A method and kit for quantitatively detecting a plurality of NUP98 fusion genes

By using real-time quantitative PCR technology, specific primers and detection probes were designed, and a standard curve was constructed, which solved the problem of efficient detection of multiple NUP98 fusion genes and improved the accuracy of leukemia treatment.

CN114752659BActive Publication Date: 2026-08-04XIAMEN ZEESAN BIOTECH
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
XIAMEN ZEESAN BIOTECH
Filing Date
2021-01-08
Publication Date
2026-08-04

AI Technical Summary

Technical Problem

Existing technologies are insufficient for efficiently detecting multiple NUP98 fusion genes, especially in the application of leukemia, which affects the guidance of leukemia treatment.

Method used

Real-time quantitative PCR technology was used to simultaneously detect multiple NUP98 fusion genes by designing specific primers and detection probes, and a standard curve of amplification product concentration versus Ct value was constructed for quantitative analysis.

Benefits of technology

It enables highly sensitive quantitative detection of multiple NUP98 fusion genes, improving the accuracy of guidance for leukemia treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114752659B_ABST
    Figure CN114752659B_ABST
Patent Text Reader

Abstract

The application belongs to the field of biology and particularly relates to a method and a kit for quantitatively detecting multiple NUP98 fusion genes. In order to solve the problem of NUP98 fusion gene detection, the application simultaneously detects multiple NUP98 fusion genes by using real-time fluorescent PCR technology, and further provides a kit for simultaneously detecting multiple NUP98 fusion genes. The method and the kit can simultaneously quantitatively detect multiple samples in a single time, have high detection flux, high sensitivity, and are safe, simple and convenient.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biology, specifically relating to a method and kit for quantitative detection of multiple NUP98 fusion genes. Background Technology

[0002] Gene fusion is a significant cause of leukemia, involving multiple different genes that can lead to various carcinogenic effects. NUP98 is a gene primarily involved in regulating the transport of proteins and RNA across the nucleus and extranuclear regions; its wild-type is non-carcinogenic. However, when NUP98 fuses with a partner gene, the fusion product possesses the potential for malignant transformation. The incidence of NUP98 fusion genes in acute myeloid leukemia is 1%-2%, with even lower frequencies in other leukemia types. Nevertheless, detecting these fusion genes is of significant clinical importance in guiding leukemia treatment.

[0003] Real-time quantitative PCR is a method that uses fluorescent chemicals to determine the total amount of product after each polymerase chain reaction (PCR) cycle in a DNA amplification reaction. It allows for the quantitative analysis of specific DNA sequences in the test sample by using internal control genes. Results are presented as amplification curves, expressed as Ct values. It boasts high detection sensitivity and, when combined with TaqMan fluorescent probes, can specifically characterize the amplification of the target gene.

[0004] Currently, a new method is needed to solve the above problems. Summary of the Invention

[0005] To address the aforementioned issues, this application utilizes real-time fluorescence PCR technology to simultaneously detect multiple NUP98 fusion genes, and further provides a kit for simultaneously detecting multiple NUP98 fusion genes, thereby completing this application.

[0006] Therefore, in a first aspect, this application provides a method for quantitatively detecting multiple NUP98 fusion genes, the method comprising:

[0007] (a) Provide a sample of target nucleic acid containing different NUP98 fusion genes, and for each target nucleic acid, provide a primer set capable of amplifying the target nucleic acid, the primer set comprising at least one upstream primer and at least one downstream primer, wherein the upstream primer is capable of targeting the sequence of nucleotides encoding the NUP98 protein in the target nucleic acid;

[0008] Furthermore, for each target nucleic acid, a detection probe is provided that can specifically hybridize with the NUP98 fusion gene in the target nucleic acid. The detection probe is labeled with a reporter group and a quencher group, wherein the reporter group can emit a signal, and the quencher group can absorb or quench the signal emitted by the reporter group; and the signal emitted by the detection probe when hybridizing with its complementary sequence is different from the signal emitted when it does not hybridize with its complementary sequence.

[0009] In some implementations, the primer set comprises one upstream primer and multiple downstream primers (e.g., 2, 5, 10, 11, or more).

[0010] (b) Under conditions that allow nucleic acid amplification, the target nucleic acids containing different NUP98 fusion genes are amplified by real-time PCR using the primer set and the detection probe, thereby obtaining the amplification curve and Ct value corresponding to the amplification products.

[0011] (c) Construct a standard curve between the concentration of the serially diluted amplified product and the Ct value of the amplified product as the x-axis and the Ct value of the amplified product as the y-axis; where Ct = slope × Log(concentration, copies / μL) + intercept.

[0012] In some implementations, parameters of the standard curve are tested to determine whether the standard curve can be used for the quantitative detection of the NUP98 fusion gene; wherein the parameters are selected from the correlation coefficient, amplification efficiency, slope, or any combination thereof of the standard curve.

[0013] In some implementations, the standard curve can be used for quantitative detection of the NUP98 fusion gene when the square of the correlation coefficient (R) of the standard curve is greater than 0.99, the amplification efficiency is greater than 85%, and the slope is between -3.0 and -4.0.

[0014] (d) The concentrations of different NUP98 fusion genes in the target nucleic acid of the sample were obtained by the ratio of Ct value to concentration.

[0015] In some embodiments, the sequence of the NUP98 fusion gene comprises all or part of the nucleotide sequence encoding the NUP98 protein and all or part of the nucleotide sequence encoding a partner protein of NUP98 (e.g., HHEX, HOXD13, LOC348801, TOP1, KDM5, DDX10, NDS1, NDS3, LEDGF, ADD3, or PHF23).

[0016] In some embodiments, the sequence of the NUP98 fusion gene is selected from SEQ ID NO:28 to SEQ ID NO:38.

[0017] In some implementations, the method can be used for non-therapeutic or diagnostic purposes, for example, the sample is selected from isolated cells or tissues.

[0018] In some embodiments, in step (a), a sample of target nucleic acid containing an internal reference gene (e.g., the GUS gene) is also provided; and, for said target nucleic acid, a primer set capable of amplifying said target nucleic acid is provided, said primer set comprising at least one upstream primer and at least one downstream primer;

[0019] Furthermore, for the target nucleic acid, a detection probe is provided that can specifically hybridize with a reference gene in the target nucleic acid. The detection probe is labeled with a reporter group and a quencher group, wherein the reporter group can emit a signal, and the quencher group can absorb or quench the signal emitted by the reporter group; and the signal emitted by the detection probe when hybridizing with its complementary sequence is different from the signal emitted when it does not hybridize with its complementary sequence.

[0020] In some implementations, the upstream primer is capable of targeting the sequence of nucleotides encoding the GUS protein in the target nucleic acid.

[0021] (b) Under conditions that allow nucleic acid amplification, the target nucleic acid containing the internal reference gene is amplified by real-time PCR using the primer set and the detection probe, thereby obtaining the amplification curve and Ct value corresponding to the amplification product.

[0022] (c) Construct a standard curve between the concentration of the serially diluted amplified product and the Ct value of the amplified product as the x-axis and the Ct value of the amplified product as the y-axis; where Ct = slope × Log(concentration, copies / μL) + intercept.

[0023] In some implementations, parameters of the standard curve are tested to determine whether the standard curve can be used for the quantitative detection of internal reference genes; wherein, the parameters are selected from the correlation coefficient, amplification efficiency, slope, or any combination thereof of the standard curve.

[0024] In some implementations, the standard curve can be used for quantitative detection of internal reference genes when the square of the correlation coefficient (R) of the standard curve is greater than 0.99, the amplification efficiency is greater than 85%, and the slope is between -3.0 and -4.0.

[0025] (d) The concentration of the internal reference gene in the target nucleic acid of the sample was obtained by the ratio of Ct value to concentration.

[0026] In some implementations, the internal reference gene is the GUS gene.

[0027] In some embodiments, the sequence of the GUS gene is shown in SEQ ID NO:39.

[0028] In some embodiments, the primer sequences of the primer set are SEQ ID NO:25 and 26.

[0029] In some embodiments, this application provides a method for quantitatively detecting multiple NUP98 fusion genes, the method comprising:

[0030] (a) Provide a sample of target nucleic acid containing different NUP98 fusion genes, and for each target nucleic acid, provide a primer set capable of amplifying the target nucleic acid, the primer set comprising at least one upstream primer and at least one downstream primer, wherein the upstream primer is capable of targeting the sequence of nucleotides encoding the NUP98 protein in the target nucleic acid;

[0031] Furthermore, a sample containing a target nucleic acid (e.g., the GUS gene) is provided; and, for the target nucleic acid, a set of internal reference primers capable of amplifying the target nucleic acid is provided, the set of internal reference primers comprising at least one upstream primer and at least one downstream primer;

[0032] In some implementations, the primer set comprises one upstream primer and multiple downstream primers (e.g., 2, 5, 10, 11, or more);

[0033] In some implementations, the upstream primer in the internal reference primer set is capable of targeting the sequence of nucleotides encoding the GUS protein in the target nucleic acid;

[0034] Furthermore, for each target nucleic acid, a detection probe is provided that can specifically hybridize with the sequence of the NUP98 fusion gene and the internal reference gene in the target nucleic acid. The detection probe is labeled with a reporter group and a quencher group, wherein the reporter group can emit a signal, and the quencher group can absorb or quench the signal emitted by the reporter group; and the signal emitted by the detection probe when hybridizing with its complementary sequence is different from the signal emitted when it does not hybridize with its complementary sequence.

[0035] (b) Under conditions that allow nucleic acid amplification, the target nucleic acids containing different NUP98 fusion genes and the target nucleic acids containing internal reference genes are amplified by real-time PCR using the primer set and the detection probe, thereby obtaining the amplification curves and Ct values ​​corresponding to the amplification products, respectively.

[0036] (c) Construct standard curves between the concentration of the serially diluted amplified products as the x-axis and the corresponding Ct value of the amplified products as the y-axis; where Ct = slope × Log(concentration, copies / μL) + intercept.

[0037] In some implementations, parameters of the standard curve are tested to determine whether the standard curve can be used for the quantitative detection of the NUP98 fusion gene and the internal reference gene; wherein the parameters are selected from the correlation coefficient, amplification efficiency, slope, or any combination thereof of the standard curve.

[0038] In some implementations, the standard curve can be used for quantitative detection of NUP98 fusion genes and internal reference genes when the square of the correlation coefficient (R) of the standard curve is greater than 0.99, the amplification efficiency is greater than 85%, and the slope is between -3.0 and -4.0.

[0039] (d) The concentrations of different NUP98 fusion genes and internal reference genes in the target nucleic acid of the sample were obtained by the ratio of Ct value to concentration.

[0040] In some embodiments, the sequence of the NUP98 fusion gene comprises all or part of the nucleotide sequence encoding the NUP98 protein and all or part of the nucleotide sequence encoding a partner protein of NUP98 (e.g., HHEX, HOXD13, LOC348801, TOP1, KDM5, DDX10, NDS1, NDS3, LEDGF, ADD3, or PHF23).

[0041] In some embodiments, the sequence of the NUP98 fusion gene is selected from SEQ ID NO:28 to SEQ ID NO:38.

[0042] In some embodiments, the sequence of the GUS gene is shown in SEQ ID NO:39.

[0043] In some implementations, the method can be used for non-therapeutic or diagnostic purposes, for example, the sample is selected from isolated cells or tissues.

[0044] In some embodiments, the target nucleic acid in step (a) is cDNA. In some embodiments, the cDNA is obtained by extracting RNA from the sample and reverse transcribing it.

[0045] In some embodiments, in step (b), the sequences of the different NUP98 fusion genes are compared and analyzed, primers are designed, and primer sequences that can specifically amplify the NUP98 fusion gene are screened through an amplification reaction.

[0046] In some embodiments, the primer sequences of the primer set are selected from any number of sets (e.g., any 2 sets, any 5 sets, any 8 sets, any 11 sets, or more sets) of SEQ ID NO:1 and 2, 1 and 4, 1 and 6, 1 and 8, 1 and 10, 12 and 13, 1 and 15, 1 and 17, 1 and 19, 1 and 21, 1 and 23.

[0047] In some embodiments, in step (b), amplification is performed using the following quantitative real-time PCR reaction procedure: 95°C pre-denaturation for 10 min; 95°C for 20 s, 65°C for 60 s, wherein the temperature is decreased by 1°C per cycle, 72°C for 60 s, for a total of 10 cycles; 95°C for 20 s, 95°C for 20 s, 56°C for 32 s, wherein the fluorescence signal of the corresponding channel is collected at the end of this step in each cycle; 72°C for 60 s, for a total of 40 cycles; wherein the fluorescence signal of the corresponding channel is collected at the end of the 56°C for 32 s step in each cycle.

[0048] In some embodiments, the detection probe has a nucleotide sequence complementary (e.g., perfectly complementary) to a designated region of the nucleic acid molecule. In some embodiments, the designated region is located at a designated distance from the region to which the primer hybridizes (e.g., 100 nt, 200 nt, 300 nt, 400 nt, 500 nt, 800 nt, 1000 nt, 1500 nt, 2000 nt, 3000 nt, 4000 nt, 5000 nt, or other designated distances).

[0049] In some implementations, each detection probe forms a double-stranded hybrid with the amplification product of the nucleic acid molecule at a different melting point (T). m In some embodiments, the melting point (T0) between the detection probe and the double-stranded hybrid formed by the amplification product of the nucleic acid molecule is... m The difference is more than 1°C (e.g., 1°C, 2°C, 3°C).

[0050] In some embodiments, the detection probes each independently comprise or consist of naturally occurring nucleotides (e.g., deoxyribonucleotides or ribonucleotides), modified nucleotides, non-natural nucleotides (e.g., peptide nucleic acids (PNAs) or locked nucleic acids), or any combination thereof.

[0051] In some embodiments, the length of each detection probe is independently 15-1000 nt, for example 15-20 nt, 20-30 nt, 30-40 nt, 40-50 nt, 50-60 nt, 60-70 nt, 70-80 nt, 80-90 nt, 90-100 nt, 100-200 nt, 200-300 nt, 300-400 nt, 400-500 nt, 500-600 nt, 600-700 nt, 700-800 nt, 800-900 nt, 900-1000 nt.

[0052] In some embodiments, the detection probes each have an independent 3'-OH end; or, the 3'-end of the detection probe is blocked; for example, by adding a chemical moiety (e.g., biotin or alkyl) to the 3'-OH of the last nucleotide of the detection probe, by removing the 3'-OH of the last nucleotide of the detection probe, or by replacing the last nucleotide with a dideoxynucleotide, thereby blocking the 3'-end of the detection probe.

[0053] In some embodiments, in step (d), the product from step (c) is gradually heated or cooled while the signal emitted by the reporter group on each detection probe is monitored in real time to obtain a curve showing how the signal intensity of each reporter group changes with temperature; then, the derivative of the curve is calculated to obtain the melting curve of the product from step (d).

[0054] In some embodiments, the reporter group and the quencher group are spaced 10-80 nt apart or longer.

[0055] In some embodiments, the reporter groups in the detection probe are each independently a fluorescent group (e.g., ALEX-350, FAM, VIC, TET, CAL). Gold 540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, CY3, CY5, CY5.5, Quasar 705); and the quenching group is a molecule or group capable of absorbing / quenching the fluorescence (e.g., DABCYL, BHQ (e.g., BHQ-1 or BHQ-2), ECLIPSE, and / or TAMRA).

[0056] In some embodiments, the detection probes each independently have the same or different reporter groups. In some embodiments, the detection probes each independently have the same or different quencher groups.

[0057] In some embodiments, the detection probes do not have resistance to nuclease activity, or each probe independently has resistance to nuclease activity (e.g., 5' nuclease activity, e.g., 5' to 3' exonuclease activity); for example, the backbone of the detection probe contains modifications to resist nuclease activity, such as thiophosphate bonds, alkyl phosphate triester bonds, aryl phosphate triester bonds, alkyl phosphonate bonds, aryl phosphonate bonds, hydrogenated phosphate bonds, alkyl amino phosphate bonds, aryl amino phosphate bonds, 2'-O-aminopropyl modification, 2'-O-alkyl modification, 2'-O-allyl modification, 2'-O-butyl modification, and 1-(4'-thio-PD-furanoribosyl) modification.

[0058] In some implementations, the detection probes are each independently linear or have a hairpin structure.

[0059] In some embodiments, the detection probes are each independently labeled with a reporter group at their 5' end or upstream and a quencher group at their 3' end or downstream, or with a reporter group at their 3' end or downstream and a quencher group at their 5' end or upstream.

[0060] In some embodiments, the sequence of the detection probe is as shown in SEQ ID NO:3, 5, 7, 9, 11, 14, 16, 18, 20, 22, 24 or 27.

[0061] In another aspect, this application provides a kit for quantitative detection of UNP98 fusion genes, the kit comprising a primer set capable of amplifying target nucleic acids containing different UNP98 fusion genes and a detection probe capable of sequence-specific hybridization with the NUP98 fusion gene in the target nucleic acid.

[0062] For each target nucleic acid, at least one primer pair is provided, the primer pair comprising at least one upstream primer and at least one downstream primer, wherein the upstream primer is capable of targeting the nucleotide sequence encoding the NUP98 protein in the target nucleic acid;

[0063] The detection probe is labeled with a reporter group and a quencher group, wherein the reporter group is capable of emitting a signal, and the quencher group is capable of absorbing or quenching the signal emitted by the reporter group; furthermore, the signal emitted by the detection probe when hybridizing with its complementary sequence is different from the signal emitted when it does not hybridize with its complementary sequence; under conditions that allow nucleic acid hybridization or annealing, the detection probe can specifically hybridize with a designated region of the UNP98 fusion gene;

[0064] In some implementations, the primer set comprises one upstream primer and multiple downstream primers (e.g., 2, 5, 10, 11, or more).

[0065] In some embodiments, the kit further includes a set of internal reference primers capable of amplifying a target nucleic acid containing an internal reference gene (e.g., the GUS gene), and an internal reference detection probe for sequence-specific hybridization of the internal reference gene in the target nucleic acid.

[0066] In some embodiments, the sequence of the NUP98 fusion gene comprises all or part of the nucleotide sequence encoding the NUP98 protein and all or part of the nucleotide sequence encoding a partner protein of NUP98 (e.g., HHEX, HOXD13, LOC348801, TOP1, KDM5, DDX10, NDS1, NDS3, LEDGF, ADD3, or PHF23).

[0067] In some embodiments, the sequence of the NUP98 fusion gene is selected from SEQ ID NO:28 to SEQ ID NO:38.

[0068] In some embodiments, the target nucleic acid is cDNA. In some embodiments, the cDNA is obtained by extracting RNA from a sample and reverse transcribing it.

[0069] In some implementations, the kit is used to perform the methods as described above.

[0070] In some embodiments, the primer sequences of the primer set are selected from any number of sets (e.g., any 2 sets, any 5 sets, any 8 sets, any 11 sets, or more) of SEQ ID NO:1 and 2, 1 and 4, 1 and 6, 1 and 8, 1 and 10, 12 and 13, 1 and 15, 1 and 17, 1 and 19, 1 and 21, 1 and 23.

[0071] In some embodiments, the primer sequences of the internal reference primer set are SEQ ID NO:25 and 26.

[0072] In some embodiments, each primer in the primer set independently comprises or consists of naturally occurring nucleotides, modified nucleotides, non-natural nucleotides, or any combination thereof.

[0073] In some embodiments, the detection probe has a nucleotide sequence complementary (e.g., perfectly complementary) to a designated region of the nucleic acid molecule. In some embodiments, the designated region is located at a designated distance from the region to which the primer hybridizes (e.g., 100 nt, 200 nt, 300 nt, 400 nt, 500 nt, 800 nt, 1000 nt, 1500 nt, 2000 nt, 3000 nt, 4000 nt, 5000 nt, or other designated distances).

[0074] In some implementations, each detection probe forms a double-stranded hybrid with the amplification product of the nucleic acid molecule at a different melting point (T). m In some embodiments, the melting point (T0) between the detection probe and the double-stranded hybrid formed by the amplification product of the nucleic acid molecule is... m The difference is more than 1°C (e.g., 1°C, 2°C, 3°C).

[0075] In some embodiments, the detection probes each independently comprise or consist of naturally occurring nucleotides (e.g., deoxyribonucleotides or ribonucleotides), modified nucleotides, non-natural nucleotides (e.g., peptide nucleic acids (PNAs) or locked nucleic acids), or any combination thereof.

[0076] In some embodiments, the length of each detection probe is independently 15-1000 nt, for example 15-20 nt, 20-30 nt, 30-40 nt, 40-50 nt, 50-60 nt, 60-70 nt, 70-80 nt, 80-90 nt, 90-100 nt, 100-200 nt, 200-300 nt, 300-400 nt, 400-500 nt, 500-600 nt, 600-700 nt, 700-800 nt, 800-900 nt, 900-1000 nt.

[0077] In some embodiments, the detection probes each have an independent 3'-OH end; or, the 3'-end of the detection probe is blocked; for example, by adding a chemical moiety (e.g., biotin or alkyl) to the 3'-OH of the last nucleotide of the detection probe, by removing the 3'-OH of the last nucleotide of the detection probe, or by replacing the last nucleotide with a dideoxynucleotide, thereby blocking the 3'-end of the detection probe.

[0078] In some embodiments, in step (d), the product from step (c) is gradually heated or cooled while the signal emitted by the reporter group on each detection probe is monitored in real time to obtain a curve showing how the signal intensity of each reporter group changes with temperature; then, the derivative of the curve is calculated to obtain the melting curve of the product from step (d).

[0079] In some embodiments, the reporter group and the quencher group are spaced 10-80 nt apart or longer.

[0080] In some embodiments, the reporter groups in the detection probe are each independently a fluorescent group (e.g., ALEX-350, FAM, VIC, TET, CAL). Gold 540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, CY3, CY5, CY5.5, Quasar 705); and the quenching group is a molecule or group capable of absorbing / quenching the fluorescence (e.g., DABCYL, BHQ (e.g., BHQ-1 or BHQ-2), ECLIPSE, and / or TAMRA).

[0081] In some embodiments, the detection probes each independently have the same or different reporter groups. In some embodiments, the detection probes each independently have the same or different quencher groups.

[0082] In some embodiments, the detection probes do not have resistance to nuclease activity, or each probe independently has resistance to nuclease activity (e.g., 5' nuclease activity, e.g., 5' to 3' exonuclease activity); for example, the backbone of the detection probe contains modifications to resist nuclease activity, such as thiophosphate bonds, alkyl phosphate triester bonds, aryl phosphate triester bonds, alkyl phosphonate bonds, aryl phosphonate bonds, hydrogenated phosphate bonds, alkyl amino phosphate bonds, aryl amino phosphate bonds, 2'-O-aminopropyl modification, 2'-O-alkyl modification, 2'-O-allyl modification, 2'-O-butyl modification, and 1-(4'-thio-PD-furanoribosyl) modification.

[0083] In some implementations, the detection probes are each independently linear or have a hairpin structure.

[0084] In some embodiments, the detection probes are each independently labeled with a reporter group at their 5' end or upstream and a quencher group at their 3' end or downstream, or with a reporter group at their 3' end or downstream and a quencher group at their 5' end or upstream.

[0085] In some embodiments, the sequence of the detection probe is as shown in SEQ ID NO:3, 5, 7, 9, 11, 14, 16, 18, 20, 22, 24 or 27.

[0086] In some embodiments, the sequence of the internal reference detection probe is SEQ ID NO:27.

[0087] The primer set described above is used to prepare a kit for the quantitative detection of the UNP98 fusion gene.

[0088] In some implementations, the kit is used to perform the methods as described above.

[0089] In some embodiments, the detection probe has a nucleotide sequence complementary (e.g., perfectly complementary) to a designated region of the nucleic acid molecule. In some embodiments, the designated region is located at a designated distance from the region to which the primer hybridizes (e.g., 100 nt, 200 nt, 300 nt, 400 nt, 500 nt, 800 nt, 1000 nt, 1500 nt, 2000 nt, 3000 nt, 4000 nt, 5000 nt, or other designated distances).

[0090] In some implementations, each detection probe forms a double-stranded hybrid with the amplification product of the nucleic acid molecule at a different melting point (T). m In some embodiments, the melting point (T0) between the detection probe and the double-stranded hybrid formed by the amplification product of the nucleic acid molecule is... m The difference is more than 1°C (e.g., 1°C, 2°C, 3°C).

[0091] In some embodiments, the detection probes each independently comprise or consist of naturally occurring nucleotides (e.g., deoxyribonucleotides or ribonucleotides), modified nucleotides, non-natural nucleotides (e.g., peptide nucleic acids (PNAs) or locked nucleic acids), or any combination thereof.

[0092] In some embodiments, the length of each detection probe is independently 15-1000 nt, for example 15-20 nt, 20-30 nt, 30-40 nt, 40-50 nt, 50-60 nt, 60-70 nt, 70-80 nt, 80-90 nt, 90-100 nt, 100-200 nt, 200-300 nt, 300-400 nt, 400-500 nt, 500-600 nt, 600-700 nt, 700-800 nt, 800-900 nt, 900-1000 nt.

[0093] In some embodiments, the detection probes each have an independent 3'-OH end; or, the 3'-end of the detection probe is blocked; for example, by adding a chemical moiety (e.g., biotin or alkyl) to the 3'-OH of the last nucleotide of the detection probe, by removing the 3'-OH of the last nucleotide of the detection probe, or by replacing the last nucleotide with a dideoxynucleotide, thereby blocking the 3'-end of the detection probe.

[0094] In some embodiments, in step (d), the product from step (c) is gradually heated or cooled while the signal emitted by the reporter group on each detection probe is monitored in real time to obtain a curve showing how the signal intensity of each reporter group changes with temperature; then, the derivative of the curve is calculated to obtain the melting curve of the product from step (d).

[0095] In some embodiments, the reporter group and the quencher group are spaced 10-80 nt apart or longer.

[0096] In some embodiments, the reporter groups in the detection probe are each independently a fluorescent group (e.g., ALEX-350, FAM, VIC, TET, CAL). Gold 540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, CY3, CY5, CY5.5, Quasar 705); and the quenching group is a molecule or group capable of absorbing / quenching the fluorescence (e.g., DABCYL, BHQ (e.g., BHQ-1 or BHQ-2), ECLIPSE, and / or TAMRA).

[0097] In some embodiments, the detection probes each independently have the same or different reporter groups. In some embodiments, the detection probes each independently have the same or different quencher groups.

[0098] In some embodiments, the detection probes each independently possess resistance to nuclease activity (e.g., 5' nuclease activity, such as 5' to 3' exonuclease activity); for example, the backbone of the detection probe contains modifications to resist nuclease activity, such as thiophosphate bonds, alkyl phosphate triester bonds, aryl phosphate triester bonds, alkyl phosphonate bonds, aryl phosphonate bonds, hydrogenated phosphate bonds, alkyl amino phosphate bonds, aryl amino phosphate bonds, 2'-O-aminopropyl modification, 2'-O-alkyl modification, 2'-O-allyl modification, 2'-O-butyl modification, and 1-(4'-thio-PD-furanoribosyl) modification.

[0099] In some implementations, the detection probes are each independently linear or have a hairpin structure.

[0100] In some embodiments, the detection probes are each independently labeled with a reporter group at their 5' end or upstream and a quencher group at their 3' end or downstream, or with a reporter group at their 3' end or downstream and a quencher group at their 5' end or upstream.

[0101] In some embodiments, the sequence of the detection probe is as shown in SEQ ID NO:3, 5, 7, 9, 11, 14, 16, 18, 20, 22, 24 or 27.

[0102] In some embodiments, the sequence of the internal reference detection probe is SEQ ID NO:27.

[0103] Terminology Definition

[0104] In this invention, unless otherwise stated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, the operational steps used herein, such as molecular genetics, nucleic acid chemistry, chemistry, molecular biology, biochemistry, cell culture, microbiology, cell biology, genomics, and recombinant DNA, are all conventional steps widely used in their respective fields. To better understand this invention, definitions and explanations of relevant terms are provided below.

[0105] As used in this article, the term "amplification product" refers to the amplified nucleic acid produced by amplifying a nucleic acid template.

[0106] As used herein, the term "NUP98 fusion gene" refers to the fusion of a gene involved in regulating the transport of proteins and RNA inside and outside the nucleus (i.e., the NUP98 gene) with its partner gene, which may include HHEX, HOXD13, LOC348801, TOP1, KDM5, DDX10, NDS1, NDS3, LEDGF, ADD3, or PHF23. In this paper, the sequence of the NUP98 fusion gene comprises all or part of the nucleotide sequence encoding the NUP98 protein and all or part of the nucleotide sequence encoding the partner protein of NUP98. The sequences of the NUP98 gene and its partner genes can be found at the National Center for Biotechnology Information (NCBI) in the United States using their sequence numbers. For example, the sequence number for the NUP98 gene is NM_016320.5, the sequence number for the HHEX gene is NM_002729.5, the sequence number for the KDM5 gene is AB209999.1, the sequence number for the LOC348801 gene is NM_001085451.1, and the sequence number for the PHF23 gene is EF071958.1. The sequence numbers for the HODX13 gene are NM_000523.4, the LEDGF gene is AF063020.1, the NSD3 gene is NM_023034.2, the NSD1 gene is NM_022455.5, the TOP1 gene is NM_003286.4, the ADD3 gene is NM_001320593.2, and the DDX10 gene is AB040537.1.

[0107] As used in this paper, the term "internal reference gene" refers to a reference gene used to detect changes in gene expression levels. The expression level of an internal reference gene is unaffected by conditions and its expression is relatively constant across tissues and cells. To reduce potential differences in target gene expression levels or reverse transcription efficiency, it is usually necessary to select an internal reference gene for correction and normalization. In this paper, the internal reference gene is the GUS (β-glucuronidase) gene, whose sequence can be found at the National Center for Biotechnology Information (NCBI) using its accession number; for example, the accession number for the GUS gene is NM_000181.

[0108] As used in this article, the term "primary curve" refers to the amplification curve obtained by quantitative real-time PCR. As the PCR reaction proceeds, amplification products accumulate, and the fluorescence signal intensity increases. Fluorescence signals are collected after each cycle, and changes in fluorescence intensity are used to monitor the change in the amount of amplification products. Typically, the vertical axis of the amplification curve represents the fluorescence value, and the horizontal axis represents the cycle number.

[0109] As used in this article, the term "Ct value (cycle threshold)" refers to the number of PCR cycles at which the fluorescence signal of the amplified product reaches a set threshold during PCR amplification. Typically, the Ct value remains relatively constant when the same template is used for the same number of cycles.

[0110] As used in this article, the term "standard curve" refers to a graph plotted during the quantitative detection of gene expression levels using real-time PCR. In this article, a standard curve is constructed with the logarithmic concentrations of serially diluted amplification products as the x-axis and the corresponding Ct values ​​of the amplification products as the y-axis, to determine the relationship between amplification product concentration and Ct values.

[0111] As used herein, and as is generally understood by those skilled in the art, the terms “upstream” and “downstream” are merely for the convenience of describing and distinguishing the two primers in a primer pair; they are relative and do not have any particular meaning.

[0112] As used herein, the term "targeted" refers to the ability to selectively / specifically hybridize or anneal with a target nucleic acid sequence under conditions that allow for nucleic acid hybridization, annealing, or amplification. In this paper, the upstream primers and detection probes having "targeted sequences" is easily understood to mean that the target sequence, or target-specific sequence, is specific to the target nucleic acid sequence. In other words, under conditions that allow for nucleic acid hybridization, annealing, or amplification, the target sequence hybridizes or anneals only with the specific target nucleic acid sequence and not with other nucleic acid sequences.

[0113] As used herein, the term "complementary" means that two nucleic acid sequences can form hydrogen bonds with each other according to the base pairing principle (Waston-Crick principle), thereby forming a double helix. In this application, the term "complementary" includes "substantially complementary" and "completely complementary." As used herein, the term "completely complementary" means that every base in one nucleic acid sequence can pair with a base in the other nucleic acid strand without mismatches or gaps. As used herein, the term "substantially complementary" means that most bases in one nucleic acid sequence can pair with bases in the other nucleic acid strand, allowing for mismatches or gaps (e.g., mismatches or gaps of one or more nucleotides). Typically, under conditions that allow nucleic acid hybridization, annealing, or amplification, two "complementary" (e.g., substantially complementary or completely complementary) nucleic acid sequences will selectively / specifically hybridize or anneal and form a double helix. Correspondingly, the term "non-complementary" means that two nucleic acid sequences cannot hybridize or anneal under conditions that allow nucleic acid hybridization, annealing, or amplification, and cannot form a double helix. As used in this article, the term "not perfectly complementary" means that the bases in one nucleic acid sequence cannot be perfectly paired with the bases in another nucleic acid chain, and there is at least one mismatch or gap.

[0114] As used herein, the terms “hybridization” and “annealing” refer to the process by which complementary single-stranded nucleic acid molecules form double-stranded nucleic acids. In this application, “hybridization” and “annealing” have the same meaning and are used interchangeably. Generally, two completely complementary or substantially complementary nucleic acid sequences can hybridize or anneal. The complementarity required for two nucleic acid sequences to hybridize or anneal depends on the hybridization conditions used, particularly the temperature.

[0115] As used herein, the term "PCR reaction" has the meaning commonly understood by those skilled in the art as referring to a reaction that uses nucleic acid polymerases and primers to amplify target nucleic acids (polymerase chain reaction).

[0116] As used herein, the term "detection probe" refers to an oligonucleotide labeled with a reporter group and a quencher group. When the probe does not hybridize with other sequences, the quencher group is located at a position capable of absorbing or quenching the signal emitted by the reporter group (e.g., the quencher group is located adjacent to the reporter group), thereby absorbing or quenching the signal emitted by the reporter group. In this case, the probe does not emit a signal. Furthermore, when the probe hybridizes with its complementary sequence, the quencher group is located at a position in which it cannot absorb or quench the signal emitted by the reporter group (e.g., the quencher group is located far from the reporter group), thereby failing to absorb or quench the signal emitted by the reporter group. In this case, the probe emits a signal.

[0117] Beneficial effects of the invention

[0118] This application establishes a method for detecting NUP98 fusion genes. High sensitivity: It can detect NUP98 fusion genes down to 100 copies / μL. High throughput: It can detect 11 NUP98 fusion genes and the internal reference gene GUS in 4 PCR reactions. A single run can complete the testing of 22 clinical samples within 4 hours (e.g., 4 tubes of reactions can be run simultaneously for 24 tests; after removing one negative control and one positive control, 22 clinical samples can be tested). Accurate and high-throughput quantification: Standard curves for detecting 11 NUP98 fusion genes and the internal reference gene GUS in 4 PCR reactions were calculated. The correlation coefficients for each detected object were greater than 0.99, the amplification efficiency was greater than 80%, the slope was between -3.0 and -4.0, and the quantifiable template range was 100–100,000 copies / reaction. High specificity: Specific primer pairs and fluorescent probes are used for each fusion gene, resulting in good specificity and a low possibility of false positives. Internal control monitoring: Due to the low frequency of NUP98 fusion gene occurrence, an internal control gene, a positive control (containing plasmids of each fusion gene to be tested), and a negative control are introduced in each PCR reaction to ensure effective detection of clinical samples. Safe and simple: Closed-tube reaction prevents contamination, and the instrument can collect signals and output results throughout the reaction, making the results simple and easy to interpret.

[0119] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings and examples. However, those skilled in the art will understand that the following drawings and examples are for illustrative purposes only and are not intended to limit the scope of the invention. Various objects and advantages of the present invention will become apparent to those skilled in the art from the following detailed description of the drawings and preferred embodiments. Attached Figure Description

[0120] Figure 1 The results of real-time fluorescence PCR detection of the NUP98-HHEX plasmid are shown.

[0121] Figure 2 The results of real-time fluorescence PCR detection of the NUP98-HOXD13 plasmid are shown.

[0122] Figure 3 The results of real-time fluorescence PCR detection of plasmid NUP98-LOC348801 are shown.

[0123] Figure 4 The results of real-time fluorescence PCR detection of the NUP98-TOP1 plasmid are shown.

[0124] Figure 5 The results of real-time fluorescence PCR detection of the NUP98-KDM5 plasmid are shown.

[0125] Figure 6 The results of real-time fluorescence PCR detection of the NUP98-PHF23 plasmid are shown.

[0126] Figure 7 The results of real-time fluorescence PCR detection of the NUP98-NSD1 plasmid are shown.

[0127] Figure 8 The results of real-time fluorescence PCR detection of the NUP98-NSD3 plasmid are shown.

[0128] Figure 9 The results of real-time fluorescence PCR detection of NUP98-LEDGF plasmid are shown.

[0129] Figure 10 The results of real-time fluorescence PCR detection of the NUP98-ADD3 plasmid are shown.

[0130] Figure 11 The results of real-time fluorescence PCR detection of the NUP98-DDX10 plasmid are shown.

[0131] Figure 12 The results of real-time fluorescent PCR detection of the GUS plasmid are shown.

[0132] Figure 13 The results of the first tube PCR test of the clinical sample are shown.

[0133] Figure 14 The results of the second-tube PCR detection system for clinical samples are shown.

[0134] Figure 15 The results of the real-time fluorescence PCR detection system for the third tube of clinical samples are shown.

[0135] Figure 16 The results of the fourth tube PCR detection system for clinical samples are shown.

[0136] Figure 17 The results and standard curve of the first tube PCR quantitative detection system by real-time fluorescence PCR are shown.

[0137] Figure 18 The results and standard curve of the real-time fluorescence PCR for the second tube PCR quantitative detection system are shown.

[0138] Figure 19 The results and standard curve of real-time fluorescence PCR for the third-tube PCR quantitative detection system are shown.

[0139] Figure 20The results and standard curve of the real-time fluorescence PCR quantitative detection system in the fourth tube are shown.

[0140] Sequence information

[0141] Information on some of the sequences involved in this invention is provided in Table 1 below.

[0142] Table 1: Sequence Description

[0143]

[0144]

[0145] Detailed Implementation

[0146] The invention will now be described with reference to the following embodiments, which are intended to illustrate the invention (and not limit it).

[0147] Unless otherwise specified, the experiments and methods described in the embodiments are performed in accordance with conventional methods well known in the art and described in various references. For example, conventional techniques such as biochemistry, molecular biology, genomics, and recombinant DNA used in this invention can be found in Sambrook, Fritsch, and Maniatis, *Molecular Cloning: A Labour Manual*, 2nd edition (1989); *Current Protocols in Molecular Biology* (edited by FM. Ausubel et al., (1987)); and the *Methods in Enzymology* series (academic publishing company): *PCR 2: A Practical Approach* (edited by MJ. MacPherson, BD. Hames, and GR. Taylor, (1995)).

[0148] Furthermore, unless specific conditions are specified in the examples, conventional conditions or conditions recommended by the manufacturer should be followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products. Those skilled in the art will understand that the examples are described by way of illustration and are not intended to limit the scope of protection claimed by the invention. All disclosures and other references mentioned herein are incorporated herein by reference in their entirety.

[0149] Example 1

[0150] In this embodiment, highly specific primers and probes were pre-designed, and 11 NUP98 fusion genes (NUP98-HHEX, NUP98-HOXD13, NUP98-LOC348801, NUP98-TOP1, NUP98-KDM5, NUP98-DDX10, NUP98-NDS1, NUP98-NDS3, NUP98-LEDGF, NUP98-ADD3, and NUP98-PHF23) were detected by real-time fluorescent PCR using the designed primers and probes. The sequences of the NUP98 gene and its partner genes, as well as the internal reference gene GUS, were obtained from the National Center for Biotechnology Information (NCBI) in the United States. The reference sequences for the NUP98 gene are NM_016320.5, HHEX gene NM_002729.5, KDM5 gene AB209999.1, LOC348801 gene NM_001085451.1, PHF23 gene EF071958.1, and HODX13. Reference sequences for the following genes are included: NM_000523.4, LEDGF gene reference sequence AF063020.1, NSD3 gene reference sequence NM_023034.2, NSD1 gene reference sequence NM_022455.5, TOP1 gene reference sequence NM_003286.4, ADD3 gene reference sequence NM_001320593.2, DDX10 gene reference sequence AB040537.1, and GUS gene reference sequence NM_000181.

[0151] Primers and probes were designed for the 11 NUP98 fusion genes mentioned above. Experiments yielded highly specific primers and probes, and all 11 NUP98 fusion genes can share a single upstream primer that targets the nucleotide sequence encoding the NUP98 protein. The specific sequences of the designed and used primers and probes are shown in Table 1.

[0152] The 12 nucleotide sequences shown in SEQ ID NO:28 to SEQ ID NO:39 were inserted into the multiple cloning site of the pUC57 plasmid, resulting in 11 plasmids containing nucleotide sequences encoding the NUP98 fusion protein (referred to as NUP98 fusion protein plasmids) and a plasmid containing nucleotide sequences encoding the GUS protein (referred to as GUS plasmids). In real-time quantitative PCR detection, the positive controls were the 11 NUP98 fusion gene plasmids and the GUS plasmid, and the negative control was deionized water. 5 μL of template (containing the above positive control plasmids and negative control) was added to a 20 μL PCR reaction system. PCR amplification was performed using TaKaRa Taq. TMThe specific reaction systems of HS Perfect Mix (purchased from TaKaRa, product number R300A) are shown in Tables 2 to 5:

[0153] Table 2. PCR system in the first tube

[0154] TaKaRa Taq HS Perfect Mix (2X) 12.5 5μM NUP98-F 0.3 5μM NUP98-HHEX-R 0.3 50μM NUP98-HHEX-P 0.1 5μM NUP98-LOC348801-R 0.3 50μM NUP98-LOC348801-P 0.1 5μM NUP98-HODX13-R 0.3 50μM NUP98-HODX13-P 0.1 5μM GUS-F 0.3 5μM GUS-R 0.3 50μM GUS-P 0.1 RNase Free Water 5.3

[0155] Table 3. PCR system in the second tube

[0156]

[0157]

[0158] Table 4. PCR system in the third tube

[0159] TaKaRa Taq HS Perfect Mix (2X) 12.5 5μM NUP98-F 0.3 5μM NUP98-NSD3-R 0.3 50μM NUP98-NSD3-P 0.1 5μM NUP98-NSD1-R 0.3 50μM NUP98-NSD1-P 0.1 5μM GUS-F 0.3 5μM GUS-R 0.3 50μM GUS-P 0.1 RNase Free Water 5.7

[0160] Table 5. PCR system in the fourth tube

[0161] TaKaRa Taq HS Perfect Mix (2X) 12.5 5μM NUP98-F 0.3 5μM NUP98-PHF23-R 0.3 50μM NUP98-PHF23-P 0.1 5μM NUP98-LEDGF-F 0.3 5μM NUP98-LEDGF-R 0.3 50μM NUP98-LEDGF-P 0.1 5μM NUP98-ADD3-R 0.3 50μM NUP98-ADD3-P 0.1 5μM GUS-F 0.3 5μM GUS-R 0.3 50μM GUS-P 0.1 RNase Free Water 5

[0162] Table 6. PCR reaction procedure

[0163]

[0164]

[0165] The reaction system was prepared on ice and then placed in a real-time PCR instrument for the reaction. The specific PCR reaction procedure is shown in Table 6.

[0166] Test results as follows Figures 1 to 12 As shown, both the NUP98 fusion protein particle and the GUS plasmid produced amplification curves in the corresponding channels of the corresponding reaction tubes, and no other non-specific amplification curves were produced, proving that the primers designed in this application have good specificity.

[0167] Example 2

[0168] This embodiment follows the steps, detection system, and procedure described in Example 1 to detect leukocyte cDNA samples from 10 leukemia patients. Each sample was tested in duplicate. 5 μL of template was added to each 20 μL PCR reaction system (Tables 2 to 5). The first tube template included: cDNA samples 1 to 10, NUP98-HHEX plasmid, NUP98-LOC34880 plasmid, NUP98-HODX13 plasmid, GUS plasmid, and a negative control (deionized water). The second tube template included: cDNA samples 1 to 10, NUP98-HHEX plasmid, NUP98-LOC34880 plasmid, NUP98-HODX13 plasmid, GUS plasmid, and a negative control (deionized water). The template in the third tube includes: cDNA samples 1 to 10, NUP98-NSD3, NUP98-NSD1, GUS, and a negative control (deionized water); the template in the fourth tube includes: cDNA samples 1 to 10, NUP98-PHF23, NUP98-LEDGF, NUP98-ADD3, GUS, and a negative control (deionized water).

[0169] This embodiment performs the detection according to the detection system and procedure described in Embodiment 1. In clinical sample testing, if there is no target gene amplification signal curve, and the internal control, positive control, and negative control tests are all normal, the result is negative; if there is a target gene amplification signal curve, and the internal control, positive control, and negative control tests are all normal, the result is positive. If the test results of the internal control, positive control, or negative control are abnormal, the cause must be identified, adjustments made, and the test repeated.

[0170] Test results as follows Figures 13 to 16 As shown, none of the leukocyte cDNA samples from the 10 leukemia patients showed a curve indicating the amplification of the target gene, while the internal control, positive control, and negative control were all normal. Therefore, the test results of all 10 leukemia samples were negative.

[0171] Example 3

[0172] This embodiment follows the steps, detection system, and procedure described in Example 1, and simultaneously performs quantitative detection of simulated test sample plasmids (NUP98-HHEX plasmid), 10 NUP98 fusion gene plasmids, and GUS plasmids using a four-tube PCR reaction. Each tube contains the internal reference gene GUS plasmid to indicate the amplification status of samples without fusion genes. Serially diluted NUP98 fusion gene plasmids and GUS plasmids (concentrations of 2*10⁻⁶) are used. 4 copies / μL, 2*10 3 copies / μL, 2*10 2 copies / μL, 2*101 Using copies / μL as a standard template, cDNA from the test sample or a simulated test sample plasmid was used in the same batch of experiments for detection. The preparation of the simulated positive sample plasmid was as follows: Human chronic myeloid leukemia cell line K-562 (purchased from ATCC Cell Bank, catalog number: CCL-243) was cultured, and total RNA was extracted from the cells using a blood total RNA extraction kit (purchased from Tiangen Biotech Co., Ltd., catalog number DP433). The extracted RNA was reverse transcribed using TaKaRa Taq HSPerfect Mix (purchased from Takara, catalog number: R300A) to obtain cDNA from the K-562 cell line, which contained a collection of transcripts of the GUS gene. Experimenter A incorporated a known concentration of the NUP98-HHEX fusion gene plasmid into the K562 cell line cDNA, thus obtaining the simulated positive sample plasmid. Meanwhile, experimenter A recorded the known concentrations of K562 cell line cDNA and the simulated plasmid concentrations of the positive sample to be tested in a logbook. The quantitative experiment was performed by another experimenter, experimenter B, who analyzed and statistically processed the results after the experiment. After obtaining the quantitative results of the system, the concentrations recorded by experimenter A were compared with the concentrations measured by experimenter B.

[0173] The reagent preparation for the PCR system is shown in Tables 2 to 5, and the detection procedure is shown in Table 6. After the reaction, a standard curve was plotted with the Ct values ​​(ordinate) of the concentration gradient of each NUP98 fusion gene plasmid and the template concentration (abscissa).

[0174] Result Interpretation: When serially diluted NUP98 fusion gene plasmid or GUS plasmid is added, an amplification curve will be generated in the corresponding channel of the corresponding reaction tube. The Ct value and concentration are used to calculate the standard curve. The calculation and judgment are performed according to the calculation method and parameter requirements in the qPCR quantification guide (Bustin S A, Vladimir B, Garson JA, et al. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments[J]. Clinical Chemistry, 2009(4):611.). When the square of its correlation coefficient (R) is greater than 0.99, the amplification efficiency is greater than 85%, and the slope is between -3.0 and -4.0, the standard curve can be used for the quantitative calculation of unknown samples in the same batch. Among them, the slope is the slope of the fitted standard curve, and the PCR amplification efficiency = 10 -1 / 斜率 -1, the correlation coefficient is obtained from the standard curve during linear fitting, and its definition is:

[0175]

[0176] If abnormal results are found, the cause must be identified, adjustments made, and the test repeated. The quantitative results and standard curve results for the standard template are shown below. Figures 17 to 20 The results of simulated fusion gene positive samples are shown in Table 7.

[0177] Table 7. Quantitative detection results of simulated fusion gene positive samples

[0178] The concentration recorded by experimenter A

[0179] Mixed Sample 1 445 copies / μL 462 copies / μL Mixed Sample 2 134 copies / μL 303 copies / μL Mixed Sample 3 320 copies / μL 520 copies / μL

[0180] The quantitative results obtained by experimenter B

[0181]

[0182] Experimenter B compared the quantitative results of the simulated sample with the concentration calculated by Experimenter A during incorporation. The comparison showed that the concentration after quantification using the system was comparable to the calculated concentration during incorporation, indicating accurate quantification. In summary, the primers, probes, and detection methods designed in this application can simultaneously quantify multiple NUP98 fusion genes with high accuracy and throughput.

[0183] Although specific embodiments of the invention have been described in detail, those skilled in the art will understand that various modifications and variations can be made to the details based on all the published teachings, and all such changes are within the scope of protection of the invention. The entire scope of the invention is given by the appended claims and any equivalents thereof. SEQUENCE LISTING <110> Xiamen Zhishan Biotechnology Co., Ltd. <120> A method and kit for quantitative detection of multiple NUP98 fusion genes <130> IDC200447 <160> 39 <170> PatentIn version 3.5 <210> 1 <211> twenty two <212> DNA <213> artificial <220> <223> NUP98-F <400> 1 cctgggactc ttggaactgg gc 22 <210> 2 <211> 20 <212> DNA <213> artificial <220> <223> NUP98-HHEX-R <400> 2 ttctgaacc aggttttgac <210> 3 <211> 21 <212> DNA <213> artificial <220> <223> NUP98-HHEX-P <400> 3 ggcttggtgc total <210> 4 <211> 19 <212> DNA <213> artificial <220> <223> NUP98-KDM5-R <400> 4 tttctagctt ccgtttccg <210> 5 <211> 26 <212> DNA <213> artificial <220> <223> NUP98-KDM5-P <400> 5 gaggagag gatgacagca tggaag <210> 6 <211> 17 <212> DNA <213> artificial <220> <223> NUP98-LOC348801-R <400> 6 ccagaagctg ctcatcc <210> 7 <211> 26 <212> DNA <213> artificial <220> <223> NUP98-LOC348801-P <400> 7 cctaagaaga aggaagaggg acaggc 26 <210> 8 <211> 20 <212> DNA <213> artificial <220> <223> NUP98-PHF23-R <400> 8 cttctcaagc aaggtagcac 20 <210> 9 <211> 25 <212> DNA <213> artificial <220> <223> NUP98-PHF23-P <400> 9 cgacagtgct accttgcttg agaag 25 <210> 10 <211> 18 <212> DNA <213> artificial <220> <223> NUP98-HODX13-R <400> 10 tcggtagacg cacatgtc 18 <210> 11 <211> 28 <212> DNA <213> artificial <220> <223> NUP98-HODX13-P <400> 11 cagtagggga tgtggctcta aatcagcc 28 <210> 12 <211> 16 <212> DNA <213> artificial <220> <223> NUP98-LEDGF-F <400> 12 acccaagcct cacagc 16 <210> 13 <211> 16 <212> DNA <213> artificial <220> <223> NUP98-LEDGF-R <400> 13 gctgcaggtc gtcctc 16 <210> 14 <211> 26 <212> DNA <213> artificial <220> <223> NUP98-LEDGF-P <400> 14 actgaggagg caggagtagt gacaac 26 <210> 15 <211> 19 <212> DNA <213> artificial <220> <223> NUP98-NSD3-R <400> 15 gcacgttctc tctgaggtc 19 <210> 16 <211> 24 <212> DNA <213> artificial <220> <223> NUP98-NSD3-P <400> 16 aggtgcccga gaatatcatg tcca 24 <210> 17 <211> 19 <212> DNA <213> artificial <220> <223> NUP98-NSD1-R <400> 17 aaggcgtttc ttctctgac 19 <210> 18 <211> 22 <212> DNA <213> artificial <220> <223> NUP98-NSD1-P <400> 18 cccagtagct gtgcggtcag ag 22 <210> 19 <211> 21 <212> DNA <213> artificial <220> <223> NUP98-TOP1-R <400> 19 tttcttgtta tctggctcag g 21 <210> 20 <211> 33 <212> DNA <213> artificial <220> <223> NUP98-TOP1-P <400> 20 gaccctaaga agaaggaaga ggatggtaaa ttg 33 <210> 21 <211> 22 <212> DNA <213> artificial <220> <223> NUP98-ADD3-R <400> 21 ttgtgcttaa cctactcact cg 22 <210> 22 <211> 26 <212> DNA <213> artificial <220> <223> NUP98-ADD3-P <400> 22 ttccaagagc ttcatctcca tggaag 26 <210> 23 <211> 20 <212> DNA <213> artificial <220> <223> NUP98-DDX10-R <400> 23 cggcaaaaca ctcggtacag 20 <210> 24 <211> 36 <212> DNA <213> artificial <220> <223> NUP98-DDX10-P <400> 24 ttgagaagcc atctgaagaa gaagagcatt gtattt 36 <210> 25 <211> 18 <212> DNA <213> artificial <220> <223> GUS-F <400> 25 gtctggatca aaaacgca 18 <210> 26 <211> 19 <212> DNA <213> artificial <220> <223> GUS-R <400> 26 gagacaacca aaaagtgca 19 <210> 27 <211> 25 <212> DNA <213> artificial <220> <223> GUS-P <400> 27 gaatttgcc gaattcatga ctgaa 25 <210> 28 <211> 282 <212> DNA <213> artificial <220> <223> NUP98-HHEX <400> 28 cttgacaga tccaaatgct tctgctgccc agcaggctgt tctccagcag cacatcaata 60 gtctaacata ctcacctttt ggactctc ctctcttccg gaatccgatg tcagacccta 120 agaagaagga agagaggcct ctgcataaaa ggaaaggcgg ccaggtgaga ttctccaacg 180 accagaccat cgagctggag aagaaattcg agacgcagaa atactctct ccgcccgaga 240 ggaagcgtct ggccaagatg ctgcagctca gcgagagaca gg 282 <210> 29 <211> 259 <212> DNA <213> artificial <220> <223> NUP98-HOXD13 <400> 29 gctcttggtg ctggacaggc atctttgttt gggaacaacc aacctaagat tggagggcct 60 cttggtacag gagcctttgg ggcccctgga tttaatacta cgacagccac tttgggcttt 120 ggagcccccc aggccccagt aggggatgtg gctctaaatc agccggacat gtgcgtctac 180 cgaagaggga ggaagaagag agtgccttac accaaactgc agcttaaaga actggagaac 240 gagtatgcca ttaacaaat 259 <210> 30 <211> 287 <212> DNA <213> artificial <220> <223> NUP98-LOC348801 <400> 30 cttgacaga tccaaatgct tctgctgccc agcaggctgt tctccagcag cacatcaata 60 gtctaacata ctcacctttt ggactctc ctctcttccg gaatccgatg tcagacccta 120 agaagaagga agagggacag gccttcagta tttggcatca cctttacatg gagcacaaag 180 atgatgatga tgatgatgtg tcttttgcca aatggatgag cagcttctgg ggccacagct 240 ggagagagga ggatcagaga ggactccggg aacgccaccg actgcaa 287 <210> 31 <211> 299 <212> DNA <213> artificial <220> <223> NUP98-TOP1 <400> 31 ctttgacaga tccaaatgct tctgctgccc agcaggctgttccagcag cacatcaata gtctaacata ctcacctttt ggagactctc ctctctccg gatccgatg tcagacccta 120 agagaagga agaggatggt aaattgaaaaaccaaaaagaaaaaaag 180 ttcctgagcc agatacaag aaaagaagc cgagaaga aggagacag aagtgaat 240 ggtgggaaga agagcgctat cctgaaggca tcaagtggaa attcctagaa cataaaggt 299 <210> 32 <211> 354 <212> DNA <213> artificial <220> <223> NUP98-KDM5 <400> 32 ctttgacaga tccaaatgct tctgctgccc agcaggctgttccagcag cacatcaata gtctaacata ctcacctttt ggagactctc ctctctccg gatccgatg tcagacccta 120 high-frequency high-frequency high-frequency high-frequency 180 cttcagagaa gaacggaaa cggaagctag aaaggtaga gcaacttttt gagaaggaa 240 aacagaagtc caaggagtta aagaaaatgg acaaacctag aaagagaaa taaaattag 300 gtgcagacaa atcaaaggag ctgaataaac tggccaagaa actagcaaaa gaag 354 <210> 33 <211> 393 <212> DNA <213> artificial <220> <223> NUP98-DDX10 <400> 33 gctcttggtg ctggacaggc atctttgttt gggaacaacc aacctaagat tggagggcct 60 cttggtacag gagcctttgg ggcccctgga tttaatacta cgacagccac tttgggcttt 120 ggagcccccc aggccccagt agttcttgat gaagcagata gaatcttgga tatgggcttt 180 gctgatacca tgaatgctgt tattgaaaat ctccccaaga aacgtcagac tttacttttc 240 tcagcaacac aaactaaatc tgtaaaggac cttgcacgct tgagtttgaa aaaccctgag 300 tatgtctggg ttcatgaaaa agcaaaatat agcacccctg ccactttgga agaactac 360 393 <210> 34 <211> 299 <212> DNA <213> artificial <220> <223> NUP98-NDS1 <400> 34 ctcttggtgc tggacaggca tcttgttg ggacaacca acctaagatt ggagggctc 60 ttggtacagg agccttttgggg gccctggat tattac agamcccact tggggctttg 120 gagcccccca ggccccagta gctgtgcggt cagagaagaa acgccttagg aagccaagca 180 agtggctttt ggaataca gagaatatg atcagatatt tgctcctaag aaaaaaaaaaa 240 agaaggtaca ggagcaggtg cacaagtaa gttcccgctg tgagaggaa agccttcta 299 <210> 35 <211> 229 <212> DNA <213> artificial <220> <223> NUP98-NDS3 <400> 35 gttttggcac aaataccagt gggaatagta ttttggaag taaaccagca cctgggactc 60 ttggaactgg gcttgtgca ggatttggaa caggtgcccg agaatcat gtccagtttt 120 ttagcaacca gccagagagg gcgtgggttc atgaaaaacg ggtacgagag tataaaggtc 180 aaacagta tgagatta ctggctgagg wind wind 229 <210> 36 <211> 277 <212> DNA <213> artificial <220> <223> NUP98-LEDGF <400> 36 gggattattt ggagtaaccc aagcctcaca gctggaggt ctttggga cagctacaaa 60 caccagcact ggctcttt gggcagacca atactggatt tggtgctt ggttcggcag 120 aaaaacaagt agaactgag gaggcaggg tagtgacaac agcaacagca tctgttaatc 180 taaaagtgag tcctaaaaga ggacgacctg cagctacaga agtcaagatt ccaaaaccaa 240 gaggcagacc caaatgta aaacagccct gtccttc 277 <210> 37 <211> 236 <212> DNA <213> artificial <220> <223> NUP98-ADD3 <400> 37 ctcttggtgc tggacaggca tcttgttg ggacaacca acctaagatt ggagggctc 60 ttggtacagg agccttttgggg gccctggat tattac agamcccact tggggctttg 120 gagcccccca ggccccagta gatgctgagc aggaattact ctcagatgac gcttcatctg 180 tttcacaaat tcagtctcaa actcagtcac cgcaaatgt ccctgaaaaa ttagaa 236 <210> 38 <211> 341 <212> DNA <213> artificial <220> <223> NUP98-PHF23 <400> 38 ctttgacaga tccaaatgct tctgctgccc agcaggctgt tctccagcag cacatcaata 60 gtctaacata ctcacctttt ggagactctc ctctcttccg gaatccgatg tcagacccta 120 agaagaagga agaggccccc gacagtgcta ccttgcttga gaagatgaag ctcaaggact 180 ctctctttga tctggatggg cccaaagtgg catctccttt gtcccccaca tccctgacac 240 atacctcccg gccccctgct gctcttaccc ccgtgcccct ttcccagggg gacctctccc 300 atcctcctcg aaagaaggac cgaaagaacc gaaagttggg g 341 <210> 39 <211> 693 <212> DNA <213> artificial <220> <223> GUS gene <400> 39 gctccgtatg tggatgtgat ctgtttgaac agctactact cttggtatca cgactacggg 60 cacctggagt tgattcagct gcagctggcc acccagtttg agaactggta taagaagtat 120 cagaagccca ttattcagag cgagtatgga gcagaaacga ttgcagggtt tcaccaggat 180 ccacctctga tgttcactga agagtaccag aaaagtctgc tagagcagta ccatctgggt 240 ctggatcaaa aacgcagaaa atacgtggtt ggagagctca tttggaattt tgccgatttc 300 atgactgaac agtcaccgac gagagtgctg gggaataaaa aggggatctt cactcggcag 360 agacaaccaa aaagtgcagc gttccttttg cgagagagat actggaagat tgccaatgaa 420 accaggtatc cccactcagt agccaagtca caatgtttgg aaaacagccc gtttacttga 480 gcaagactga taccacctgc gtgtcccttc ctccccgagt cagggcgact tccacagcag 540 cagaacaagt gcctcctgga ctgttcacgg cagaccagaa cgtttctggc ctgggttttg 600 tggtcatcta ttctagcagg gaacactaaa gttggaaata aaagattttc tattatggaa 660 ataaagagtt ggcatgaaag tggctactga aaa 693

Claims

1. The use of primer sets and detection probes in the preparation of kits for the quantitative detection of multiple NUP98 fusion genes; in, The sequence of the NUP98 fusion gene contains all or part of the nucleotide sequence encoding the NUP98 protein and all or part of the nucleotide sequence encoding the NUP98 partner proteins HHEX, HOXD13, LOC348801, TOP1, KDM5, DDX10, NDS1, NDS3, LEDGF, ADD3 and / or PHF23. The primer set comprises: an upstream primer as shown in SEQ ID NO: 1, and downstream primers as shown in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21 and SEQ ID NO: 23; and an upstream primer as shown in SEQ ID NO: 12 and a downstream primer as shown in SEQ ID NO: 13; Furthermore, the sequences of the detection probes are shown in SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22 and SEQ ID NO:

24.

2. The method of claim 1, wherein the sequence of the NUP98 fusion gene is selected from SEQ ID NO: 28 to SEQ ID NO:

38.

3. The method of claim 1, wherein, The detection probe has one or more of the following technical features: (1) Each of the detection probes independently comprises or consists of naturally occurring nucleotides, modified nucleotides, non-natural nucleotides, or any combination thereof; (2) Each of the detection probes has an independent 3'-OH end; or, the 3'-end of the detection probe is closed; (4) The reporter groups in the detection probes are each independently a fluorescent group; (5) Each of the detection probes independently has the same or different reporter groups; (6) The detection probes do not have resistance to nuclease activity, or each probe independently has resistance to nuclease activity; (7) Each of the detection probes is independently labeled with a reporter group at its 5' end or upstream and with a quencher group at its 3' end or downstream, or with a reporter group at its 3' end or downstream and with a quencher group at its 5' end or upstream.

4. A kit for quantitative detection of NUP98 fusion genes, the kit comprising a primer set capable of amplifying target nucleic acids containing different NUP98 fusion genes and a detection probe capable of sequence-specific hybridization with the NUP98 fusion gene in the target nucleic acid; in, The sequence of the NUP98 fusion gene contains all or part of the nucleotide sequence encoding the NUP98 protein and all or part of the nucleotide sequence encoding the NUP98 partner proteins HHEX, HOXD13, LOC348801, TOP1, KDM5, DDX10, NDS1, NDS3, LEDGF, ADD3 and / or PHF23. The primer set comprises: an upstream primer as shown in SEQ ID NO: 1, and downstream primers as shown in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21 and SEQ ID NO: 23; and an upstream primer as shown in SEQ ID NO: 12 and a downstream primer as shown in SEQ ID NO: 13; Furthermore, the sequences of the detection probes are shown in SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22 and SEQ ID NO:

24.

5. The kit of claim 4, further comprising a set of internal reference primers capable of amplifying the target nucleic acid containing the GUS gene, and an internal reference detection probe for sequence-specific hybridization of the internal reference gene in the target nucleic acid.

6. The kit of claim 4, wherein the sequence of the NUP98 fusion gene is selected from SEQ ID NO: 28 to SEQ ID NO:

38.

7. The kit of claim 5, wherein, The kit has one or more features selected from the following: (1) The primer sequences of the internal reference primer set are shown in SEQ ID NO: 25 and SEQ ID NO: 26; and the sequence of the detection probe is shown in SEQ ID NO: 27; (2) Each primer in the primer set independently contains or consists of naturally occurring nucleotides, modified nucleotides, non-natural nucleotides, or any combination thereof.

8. The kit of claim 4, wherein, The kit has one or more features selected from the following: (1) Each of the detection probes independently comprises or consists of naturally occurring nucleotides, modified nucleotides, non-natural nucleotides, or any combination thereof; (2) Each of the detection probes has an independent 3'-OH end; or, the 3'-end of the detection probe is closed; (3) The reporter groups in the detection probe are each independently a fluorescent group; and the quenching group is a molecule or group that can absorb / quench the fluorescence; (4) Each of the detection probes independently has the same or different reporter groups; (5) The detection probes do not have resistance to nuclease activity, or each probe is independently modified to resist nuclease activity; (6) Each of the detection probes is independently labeled with a reporter group at its 5' end or upstream and with a quencher group at its 3' end or downstream, or with a reporter group at its 3' end or downstream and with a quencher group at its 5' end or upstream.