A multiplex amplification method

Abstract

The application provides a multiple amplification method, which mainly comprises two processes of linear amplification initiated by low-concentration capture oligonucleotide and exponential amplification initiated by universal primer. Firstly, specific capture oligonucleotide with low concentration is used to combine with target molecules with clear 5' end sequence information and initiate linear amplification; the linear amplification product can obtain a product with complete hairpin structure through self-folding and self-extension, so that an amplification intermediate product with a universal sequence as the end but containing a target sequence is obtained; the amplification intermediate products containing different target sequences can be amplified in an exponential manner by the same universal primer to realize equivalent signal amplification. The detection strategy combining linear amplification and exponential amplification based on the universal primer can finally realize the purpose of equivalent amplification and detection of multiple target molecules.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a multiplex amplification method. Background Technology

[0002] Multiplex PCR (MPCR) refers to a technique that amplifies multiple targets simultaneously in a single PCR reaction, and then uses specific detection methods to detect the amplified products, thereby enabling the detection of multiple targets. MPCR has been extensively studied due to its high efficiency, high throughput, and low cost, significantly improving detection efficiency while reducing costs. MPCR has been applied in many fields, including gene mutation and deletion detection, genotyping and quantification, genetic testing, and companion diagnostics. Currently, MPCR can be mainly classified into liquid-phase MPCR, microfluidic-based MPCR, and solid-phase multiplex PCR.

[0003] Liquid-phase mPCR uses multiple target-specific primers to amplify multiple targets, but this method introduces multiplex amplification primers into the same reaction. As the number of target molecules to be detected increases, the number of nucleotide chains in the tube also increases twofold. The possibility of these nucleotide chains forming dimers or even multimers increases significantly. This can lead to non-specific amplification, decreased target amplification efficiency, and reduced detection sensitivity and specificity; or even non-specific amplification becoming dominant and target amplification failing. Furthermore, this design method can cause inconsistent amplification efficiency for each target molecule. Currently, there are reports of detection strategies based on multiplex ligation-dependent probe amplification (MLPA), hairpin structures (PCT / US2002 / 037238), and two-round amplification (PCT patent WO 96 / 41012). MLPA first designs specific ligation primers and universal amplification primers for the terminal information of different target molecules. However, this technology not only requires a ligation reaction to initiate the reaction, but is also affected by interference from ligase specificity, difficulty in primer preparation, and the number and concentration of primers. PCT / US2002 / 037238 employs a long primer-based amplification mode, which in principle can detect the information type at the 5' end. However, this scheme requires an enzymatic or chemical cleavage step after the first amplification step, as well as a complex pre-amplification and purification process, which not only reduces the sensitivity of the reaction but also increases the complexity of the operation. PCT patent WO 96 / 41012 discloses a two-round amplification detection strategy, but this scheme not only cannot detect the information type at the 5' end of multiple specific target sequences, but also suffers from the problems of a large number of primers and competition for amplification.

[0004] Microfluidic chip-based MPCR confines each amplification to its own independent space by pre-packing different primer pairs into the microwells of the chip. Due to the unique nature of its amplification mechanism, this type of technology requires dedicated detection instruments, and its complexity makes its implementation quite difficult.

[0005] Solid-phase vector-based MPCR mainly includes multiplex detection techniques based on liquid-phase microarrays. Liquid-phase microarrays use encoded microspheres as a matrix for multiplex detection. Although liquid-phase microarrays offer high throughput and efficiency in detection, they do not fundamentally solve the problem of mismatches between numerous primers and templates during multiplex amplification because they require liquid-phase multiplex amplification followed by hybridization identification using encoded microspheres.

[0006] In summary, while mPCR has broad application prospects, current technologies face challenges such as declining amplification efficiency, inconsistent amplification efficiencies between templates, and cumbersome operational procedures. Therefore, there is an urgent need to develop simple, convenient, and efficient single-reaction, multiplex nucleic acid equivalent amplification techniques. Summary of the Invention

[0007] To overcome the drawbacks of traditional mPCR technology, such as decreased amplification efficiency, inconsistent amplification efficiency between templates, and cumbersome operation steps, this invention proposes a novel multiplex amplification method. This method comprises two steps: First, a capture oligonucleotide binds to the target molecule and initiates specific linear amplification, yielding an intermediate sequence containing a universal primer-induced exponential amplification. Second, the multiplex intermediate sequence obtained from the linear amplification of the target molecule in the first step is subjected to multiplex exponential amplification induced by a universal primer. The capture oligonucleotide proposed in this invention, due to its special molecular sequence design, not only ensures specific linear amplification of the target molecule but also guarantees that the linear amplification product can self-fold and self-extend to form a universal sequence containing a universal primer-induced exponential amplification and a specific sequence corresponding to the multiplex target molecule. Because linear amplification only requires a low concentration (1 / 20-1 / 40 of the concentration of ordinary multiplex PCR primers) of a single specific capture oligonucleotide, it not only ensures the specificity of amplification but also effectively reduces the primer concentration and number required in the MPCR reaction, avoiding interference between primers. Multiplex exponential amplification initiated by universal primers not only significantly improves amplification efficiency and ensures reaction sensitivity but also achieves equivalent amplification of multiple different target molecules. The combination of these two steps allows this invention to effectively solve the key problems existing in traditional MPCR amplification technology.

[0008] To achieve this objective, the present invention adopts the following technical solution:

[0009] In a first aspect, the present invention provides a capture oligonucleotide for nucleic acid amplification, wherein the capture oligonucleotide comprises, from the 5' end to the 3' end, a first universal sequence, a folded sequence and a binding capture sequence in sequence;

[0010] The folded sequence is at least partially identical to the 5' end sequence of the target molecule;

[0011] The binding capture sequence binds complementary to the non-5' end sequence of the target molecule.

[0012] In this invention, the captured oligonucleotide mainly comprises three regions: a first universal sequence, a folding sequence, and a binding capture sequence. The captured oligonucleotide first captures a target molecule with a clearly defined 5' end sequence by binding the capture sequence. Then, using the target molecule as a template, an extension reaction is performed. A complementary strand of the target molecule is added to the 3' end of the captured oligonucleotide. The resulting extended captured oligonucleotide, due to the presence of at least partially complementary base-paired folding sequences and its extended 3' end sequence, induces intramolecular self-folding and further extends under the action of polymerase. A complementary strand of the first universal sequence is added to the 3' end, ultimately yielding a product with a complete hairpin structure, which can be detected by PCR amplification using universal primers and / or target molecule-specific primers.

[0013] In this invention, the first universal sequence is an artificially synthesized sequence that is independent of the target molecule sequence. Therefore, when detecting different target molecules, it is only necessary to design the folding sequence and binding capture sequence of the capture oligonucleotide based on the target molecule, while keeping the first universal sequence unchanged.

[0014] Preferably, the capturing oligonucleotide further includes a second universal sequence.

[0015] Preferably, the second universal sequence is located at the 5' end of the combined capture sequence.

[0016] In this invention, by setting a second universal sequence between the folding sequence and the binding capture sequence, after the capture oligonucleotide is extended and self-folded, the resulting hairpin structure product can be amplified and detected by PCR using universal primers that are the same as or partially the same as the first universal sequence and the second universal sequence as upstream and downstream primers, thereby achieving the effect of equivalent amplification of multiple target molecules.

[0017] Preferably, the capturing oligonucleotide further includes a nucleic acid extension blocking site located at the 3' end of the folded sequence, which is used to block the binding of the capturing sequence and the folded sequence.

[0018] Preferably, the nucleic acid extension blocking site is located at the 5' end of the second universal sequence, and is used to separate the second universal sequence and the folded sequence.

[0019] In this invention, the nucleic acid extension blocking site is set at the 3' end of the folded sequence, or more preferably between the second universal sequence and the folded sequence. This not only does not affect the self-folding of the extended capture oligonucleotide, but also allows the capture oligonucleotide to extend itself using itself as a template after self-folding, adding a complementary strand to the 3' end of the first universal sequence that does not belong to the target molecule, thereby forming a product with a complete hairpin structure. The hairpin structure product can be used as a template for PCR amplification with universal primers and / or target molecule-specific primers, enabling exponential PCR amplification and effectively ensuring the specificity and accuracy of the amplification.

[0020] Preferably, the nucleic acid extension blocking site is modified with a substance that can block DNA polymerase extension, so that when the hairpin structure product is amplified by PCR using universal primers and / or target molecule-specific primers, the extension is terminated at the nucleic acid extension blocking site, thereby generating a linearized amplification template for subsequent exponential amplification and improving amplification efficiency.

[0021] Preferably, the substance capable of blocking DNA polymerase extension is any one or a combination of at least two of the following: spacer, thio group, or uracil base.

[0022] Preferably, the folded sequence is modified with a nucleic acid analog.

[0023] It is worth noting that, due to the limitations of existing oligonucleotide synthesis technologies, incomplete sequence fragments may be generated as byproducts during the synthesis of capture oligonucleotides. However, according to the present invention, since the sequence of the folded region of the capture oligonucleotide originates from the target molecule, the presence of such byproducts may trigger non-specific amplification. Therefore, to further improve the specificity of the detection system, the present invention modifies the folded sequence of the capture oligonucleotide using nucleic acid analogs. While ensuring the normal base complementary pairing function of the folded sequence, it inhibits the elongation of the synthesized capture oligonucleotide byproducts, blocks the non-specific amplification of the original gene fragment or genome, thereby improving the specificity of the detection system.

[0024] Preferably, the nucleic acid analogue includes any one or a combination of at least two of peptide nucleic acids, locked nucleic acids, transposed bases, 2'-O,4'-C-methylenebridge RNA, 2'-O-Methyl RNA, or 2'-Fluoro RNA.

[0025] In this invention, the transposed base is a type of base whose orientation is opposite to that of the normal base. Its 3' end forms a 3-3-phosphodiester bond with the 3' end of the upstream base and a 5-5-phosphodiester bond with the 5' end of the downstream base, thereby inhibiting the elongation of DNA polymerase and the degradation by exonuclease during the elongation process.

[0026] In a second aspect, the present invention provides a nucleic acid amplification kit, the kit comprising the capture oligonucleotides described in the first aspect.

[0027] Preferably, the kit further includes a target nucleic acid pretreatment reagent to generate target molecules with clearly defined 5' end sequence information.

[0028] Preferably, the pretreatment reagent includes any one or a combination of at least two of the following: a nuclease capable of site-specific cleavage, a nucleic acid extension blocking agent, or a specific primer.

[0029] Preferably, the 5' end of the specific primer contains a modifying group.

[0030] Preferably, the modifying group includes a phosphate group and / or a thio group.

[0031] Preferably, the kit further includes universal primers.

[0032] Preferably, the nucleic acid sequence of the universal primer is the same as or partially the same as the first universal sequence or the second universal sequence.

[0033] In this invention, the amplification reaction based on universal primers uses target molecules whose 5' end sequence information is determined as templates. The target molecules can be target molecules with clearly defined 5' end sequence information types, or target molecules with clearly defined 5' end sequence information types generated after treatment with chemical factors or biological methods.

[0034] In this invention, the types of nucleic acid sequences with clearly defined 5' end sequence information include normal nucleic acid sequences, modified nucleic acid sequences, single nucleotide mutations, sequence transpositions, sequence deletions, and sequence recombinations.

[0035] Preferably, the target molecule has a clearly defined 5' end sequence, such as mature microRNA, microRNA precursor, cfDNA, etc.

[0036] Preferably, target molecules with clearly defined 5' end sequence information can be obtained by cleavage or blocking using chemical factors, including any one or a combination of at least two of the following: short oligonucleotide chains modified with polypeptide nucleic acid (PNA) and complementary to the target sequence; short oligonucleotide chains modified with locked nucleic acid (LNA) and complementary to the target sequence; short oligonucleotide chains modified with methoxy group and complementary to the target sequence; short oligonucleotide chains modified with RNA and complementary to the target sequence; short oligonucleotide chains modified with 2-fluorine and complementary to the target sequence; short oligonucleotide chains modified with reverse base and complementary to the target sequence; short oligonucleotide chains modified with phosphate group and complementary to the target sequence; and short oligonucleotide chains modified with thio group and complementary to the target sequence.

[0037] Preferably, the target molecule intermediate with a clearly defined 5' end sequence can be obtained by biological methods of cutting or blocking, including any one or a combination of at least two of the following: AP exonuclease, AP lyase, uracil-DNA glycosylase (UDG), restriction endonuclease, methylation-dependent restriction endonuclease, methylation-sensitive restriction endonuclease, nicking enzyme, giant nuclease, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), CRISPR-Cas, etc.

[0038] In this invention, amplification can only occur with the combined participation of the capturing oligonucleotide, universal primers, and / or specific primers. Briefly, in a dual universal primer amplification system, the nucleic acid sequence of the universal primer is identical or partially identical to the first or second universal sequence of the capturing oligonucleotide. Without a target molecule defined by its 5' end sequence, PCR amplification cannot be initiated. When a target molecule defined by its 5' end sequence is present in the system, an extension reaction initiated by the capturing oligonucleotide is triggered, forming an intermediate product with a hairpin structure, which serves as the template for the universal primer amplification reaction. Simultaneously, since the extended capturing oligonucleotide can only self-fold and form a hairpin structure when the extended sequence and the folding sequence of the extension reaction can form a complementary pair, the specificity of the reaction is effectively guaranteed. The extended sequence and the folding sequence can be completely complementary or incompletely complementary.

[0039] Preferably, the kit further includes specific primers.

[0040] In this invention, when the captured oligonucleotide includes only the first universal sequence, the folded sequence, and the binding capture sequence, but not the second universal sequence, that is, in the single universal primer amplification system, universal primers and target molecule-specific primers are used as upstream and downstream primers for PCR, which further improves the specificity and sensitivity of the reaction. When the method of this invention is used to detect target molecules of the same concentration but different sequences, the obtained Ct values ​​are basically consistent, thus proving that this method can guarantee equivalent amplification performance for different target molecules.

[0041] Preferably, the kit further includes a detection probe.

[0042] Preferably, the detection probe is labeled with a fluorescent group and / or a quenching group.

[0043] In this invention, a detection probe labeled with a fluorescent group and / or a quencher group is used to hybridize and complement the amplification product, which is beneficial for realizing real-time quantitative detection of the amplification product.

[0044] Preferably, the fluorescent group is labeled on the 5' end of the detection probe.

[0045] Preferably, the quenching group is labeled on the 3' end of the detection probe.

[0046] Preferably, the fluorescent group includes any one of FAM, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, or LCRED460.

[0047] Preferably, the quenching group includes any one of BHQ1, BHQ2, BHQ3, Dabcy1, or Tamra.

[0048] Thirdly, the present invention provides a nucleic acid detection method, which includes capturing oligonucleotides to bind target molecules and initiating specific linear amplification and nucleic acid amplification detection based on universal primers.

[0049] Preferably, the capture of oligonucleotides to bind target molecules and the initiation of specific linear amplification includes the following steps:

[0050] (1) The target molecule determined by the 5' end sequence binds to the binding capture sequence of the capture oligonucleotide;

[0051] (2) The capture oligonucleotide uses the target molecule as a template to carry out an extension reaction. A nucleotide complementary to the target molecule is added to the 3' end of the capture oligonucleotide to form an extended capture oligonucleotide.

[0052] (3) The extended capture oligonucleotides bind to the folded sequences inside the molecule through the extended sequence to form a half-hairpin structure product.

[0053] (4) The half-hairpin structure product undergoes an extension reaction, and a nucleotide complementary to the first universal sequence inside the molecule is added to the 3' end to form a complete hairpin structure product.

[0054] Preferably, the nucleic acid amplification detection based on universal primers includes the following steps:

[0055] Using the complete hairpin structure product as a template, exponential amplification was performed using universal primers and / or specific primers to obtain the amplified product.

[0056] Preferably, the nucleic acid sequence of the universal primer is the same as or partially the same as the first or second universal sequence of the capturing oligonucleotide.

[0057] Preferably, the exponential amplification includes polymerase chain reaction, such as any one of conventional PCR, qPCR, or digital PCR.

[0058] Preferably, the method further includes a step of binding the amplification product with a detection probe for detection.

[0059] Compared with the prior art, the present invention has the following beneficial effects:

[0060] (1) The nucleic acid detection kit of the present invention does not require additional steps such as ligation reaction and chemical treatment of amplification products. As long as the 5' end sequence information of the target molecule is clear, high specificity and high sensitivity of nucleic acid multiplex detection can be achieved.

[0061] (2) In the nucleic acid detection kit of the present invention, the captured oligonucleotide and universal primer are specially designed and work together. In the presence of the target molecule, the target molecule triggers the extension reaction initiated by the captured oligonucleotide to form a hairpin structure product, which is used as a template for the amplification reaction of the universal primer and / or the specific primer. Since the amplification reaction is based on the product determined by the 5' sequence, the false positive problem is effectively avoided.

[0062] (3) In this invention, the 3' extension sequence of the captured oligonucleotide and the folding sequence can form a complementary pair, which can trigger the self-folding of the captured oligonucleotide to form a hairpin structure, effectively ensuring the specificity of the reaction;

[0063] (4) When the nucleic acid detection kit of the present invention detects different target molecules, it only needs to design the folding sequence and binding capture sequence of the capture oligonucleotide according to the target molecule, while keeping the first universal sequence unchanged, which greatly reduces the interference between multiple primers in multiple target amplification and improves the sensitivity of amplification.

[0064] (5) The nucleic acid detection kit of the present invention achieves signal amplification through an exponential amplification process, which not only meets the sensitivity requirements of DNA / RNA detection, but also the exponential amplification process is completed using only extended capture oligonucleotides and universal primers. It can achieve equivalent amplification of multiple target molecules while keeping the number and concentration of universal primers unchanged, thus avoiding deviations in amplification efficiency caused by sequence differences.

[0065] (6) The nucleic acid detection kit of the present invention is easy to operate. Attached Figure Description

[0066] Figure 1(A) is a schematic diagram of amplification using dual universal primers, and Figure 1(B) is a schematic diagram of amplification using a single universal primer.

[0067] Figure 2 A schematic diagram for constructing target molecules with well-defined 5' end sequences;

[0068] Figure 3 Figure showing the results of qPCR detection of miRNA21 and let-7a;

[0069] Figure 4 Image showing the results of agarose gel electrophoresis for multiple human genes;

[0070] Figure 5 The image shows the results of rifampicin 526 resistance mutation detection in Mycobacterium tuberculosis.

[0071] Figure 6 The image shows the results of qPCR detection of the SEPT9 gene.

[0072] Figure 7 The image shows the results of ddPCR detection of the SEPT9 gene.

[0073] Figure 8(A) shows the sensitivity detection results of Septin 9 gene in samples with different concentrations of methylation, and Figure 8(B) shows the sensitivity detection results of RASS-F1 gene in samples with different concentrations of methylation.

[0074] Figure 9(A) shows the detection specificity results of ordinary capture oligonucleotides, and Figure 9(B) shows the detection specificity results of LNA-modified capture oligonucleotides;

[0075] Figure 10 The image shows the results of qPCR detection of the RASS-F1 gene. Detailed Implementation

[0076] To further illustrate the technical means and effects of this invention, the following description, in conjunction with embodiments and accompanying drawings, provides a further explanation of the invention. It is understood that the specific embodiments described herein are merely illustrative of the invention and not intended to limit it.

[0077] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in consensus literature in the field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0078] Example 1: Basic Principles of Amplification in this Invention

[0079] This invention includes two modes: a dual universal primer mode and a single universal primer mode, the principles of which are shown in Figure 1(A) and Figure 1(B).

[0080] In dual-universal primer amplification, the captured oligonucleotide comprises four regions: a first universal sequence U1s, a folding sequence T1s, a second universal sequence U2s, and a binding capture sequence T2a. The captured oligonucleotide first captures the target molecule defined by the 5' end sequence via the binding capture sequence T2a. Then, using the target molecule as a template, an extension reaction is performed, adding the complementary strand T1a of the folding sequence T1s to the 3' end, resulting in an extended captured oligonucleotide. T1a and T1s can be completely complementary or incompletely complementary, as long as T1a and T1s can induce intramolecular self-folding and form a half-hairpin structure product. This half-hairpin structure product is further extended under the action of polymerase, adding the complementary strand U1a of the first universal sequence U1s to the 3' end, resulting in a hairpin structure product. This product can be detected by PCR amplification using universal primers that are identical or partially identical to the first universal sequence U1s and the second universal sequence U2s. Specifically, during the annealing phase, the universal primer U1s (used here for convenience, though the actual sequence may not be identical to U1s) binds to the U1a region of the hairpin product and extends. When a nucleic acid extension blocking site exists between the second universal sequence and the folded sequence of the hairpin product, the extension stops at the blocking site, forming a local double-stranded structure. The product formed by the extension of universal primer U1s serves as the PCR template for universal primers U1s and U2s, which can be used for subsequent PCR amplification and detection. When no nucleic acid extension blocking site exists between the second universal sequence and the folded sequence of the hairpin product, the extension of universal primer U1s forms a complete double-stranded structure. The local region of the newly generated double-stranded structure serves as the PCR template for universal primers U1s and U2s, which can be used for subsequent PCR amplification and detection.

[0081] In single universal primer amplification, the captured oligonucleotide mainly comprises three regions: the first universal sequence U1s, the folding sequence T1s, and the binding capture sequence T3a. The captured oligonucleotide first captures the target molecule determined by the 5' end sequence through the binding capture sequence T3a. Subsequently, using the target molecule as a template, an extension reaction is performed, adding the complementary strand T1a of the folding sequence T1s to the 3' end, resulting in an extended captured oligonucleotide. T1a and T1s can be completely complementary or incompletely complementary, as long as T1a and T1s can induce intramolecular self-folding and form a half-hairpin structure product. This half-hairpin structure product is further extended under the action of polymerase, adding the complementary strand U1a of the first universal sequence U1s to the 3' end, resulting in a hairpin-shaped intermediate product. This intermediate product can be detected by PCR amplification using universal primers that are identical or partially identical to the first universal sequence U1s and target molecule-specific primers. Specifically, during the annealing phase, the universal primer U1s (U1s is used here for convenience; the actual sequence may not be exactly the same as U1s) binds to and extends the U1a region of the hairpin product. When there is a nucleic acid extension blocking site between the binding capture sequence and the folded sequence of the hairpin product, the extension stops at the nucleic acid extension blocking site, forming a local double-stranded structure. The product formed by the extension of the universal primer U1s is precisely the PCR template for both the universal primer U1s and the specific primer T2a, and can be used for subsequent PCR amplification and detection. When there is no nucleic acid extension blocking site between the binding capture sequence and the folded sequence of the hairpin product, the extension of the universal primer U1s forms a complete double-stranded structure. The local region of the newly generated double-stranded structure is the PCR template for both the universal primer U1s and the specific primer T2a, and can be used for subsequent PCR amplification and detection.

[0082] Example 2: Construction of a product with a well-defined 5' end sequence

[0083] The method of this invention requires a sample with a well-defined 5' end sequence to initiate an extension reaction mediated by captured oligonucleotides. The strategy for constructing a product with a well-defined 5' end sequence is as follows: Figure 2 As shown: ① For example, designing nucleic acid extension blocking agents for target molecules to block DNA polymerase extension, thereby obtaining products with a defined 5' end sequence; ② using different cleavage enzymes to perform cleavage reactions for specific cleavage sites in target molecules, thereby obtaining products with a defined 5' end sequence; ③ or designing low concentrations of specific primers for specific amplification of target molecules, thereby obtaining products with a defined 5' end sequence.

[0084] Example 3: qPCR detection of miRNA21 and let-7a

[0085] microRNAs (miRNAs) are a class of endogenous non-coding single-stranded small RNA molecules, 19-25 nucleotides in length, which are ubiquitous in eukaryotic cells and control the activity of more than 50% of coding genes.

[0086] This embodiment detects miRNA21 and let-7a, and the steps are as follows:

[0087] (1) Artificially synthesize miRNA21 and let-7a sequences;

[0088] (2) Capture oligonucleotides, universal primers, and detection probes of miRNA21 and let-7a genes were added simultaneously to the reaction system containing miRNA21 and let-7a sequences. PCR detection of miRNA21 and let-7a was performed. The PCR amplification system consisted of template RNA, 5 nM capture oligonucleotides, 150 nM first universal primer, 150 nM second universal primer, 150 nM detection probe, 1 U reverse transcriptase, 1 U Taq polymerase, 200 μM dNTP, 4.5 mM MgCl2, and 2× PCR buffer, with a final volume of 20 μL. The PCR reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ for 10 s, 66℃ for 90 s, 10 cycles; 94℃ for 10 s, 65℃ for 20 s, 40 cycles. Real-time PCR was performed on a ROCHE instrument (480), and the corresponding fluorescence values ​​were collected.

[0089] The combination of universal primers, capturing oligonucleotides, and detection probes used includes:

[0090] First universal primer (SEQ ID NO:1)

[0091] 5-GCGATCCGCACCGTCAATTCG;

[0092] Second universal primer (SEQ ID NO:2)

[0093] 5-GAGGTCCGATCCATCCAGACC;

[0094] let-7a uses a capture oligonucleotide (SEQ ID NO:3).

[0095] 5-CCGCACCGTCAATTCGTGAGGTAGTAGG-spacer-CCGATCCATCCAGACCTTTAACTATACAAC;

[0096] let-7a detection probe (SEQ ID NO:4)

[0097] 5-FAM-TGAGGTAGTAGGT-MGB;

[0098] miRNA21 uses a capture oligonucleotide (SEQ ID NO:5).

[0099] 5-CCGCACCGTCAATTCGTTCACAGTGGC-spacer-CCGATCCATCCAGACCTTTGCGGAACTTAG;

[0100] miRNA21 detection probe (SEQ ID NO:6)

[0101] 5-ROX-GTTCACAGTGGC-MGB.

[0102] Test results as follows Figure 3 As shown, curve miRNA21 is the amplification curve of miRNA21, and curve let-7a is the amplification curve of let-7a. This demonstrates that the present invention can simultaneously detect miRNA 21 and let-7a using universal primers, with the same Ct value, thus achieving equivalent amplification of the two miRNAs.

[0103] Example 4: Multiplex Detection of Human Genes

[0104] This embodiment involves the detection of human genetic DNA, and the steps are as follows:

[0105] (1) Genomic DNA was extracted from the HeLa cell line, serially diluted, and used as a template;

[0106] (2) The genome was digested with the restriction endonuclease AluI. The reaction system consisted of 2 μL of 10× digestion buffer and 20 μL of genomic DNA of different concentrations. The reaction conditions were 37°C for 1 hour. After the digestion reaction, the system was heated to 85°C and incubated for 10 minutes to heat-inactivate AluI.

[0107] (3) Add each gene capture oligonucleotide and universal primer to the above enzyme digestion reaction system respectively, and perform PCR amplification. The PCR amplification system includes enzyme digested DNA template, 5 nM capture oligonucleotide, 150 nM first universal primer, 150 nM second universal primer, 1 U Taq polymerase, 200 μM dNTP, 4.5 mM MgCl2 and 2× PCR buffer, with a final volume of 20 μL. The PCR reaction program is 94℃ pre-denaturation for 5 min; 94℃ for 10 s, 66℃ for 90 s, 10 cycles; 94℃ for 10 s, 65℃ for 20 s, 40 cycles. Real-time PCR is performed on a ROCHE instrument (480), and the PCR products are subjected to agarose gel electrophoresis.

[0108] The captured oligonucleotides and universal primer combinations used include:

[0109] First universal primer (SEQ ID NO:7)

[0110] 5-ACTGGACGAGCTGATTTACG;

[0111] Second universal primer (SEQ ID NO:8)

[0112] 5-CGCAATCAGGCAATACCATAGC;

[0113] IL4 utilizes the capture oligonucleotide 1 (SEQ ID NO:9) (86bp).

[0114] 5-ACTGGACGAGCTGATTTACGCTGCTAGAGAAGTTGA-spacer-CGCAATCAGGCAATACCATAGCGGCTGCCACTGACCACCA;

[0115] GAPDH uses capture oligonucleotide 2 (SEQ ID NO:10) (104bp).

[0116] 5-ACTGGACGAGCTGATTTACGCTGCTTAGACGCTGGA-spacer-CGCAATCAGGCAATACCATAGCGTCGCGGGAGGCTGCT;

[0117] Homo sapiens actin alpha 1 utilizes the trapping oligonucleotide 3 (SEQ ID NO:11) (137bp).

[0118] 5-ACTGGACGAGCTGATTTACGCTTCCCGTTCTCAGCCTTGACGCAATCAGGCAATACCATAGCCATTGACCTCAACTACATGG;

[0119] 18S ribosomal 1 uses the trapping oligonucleotide 4 (SEQ ID NO:12) (200bp).

[0120] 5-ACTGGACGAGCTGATTTACGCTCTTTCTCGATTCCGTGGG-spacer-ATCAGGCAATACCATAGCGTCCCTCTAAGAAGTTGG;

[0121] 18S ribosomal 2 uses the trapping oligonucleotide 5 (SEQ ID NO:13) (300bp).

[0122] 5-ACTGGACGAGCTGATTTACGCTACCCGCCCAGAAAACTAGA-spacer-CGCAATCAGGCAATACCATAGCCACCAGGCCGGAGCCATTG;

[0123] The results are as follows Figure 4 As shown, lane 1 is a 20bp ladder, lane 2 is the amplified product of the Saimiri sciureus interleukin4 (IL4) gene, lane 3 is the amplified product of the Homo sapiens glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene, lane 4 is the amplified product of the Homo sapiens actin alpha 1 gene, lane 5 is the amplified product of 18S ribosomal 1, lane 6 is the amplified product of 18S ribosomal 2, and lane 7 is the multiplex amplification result, all of which are positive.

[0124] This demonstrates that the present invention utilizes universal primers for sensitive and specific multiplex detection of different human genes.

[0125] Example 5: Detection of Rifampicin Resistance Mutation in Mycobacterium tuberculosis

[0126] For rifampicin resistance mutations in Mycobacterium tuberculosis (mutation at position 526 of the rpoB gene), multiplex detection of resistance mutations at multiple sites is performed by combining mismatch repair enzymes and universal primers.

[0127] The steps are as follows:

[0128] (1) Add an artificial sequence that is completely complementary to the wild genome to the synthesized Mycobacterium tuberculosis mutant plasmid, heat the system to 95°C and incubate for 10 minutes. The artificial sequence and the mutant plasmid hybridize and produce a mismatch.

[0129] (2) The hybridization products obtained in step (1) were digested with the mismatch enzyme T7E1. The reaction system was 2 μL of 10× enzyme digestion buffer and 20 μL of hybridization products of different concentrations. The reaction conditions were 37℃ for 1 hour. After the enzyme digestion reaction was completed, the system was heated to 85℃ and incubated for 10 minutes to heat-inactivate the mismatch enzyme.

[0130] (3) Add the corresponding capture oligonucleotides, universal primers and detection probes to the above enzyme digestion reaction system and the undigested wild plasmid system respectively. PCR detection of the 526-site mutation status. The PCR amplification system includes enzyme-digested DNA template, 5 nM capture oligonucleotides, 150 nM first universal primer, 150 nM second universal primer, 150 nM detection probe, 1 U Taq polymerase, 200 μM dNTP, 4.5 mM MgCl2 and 2× PCR buffer, with a final volume of 20 μL. The PCR reaction program is: 94℃ pre-denaturation for 5 min; 94℃ for 10 s, 66℃ for 90 s, 10 cycles; 94℃ for 10 s, 65℃ for 20 s, 40 cycles. Real-time PCR is performed on a ROCHE instrument (480), and the corresponding fluorescence values ​​are collected.

[0131] First universal primer (SEQ ID NO:8)

[0132] 5-CGCAATCAGGCAATACCATAGC;

[0133] Second universal primer (SEQ ID NO:14)

[0134] 5-GAGCGCAGGTCGTACTCG;

[0135] The 526 mutation captures oligonucleotides (SEQ ID NO:15)

[0136] 5-CAGGCAATACCATAGCTTGTGGGTCAACCCCGACAGAGCGCAGGTCGTACTCGTGCACCAGCCAGCTGAG;

[0137] 526 mutation detection probe (SEQ ID NO:16)

[0138] 5-FAM-CCAATTCATGGACCAGAACAAC-MGB;

[0139] Artificial sequence (SEQ ID NO:17)

[0140] 5-CCACGGTCACTTGAGCAACCTCTC.

[0141] The results are as follows Figure 5 As shown, curve A is the amplification curve of the mutant plasmid, and curve a is the amplification curve of the wild plasmid.

[0142] This demonstrates that the present invention can sensitively and specifically detect rifampicin resistance mutations in Mycobacterium tuberculosis using universal primers with the aid of appropriate artificial sequences.

[0143] Example 6: qPCR detection of human Septin 9 gene methylation

[0144] The Septin 9 (SEPT9) gene is located on human chromosome 17q25.3 and is a member of the septin gene family. It is involved in regulating cell biological processes such as cytokinesis and cell cycle.

[0145] Due to the diversity of cellular components, the DNA obtained from biological samples using existing technologies is often a mixture of unmethylated and methylated DNA. For example, the DNA in cancer tissue comes from both methylated cancer cells and unmethylated normal cells; the main source of circulating cell-free DNA (cfDNA) in peripheral blood is unmethylated normal leukocytes, and as cancer cells undergo apoptosis and death, the amount of cancer cell DNA entering the peripheral blood is generally less than 0.1%. Therefore, methods for detecting SEPT9 gene methylated DNA need to be able to effectively distinguish between methylated and unmethylated DNA, specifically detecting methylated DNA in the sample.

[0146] This embodiment detects methylated DNA of the human Septin 9 gene, and the steps are as follows:

[0147] (1) Genomic DNA was extracted from Jurkat cell line and Hela cell line respectively, and the methylation status of SEPT9 gene was identified by sequencing;

[0148] (2) The methylation-dependent restriction endonuclease GlaI was used to digest the genomic DNA of Jurkat cell line, Hela cell line and negative control NC. The reaction system was 2 μL of 10× digestion buffer and 20 μL of genomic DNA of different concentrations. The reaction conditions were incubation at 37℃ for 1 hour. After the digestion reaction, the system was heated to 85℃ and incubated for 10 minutes to heat inactivate GlaI.

[0149] (3) SEPT9 gene capture oligonucleotide, universal primer and detection probe were added to the above enzyme digestion reaction system respectively. The methylation status of SEPT9 gene was detected by PCR. The PCR amplification system included enzyme digestion DNA template, 5nM capture oligonucleotide, 150nM universal primer, 150nM specific primer, 150nM detection probe, 1U Taq polymerase, 200μM dNTP, 4.5mM MgCl2 and 2×PCR buffer, with a final volume of 20μL. The PCR reaction program was 94℃ pre-denaturation for 5min; 94℃ for 10s, 66℃ for 90s, 10 cycles; 94℃ for 10s, 65℃ for 20s, 40 cycles. Real-time PCR was performed on a ROCHE instrument (480) and the corresponding fluorescence values ​​were collected.

[0150] The combination of capture oligonucleotides, universal primers, and detection probes used includes:

[0151] Capture oligonucleotides (SEQ ID NO:18)

[0152] 5-TGTCAGCCAACGGTATTCGTTGACCGCGGGCTCGCCGCTGCCCTCCGC;

[0153] Universal primer (SEQ ID NO:19)

[0154] 5-GCCTGTCAGCCAACGGTATTC;

[0155] Specific primer (SEQ ID NO:20)

[0156] 5-CGACCCGCTGCCCACCAG;

[0157] Detection probe (SEQ ID NO:21)

[0158] 5-VIC-CCATCATGTCGGACCC-MGB;

[0159] The human Septin 9 gene is shown in SEQ ID NO:22:

[0160] 5-GCG C / / G TTGACCGCGGGGTCCGACATGATGGCTGGTGGGCAGCGGGTCGCGCGGAGGGCAGCGGCGAGGAA;

[0161] The underlined area indicates the methylation site, and / / indicates the enzyme cleavage site.

[0162] Sequencing analysis revealed that the SEPT9 gene in the Jurkat cell line genome was unmethylated, while the SEPT9 gene in the Hela cell line genome was methylated. qPCR was used to detect the methylation status of the SEPT9 gene in methylated and unmethylated samples at different concentrations. Figure 6 As shown, 140 copies and 28 copies are the amplification curves of SEPT9 methylated samples, representing SEPT9 methylated gene samples with 140 copies / reaction and 28 copies / reaction, respectively. 16,000 copies are the amplification curves of unmethylated samples, and NC is the amplification curve of ddH2O.

[0163] This demonstrates that the present invention can sensitively and specifically detect methylated DNA in the SEPT9 gene.

[0164] Example 7: ddPCR detection of Septin 9 gene methylation

[0165] Compared to Example 7, at STILLA Company Naica TM The methylation of the Septin 9 gene was detected using a crystal digital PCR instrument. GlaI was used as the methylation-dependent restriction endonuclease, and other conditions were the same as in Example 7.

[0166] The results are as follows Figure 7 The chart shows the copy number of the SEPT9 gene in samples with different concentrations of methylation. The left side is a scatter plot of 100 copies / reaction, and the right side is a scatter plot of 10 copies / reaction. Points above the dashed line represent positive droplets, and points below the dashed line represent negative droplets.

[0167] Therefore, this invention can achieve highly sensitive detection of methylated DNA in the SEPT9 gene on a digital PCR instrument.

[0168] Example 8 Dual detection of methylation in human SEPT9 and RASS-F1 genes

[0169] In this embodiment, Jurkat DNA treated with methyltransferase was used as a methylation positive standard, with CG sites at 5mCG. Dual detection of methylation in the SEPT9 and RASS-F1 genes was performed. The methylation-dependent restriction endonuclease used was GlaI, and the negative control was nuclease-free water. Specifically, the capture oligonucleotide for the SEPT9 gene is SEQ ID NO:18, the universal primer is SEQ ID NO:19, the specific primer is SEQ ID NO:20, and the detection probe is SEQ ID NO:21. For the RASS-F1 gene, the capture oligonucleotide is SEQ ID NO:23, the universal primer is SEQ ID NO:19, the specific primer is SEQ ID NO:24, and the detection probe is SEQ ID NO:25.

[0170] Capture oligonucleotides (SEQ ID NO:23)

[0171] 5-TGTCAGCCAACGGTATTCGCCCAGCGGGGTGCGAAGCACGGGCCCAAC;

[0172] Specific primer (SEQ ID NO:24)

[0173] 5-CCATGTCGGGGGAGCCTG;

[0174] Detection probe (SEQ ID NO:25)

[0175] 5-FAM-CTCCCGCAGCTCAATG-MGB.

[0176] Figure 8(A) shows the sensitivity detection of Septin 9 gene in methylated samples with different concentrations, from left to right: 140 copies / reaction and 28 copies / reaction; Figure 8(B) shows the sensitivity detection of RASS-F1 gene in methylated samples with different concentrations, from left to right: 140 copies / reaction and 28 copies / reaction.

[0177] This demonstrates that the present invention can simultaneously achieve sensitive and specific detection of methylated DNA in the SEPT9 and RASS-F1 genes.

[0178] Example 9: Optimization of Specificity for Detection of Methylation Sites in Human SEPT9 Gene

[0179] In this embodiment, Jurkat DNA treated with methyltransferase was used as a positive standard for human SEPT9 gene methylation, and Jurkat DNA was used as a negative standard for human SEPT9 gene methylation. The negative control nc was nuclease-free water. The samples were digested with the methylation-dependent restriction endonuclease GlaI, and amplification and detection were performed using common capture oligonucleotides or LNA-modified capture oligonucleotides, as well as universal primers (SEQ ID NO:19), specific primers (SEQ ID NO:20), and detection probes (SEQ ID NO:21).

[0180] The captured oligonucleotides used include:

[0181] Commonly captured oligonucleotides (SEQ ID NO:26)

[0182] 5-GCCTGTCAGCCAACGGTATTCGTTGACCGCGGGCTCGCCGCTGCCCTCCGC;

[0183] LNA-modified trap oligonucleotides (SEQ ID NO:27)

[0184] 5-GCCTGTCAGCCAACGGTATTCGTTGACC+G+CGCTCGCCGCTGCCCTCCGC (The base following the + indicates that the base modifies the locked nucleic acid);

[0185] The human Septin 9 gene is shown in SEQ ID NO:22.

[0186] The results are shown in Figures 9(A) and 9(B). Both capture oligonucleotides showed positive results in 120-copy and 12-copy positive templates. However, in the ordinary capture oligonucleotide system, when 100 ng of unmethylated genomic DNA (jurkat DNA) was added, non-specific amplification occurred. This was caused by the extension of the target molecule due to the binding of synthetic byproducts of the capture oligonucleotides. After introducing LNA modification into the folded sequence of the capture oligonucleotides, amplification efficiency was maintained (detecting 120-copy and 12-copy positives), and non-specific amplification was not triggered in high concentrations of unmethylated genomic DNA (100 ng). The mechanism for inhibiting non-specific amplification is that when the folded sequence is modified with a nucleic acid analog, the extension of the primer synthetic byproducts is inhibited while ensuring complementary base pairing in the folded region. Therefore, the results show that nucleic acid analog modification of the folded sequence can improve the specificity of the detection system.

[0187] Example 10: Amplification results with incompletely identical folded region sequences

[0188] This embodiment detects methylated DNA of the human RASS-F1 gene, and the steps are as follows:

[0189] (1) Jurkat DNA was treated with methyltransferase to construct a fully methylated positive genome, and the methylation status of the RASS-F1 gene was identified by sequencing.

[0190] (2) Methylation-dependent restriction endonuclease GlaI was used to digest methylated positive Jurkat genomic DNA and negative control, respectively. The reaction system consisted of 2 μL of 10× digestion buffer and 20 μL of genomic DNA of different concentrations. The reaction conditions were incubation at 37°C for 1 hour. After the digestion reaction, the system was heated to 85°C and incubated for 10 minutes to heat-inactivate GlaI.

[0191] (3) RASS-F1 gene capture oligonucleotide, universal primer, specific reverse primer and detection probe were added to the above enzyme digestion reaction system respectively. The methylation status of RASS-F1 gene was detected by PCR. The PCR amplification system included enzyme digested DNA template, 5 nM capture oligonucleotide, 150 nM universal primer, 150 nM specific primer, 150 nM detection probe, 1 U Taq polymerase, 200 μM dNTP, 4.5 mM MgCl2 and 2× PCR buffer, with a final volume of 20 μL. The PCR reaction program was 94℃ pre-denaturation for 5 min; 94℃ for 10 s, 66℃ for 90 s, 10 cycles; 94℃ for 10 s, 65℃ for 20 s, 40 cycles. Real-time PCR was performed on a ROCHE instrument (480) and the corresponding fluorescence values ​​were collected.

[0192] The combination of capture oligonucleotides, universal primers, and detection probes used includes:

[0193] Capture oligonucleotides (SEQ ID NO:28)

[0194] 5-GCCTGTCAGCCAACGGTATTCGCCCAG+C+GGTTTTTGCCAG / spacer18 / GCGAAGCACGGGCCCAAC (The base following the + indicates that the base modifies the locked nucleic acid);

[0195] Universal primer (SEQ ID NO:19)

[0196] 5-GCCTGTCAGCCAACGGTATTC;

[0197] Specific primer (SEQ ID NO:29)

[0198] 5-CCATGTCGGGGGAGCCTGAG;

[0199] Detection probe (SEQ ID NO:30)

[0200] 5-VIC-CTCCCGCAGCTCAATG-MGB;

[0201] The human RASS-F1 gene is shown in SEQ ID NO:31:

[0202] 5-GCG C / / G CCCAGCGGGTGCCAGCTCCCGCAGCTCAATGAGCTCAGGCTCCCCGACATGGCCCGGTTGGGCCCGTGCTTCGCTGG;

[0203] The underlined area indicates the methylation site, and / / indicates the enzyme cleavage site.

[0204] In this embodiment, the folded region of the captured oligonucleotide is not entirely identical to the 5' end sequence of the target molecule. The methylation status of the RASS-F1 gene in methylated positive samples at different concentrations was detected using qPCR, such as... Figure 10 As shown, curves 1, 2, and 3 are the amplification curves of RASS-F1 methylated samples, representing RASS-F1 methylated gene samples with 120 copies / reaction, 40 copies / reaction, and 28 copies / reaction, respectively. The negative control is the amplification curve with added ddH2O.

[0205] This demonstrates that the capture oligonucleotide fold region of the present invention only needs to have a partial sequence similarity with the 5' end sequence of the target molecule to achieve amplification.

[0206] In summary, this invention utilizes specially designed capture oligonucleotides to amplify samples with well-defined 5' end sequences, forming hairpin-shaped products that serve as templates for universal primer amplification reactions. This achieves the effect of using universal primers for multiplex PCR amplification to detect different target molecules, avoiding amplification efficiency deviations caused by sequence differences. It exhibits good specificity and is suitable for widespread application.

[0207] The applicant declares that the detailed method of the present invention is illustrated by the above embodiments, but the present invention is not limited to the above detailed method, that is, it does not mean that the present invention must rely on the above detailed method to be implemented. Those skilled in the art should understand that any improvements to the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention. sequence list <110> Shanghai Jiao Tong University; Shanghai Maijing Nanotechnology Co., Ltd. <120> A multiplex amplification method <130> 20201230 <160> 31 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty one <212> DNA <213> Artificial sequence() <400> 1 gcgatccgca ccgtcaattc g 21 <210> 2 <211> twenty one <212> DNA <213> Artificial sequence() <400> 2 gaggtccgat ccatccagac c 21 <210> 3 <211> 58 <212> DNA <213> Artificial sequence() <400> 3 ccgcaccgtc aattcgtgag gtagtaggcc gatccatcca gacctttaac tatacaac 58 <210> 4 <211> 13 <212> DNA <213> Artificial sequence() <400> 4 tgaggtagta ggt 13 <210> 5 <211> 57 <212> DNA <213> Artificial sequence() <400> 5 ccgcaccgtc aattcgttca cagtggcccg atccatccag acctttgcgg aacttag 57 <210> 6 <211> 12 <212> DNA <213> Artificial sequence() <400> 6 gttcacagtg gc 12 <210> 7 <211> 20 <212> DNA <213> Artificial sequence() <400> 7 actggacgag ctgatttacg 20 <210> 8 <211> twenty two <212> DNA <213> Artificial sequence() <400> 8 cgcaatcagg caataccata gc 22 <210> 9 <211> 76 <212> DNA <213> Artificial sequence() <400> 9 actggacgag ctgatttacg ctgctagaga agttgacgca atcaggcaat accatagcgg 60 ctgccactga ccacca 76 <210> 10 <211> 74 <212> DNA <213> Artificial sequence() <400> 10 actggacgag ctgatttacg ctgcttagac gctggacgca atcaggcaat accatagcgt 60 cgcgggaggc tgct 74 <210> 11 <211> 82 <212> DNA <213> Artificial sequence() <400> 11 actggacgag ctgatttacg cttcccgttc tcagccttga cgcaatcagg caataccata 60 gccattgacc tcaactacat gg 82 <210> 12 <211> 76 <212> DNA <213> Artificial sequence() <400> 12 actggacgag ctgatttacg ctctttctcg attccgtggg atcaggcaat accatagcgt 60 ccctctaaga agttgg 76 <210> 13 <211> 81 <212> DNA <213> Artificial sequence() <400> 13 actggacgag ctgatttacg ctacccgccc agaaactaga cgcaatcagg caataccata 60 gccaccaggc cggagccatt g 81 <210> 14 <211> 18 <212> DNA <213> Artificial sequence() <400> 14 gagcgcaggt cgtactcg 18 <210> 15 <211> 70 <212> DNA <213> Artificial sequence() <400> 15 caggcaatac catagcttgt gggtcaaccc cgacagagcg caggtcgtac tcgtgcacca 60 gccagctgag 70 <210> 16 <211> twenty two <212> DNA <213> Artificial sequence() <400> 16 ccaattcatg gaccagaaca ac 22 <210> 17 <211> twenty four <212> DNA <213> Artificial sequence() <400> 17 ccacggtcac ttgagcaacc tctc 24 <210> 18 <211> 48 <212> DNA <213> Artificial sequence() <400> 18 tgtcagccaa cggtattcgt tgaccgcggg ctcgccgctg ccctccgc 48 <210> 19 <211> twenty one <212> DNA <213> Artificial sequence() <400> 19 gcctgtcagc caacggtatt c 21 <210> 20 <211> twenty one <212> DNA <213> Artificial sequence() <400> 20 gcctgtcagc caacggtatt c 21 <210> twenty one <211> 16 <212> DNA <213> Artificial sequence() <400> twenty one ccatcatgtc ggaccc 16 <210> twenty two <211> 70 <212> DNA <213> Artificial sequence() <400> twenty two gcgcgttgac cgcggggtcc gacatgatgg ctggtgggca gcgggtcgcg cggagggcag 60 cggcgaggaa 70 <210> twenty three <211> 47 <212> DNA <213> Artificial sequence() <400> twenty three tgtcagccaa cggtattcgc ccagcgggtg cgaagcacgg gcccaac 47 <210> twenty four <211> 18 <212> DNA <213> Artificial sequence() <400> twenty four ccatgtcggg ggagcctg 18 <210> 25 <211> 16 <212> DNA <213> Artificial sequence() <400> 25 ctcccgcagc tcaatg 16 <210> 26 <211> 51 <212> DNA <213> Artificial sequence() <400> 26 gcctgtcagc caacggtatt cgttgaccgc gggctcgccg ctgccctccg c 51 <210> 27 <211> 49 <212> DNA <213> Artificial sequence() <400> 27 gcctgtcagc caacggtatt cgttgaccgc gctcgccgct gccctccgc 49 <210> 28 <211> 58 <212> DNA <213> Artificial sequence() <400> 28 gcctgtcagc caacggtatt cgcccagcgg tttttgccag gcgaagcacg ggcccaac 58 <210> 29 <211> 20 <212> DNA <213> Artificial sequence() <400> 29 ccatgtcggg ggagcctgag 20 <210> 30 <211> 16 <212> DNA <213> Artificial sequence() <400> 30 ctcccgcagc tcaatg 16 <210> 31 <211> 83 <212> DNA <213> Artificial sequence() <400> 31 gcgcgcccag cgggtgccag ctcccgcagc tcaatgagct caggctcccc cgacatggcc 60 cggttgggcc cgtgcttcgc tgg 83

Claims

1. A capture oligonucleotide for nucleic acid amplification, characterized in that, The capturing oligonucleotide comprises, from the 5' end to the 3' end, a first universal sequence, a folded sequence, and a binding capture sequence; The folded sequence is at least partially identical to the 5' end sequence of the target molecule; The binding capture sequence binds complementary to the non-5' end sequence of the target molecule.

2. The captured oligonucleotide according to claim 1, characterized in that, The captured oligonucleotide also includes a second universal sequence; The second universal sequence is located at the 5' end of the combined capture sequence.

3. The captured oligonucleotide according to claim 1, characterized in that, The captured oligonucleotide also includes a nucleic acid extension blocking site; The nucleic acid extension blocking site is located at the 3' end of the folded sequence; The nucleic acid extension blocking site is modified with any one or a combination of at least two of the following: a spacer, a thio group, or a uracil base.

4. The captured oligonucleotide according to claim 2, characterized in that, The captured oligonucleotide also includes a nucleic acid extension blocking site; The nucleic acid extension blocking site is located at the 3' end of the folded sequence; The nucleic acid extension blocking site is located at the 5' end of the second universal sequence; The nucleic acid extension blocking site is modified with any one or a combination of at least two of the following: a spacer, a thio group, or a uracil base.

5. The captured oligonucleotide according to any one of claims 1-4, characterized in that, The folded sequence is modified with a nucleic acid analog; The nucleic acid analogues include any one or a combination of at least two of peptide nucleic acids, locked nucleic acids, transposed bases, 2'-O,4'-C-methylene bridge RNA, 2'-O-Methyl RNA, or 2'-Fluoro RNA.

6. A reagent kit for nucleic acid amplification, characterized in that, The kit comprises the capture oligonucleotide as described in any one of claims 1-5.

7. The reagent kit according to claim 6, characterized in that, The kit also includes target molecule pretreatment reagents.

8. The reagent kit according to claim 7, characterized in that, The target molecule pretreatment reagent includes any one or a combination of at least two of the following: nucleases that perform site-specific cleavage, nucleic acid extension blocking agents, or specific primers.

9. The reagent kit according to claim 8, characterized in that, The nucleases that perform site-specific cleavage include exonucleases and / or endonucleases; The nuclease includes any one or a combination of at least two of methylation-dependent restriction endonucleases, methylation-sensitive restriction endonucleases, or mismatch repair enzymes.

10. The reagent kit according to claim 8, characterized in that, The nucleic acid extension blocking agent includes peptide nucleic acids and / or locked nucleic acids.

11. The reagent kit according to claim 8, characterized in that, The 5' end of the specific primer contains a modifying group.

12. The kit according to claim 11, characterized in that, The modifying groups include phosphate groups and / or thio groups.

13. The reagent kit according to any one of claims 6-12, characterized in that, The kit also includes universal primers; The nucleic acid sequence of the universal primer is the same as or partially the same as the first or second universal sequence of the captured oligonucleotide.

14. The kit according to claim 13, characterized in that, The kit also includes specific primers.

15. The reagent kit according to any one of claims 6-12, characterized in that, The kit also includes detection probes; The detection probe is labeled with a fluorescent group and / or a quenching group.

16. The reagent kit according to claim 15, characterized in that, The fluorescent group is labeled on the 5' end of the detection probe; The quenching group is labeled on the 3' end of the detection probe; The fluorescent group includes any one of FAM, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, or LC RED460; The quenching group includes any one of BHQ1, BHQ2, BHQ3, Dabcy1, or Tamra.

17. A method for nucleic acid amplification for non-diagnostic purposes, characterized in that, The nucleic acid amplification method includes capturing oligonucleotides to bind target molecules and initiating specific linear amplification and nucleic acid amplification detection based on universal primers, as described in any one of claims 1-5. The nucleic acid amplification detection based on universal primers includes the following steps: (1) The target molecule intermediate determined by the 5' end sequence binds to the binding capture sequence of the capture oligonucleotide; (2) The capture oligonucleotide uses the intermediate product of the target molecule as a template for the extension reaction. A nucleotide complementary to the target molecule is added to the 3' end of the capture oligonucleotide to form an extended capture oligonucleotide. (3) The extended capture oligonucleotides form a half-hairpin structure product by base complementarity pairing between the extended sequence and the folded sequence inside the molecule; (4) The half-hairpin structure product undergoes an extension reaction, and a nucleotide complementary to the first universal sequence inside the molecule is added to the 3' end, thereby forming a complete hairpin structure product.

18. The method according to claim 17, characterized in that, The method further includes using the complete hairpin structure product as a template, and performing exponential amplification using universal primers and / or specific primers to obtain the amplified product; The nucleic acid sequence of the universal primer is the same as or partially the same as the first or second universal sequence of the captured oligonucleotide.

19. The method according to claim 18, characterized in that, The exponential amplification includes polymerase chain reaction.

20. The method according to claim 18, characterized in that, The method also includes the step of binding the amplification product with a detection probe for detection.

Images