemical bond.

25. The DNA complex of claim 24, wherein the template hybridization sequence is a primer sequence, and wherein the primer sequence includes an extendable 3' end.

26. A DNA complex comprising a DNA template, two or more second strands, wherein each second strand comprises a suspension region and a hybridization region for hybridizing with the DNA template. Wherein two or more second strands are complementary to the DNA template, and The 5' ends of at least two of the second strands are joined, and the DNA complex further comprises two or more second-strand head oligonucleotides that hybridize with two or more of the second strands. Each second linker oligonucleotide containing the second stapler sequence and at least two second linker oligonucleotides are linked by hybridization of the corresponding second stapler sequence.

27. A DNA array comprising a DNA complex as claimed in any one of claims 24-26.

28. Two linker oligonucleotides, each linker oligonucleotide comprising a stapler sequence and a primer sequence, wherein the stapler sequence is located at the 5' end of the primer sequence. The stapler sequences in the two linker oligonucleotides are complementary to each other and hybridize with each other to obtain two hybridized linker oligonucleotides, wherein the stapler sequence is a palindromic sequence.

29. The two linker oligonucleotides of claim 28, wherein the primer sequences on the two linker oligonucleotides have the same sequence.

30. The two linker oligonucleotides of claim 28, wherein each oligonucleotide comprises an additional stapler sequence that is a non-palindromic stapler sequence, and wherein the additional non-palindromic stapler sequence is at the 5' end of the stapler sequence.

31. The two linker oligonucleotides of claim 30, wherein the additional non-palindromic stapler sequence in one of the two linker oligonucleotides hybridizes with the stapler sequence in the third linker oligonucleotide.

32. The two linker oligonucleotides of claim 28, wherein at least one comprises a sequence selected from the group consisting of SEQ ID NO: 1-10.

33. A method for preparing a DNA template for nucleic acid analysis, the method comprising immobilizing the DNA template on an array, wherein the DNA template is a DNA multiplex comprising a plurality of monomers, wherein each monomer comprises an adaptor sequence and a DNA target sequence. Multiple first linker oligonucleotides are hybridized to the DNA template, wherein each first linker oligonucleotide contains a template hybridization sequence. The template hybridization sequence is complementary to and hybridizes with the adaptor sequence of the DNA template, and at least two of the plurality of first linker oligonucleotides hybridizing with the DNA template are linked to each other by hybridization of a stapler sequence located on each linker oligonucleotide or by a chemical bond.

34. The method of claim 33, wherein the template hybridization sequence is a primer sequence, and wherein the primer sequence includes an extendable 3' end.

Images