Methods and compositions for enriching amplification products

Abstract

In some aspects, the present disclosure provides methods for enriching amplicons or amplification products comprising concatemers of at least two or more copies of a target polynucleotide. In some embodiments, the methods comprise sequencing an amplicon comprising at least two or more copies of a target polynucleotide. In some embodiments, the target polynucleotide comprises a sequence resulting from a chromosomal rearrangement including, but not limited to, a point mutation, a single nucleotide polymorphism, an insertion, a deletion, and a translocation comprising a fusion gene. In some aspects, the present disclosure provides compositions and reaction mixtures useful in the methods.

Description

[0001] This application is a divisional application of Chinese patent application No. 201680072543.1, filed on October 7, 2016, entitled "Method and Composition for Enriching Amplified Products" (the corresponding PCT application was filed on October 7, 2016, with application number PCT / US2016 / 056126).

[0002] Cross-references

[0003] This application claims the benefit of U.S. Provisional Application No. 62 / 239,690, filed October 9, 2015, which is incorporated herein by reference. Background of the Invention

[0004] The advent of massively parallel nucleic acid sequencing has made it feasible to identify sequence variations within complex populations. Rolling circle amplification (RCA), an amplification method utilizing polymerases with strand displacement capabilities, has emerged as a useful alternative and complement to polymerase chain reaction (PCR) procedures used to prepare nucleic acids for sequencing analysis. RCA involves growing polynucleotides with repetitive sequences by sequentially adding nucleotides to primers that anneal to a circular polynucleotide template (such as a circular DNA template). This extension process can cover the full length of the circular polynucleotide template multiple times, resulting in the formation of repetitive sequences, or so-called polymers, of the template. These polymers can also serve as templates to generate further amplification products. However, this extension only proceeds until the ends of the linear polymers are reached. As the leading edge of the growing polynucleotide chain encounters the double-stranded portion of the DNA, the growing chain replaces the existing strand of the template. The result is typically the formation of double-stranded DNA of various lengths composed of a variable number of repetitions of the template sequence. In conventional RCA methods, shorter polymers are often amplified disproportionately compared to longer polymers containing multiple repetitions of the target sequence. Therefore, further analysis of longer polysynthetic structures may be more difficult.

[0005] Massive parallel sequencing has significant limitations because the inherent error frequency of commonly used techniques is greater than the frequency of many actual sequence variants within a population. For example, error rates of 0.1–1% have been reported in standard high-throughput sequencing. When variant frequencies are low, such as equal to or below this error rate, the detection of rare sequence variants has a high false-positive rate.

[0006] The ability to detect rare sequence variants is crucial for a variety of reasons. For example, detecting rare characteristic sequences can be used to identify and differentiate the presence of harmful environmental pollutants such as bacterial taxa. A common method for characterizing bacterial taxa is to identify differences in highly conserved sequences such as rRNA sequences. However, typical sequencing-based methods to date face challenges related to the absolute number of different genomes in a given sample and the degree of homology between members, thus presenting complex problems to an already cumbersome procedure.

[0007] Existing techniques for detecting sequence variations are particularly inefficient at detecting fusion gene variations and chromosomal rearrangements. Often, the 'partner' gene fused with the rearranged gene is unknown, making detection even more challenging. Fusion genes may also be difficult to detect if the junction is not observed. Summary of the Invention

[0008] In view of the above, there is a need for alternative and / or robust methods and compositions for detecting rare sequence variations, particularly rare sequence alterations and gene fusion events. The compositions and methods of this disclosure meet this need and also provide additional benefits. In particular, various aspects of this disclosure provide amplicons containing multiple copies of the target polynucleotide for use in massively parallel sequencing methods. Using amplicons containing multiple copies of the target polynucleotide allows for sequencing of the target polynucleotide more than once, thereby reducing errors when sequencing rare sequence variants and fusion genes.

[0009] In one aspect, a method for enriching amplicones of multiplexes containing at least two or more copies of a target polynucleotide is disclosed. The method comprises: (a) generating a multiplex containing a single-stranded polynucleotide from a cyclic target polynucleotide by extending a first primer, the first primer comprising a first 3' end that specifically hybridizes to the target polynucleotide via sequence complementarity and a first 5' end that does not specifically hybridize to the target polynucleotide via sequence complementarity; (b) generating multiple extension products containing one or more copies of the target polynucleotide by extending a second primer, the second primer comprising a second 3' end that specifically hybridizes to the multiplex via sequence complementarity and a second 5' end that does not specifically hybridize to the multiplex via sequence complementarity, wherein the first and second common sequences each comprise at least 10 consecutive nucleotides at their 5' ends and are at least 90% identical when optimally aligned; and (c) amplifying the multiple extension products of step (b) under conditions of generating multiple amplicones, wherein amplicones containing at least two or more copies of the target polynucleotide are enriched. In some embodiments, step (a) is performed by a polymerase with chain displacement activity. In some embodiments, the first common sequence and the second common sequence are identical. In some embodiments, the amplification in step (c) includes primer extension of a third primer, wherein the third primer contains a sequence that specifically hybridizes to the first or second common sequence via sequence complementarity. In some embodiments, the percentage of amplicones with two or more copies of the target polynucleotide produced by the amplification step (c) is greater than the percentage of amplicones with fewer than two copies of the target polynucleotide. In some embodiments, the percentage of amplicones with two or more copies of the target polynucleotide is at least 90%. In some embodiments, the percentage of amplicones with two or more copies of the target polynucleotide is at least 80%. In some embodiments, the percentage of amplicones with two or more copies of the target polynucleotide is at least 60%. In some embodiments, the extension product forms a stem-loop structure comprising (i) intramolecular hybridization between the complement of the first common sequence and the second common sequence, or (ii) intramolecular hybridization between the complement of the second common sequence and the first common sequence. In some embodiments, the stem-loop product is formed by amplification in step (c) while the annealing step is performed at a temperature within ±5°C of the third primer's melting temperature. In some embodiments, the stem-loop product is formed by amplification in step (c) while the annealing step is performed at a temperature below 70°C. In some embodiments, the stem-loop structure comprises intramolecular hybridization of at least 9 base pairs. In some embodiments, the stem-loop structure comprises intramolecular hybridization of at least 15 base pairs. In some embodiments, the stem-loop structure comprises intramolecular hybridization of at least 20 base pairs.In some embodiments, the stem-loop structure comprises intramolecular hybridization of at least 25 base pairs. In some embodiments, the stem-loop structure comprises intramolecular hybridization of at least 30 base pairs. In some embodiments, step (b) comprises no more than 6 cycles of second primer extension. In some embodiments, step (b) comprises no more than 8 cycles of second primer extension. In some embodiments, step (b) comprises no more than 10 cycles of second primer extension. In some embodiments, the hybridization sequences of the first common sequence, the second common sequence, and the third primer all have melting temperatures (Tm) within ±5°C of each other. In some embodiments, the circular target polynucleotide is circularized cell-free DNA. In some embodiments, the circular target polynucleotide is a circularized fragment of genomic DNA. In some embodiments, the circular target polynucleotide comprises a sequence generated by chromosomal rearrangement. In some embodiments, the chromosomal rearrangement is at least one of deletion, duplication, inversion, and translocation. In some embodiments, the combined length of the sequence portions of the target polynucleotide from 5' to 3' corresponding to (i) the sequence complementary to the first 3' end, (ii) the same sequence as the second 3' end, and (iii) the interpolated sequence between (i) and (ii) is 75 nucleotides or less. In some embodiments, at least 50% of the polynucleotides contain a target polynucleotide of at least 75 nucleotides in length. In some embodiments, the circular target polynucleotide is single-stranded. In some embodiments, the method further includes sequencing the multiple amplicons generated in step (c). In some embodiments, the sequencing is performed without selectively purifying amplicons containing two or more copies of the target polynucleotide relative to amplicons containing only one copy of the target polynucleotide. In some embodiments, the method further includes purifying amplicons containing two or more copies of the target polynucleotide from the multiple amplicons generated in step (c). In some embodiments, the method further includes sequencing the purified amplicons. In some embodiments, multiple different target polynucleotides are amplified in the same reaction mixture.

[0010] In another embodiment, a reaction mixture for enriching amplicon of a multiplex containing at least two or more copies of a target polynucleotide is disclosed. In one embodiment, the reaction mixture comprises: (a) a cyclic target polynucleotide; (b) a first primer comprising a first 3' end that hybridizes specifically to the target polynucleotide via sequence complementarity and a first 5' end comprising a first common sequence that does not hybridize specifically to the target polynucleotide via sequence complementarity; and (c) a second primer comprising a second 3' end that hybridizes specifically to the multiplex via sequence complementarity and a second 5' end comprising a second common sequence that does not hybridize specifically to the multiplex via sequence complementarity, wherein the first common sequence and the second common sequence each comprise at least 10 consecutive nucleotides at their 5' ends and are at least 90% identical when optimally aligned, and the multiplex is an extension of the first primer. In some embodiments, the first common sequence and the second common sequence are identical. In some embodiments, the reaction mixture is contained in a container. In some embodiments, the container is a well, plate, tube, chamber, flow cell, or chip. In some embodiments, the reaction mixture further comprises a third primer having a sequence that specifically hybridizes to a first common sequence or a second common sequence via sequence complementarity. In some embodiments, the hybridization sequences of the first common sequence, the second common sequence, and the third primer all have melting temperatures (Tm) within ±5°C of each other. In some embodiments, the first common sequence and the second common sequence each comprise at least 15 nucleotides. In some embodiments, the circular target polynucleotide is circularized cell-free DNA. In some embodiments, the circular target polynucleotide is a circularized fragment of genomic DNA. In some embodiments, the circular target polynucleotide comprises a sequence generated by a chromosomal rearrangement. In some embodiments, the chromosomal rearrangement is at least one of deletion, duplication, inversion, and translocation. In some embodiments, the combined length of the sequence portion of the target polynucleotide corresponding from 5' to 3' along the target polynucleotide to (i) a sequence complementary to the first 3' end, (ii) a sequence identical to the second 3' end, and (iii) an interpolated sequence between (i) and (ii) is 75 or fewer nucleotides. In some embodiments, the circular target polynucleotide is single-stranded.

[0011] In another embodiment, a kit for enriching amplicones of multiplexes containing at least two or more copies of a target polynucleotide is disclosed. In one embodiment, the kit comprises: (a) a first primer comprising a first 3' end that hybridizes specifically to the target polynucleotide via sequence complementarity and a first 5' end that does not hybridize specifically to the target polynucleotide via sequence complementarity; (b) a second primer comprising a second 3' end that hybridizes specifically to the multiplexe via sequence complementarity and a second 5' end that does not hybridize specifically to the multiplexe via sequence complementarity, wherein the first and second common sequences each contain at least 10 consecutive nucleotides at their 5' ends and are at least 90% identical when optimally aligned, and the multiplexe is an extension of the first primer; and (c) a third primer having a sequence that hybridizes specifically to either the first or second common sequence via sequence complementarity. In some embodiments, the first and second common sequences are identical. In some embodiments, the hybridization sequences of the first, second, and third primers all have melting temperatures (Tm) within ±5°C of each other. In some embodiments, the combined length of the sequence portion of the target polynucleotide from 5' to 3' corresponding to (i) a sequence complementary to the first 3' end, (ii) a sequence identical to the second 3' end, and (iii) an interpolated sequence between (i) and (ii) is 75 nucleotides or less.

[0012] On the other hand, a system for designing primers for enriching amplicon containing at least two or more copies of a target polynucleotide is disclosed. In one embodiment, the system comprises: (a) a computer configured to receive a client request to design primers for amplifying a specified target sequence; and (b) a computer-readable medium containing code that, when executed by one or more processors, designs at least three primers for amplifying the target sequence, wherein the at least three primers comprise: (i) a first primer comprising a first 3' end that specifically hybridizes to the target polynucleotide through sequence complementarity and a first 5' end comprising a first common sequence that does not specifically hybridize to the target polynucleotide through sequence complementarity; and (ii) a second primer comprising a first 3' end that specifically hybridizes to the target polynucleotide through sequence complementarity. The first and second common sequences are: (i) a second 3' end that specifically hybridizes with the polyp and (ii) a second 5' end that does not specifically hybridize with the polyp through sequence complementarity, wherein the first and second common sequences each contain at least 10 consecutive nucleotides at their 5' ends and are at least 90% identical when optimally aligned, and the polyp is an extension of the first primer; (iii) a third primer having a sequence that specifically hybridizes with the first or second common sequence through sequence complementarity; and (c) a report generator that sends a report to a recipient, wherein the report contains the sequences of the at least three primers. In some embodiments, the first and second common sequences are identical. In some embodiments, the hybridization sequences of the first, second, and third primers all have melting temperatures (Tm) within ±5°C of each other. In some embodiments, the combined length of the sequence portions of the target polynucleotide corresponding from 5' to 3' along the target polynucleotide to (i) the sequence complementary to the first 3' end, (ii) the sequence identical to the second 3' end, and (iii) the interpolation sequence between (i) and (ii) is 75 or fewer nucleotides.

[0013] In one aspect, this disclosure provides a method for performing rolling circle amplification. The method includes (a) providing a cyclic polynucleotide comprising a target polynucleotide; and (b) subjecting an amplification reaction mixture to multiple cycles of rolling circle amplification to generate multiple amplification products comprising polynucleotides, wherein the amplification reaction mixture comprises (i) a polymerase having chain displacement activity, (ii) the cyclic polynucleotide, and (iii) primers; and wherein each cycle of the multiple cycles of rolling circle amplification comprises denaturation at a denaturation temperature, primer annealing at an annealing temperature, and primer extension at an extension temperature for a given extension time, thereby generating multiple amplification products; and wherein the generated multiple amplification products are characterized by containing a higher proportion of polynucleotides having at least two copies compared to multiple amplification products generated by an amplification cycle utilizing equivalent denaturation and primer annealing conditions but with an extension time equivalent to the sum of the extension times of the multiple cycles.

[0014] In one aspect, this disclosure provides a method for increasing the proportion of multiplys containing at least two copies of a target polynucleotide generated by rolling circle amplification. The method includes (a) providing a cyclic polynucleotide comprising the target polynucleotide; and (b) subjecting an amplification reaction mixture to multiple cycles of rolling circle amplification to generate multiple amplification products containing multiplys, wherein the amplification reaction mixture comprises (i) a polymerase with chain displacement activity, (ii) the cyclic polynucleotide, and (iii) primers; and wherein each cycle of the multiple cycles of rolling circle amplification includes denaturation at a denaturation temperature, primer annealing at an annealing temperature, and primer extension at an extension temperature for a given extension time, thereby generating multiple amplification products; thereby increasing the proportion of multiplys containing at least two copies of the target polynucleotide. In some embodiments, the proportion of multiplys containing at least two copies of the target polynucleotide in the multiple amplification products is increased compared to multiple amplification products generated by utilizing an amplification cycle with equivalent denaturation and primer annealing conditions but an extension time equivalent to the sum of the extension times of the multiple cycles.

[0015] In some embodiments, the polymerase is selected from: Bsu DNA polymerase, Vent polymerase, Bst DNA polymerase, phi29 DNA polymerase, PyroPhage 3173 polymerase, any variant thereof, and any fragment thereof.

[0016] In some embodiments, when the cyclic polynucleotide used in the reaction mixture comprises human cell-free DNA (cfDNA), the multiple amplification products exhibit an average fragment length of about 180 base pairs. In some embodiments, when the cyclic polynucleotide used in the reaction mixture comprises human cell-free DNA (cfDNA), the multiple amplification products exhibit a median fragment length of about 170 base pairs. In some embodiments, when the cyclic polynucleotide used in the reaction mixture comprises human cell-free DNA (cfDNA), the multiple amplification products exhibit a fragment length distribution of about 40 to about 450 base pairs. In some embodiments, when the cyclic polynucleotide used in the reaction mixture comprises human cell-free DNA (cfDNA), the multiple amplification products exhibit a fragment length distribution of about 100 to about 200 base pairs.

[0017] In some embodiments, the proportion of multiplys having at least two copies of the target polynucleotide is increased by at least about 1%. In some embodiments, the method further includes replenishing the reaction mixture with polymerase after at least one cycle of rolling circle amplification in a plurality of cycles.

[0018] In some embodiments, the cyclic polynucleotide has a length of about 40 bases to about 500 bases. In some embodiments, the cyclic polynucleotide comprises cell-free DNA (cfDNA). In some embodiments, the cyclic polynucleotide comprises a fragment of genomic DNA. In some embodiments, the cyclic polynucleotide comprises a sequence generated by a chromosomal rearrangement. In some embodiments, the chromosomal rearrangement is at least one of deletion, duplication, inversion, and translocation. In some embodiments, the cyclic polynucleotide is double-stranded. In some embodiments, the cyclic polynucleotide is single-stranded.

[0019] In some embodiments, multiple different cyclic polynucleotides are amplified in the amplification reaction mixture. In some embodiments, the plurality of cycles includes at least two cycles. In some embodiments, each of the plurality of cycles includes (i) denaturation at a denaturation temperature of about 75°C to about 95°C for about 5 seconds to about 60 seconds, (ii) primer annealing at an annealing temperature of about 45°C to about 65°C for about 5 seconds to about 60 seconds, and (iii) primer extension at an extension temperature of about 65°C to about 75°C for about 30 seconds to about 10 minutes. In some embodiments, each of the plurality of cycles includes (i) denaturation at a denaturation temperature of about 80°C for about 15 seconds to about 30 seconds, (ii) primer annealing at an annealing temperature of about 50°C for about 15 seconds to about 45 seconds, and (iii) primer extension at an extension temperature of about 70°C for about 3 minutes to about 10 minutes.

[0020] In some embodiments, the primer comprises a random sequence capable of randomly hybridizing with and priming different regions of a cyclic polynucleotide for primer extension. In some embodiments, the primer comprises a gene-specific sequence capable of hybridizing with and priming a region of a cyclic polynucleotide in a sequence-specific manner for primer extension. In some embodiments, the primer comprises a first primer comprising (i) a first 3' end that hybridizes specifically with the cyclic polynucleotide via sequence complementarity, and (ii) a first 5' end comprising a first common sequence that does not hybridize specifically with the target polynucleotide via sequence complementarity, wherein during multiple cycles of rolling circle amplification, multiplyes comprising single-stranded polynucleotides are generated by extending the first primer using a cyclic polynucleotide as a template. In some embodiments, the primer includes a second primer comprising (i) a second 3' end that specifically hybridizes to a multiplex containing a single-stranded polynucleotide via sequence complementarity, and (ii) a second 5' end containing a second common sequence that does not specifically hybridize to the multiplex via sequence complementarity, wherein multiple extension products containing one or more copies of the target polynucleotide are generated by extending the second primer using the multiplex as a template during multiple cycles of rolling circle amplification. In some embodiments, the first common sequence and the second common sequence each contain at least 10 consecutive nucleotides at their 5' ends and are at least 90% identical when optimally aligned. In some embodiments, the first common sequence and the second common sequence are identical.

[0021] In some embodiments, the method further includes amplifying multiple extension products under conditions that generate multiple amplicons, wherein amplicons containing at least two or more copies of the target polynucleotide are enriched. In some embodiments, the amplification includes primer extension of a third primer, wherein the third primer contains a sequence that specifically hybridizes to a first common sequence or a second common sequence through sequence complementarity. In some embodiments, the percentage of amplicons with two or more copies of the target polynucleotide generated by amplification is greater than the percentage of amplicons with fewer than two copies of the target polynucleotide. In some embodiments, the percentage of amplicons with two or more copies of the target polynucleotide is at least 5%. In some embodiments, the percentage of amplicons with two or more copies of the target polynucleotide is at least 10%. In some embodiments, the percentage of amplicons with two or more copies of the target polynucleotide is at least 20%. In some embodiments, the percentage of amplicons with two or more copies of the target polynucleotide is at least 30%. In some embodiments, the percentage of amplicons with two or more copies of the target polynucleotide is at least 40%. In some embodiments, the percentage of amplicons with two or more copies of the target polynucleotide is at least 60%. In some embodiments, the percentage of amplicones having two or more copies of the target polynucleotide is at least 80%. In some embodiments, the percentage of amplicones having two or more copies of the target polynucleotide is at least 90%.

[0022] In some embodiments, the multiple extension products form a stem-loop structure comprising (i) intramolecular hybridization between a complement of a first common sequence and a second common sequence, or (ii) intramolecular hybridization between a complement of a second common sequence and a first common sequence. In some embodiments, the stem-loop structure is formed by amplification with the annealing step maintained at a temperature within ±5°C of the melting temperature of the third primer. In some embodiments, the stem-loop structure is formed by amplification with the annealing step maintained at a temperature below about 70°C. In some embodiments, the stem-loop structure comprises intramolecular hybridization of at least 9 base pairs. In some embodiments, the stem-loop structure comprises intramolecular hybridization of at least 15 base pairs. In some embodiments, the stem-loop structure comprises intramolecular hybridization of at least 20 base pairs. In some embodiments, the stem-loop structure comprises intramolecular hybridization of at least 25 base pairs. In some embodiments, the stem-loop structure comprises intramolecular hybridization of at least 30 base pairs. In some embodiments, the hybridization sequences of the first common sequence, the second common sequence, and the third primer all have melting temperatures (Tm) within ±5°C of each other.

[0023] In some embodiments, the combined length of the sequence portion of the target polynucleotide from 5' to 3' corresponding to (i) a sequence complementary to the first 3' end, (ii) a sequence identical to the second 3' end, and (iii) an interpolated sequence between (i) and (ii) is 75 nucleotides or less.

[0024] In some embodiments, the method further includes sequencing multiple amplification products containing multiples. In some embodiments, the sequencing is performed without selectively separating multiples containing at least two copies of the target polynucleotide from multiples containing fewer than two copies of the target polynucleotide.

[0025] In some embodiments, the method further includes separating multiplexes containing at least two copies of the target polynucleotide from multiplexes containing fewer than two copies of the target polynucleotide. In some embodiments, the method further includes sequencing the multiplexes containing at least two copies of the target polynucleotide.

[0026] Incorporation

[0027] All publications, patents and patent applications mentioned in this specification are incorporated herein by reference to the extent that each individual publication, patent or patent application is specifically and separately incorporated by reference. Attached Figure Description

[0028] The novel features of the invention are specifically set forth in the appended claims. A better understanding of the features and advantages of the invention will be obtained by referring to the following detailed description of illustrative embodiments utilizing the principles of the invention, and the accompanying drawings (Figures), in which:

[0029] Figure 1 The diagram illustrates the formation of a stem-ring product according to one embodiment.

[0030] Figure 2 The illustration shows a back-to-back (B2B) primer design according to one embodiment, wherein the forward and reverse primers are designed to have adjacent 5' ends for RCA amplification.

[0031] Figure 3 The illustration shows a method for constructing a sequencing library using back-to-back primers according to one implementation scheme.

[0032] Figure 4 The illustration shows a method for enriching amplicon according to one embodiment.

[0033] Figure 5 The size distribution of amplification products generated by one cycle of rolling circle amplification and multiple cycles of rolling circle amplification is shown, obtained by agarose gel.

[0034] Figure 6 The table presented shows the ratios between amplification products with different numbers of replicates.

[0035] Figure 7 The illustration shows the size distribution of individual repeating elements in exemplary rolling circle amplification reactions comprising one cycle and multiple cycles.

[0036] Figure 8 The fragment size distribution of sequencing targets generated by one cycle of rolling circle amplification and multiple cycles of rolling circle amplification is shown.

[0037] Figure 9 The presented table illustrates how, according to one implementation scheme, HD664, ELM4 / ALK fusion DNA samples are mixed with wild-type reference DNA samples in different proportions.

[0038] Figure 10 The illustration shows the detection of fusion alleles according to one implementation scheme.

[0039] Figure 11 The illustration shows that multiple target polynucleotide sequences can be detected in multiple reactions according to one implementation scheme. Detailed Implementation

[0040] Unless otherwise stated, some of the methods disclosed herein are practiced using conventional techniques within the scope of the art, including immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, and recombinant DNA. See, for example, Sambrook and Green, Molecular Cloning: A Laboratory Manual, 4th edition (2012); Current Protocols in Molecular Biology series (edited by F.M.A. Susubel et al.); Methods in Enzymology series (Academic Press, Inc.), PCR 2: A Practical Approach (edited by M.J. MacPherson, B.D. Hames, and G.G. Taylor (1995)); Harlow and Lane (edited by 1988), Antibodies, A Laboratory Manual, and Culture of Animal Cells: A Manual of Basic Technique and Specialized Applications, 6th edition (edited by R.R. Freshney (2010)).

[0041] The terms “about” or “approximately” mean that a particular value is within an acceptable margin of error as determined by one of ordinary skill in the art, depending in part on how the value was measured or determined, i.e., the limitations of the measurement system. For example, “about” can mean within one or more standard deviations according to practice in the art. Alternatively, “about” can mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value. Or, particularly for biological systems or processes, the term can mean within an order of magnitude of the numerical value, preferably within five times, more preferably within two times. When describing a particular value in this application and claims, unless otherwise stated, the term “about” should be considered to mean within an acceptable margin of error for the particular value.

[0042] The terms "polynucleotide," "nucleic acid," and "oligonucleotide" are used interchangeably. They refer to polymeric forms of nucleotides (deoxyribonucleotides or ribonucleotides) of arbitrary length or their analogues. Polynucleotides can have any three-dimensional structure and can perform any known or unknown function. The following are non-limiting examples of polynucleotides: coding or non-coding regions of genes or gene segments, loci (seats) identified by linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. Polynucleotides may contain one or more modified nucleotides, such as methylated nucleotides and nucleotide analogues. If present, modifications to the nucleotide structure can be conferred before or after polymer assembly. The nucleotide sequence can be broken down by non-nucleotide components. Polynucleotides can be further modified after polymerization, for example, by coupling with labeled components.

[0043] The term "target polynucleotide" refers to a nucleic acid molecule or polynucleotide in a population of nucleic acid molecules that has a target sequence, the presence, amount, and / or alteration of the nucleotide sequence or one or more of these sequences that is to be determined. A target polynucleotide can be a portion of a larger polynucleotide (e.g., a portion to be amplified, sequenced, or otherwise analyzed), or can be used to refer to a larger polynucleotide containing the target sequence. Typically, the term "target sequence" refers to a nucleic acid sequence on a single strand of nucleic acid. A target sequence can be a portion of a gene, a regulatory sequence, genomic DNA, cDNA, a fusion gene, RNA including mRNA, miRNA, rRNA, etc. A target sequence can be a target sequence derived from a sample or a secondary target such as the product of an amplification reaction.

[0044] Generally, the term "sequence variant" refers to any variation in a sequence relative to one or more reference sequences. Typically, for a given population of individuals with known reference sequences, sequence variants occur at a lower frequency than the reference sequences. In some cases, the reference sequence is a single known sequence, such as the genome sequence of a single individual. In other cases, the reference sequence is a shared sequence formed by aligning multiple known sequences, such as the genome sequences of multiple individuals in a reference population, or multiple sequencing reads of multiple nucleotides from the same individual. In some cases, sequence variants occur at a low frequency in the population (also known as "rare" sequence variants). For example, sequence variants can occur at a frequency of approximately or less than approximately 5%, 4%, 3%, 2%, 1.5%, 1%, 0.75%, 0.5%, 0.25%, 0.1%, 0.075%, 0.05%, 0.04%, 0.03%, 0.02%, 0.01%, 0.005%, 0.001%, or lower. In some cases, sequence variants occur at a frequency of approximately or less than approximately 0.1%. Sequence variants can be any variation relative to a reference sequence. Sequence variants can consist of changes, insertions, or deletions of one or more nucleotides (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides). When a sequence variant contains two or more nucleotide differences, the different nucleotides can be adjacent to each other or discontinuous. Non-limiting examples of sequence variant types include single nucleotide polymorphisms (SNPs), deletion / insertion polymorphisms (DIPs), copy number variants (CNVs), short tandem repeats (STRs), simple sequence repeats (SSRs), variable number tandem repeats (VNTRs), amplified fragment length polymorphisms (AFLPs), retrotransposon-based insertion polymorphisms, sequence-specific amplification polymorphisms, and differences in epigenetic markers detectable as sequence variants (e.g., methylation differences). In some embodiments, a sequence variant can refer to chromosomal rearrangements, including but not limited to translocations or fusion genes.

[0045] As used herein, the term "multiplex" generally refers to a ligation or amplification product comprising a series of polynucleotides containing multiple copies of a target polynucleotide sequence (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 copies of the target sequence; in some cases, at least 2 copies). In some cases, the multiplex comprises multiple copies of the target polynucleotide sequence tandemly linked. In some cases, additional polynucleotide sequences are scattered among the multiple copies of the target polynucleotide sequence.

[0046] As used herein, the terms “hybridization” and “annealing” generally refer to reactions in which one or more polynucleotides react to form a complex that is stabilized by hydrogen bonding between the bases of nucleotide residues. This hydrogen bonding can occur via Watson-Crick base pairing, Hoogstein binding, or any other sequence-specific manner. The complex can comprise two strands forming a double-stranded structure, three or more strands forming a multi-stranded complex, a self-hybridized single strand, or any combination thereof. Hybridization reactions can constitute steps in broader processes, such as the initiation of PCR or the ribozyme digestion of polynucleotides. A first sequence that can be stabilized by hydrogen bonding with the bases of nucleotide residues of a second sequence is referred to as being “hybridizable” to the second sequence. In this case, the second sequence may also be referred to as being hybridizable to the first sequence.

[0047] As used herein, the terms “complement,” “complement,” and “complementarity” generally refer to a sequence that is completely complementary to and hybridizes with a given sequence. In some cases, if a base sequence in a given region can bind complementary to the base sequence of its binding partner, such that, for example, an AT, AU, GC, and GU base pair is formed, the sequence hybridizing with that given nucleic acid is referred to as a “complement” or “reverse complement” of the given molecule. Typically, a first sequence that can hybridize with a second sequence hybridizes specifically or selectively with that second sequence, such that hybridization with the second sequence or a group of second sequences is preferred over hybridization with a non-target sequence during the hybridization reaction (e.g., more thermodynamically stable under a given set of conditions, such as the stringent conditions commonly used in the art). Generally, hybridizable sequences have a certain degree of sequence complementarity in their full length or a portion thereof, such as 25%-100% complementarity, including at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100% sequence complementarity. Sequence identity, such as for assessing the percentage of complementarity, can be measured using any suitable alignment algorithm, including but not limited to the Needleman-Wunsch algorithm (see, for example, the EMBOSS Needle aligner, available from www.ebi.ac.uk / Tools / psa / emboss_needle / nucleotide.html, optionally with default settings), the BLAST algorithm (see, for example, the BLAST alignment tool, available from blast.ncbi.nlm.nih.gov / Blast.cgi, optionally with default settings), or the Smith-Waterman algorithm (see, for example, the EMBOSS Water aligner, available from www.ebi.ac.uk / Tools / psa / emboss_water / nucleotide.html, optionally with default settings). The optimal algorithm can be evaluated using any suitable parameters of the selected algorithm (including default parameters).

[0048] As used herein, the term "extension product" generally refers to the product of a reaction in which a nucleotide primer is extended by the covalent addition of a nucleotide. In some cases, nucleotide incorporation can be template-guided. In some cases, nucleotide incorporation can occur without a template. In some cases, the extension product is an amplification product such as that from PCR amplification, rolling circle amplification (RCA), or isothermal amplification.

[0049] As used herein, the term "amplification" generally refers to any process by which one or more copies of a target polynucleotide or a portion thereof are formed. A variety of methods for amplifying polynucleotides (e.g., DNA and / or RNA) are available, and some examples of these methods are described herein. Amplification can be linear, exponential, or involve both linear and exponential phases in a multi-stage amplification process. Amplification methods may include temperature variations, such as a thermal denaturation step, or may be isothermal processes that do not require thermal denaturation.

[0050] As used herein, the terms "stem-loop product" and "stem-loop structure" generally refer to a polynucleotide secondary structure in which intramolecular hybridization occurs between portions of a polynucleotide. A stem-loop can be formed when two regions of a single polynucleotide chain hybridize to form a double-stranded portion, which may be called a "stem," and an unpaired single-stranded loop, which may be called a "loop." The stem can have base pairs of any variable length, and base pairing along the stem can be interrupted within the gaps between one or more unpaired bases involved in one or both portions of the stem. The loop can have unpaired bases of any variable length. In some cases, the loop is at least 3 bases long. In some cases, the two regions forming the "stem" are completely complementary. In some cases, the two regions forming the "stem" are partially complementary. In some cases, a single polynucleotide may contain one stem-loop structure. In some cases, a single polynucleotide may contain more than one stem-loop structure. The stem portion of the stem-loop structure may terminate as a double-stranded portion without a protruding end, a single-stranded portion containing a 5' protruding end, a single-stranded portion containing a 3' protruding end, or a single-stranded portion extending from both the 5' and 3' ends.

[0051] This disclosure provides methods and compositions for generating amplicones containing two or more copies of a target polynucleotide. In some embodiments, the method is useful for detecting rare sequence variants and fusion genes. In some embodiments, gene fusions are detected without prior knowledge of the parent gene and can be used, for example, to screen for gene rearrangement events in cell-free DNA or genomic DNA samples. Various aspects of this disclosure provide amplicones containing two or more copies of a target polynucleotide that can be used with massively parallel sequencing methods.

[0052] In one aspect, this disclosure provides a method for increasing the proportion of multiplys containing at least two copies of a target polynucleotide generated by rolling circle amplification. The method includes (a) providing a cyclic polynucleotide containing the target polynucleotide, and (b) subjecting an amplification reaction mixture to multiple cycles of rolling circle amplification to generate multiple amplification products containing the multiplys. The reaction mixture may contain (i) a polymerase with chain displacement activity, (ii) the cyclic polynucleotide containing the target polynucleotide, and (iii) primers. Each cycle of the multiple cycles of rolling circle amplification may include denaturation at a denaturation temperature, primer annealing at an annealing temperature, and primer extension at an extension temperature for a given extension time. Multiple cycles of rolling circle amplification can produce multiple amplification products with an increased proportion of multiplys containing at least two copies of the target polynucleotide. The generated multiple amplification products may be characterized by containing a higher proportion of multiplys containing at least two copies of the target polynucleotide compared to multiple amplification products generated by an amplification cycle utilizing denaturation and primer annealing conditions but with an extension time equivalent to the sum of the extension times of the multiple cycles.

[0053] Polymerases with strand displacement activity (e.g., DNA polymerases with strand displacement activity) can promote rolling circle amplification. Several polymerases useful in this method are available, and non-limiting examples include Bst DNA polymerase (large fragment); Bsu DNA polymerase (large fragment); and Deep Vent. R TM DNA polymerase; Deep Vent R TM (exo-)DNA polymerase; Klenow fragment (3'-5'exo-); DNA polymerase I, large fragment; M-MuLV reverse transcriptase; phi29 DNA polymerase; PyroPhage3173 polymerase; DNA polymerase; and (exo-)DNA polymerase.

[0054] The amplification reaction mixture for rolling circle amplification may contain the necessary reagents for primer extension, including but not limited to a template (e.g., a cyclic polynucleotide), one or more primers, dNTPs, and buffer components. An amplification cycle may include (i) denaturation at a denaturation temperature, where a double-stranded template is converted to a single-stranded polynucleotide, (ii) primer annealing at an annealing temperature, where the primer hybridizes with the single-stranded polynucleotide, and (iii) primer extension at an extension temperature for a given extension time, where a single-stranded polynucleotide is used as the template for extension and hybridization with the single-stranded polynucleotide. Chain displacement polymerases are particularly useful in RCA because displacement allows the polymerase to continuously polymerize around the cyclic template more than once, thereby generating tandem copies of a sequence complementary to the cyclic template. Using a cyclic polynucleotide as a template, primer extension can be sustained on that template, thereby generating an amplification product containing multiple copies of the cyclic polynucleotide sequence (e.g., a multiplicand). In some embodiments, multiple amplification products are generated by subjecting the amplification reaction mixture to multiple cycles of rolling circle amplification.

[0055] In some embodiments, the plurality of cycles includes at least two cycles (e.g., at least 3, 4, 5, 6, 7, 8, 9, or 10 cycles). Multiple cycles of RCA can result in the formation of multiple linear polymers from a circular template. During denaturation, the extension of the first polymer from the circular template is terminated. Multiple polymers can be generated from the circular template through multiple cycles by repeating primer binding and extension. In some embodiments, three temperature phases are used—a first temperature phase for denaturation, a second temperature phase for primer binding, and a third temperature phase for primer extension. In some embodiments, a primer extension temperature higher than the primer binding temperature is selected to minimize primer binding during primer extension. When the amplification reaction mixture contains a reverse primer, minimizing primer binding during primer extension reduces the formation of shorter amplification products and reduces biased amplification of short fragments, as the primer is less likely to hybridize with the amplification product during formation. Primers that hybridize with the amplified product during formation may also participate in primer extension, but this may result in preferential amplification of smaller fragments because, during extension, smaller loops tend to generate more copies of repeating units and more primer binding sites than larger fragments within a given time period. In some embodiments, the temperature selected for primer extension may be at least 5°C higher than the temperature selected for primer annealing (e.g., at least 6°C, 7°C, 8°C, 9°C, 10°C, 11°C, 12°C, 13°C, 14°C, 15°C or more). The temperature selected for primer extension may be about 1°C to 20°C higher than the temperature selected for primer annealing (e.g., about 2°C to 18°C, about 4°C to 15°C, or about 5°C to 10°C). The temperature range suitable for non-isothermal RCA may depend on the nature of the polymerase used.

[0056] Each of the plurality of cycles may include denaturation at a denaturation temperature of at least about 70°C, 71°C, 72°C, 73°C, 74°C, 75°C, 76°C, 77°C, 78°C, 79°C, 80°C, 81°C, 82°C, 83°C, 84°C, 85°C, 86°C, 87°C, 88°C, 89°C, 90°C, 91°C, 92°C, 93°C, 94°C, or 95°C. Each of the plurality of cycles may include denaturation at a denaturation temperature of up to about 70°C, 71°C, 72°C, 73°C, 74°C, 75°C, 76°C, 77°C, 78°C, 79°C, 80°C, 81°C, 82°C, 83°C, 84°C, 85°C, 86°C, 87°C, 88°C, 89°C, 90°C, 91°C, 92°C, 93°C, 94°C, or 95°C. Each of the plurality of cycles may include denaturation at a denaturation temperature of about 70°C to about 100°C, about 70°C to about 95°C, about 70°C to about 90°C, about 70°C to about 85°C, about 70°C to about 80°C, or about 70°C to about 75°C. Each of the plurality of cycles may include denaturation at a denaturation temperature of about 70°C to about 100°C, about 75°C to about 100°C, about 80°C to about 100°C, about 85°C to about 100°C, about 90°C to about 100°C, or about 95°C to about 100°C. Each of the plurality of cycles may include denaturation at the denaturation temperature for a duration of at least about 5 seconds, 10 seconds, 15 seconds, 20 seconds, 25 seconds, 30 seconds, 35 seconds, 40 seconds, 45 seconds, 50 seconds, 55 seconds, or 60 seconds. Each of the plurality of cycles may include denaturation at the denaturation temperature for a duration of at least 5 seconds, 10 seconds, 15 seconds, 20 seconds, 25 seconds, 30 seconds, 35 seconds, 40 seconds, 45 seconds, 50 seconds, 55 seconds, or 60 seconds. Each of the plurality of cycles may include denaturation at the denaturation temperature for up to about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 seconds. Each of the plurality of cycles may include denaturation at the denaturation temperature for about 5 to 60 seconds, 5 to 55 seconds, 5 to 50 seconds, 5 to 45 seconds, 5 to 40 seconds, 5 to 35 seconds, 5 to 30 seconds, 5 to 25 seconds, 5 to 20 seconds, 5 to 15 seconds, or 5 to 10 seconds.Each of the plurality of cycles may include denaturation at the denaturation temperature for approximately 5 to 60 seconds, 10 to 60 seconds, 15 to 60 seconds, 20 to 60 seconds, 25 to 60 seconds, 30 to 60 seconds, 35 to 60 seconds, 40 to 60 seconds, 45 to 60 seconds, 50 to 60 seconds, or 55 to 60 seconds.

[0057] Each of the plurality of cycles may include primer annealing at an annealing temperature of at least about 45°C, 46°C, 47°C, 48°C, 49°C, 50°C, 51°C, 52°C, 53°C, 54°C, 55°C, 56°C, 57°C, 58°C, 59°C, 60°C, 61°C, 62°C, 63°C, 64°C, or 65°C. Each of the plurality of cycles may include primer annealing at an annealing temperature of up to about 45°C, 46°C, 47°C, 48°C, 49°C, 50°C, 51°C, 52°C, 53°C, 54°C, 55°C, 56°C, 57°C, 58°C, 59°C, 60°C, 61°C, 62°C, 63°C, 64°C, or 65°C. Each of the plurality of cycles may include primer annealing at an annealing temperature of about 45°C to about 65°C, about 45°C to about 60°C, about 45°C to about 55°C, or about 45°C to about 50°C. Each of the plurality of cycles may include primer annealing at an annealing temperature of about 45°C to about 65°C, about 50°C to about 65°C, about 55°C to about 65°C, or about 60°C to about 65°C. Each of the plurality of cycles may include primer annealing for at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 seconds at an annealing temperature. Each of the plurality of cycles may include primer annealing for at most about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 seconds at an annealing temperature. Each of the plurality of cycles may include primer annealing for at most about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 seconds at an annealing temperature. Each of the plurality of cycles may include primer annealing for approximately 5 to 60 seconds, 5 to 55 seconds, 5 to 50 seconds, 5 to 45 seconds, 5 to 40 seconds, 5 to 35 seconds, 5 to 30 seconds, 5 to 25 seconds, 5 to 20 seconds, 5 to 15 seconds, or 5 to 10 seconds at an annealing temperature. Each of the plurality of cycles may include primer annealing for approximately 5 to 60 seconds, 10 to 60 seconds, 15 to 60 seconds, 20 to 60 seconds, 25 to 60 seconds, 30 to 60 seconds, 35 to 60 seconds, 40 to 60 seconds, 45 to 60 seconds, 50 to 60 seconds, or 55 to 60 seconds at an annealing temperature.

[0058] Each of the plurality of cycles may include primer extension at an extension temperature of at least about 65°C, 66°C, 67°C, 68°C, 69°C, 70°C, 71°C, 72°C, 73°C, 74°C, or 75°C. Each of the plurality of cycles may include primer extension at an extension temperature of at most about 65°C, 66°C, 67°C, 68°C, 69°C, 70°C, 71°C, 72°C, 73°C, 74°C, or 75°C. Each of the plurality of cycles may include primer extension at an extension temperature of about 65°C to about 75°C or about 65°C to about 70°C. Each of the plurality of cycles may include primer extension at an extension temperature of approximately 65°C to approximately 75°C or approximately 70°C to approximately 75°C. Each of the plurality of cycles may include primer extension at the extension temperature for an extension period of at least approximately 30 seconds, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, or 10 minutes. Each of the plurality of cycles may include primer extension at the extension temperature for an extension period of at most approximately 30 seconds, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, or 10 minutes. Each of the plurality of cycles may include primer extension for an extension period of approximately 30 seconds to 10 minutes, 30 seconds to 9 minutes, 30 seconds to 8 minutes, 30 seconds to 7 minutes, 30 seconds to 6 minutes, 30 seconds to 5 minutes, 30 seconds to 4 minutes, 30 seconds to 3 minutes, 30 seconds to 2 minutes, or 30 seconds to 1 minute at an extension temperature. The length of the extension period can be selected to optimize the amplification product yield. Some factors considered when selecting the extension period include, but are not limited to, the size of the cyclic polynucleotide (e.g., the cyclic template), the GC content of the cyclic polynucleotide sequence, and the formation of secondary structures in the amplification product. For example, for amplification products that produce similar yields, longer cyclic polynucleotides may require a longer extension time compared to shorter cyclic polynucleotides.For further examples, for amplification products that produce similar yields, cyclic polynucleotides with higher GC content may require a longer extension time compared to cyclic polynucleotides with lower GC content but comparable length.

[0059] In some embodiments, each of the plurality of cycles includes (i) denaturation at a denaturation temperature of about 75°C to about 95°C for about 5 seconds to about 60 seconds, (ii) primer annealing at an annealing temperature of about 45°C to about 65°C for about 5 seconds to about 60 seconds, and (iii) primer extension at an extension temperature of about 65°C to about 75°C for about 30 seconds to about 10 minutes. In some embodiments, each of the plurality of cycles includes (i) denaturation at a denaturation temperature of about 80°C for about 15 seconds to about 30 seconds, (ii) primer annealing at an annealing temperature of about 50°C for about 15 seconds to about 45 seconds, and (iii) primer extension at an extension temperature of about 70°C for about 3 minutes to about 10 minutes. In some embodiments, each of the plurality of cycles includes (i) denaturation at a denaturation temperature of about 80°C for about 20 seconds, (ii) primer annealing at an annealing temperature of about 50°C for about 30 seconds, and (iii) primer extension at an extension temperature of about 70°C for about 6 minutes.

[0060] In some embodiments, polymerase is replenished to the reaction mixture at any cycle of the plurality of rolling circle amplification cycles. In some embodiments, polymerase is replenished to the reaction mixture at at least two cycles of the plurality of rolling circle amplification cycles. In some cases, replenishment of the amplification reaction mixture may be necessary due to thermal inactivation of polymerase activity. Some polymerases are thermally inactivated at elevated temperatures. The temperature of thermal inactivation may depend on the polymerase used. Depending on the polymerase selected for amplification and the temperature chosen for any one of the denaturation temperature, primer annealing temperature, and primer extension temperature, polymerase may optionally be replenished after at least one amplification cycle. In some embodiments, polymerase is replenished to the reaction mixture after every other cycle. In various embodiments, polymerase is replenished to the reaction mixture as needed, for example, depending on the yield of the amplification product.

[0061] In some embodiments, multiple amplification products generated using the methods disclosed herein are characterized by containing a higher proportion of multiplyings of the target polynucleotide with at least two copies (e.g., at least three, four, or five copies) compared to multiple amplification products generated using an amplification cycle with comparable denaturation and primer annealing conditions but with an extension time equivalent to the sum of the extension times of the multiple cycles.

[0062] Multiply or amplification products with more copies of the target polynucleotide can have larger fragment sizes compared to amplification products with fewer copies of the target polynucleotide. The copy number of the target polynucleotide in the amplification product or multiply can be determined using various methods, such as agarose gel electrophoresis, size exclusion chromatography, or next-generation sequencing. As determined using any suitable method (e.g., agarose gel electrophoresis, size exclusion chromatography, or next-generation sequencing), multiply or amplification products generated using methods comprising multiple cycles of rolling circle amplification as disclosed herein can have a proportionally increased number of multiply with at least two copies of the target polynucleotide compared to rolling circle amplification comprising one cycle. In some embodiments, the proportion of multiply with at least two copies of the target polynucleotide is increased by at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 25%, or 50%.

[0063] In some embodiments, the multiple amplification products exhibit an average fragment length of at least about 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, or 250 base pairs. In some embodiments, the multiple amplification products exhibit an average fragment length of at most about 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, or 250 base pairs. In some embodiments, the multiple amplification products exhibit an average fragment length of approximately 150 base pairs. In some embodiments, the multiple amplification products exhibit an average fragment length of approximately 160 base pairs. In some embodiments, the multiple amplification products exhibit an average fragment length of approximately 170 base pairs. In some embodiments, the multiple amplification products exhibit an average fragment length of approximately 180 base pairs. In some embodiments, the multiple amplification products exhibit an average fragment length of approximately 190 base pairs. In some embodiments, the multiple amplification products exhibit an average fragment length of approximately 200 base pairs.

[0064] In some embodiments, the multiple amplification products exhibit a median fragment length of at least about 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, or 250 base pairs. In some embodiments, the multiple amplification products exhibit a median fragment length of up to about 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, or 250 base pairs. In some embodiments, the multiple amplification products exhibit a median fragment length of about 150 base pairs. In some embodiments, the multiple amplification products exhibit a median fragment length of about 160 base pairs. In some embodiments, the multiple amplification products exhibit a median fragment length of about 170 base pairs. In some embodiments, the multiple amplification products exhibit a median fragment length of about 180 base pairs. In some embodiments, the multiple amplification products exhibit a median fragment length of about 190 base pairs. In some embodiments, the multiple amplification products exhibit a median fragment length of about 200 base pairs.

[0065] In some embodiments, it is desirable to analyze cell-free polynucleotides, such as cell-free DNA. Cell-free DNA (cfDNA), as further described elsewhere herein, can be circulating tumor DNA or circulating fetal DNA. In some cases, cell-free polynucleotides may include cell-free RNA. For example, cell-free DNA can be circularized using an enzyme such as a ligase and amplified via this method. In some embodiments, when the circular polynucleotides used in the reaction mixture contain cfDNA, the various amplification products exhibit fragment length distributions of about 40 to about 450 bases, 40 to about 400 bases, 40 to about 350 bases, 40 to about 300 bases, 40 to about 250 bases, 40 to about 200 bases, 40 to about 150 bases, 40 to about 100 bases, or 40 to about 50 bases. In some embodiments, when the cyclic polynucleotide used in the reaction mixture comprises cfDNA, the various amplification products exhibit fragment length distributions of about 40 bases to about 450 bases, 50 bases to about 450 bases, 100 bases to about 450 bases, 150 bases to about 450 bases, 200 bases to about 450 bases, 250 bases to about 450 bases, 300 bases to about 450 bases, 350 bases to about 450 bases, or 400 bases to about 450 bases. In some embodiments, when the cyclic polynucleotide used in the reaction mixture comprises cfDNA, the various amplification products exhibit fragment length distributions of about 100 to about 200 bases, 110 to about 200 bases, 120 to about 200 bases, 130 to about 200 bases, 140 to about 200 bases, 150 to about 200 bases, 160 to about 200 bases, 170 to about 200 bases, 180 to about 200 bases, or 190 to about 200 bases. In some embodiments, when the cyclic polynucleotide used in the reaction mixture comprises cfDNA, the various amplification products exhibit fragment length distributions of about 100 to about 200 bases, 100 to about 190 bases, 100 to about 180 bases, 100 to about 170 bases, 100 to about 160 bases, 100 to about 150 bases, 100 to about 140 bases, 100 to about 130 bases, 100 to about 120 bases, or 100 to about 110 bases.

[0066] In some embodiments, the primers in the amplification reaction mixture contain random sequences. In some embodiments, the primers in the amplification reaction mixture contain gene-specific sequences. In some embodiments, the primers contain gene-specific sequences targeting multiple genes (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 genes). In some embodiments, the primers include a first primer containing (i) a first 3' end that specifically hybridizes to a cyclic polynucleotide via sequence complementarity and (ii) a first 5' end containing a first common sequence that does not specifically hybridize to the target polynucleotide via sequence complementarity. A polynucleotide multiply can be generated during multiple cycles of rolling circle amplification by extending the first primer using a cyclic polynucleotide as a template. The primers may include a second primer containing (i) a second 3' end that specifically hybridizes to a polynucleotide multiply via sequence complementarity and (ii) a second 5' end containing a second common sequence that does not specifically hybridize to the polynucleotide via sequence complementarity. Multiple extension products containing one or more copies of the target polynucleotide can be generated during multiple cycles of rolling circle amplification by extending a second primer using a multiply as a template. As further described herein, amplification methods using such a first primer and a second primer can be used to enrich amplicons containing at least two or more copies of the target polynucleotide.

[0067] In one aspect, this disclosure provides a method for enriching amplicons of multiplexes containing at least two or more copies of a target polynucleotide. In one embodiment, the method includes (a) generating a multiplex containing a single-stranded polynucleotide from a cyclic target polynucleotide by extending a first primer, the first primer comprising a first 3' end that specifically hybridizes to the target polynucleotide via sequence complementarity and a first 5' end comprising a first common sequence that does not hybridize to the target polynucleotide via sequence complementarity; (b) generating multiple extension products containing one or more copies of the target polynucleotide by extending a second primer, the second primer comprising a second 3' end that specifically hybridizes to the multiplex via sequence complementarity and a second 5' end comprising a second common sequence that does not hybridize to the multiplex via sequence complementarity, wherein the first common sequence and the second common sequence each comprise at least 10 consecutive nucleotides at their 5' ends and are at least 90% identical when optimally aligned; and (c) amplifying the multiple extension products of step (b) under conditions of generating multiple amplicons, wherein amplicons containing at least two or more copies of the target polynucleotide are enriched.

[0068] In some embodiments, the generation of multiply containing single-stranded polynucleotides from a circular target polynucleotide includes the extension of a first primer. Primer extension can be accomplished by an amplification reaction including, but not limited to, thermal cycling and isothermal reactions. In some embodiments, thermal cycling involves several cycles of, for example, denaturation, primer binding, and primer extension. In some embodiments, the generation of multiply by this method is achieved by a polymerase. Various polymerases useful in this method are available, and non-limiting examples are provided herein. In some embodiments, the polymerase used to achieve multiply generation has chain displacement activity. In some embodiments, the generation of multiply containing single-stranded polynucleotides from a circular target polynucleotide includes isothermal rolling circle amplification (RCA). Chain displacement polymerases are particularly useful in RCA because displacement allows the polymerase to continuously polymerize around the circular template more than once, thereby generating tandem copies of the multiply sequence complementary to the circular template. In some embodiments, the generation of multiply containing single-stranded polynucleotides includes non-isothermal RCA. Non-isothermal RCA may include at least two cycles (e.g., at least 2, 3, 4, or 10 or more cycles) of at least two temperature phases (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or 10 cycles). For example, the first temperature phase may be suitable for primer binding and extension, while the second temperature phase may be suitable for denaturing the double-stranded polynucleotide. In some embodiments, non-isothermal RCA includes 2 to 35 cycles of at least two temperature phases (e.g., 3 to 30, 4 to 20, 5 to 15, or 6 to 10 cycles). Cycling through temperature phases, including the second temperature phase suitable for denaturing the double-stranded polynucleotide, during non-isothermal RCA can result in the formation of multiple linear polynucleotides from the circular template. During denaturation, the extension of the first polynucleotide from the circular template is terminated. By repeating primer binding and extension, multiple polynucleotides can be generated from the circular template over several cycles. In some embodiments, three temperature phases are used—a first temperature phase for primer annealing, a second temperature phase for primer extension, and a third temperature phase for denaturing the double-stranded polynucleotide. In some embodiments, a primer extension temperature higher than the primer binding temperature is selected to minimize primer binding during primer extension. When a reverse primer is included in the amplification reaction mixture, minimizing primer binding during primer extension reduces the formation of shorter amplification products and reduces biased amplification of short fragments, as primers are less likely to hybridize with the amplification product at the time of formation. Primers that hybridize with the amplification product at the time of formation can also participate in primer extension, but may result in preferential amplification of smaller fragments because, during extension, smaller loops tend to generate more copies of repeating units and more primer binding sites than larger fragments within a given time period. In some embodiments, the temperature selected for primer extension may be at least 5°C higher than the temperature selected for primer annealing (e.g., at least 6°C, 7°C, 8°C, 9°C, 10°C, 11°C, 12°C, 13°C, 14°C, 15°C, or more).The temperature selected for primer extension can be approximately 1°C to 20°C higher than the temperature selected for primer annealing (e.g., approximately 2°C to 18°C, approximately 4°C to 15°C, or approximately 5°C to 10°C). In some embodiments, the non-isothermal RCA may include a fourth temperature stage. The fourth temperature stage may be suitable, for example, for the formation of secondary structures in the extension product, such as stem-loop structures. The suitable temperature range for non-isothermal RCA may depend on the nature of the polymerase used.

[0069] In some embodiments, the RCA (isothermal or non-isothermal) may comprise a primer extension reaction along a linear template, such as along a reverse primer extension of a linear polynucleotide generated by extension along a circular template primer. For example, a second primer may hybridize with a template containing a linear polynucleotide template generated as an extension product of the first primer, and primer extension of the second primer during the primer extension stage may generate a linear double-stranded polynucleotide, the strand of which may further serve as a template for extension by additional copies of the first and second primers.

[0070] In some embodiments, generating multiple extension products containing one or more copies of the target polynucleotide includes using a second primer to hybridize with a linear polyp template generated from the extension product as a first primer. In some embodiments, the generation of multiple extension primers may occur simultaneously with the generation of the linear polyp from the circular template during non-isothermal RCA. Primer extension and amplification methods generally favor the amplification of short fragments over long fragments. According to some embodiments, the primer extension reaction for generating extension products can be optimized to reduce the bias favoring shorter products and thereby increase the proportion of longer products (such as products containing two or more copies of the target polynucleotide). This disclosure contemplates various ways to achieve this objective, which can be used alone or in combination. One way to achieve this objective is by limiting the number of primer extension cycles so that short fragments are not preferentially amplified, or amplified at a reduced frequency compared to templates of the same length but lacking hairpin structures. In some embodiments, generating extension products includes a second primer extension of no more than 15 cycles (e.g., no more than 10, 8, 6, or fewer cycles). In some embodiments, generating extension products includes a second primer extension of 2 to 15 cycles. In some embodiments, generating the extension product includes 2 to 10 cycles of second primer extension. In some embodiments, the extension of the second primer occurs simultaneously with the extension of the first primer.

[0071] In some embodiments, the cyclic target polynucleotides used interchangeably with cyclic polynucleotides herein for generating multiplexes are formed from linear target polynucleotides. In some embodiments, the cyclic target polynucleotides or cyclic polynucleotides are single-stranded. In some embodiments, the cyclic target polynucleotides or cyclic polynucleotides are double-stranded. The cyclic target polynucleotides or cyclic polynucleotides can have any length. In some embodiments, the length of the cyclic target polynucleotides or cyclic polynucleotides is about 25, 50, 75, 100, 150, 200, 250, 300, 400, 500, 600, 700, or 800 nucleotides. In some embodiments, the length of the cyclic target polynucleotides or cyclic polynucleotides is 25-1000 nucleotides. In some embodiments, the length of the cyclic target polynucleotides or cyclic polynucleotides is 50-500 nucleotides. In some embodiments, the length of the cyclic target polynucleotides or cyclic polynucleotides is 75-250 nucleotides. In some embodiments, the cyclic target polynucleotide or cyclic polynucleotide is 100-200 nucleotides in length. The cyclic target polynucleotide or cyclic polynucleotide may comprise a chromosome or gene segment. In some embodiments, the cyclic target polynucleotide or cyclic polynucleotide comprises a gene product, including but not limited to miRNA, rRNA, tRNA, and mRNA. In some embodiments, the cyclic target polynucleotide or cyclic polynucleotide comprises a sequence generated by point mutation, SNP, insertion, or deletion. In some embodiments, the cyclic target polynucleotide or cyclic polynucleotide comprises a sequence generated by chromosomal rearrangement. Chromosomal rearrangement can be one or more inversions; one or more deletions; one or more duplications; one or more translocations; or combinations thereof. In some embodiments, the cyclic target polynucleotide or cyclic polynucleotide containing one or more translocations comprises a fusion site or fusion linker of a fusion gene. In some embodiments, the cyclic target polynucleotide or cyclic polynucleotide comprises at least one of inversions, deletions, duplications, and translocations.

[0072] In one or more of these methods, the first primer used to generate the multiply may comprise a first 3' end that hybridizes specifically to the target polynucleotide through sequence complementarity and a first 5' end that does not hybridize specifically to the target polynucleotide through sequence complementarity, comprising a first common sequence. The first primer may be of any suitable length, such as at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 90, or 100 nucleotides, any portion of which may be complementary to the corresponding target sequence to which the primer hybridizes (e.g., at least 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides). The first 3' end of the first primer that hybridizes specifically to the target sequence through sequence complementarity may be of any suitable length, such as at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95 nucleotides. In some embodiments, the first primer contains a first 3' end with a random nucleotide sequence that randomly hybridizes and induces random regions of a circular target polynucleotide or circular polynucleotide for primer extension, each random sequence specifically hybridizing with a corresponding complementary sequence via sequence complementarity. When the primer contains a random 3' end sequence, the target sequence is the sequence amplified by primer extension. Generally, the 3' end contains a 3' terminal nucleotide. The first 5' end (having the first common sequence of the first primer and not specifically hybridizing with the target polynucleotide via sequence complementarity) can be of any suitable length, such as at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95 nucleotides long. The first common sequence can be of any suitable length. In some embodiments, the first common sequence of the first primer is at least 10 nucleotides long (e.g., at least 15, 20, 25, 30, or more nucleotides long). Typically, the 5' end refers to the polynucleotide portion at 5' relative to the 3' end. In some implementations, the 5' end contains a 5' terminal nucleotide.

[0073] A second primer containing a second 3' end that hybridizes specifically to the polynucleotide through sequence complementarity and a second 5' end containing a second common sequence that does not hybridize specifically to the polynucleotide through sequence complementarity can be used to generate a variety of extension products containing one or more copies of the target polynucleotide through primer extension. The second primer used to generate a variety of extension products can have any suitable length, such as about or at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 90 or 100 nucleotides, any part of which can be complementary to the corresponding target sequence hybridized to by the primer (e.g., at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50 nucleotides). The second 3' end of the second primer, which hybridizes specifically to the multiply via sequence complementarity, can be of any suitable length, such as at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95 nucleotides long. In some embodiments, the second primer includes a second 3' end containing a random nucleotide sequence that randomly hybridizes and induces random regions of the multiply for primer extension. The second 5' end of the second primer, which does not hybridize specifically to the multiply via sequence complementarity, and which contains a second common sequence, can be of any suitable length, such as at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95 nucleotides long. The second common sequence can be of any suitable length. In some embodiments, the second common sequence of the second primer is at least 10 nucleotides long (e.g., at least 15, 20, 25, 30 or more nucleotides long). Typically, the 5' end refers to the polynucleotide portion at 5' relative to the 3' end. In some embodiments, the 5' end comprises a 5' terminal nucleotide. In some embodiments, the second common sequence is at least 80% identical to the first common sequence (e.g., at least 90%, 95%, or 100% identical), such that the second common sequence can hybridize with the complement of the first common sequence under suitable reaction conditions (e.g., one or more steps in the amplification reaction, such as primer hybridization and / or primer extension). In some embodiments, the first and second common sequences are identical.

[0074] Typically, the common sequence that does not hybridize specifically with the target is designed not to hybridize with the target polynucleotide under conditions that hybridize at the 3' end (e.g., one or more steps in an amplification reaction). In some embodiments, the common sequence is designed to have complementarity of less than 75%, 50%, 25%, 10%, or lower with any group of a polynucleotide along the 3' end of the target polynucleotide relative to the 3' end hybridization point, any sequence within the target polynucleotide, or any group of a polynucleotide in a sample (e.g., all genomic sequences of an organism such as bacteria, viruses, plants, or animals, including human genomic DNA sequences). In some embodiments, the first common sequence and the second common sequence each contain at least 10 (e.g., at least 15, 20, 25, 30, 40, 50, or more) consecutive nucleotides at the 5' end and are at least 90% identical when optimally aligned. In some embodiments, the first common sequence and the second common sequence contain at least 5, 10, 15, 20, 25 or 30 consecutive nucleotides at the 5' end, and are at least 70% identical when optimally aligned (e.g., at least 80%, 90%, 95% or 100% identical).

[0075] In some embodiments, the extension product of this method forms a stem-loop structure comprising (i) intramolecular hybridization between a complement of a first common sequence and a second common sequence, and / or (ii) intramolecular hybridization between a complement of a second common sequence and a first common sequence. The extension product may form the stem-loop structure during a non-isothermal RCA, for example, during a fourth temperature stage with a temperature suitable for stem-loop structure formation. In some embodiments, the stem-loop structure forms during a subsequent amplification reaction after RCA. The formation of the stem-loop structure may depend on the stability of the double-stranded stem region and the single-stranded loop region. The stability of the stem may depend on its length, the number of mismatches, and the base composition. The stability of the stem-loop structure also depends on the loop length. Large loops without secondary structures may be unstable, and loops shorter than three bases in length may be spatially impossible. In some embodiments, a stem-loop structure with a longer stem portion may be more stable than a stem-loop structure with the same loop and a shorter stem. In some cases, a stem-loop structure with a longer loop may be less stable than a stem-loop structure with the same stem and a shorter loop.

[0076] An illustrative implementation scheme of the method for generating polyhedra is shown in Figure 1In the process, a first primer is extended via rolling circle amplification (RCA). This first primer contains a first 3' end that hybridizes specifically to the target polynucleotide via sequence complementarity and a first 5' end that does not hybridize specifically to the target polynucleotide via sequence complementarity, containing a first common sequence 5'-TACGCA-3'. Next, various extension products containing one or more copies of the target polynucleotide are generated, including an extension second primer containing a second 3' end that hybridizes specifically to the polynucleotide via sequence complementarity and a second 5' end that does not hybridize specifically to the polynucleotide via sequence complementarity, containing a second common sequence 5'-TACGCA-3' (identical to the first common sequence). Due to intramolecular hybridization between the complementary pairs of the second common sequence and the first common sequence, the extension products can form a stem-loop structure. The stem-loop structure can contain a variable number of target polynucleotides. The length of the stem in the base pairs can vary. In some embodiments, the stem length is at least 6, 9, 15, 20, 25, 30, or more base pairs. In some embodiments, the stem-loop structure contains intramolecular hybridization of 5 to 30 base pairs. In some embodiments, the stem-loop structure comprises intramolecular hybridization of 10 to 20 base pairs. Table 1 provides non-limiting examples of sequences that can be used as the first or second common sequence.

[0077] Table 1. Unrestricted Examples of Candidate Common Sequences

[0078]

[0079]

[0080] The number of base pairs involved in intramolecular hybridization may depend on the number of consecutive nucleotides in the first common sequence and the second common sequence, or the number of consecutive nucleotides in the complement of the second common sequence to the first common sequence. The number of base pairs involved in intramolecular hybridization may also depend on the identity percentage between the first and second common sequences, where the identity percentage refers to the percentage of identical bases between the first and second common sequences when optimally aligned. In some embodiments, the first and second common sequences each contain at least 10 consecutive nucleotides at their 5' ends and are at least 90% identical when optimally aligned. In some embodiments, the first and second common sequences each contain at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, or 50 consecutive nucleotides at their 5' ends. In some embodiments, the first and second common sequences each contain 5 to 25 consecutive nucleotides at their 5' ends. In some embodiments, the first and second common sequences are at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical at optimal alignment. In some embodiments, the first and second common sequences are 60% to 100% identical at optimal alignment. In some embodiments, the first and second common sequences contain 5 to 25 consecutive nucleotides at their 5' ends and are 60% to 100% identical at optimal alignment.

[0081] Amplification of multiple extension products of the first and second primers may include primer extension with a third primer. In some embodiments, the third primer comprises a sequence that specifically hybridizes to the first common sequence and / or the second common sequence through sequence complementarity. The third primer used for nucleic acid amplification may have any suitable length, such as at least 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 90, or 100 nucleotides, any part or all of which may be complementary to the corresponding target sequence (e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50 nucleotides or more). The third primer may contain a segment comprising one or more amplification primer annealing sequences or their complements; one or more sequencing primer annealing sequences or their complements; one or more barcode sequences; one or more common sequences shared among multiple different primers; one or more restriction enzyme recognition sites; one or more probe binding sites or sequencing adaptors (e.g., for attachment to a sequencing platform, such as a flow cell for massively parallel sequencing); one or more random or near-random sequences (e.g., one or more nucleotides randomly selected from a set of two or more different nucleotides at one or more positions); and combinations thereof. Amplification primer annealing sequences may also be used as sequencing primer annealing sequences.

[0082] Based on the stability of the stem-loop structure, it can be amplified with variable efficiency. Generally, among multiple stem-loop structures containing a stem of equal length and a loop of variable length, the stem-loop structure containing the longer loop is thermodynamically less stable, more accessible as a template, and therefore can be amplified more efficiently. Thus, in some embodiments, amplification of a target sequence flanked by a hybridizable common sequence enriches amplicons containing at least two or more copies of the target sequence. Amplicons generated by primer extension of a third primer may contain a variable number of target polynucleotides. In some embodiments, the percentage of amplicons containing two or more copies of the target polynucleotide is at least 50% (e.g., at least 60%, 70%, 80%, 90%, or greater). In some embodiments, the percentage of amplicons containing two or more copies of the target polynucleotide is 10%–100% (e.g., 20%–90%, 30%–80%, or 40%–60%).

[0083] In implementing this method, the formation of stem-loop products and the enrichment of amplicon containing at least two or more copies of the target polynucleotide can be optimized by specifying the melting temperatures of the hybridization sequences of the first common sequence, the second common sequence, and the third primer sequence, as well as adjusting the temperature at which amplification is performed. For embodiments where the amplification of the primer extension product involves primer extension of a third primer that specifically hybridizes to the first common sequence and / or the second common sequence, the primer binding efficiency of the third primer may depend on one or more of the melting temperatures of the hybridization sequences of the first common sequence, the second common sequence, and the third primer. In some embodiments, the hybridization sequences of the first common sequence, the second common sequence, and the third primer each have a melting temperature (Tm) within ±15°C (e.g., ±10°C, ±5°C, or ±1°C) of each other. In some embodiments, the hybridization sequences of the first common sequence, the second common sequence, and the third primer each have a melting temperature (Tm) within ±5°C of each other. Generally, Tm typically represents the temperature at which 50% of the oligonucleotides consisting of the reference sequence (which may actually be a sub-sequence within a larger polynucleotide) and its complementary sequence hybridize (or separate) are formed. Tm can be based on standard calculations, algorithms, or measurements available in the art. An exemplary tool for measuring Tm, OligoAnalyzer, is made possible by Integrated DNA Technologies. www.idtdna.com / calc / analyzer This tool is available and can be set to use default parameters. Other similar tools are available.

[0084] The amplification temperature can also affect the primer binding and elongation efficiency of long and short stem-loop products. In some embodiments, stem-loop structure formation can be achieved by performing amplification step (c) at a temperature maintained within ±15°C (e.g., ±10°C, ±5°C, or ±1°C) of the third primer's melting temperature during the annealing step. In some embodiments, stem-loop product formation can be achieved by performing amplification step (c) at a temperature maintained below 75°C (e.g., below 70°C, 65°C, 60°C, or lower) during the annealing step. In some embodiments, stem-loop product formation can be achieved by performing amplification step (c) at a temperature maintained between 55°C and 75°C (e.g., 60°C and 70°C) during the annealing step.

[0085] In some embodiments, the circular target polynucleotide or cyclic polynucleotide is a circularized cell-free polynucleotide (e.g., cell-free DNA, cDNA, or RNA). In some embodiments, the circular target polynucleotide or cyclic polynucleotide is a circularized fragment of genomic DNA. In some embodiments, the circular target polynucleotide or cyclic polynucleotide comprises a sequence generated by a chromosomal rearrangement. In some embodiments, the chromosomal rearrangement is at least one of deletion, duplication, inversion, and translocation. In some embodiments, the circular target polynucleotide or cyclic polynucleotide of this method is single-stranded. In some embodiments, the circular target polynucleotide or cyclic polynucleotide of this method is double-stranded. In some embodiments, the combined length of the target polynucleotide sequence portion corresponding to (i) a sequence complementary to the first 3' end, (ii) a sequence identical to the second 3' end, and (iii) an interpolated sequence between (i) and (ii) is 75 nucleotides or less. In some embodiments, the combined length of the sequence portion is 60 nucleotides or less. In some embodiments, the combined length of the sequence portion is 50 nucleotides or less. In some implementations, the combined length of the sequence portion is 40 or fewer nucleotides. In some cases, the combined length of the sequence portion is 30 or fewer nucleotides.

[0086] In one illustrative embodiment, the first primer and the second primer are as follows: Figure 2 The arrangement is shown. For simplicity, the relative hybridization positions of the first and second primers are illustrated relative to the single strand of the target polynucleotide. However, as described below, one primer hybridizes with the strand containing the target sequence, while the other primer hybridizes with the strand containing the complement of the target sequence. The first 3' end of the first primer, i.e., the forward primer (F primer), hybridizes specifically with the target polynucleotide through sequence complementarity, while the first 5' end does not hybridize specifically with the target polynucleotide. The second 3' end of the second primer, i.e., the reverse primer (R primer), hybridizes specifically with the complement of the target polynucleotide through sequence complementarity, while the second 5' end does not hybridize specifically with the complement of the target polynucleotide. Given the orientation of the forward primer (F primer) and the reverse primer (R primer) relative to the target sequence monomer, this arrangement can be referred to as a "back-to-back" (B2B) or "inverted" primer. Compared to the traditional head-to-head design, this primer design has a reduced primer footprint (the total distance traversed by a pair of primers). Figure 2In this design, the combined length of the target polynucleotide sequence portion corresponding to (i) the sequence complementary to the first 3' end, (ii) the sequence identical to the second 3' end, and the interpolated sequence between (i) and (ii) is approximately 30-100 nucleotides (e.g., 40-80 or 50-70 nucleotides) along the target polynucleotide from 5' to 3' is also referred to as the "primer footprint". In some embodiments, the primer footprint is less than 100 nucleotides long (e.g., less than 90, 80, 70, 60, 50, or fewer nucleotides). In some embodiments, a circular target polynucleotide or cyclic polynucleotide containing point mutations, indels (insertions / deletions), or gene fusions can be amplified using a first and second primer arranged back-to-back. This reduced primer footprint allows for amplification of various fragmentation events around the target sequence because the likelihood of engagement (e.g., fusion engagement) occurring between B2B primers is less than the likelihood of such engagement occurring in primer arrangements found in typical amplification reactions (facing each other, across the target sequence).

[0087] In one illustrative implementation scheme, such as Figure 3 The sequencing library is constructed as shown. A linear DNA molecule is first circularized to form a template for the RCA (Random Access Array). Back-to-back primers with conventional sequencing adaptors at the 5' end bind to the target molecule, while a polymerase with strand displacement activity amplifies the target during the RCA. The library can be sequenced, or further amplified by PCR before sequencing to detect sequence variants (e.g., point mutations, SNPs, and fusion genes).

[0088] In some embodiments, multiple polynucleotides can be generated from a variety of target polynucleotides in a sample. The sample may contain one or more target sequences. Each target sequence may have one or more corresponding polynucleotides. Each polynucleotide corresponding to a unique target polynucleotide may contain a variable copy number of the target polynucleotide. In some embodiments, the method can be optimized to generate polynucleotides of variable length. The variability in polynucleotide length may result from variations in the length of the target polynucleotide and / or the copy number of the target polynucleotide in each polynucleotide. In some embodiments, at least 50% (e.g., at least 60%, 70%, 80%, 90% or more) of the polynucleotides contain a target polynucleotide of at least 75 nucleotides in length (e.g., at least 100, 150, 200 or more nucleotides in length). In some embodiments, at least 80% of the polynucleotides contain a target polynucleotide of at least 75 nucleotides in length. In some embodiments, at least 60% of the polynucleotides contain a target polynucleotide of at least 100 nucleotides in length. In some implementations, at least 50% of the polynucleotides contain a target polynucleotide with a length of at least 150 nucleotides.

[0089] In some embodiments, the method of this disclosure includes sequencing multiple amplicons generated in step (c). In some embodiments, the sequencing is performed without selectively purifying amplicons containing two or more copies of the target polynucleotide relative to amplicon containing only one copy of the target polynucleotide. In some embodiments, the method of this disclosure includes purifying amplicons containing two or more copies of the target polynucleotide from the multiple amplicons generated in step (c). In some embodiments, the purified amplicon of this method is sequenced. In some embodiments, the method of this disclosure includes amplifying multiple different target polynucleotides in the same reaction mixture. The components of the multiple target polynucleotides may have different lengths. In some embodiments, the target polynucleotides are from 30 nucleotides to 1000 nucleotides in length (e.g., 50-600, 75-500, 100-400, or 200-300 nucleotides). In some embodiments, the target polynucleotides are cyclized by ligation in a single reaction mixture.

[0090] In one illustrative implementation scheme, such as Figure 4The diagram illustrates the amplification of a nucleic acid sample containing a mixture of cell-free polynucleotides. Polynucleotides in the mixture (e.g., single-stranded DNA, "ssDNA") may be circularized to form circular target polynucleotides or cyclic polynucleotides. Primer binding in a first temperature phase of non-isothermal RCA (e.g., 55°C) and primer extension of one or more first primers in a second temperature phase of non-isothermal RCA (e.g., 70°C) generate a mixture of polynucleotides. Choosing a temperature higher than that chosen for primer binding minimizes additional primer binding during primer extension. Each target polynucleotide may have one or more corresponding polynucleotides. Each polynucleotide corresponding to a unique target polynucleotide may contain a variable copy number of the target polynucleotide. As illustrated, one or more first primers contain a first 3' end that specifically hybridizes to the target polynucleotide via sequence complementarity and a first 5' end containing a first common sequence that does not specifically hybridize to the target polynucleotide via sequence complementarity. In subsequent cycles of non-isothermal amplification, the generation of multiple second extension products occurs simultaneously with the generation of polynucleotides. These extension products are obtained by primer extension of one or more second primers in a second temperature phase. These second primers have hybridized with the linear polynucleotide template generated as the extension product of the first primer in the first temperature phase and do not hybridize with the circular template due to denaturation during the third temperature phase (e.g., 94°C) in the previous cycle. New hybridization sites of the second primers are exposed by the replacement of the circular template by the progressive polymerase around the circular template. The one or more second primers contain a second 3' end that hybridizes specifically with the polynucleotide through sequence complementarity and a second 5' end containing a second common sequence that does not hybridize specifically with the polynucleotide through sequence complementarity. The extension products may contain different copy numbers of the target polynucleotide. In mixed samples, the target polynucleotides may have different lengths, and the resulting extension products may also have different lengths. Stem-loop structures of different sizes can be formed by intramolecular hybridization between the complement of the first common sequence and the second common sequence, or by intramolecular hybridization between the complement of the first common sequence and the (second) common sequence. The stem-loop structure can form during one or more stages of amplification (e.g., annealing, extension, or a fourth temperature stage for stem-loop formation (e.g., 58°C)). The stem-loop structure can also form during subsequent amplification reactions after RCA. The extension product can serve as a template for the amplification reaction to generate amplicons, and the stability of the stem-loop structure can affect primer binding and extension. During subsequent amplification reactions, extension products containing longer or more copies of the target polynucleotide sequence can be preferentially enriched compared to extension products where the stem-loop structure has a smaller loop. In some embodiments, amplicons containing two or more copies of the target polynucleotide are enriched. In some embodiments, the percentage of amplicons containing two or more copies of the target polynucleotide is at least 50% (e.g., at least 60%, 70%, 80%, 90%, or greater).In some embodiments, the percentage of amplicones having two or more copies of the target polynucleotide is 10%-100% (e.g., 20%-90%, 30%-80%, or 40%-60%). In some embodiments, amplicones containing longer target polynucleotides are enriched. In some embodiments, at least 50% (e.g., at least 60%, 70%, 80%, 90%, or more) of the multiply contain a target polynucleotide of at least 75 nucleotides in length (e.g., at least 100, 150, 200, or more nucleotides in length). In some embodiments, at least 80% of the multiply contain a target polynucleotide of at least 75 nucleotides in length. In some embodiments, at least 60% of the multiply contain a target polynucleotide of at least 100 nucleotides in length. In some embodiments, at least 50% of the multiply contain a target polynucleotide of at least 150 nucleotides in length.

[0091] In another aspect, this disclosure provides a reaction mixture for performing the methods according to this disclosure. The reaction mixture may contain one or more of a variety of components as described herein with respect to any of the various aspects and methods. In some embodiments, this disclosure provides a reaction mixture for enriching amplicon of a multiply comprising at least two or more copies of a target polynucleotide. In one embodiment, the reaction mixture comprises: (a) a circular target polynucleotide; (b) a first primer comprising a first 3' end that specifically hybridizes to the target polynucleotide via sequence complementarity and a first 5' end comprising a first common sequence that does not specifically hybridize to the target polynucleotide via sequence complementarity; and (c) a second primer comprising a second 3' end that specifically hybridizes to the multiply via sequence complementarity and a second 5' end comprising a second common sequence that does not specifically hybridize to the multiply via sequence complementarity, wherein the first common sequence and the second common sequence each comprise at least 10 consecutive nucleotides at their 5' ends and are at least 90% identical when optimally aligned.

[0092] In some embodiments, the reaction mixture of this disclosure is contained within a container. Each component may be packaged into a separate container, or, where cross-reactivity and shelf life permit, a combination of components may be provided in a container. The container may be a via, plate, tube, chamber, flow cell, or chip.

[0093] In some embodiments, the reaction mixture comprises a third primer having a sequence that specifically hybridizes to a first common sequence or a second common sequence through sequence complementarity. In some embodiments, the third primer can be used to amplify multiple extension products. The third primer used for nucleic acid amplification can have any suitable length, such as at least 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 90, or 100 nucleotides, any part or all of which can be complementary to the corresponding target sequence (e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50 nucleotides or more). The third primer may contain a segment comprising one or more amplification primer annealing sequences or their complements; one or more sequencing primer annealing sequences or their complements; one or more barcode sequences; one or more common sequences shared among multiple different primers; one or more restriction enzyme recognition sites; one or more probe binding sites or sequencing adaptors (e.g., for attachment to a sequencing platform, such as a flow cell for massively parallel sequencing); one or more random or near-random sequences (e.g., one or more nucleotides randomly selected from a set of two or more different nucleotides at one or more locations); and combinations thereof. Amplification primer annealing sequences can also be used as sequencing primer annealing sequences.

[0094] In some embodiments, the extension product may form a stem-loop product, and the amplicon yield from primer extension from the third primer can be optimized by optimizing the properties of the third hybridization sequence of the first common sequence, the second common sequence, and the third primer, for example, by optimizing their melting temperatures. In some embodiments, the hybridization sequences of the first common sequence, the second common sequence, and the third primer all have melting temperatures (Tm) within ±15°C of each other. In some embodiments, the hybridization sequences of the first common sequence, the second common sequence, and the third primer all have melting temperatures (Tm) within ±10°C of each other. In some embodiments, the hybridization sequences of the first common sequence, the second common sequence, and the third primer all have melting temperatures (Tm) within ±5°C of each other. In some embodiments, the hybridization sequences of the first common sequence, the second common sequence, and the third primer all have melting temperatures (Tm) within ±1°C of each other.

[0095] In some embodiments, the reaction mixture of this disclosure comprises circularized cell-free DNA as a circular target polynucleotide or cyclic polynucleotide. In some embodiments, the reaction mixture of this disclosure comprises a circularized fragment of genomic DNA as a circular target polynucleotide or cyclic polynucleotide. In some embodiments, the circular target polynucleotide or cyclic polynucleotide comprises a sequence generated by a chromosomal rearrangement. In some embodiments, the chromosomal rearrangement is at least one of deletion, duplication, inversion, and translocation. In some embodiments, the circular target polynucleotide or cyclic polynucleotide of this method is single-stranded. In some embodiments, the circular target polynucleotide or cyclic polynucleotide of this method is double-stranded.

[0096] In some embodiments, the reaction mixture of this disclosure comprises a target polynucleotide sequence portion of 75 or fewer nucleotides in length, corresponding to (i) a sequence complementary to the first 3' end, (ii) a sequence identical to the second 3' end, and (iii) an interpolated sequence between (i) and (ii). In some embodiments, the combined length of the target polynucleotide sequence portion is 60 or fewer nucleotides. In some embodiments, the combined length of the target polynucleotide sequence portion is 50 or fewer nucleotides. In some embodiments, the combined length of the target polynucleotide sequence portion is 40 or fewer nucleotides. In some embodiments, the combined length of the target polynucleotide sequence portion is 30 or fewer nucleotides.

[0097] In some embodiments of the various aspects described herein, including the methods and reaction mixtures of this disclosure, a circular target polynucleotide or cyclic polynucleotide is formed by linking a linear target polynucleotide. The cyclic target polynucleotide formed from the linear target polynucleotide may contain the sequence to be characterized, such as a rare sequence variant or fusion gene. In some embodiments, the linear target polynucleotide is single-stranded. In other embodiments, the linear target polynucleotide is double-stranded. Non-limiting examples of target polynucleotides include DNA, RNA, cDNA, dsDNA, ssDNA, plasmid DNA, coliform DNA, chromosomal DNA, genomic DNA, viral DNA, bacterial DNA, mtDNA (mitochondrial DNA), mRNA, rRNA, tRNA, nRNA, siRNA, snRNA, snoRNA, scaRNA, microRNA, dsRNA, ribozymes, ribosomes, and viral RNA (e.g., retroviral RNA).

[0098] In some embodiments of any of these aspects, the cyclic target polynucleotide or cyclic polynucleotide comprises acellular polynucleotide, including but not limited to cell-free DNA or cell-free RNA (cfDNA or cfRNA). In some embodiments, the cell-free polynucleotide is circulating tumor DNA or circulating tumor RNA (ctDNA or ctRNA). In some embodiments, the cell-free polynucleotide comprises fetal DNA or fetal RNA. In some embodiments, the cell-free polynucleotide is a polynucleotide derived from cells but not directly from cellular sources such as tissue samples. Non-limiting examples of sources from which cell-free polynucleotides may originate are normal cells and tissues, abnormal cells and tissues (e.g., cancer cells or tissues), fetal cells and tissues, and pathogens. Cell-free polynucleotides present in non-cellular sources may be produced by cell death (e.g., apoptosis or necrosis) or cell shedding. Sequence analysis of cell-free polynucleotides can be used to characterize the cells or cell populations from which the cell-free DNA originates, such as tumor cells (e.g., in cancer detection), fetal cells (e.g., in prenatal diagnosis), cells from transplanted tissues (e.g., in early detection of transplant failure), or pathogens (e.g., bacteria or viruses).

[0099] Implementations of this disclosure may use any cell-free polynucleotide. Cell-free polynucleotides may be obtained from a subject, such as any animal or living organism. Non-limiting examples of subjects include mammals such as humans, non-human primates, rodents such as mice and rats, dogs, cats, pigs, sheep, rabbits, etc. In some implementations, the subject is healthy, and therefore the cell-free polynucleotides obtained from that subject may not contain sequence variants associated with a disease or condition. In some implementations, the subject is suspected of having a disease or condition, and therefore the cell-free polynucleotides obtained from that subject may contain sequence variants associated with the disease or condition. In some implementations, the subject is pregnant, and therefore the cell-free polynucleotides obtained from that subject include fetal polynucleotides.

[0100] Cell-free polynucleotides can be obtained from a variety of non-cellular sources. Non-limiting examples of non-cellular sources from which cell-free polynucleotides can be obtained include serum, plasma, blood, sweat, saliva, urine, feces, semen, mucosal excretions, cerebrospinal fluid, amniotic fluid, and lymph. Various methods are available for collecting samples from non-cellular sources from which cell-free polynucleotides can be obtained. In some embodiments, the sample from the non-cellular source from which cell-free polynucleotides can be obtained is obtained from a subject. In some embodiments, the sample is obtained by venipuncture. In some embodiments, the sample is obtained by aspiration.

[0101] Various methods and commercially available kits are available for obtaining cell-free polynucleotides, such as cell-free DNA, from samples. Examples of methods and kits for the extraction and isolation of cell-free polynucleotides (including cell-free DNA) include phenol / chloroform extraction, phenol / chloroform / isoamyl alcohol (PCI)-glycogen extraction, NaI (sodium iodide) extraction, guanidine resin extraction, the QIAmpDNA Blood Midi kit with vector RNA, the ChargeSwitch serum kit, the ZR serum DNA kit, and the Qiagen Qubit kit. TM dsDNA HS Assay Kit, Agilent TM DNA 1000 kit, TruSeq TM Sequencing library preparation and Puregene DNA purification system blood kit.

[0102] Cell-free polynucleotides (including cell-free DNA) can be extracted and separated from body fluids via a separation step, in which the cell-free polynucleotides are separated from the cells and other insoluble components of the body fluid. Examples of separation techniques are centrifugation and filtration. In some embodiments, instead of separating the cells from the cell-free polynucleotides first, lysis is performed first. In some embodiments, the genomic DNA of intact cells is separated by selective precipitation. Cell-free polynucleotides (including DNA) remain soluble and can be separated from and extracted from insoluble genomic DNA. Depending on some procedures, DNA can be precipitated using isopropanol precipitation after adding buffer and other wash steps specific to different kits. Further cleaning steps, such as silica-based columns, can be used to remove contaminants or salts. General steps can be optimized for specific applications. For example, nonspecific batch carrier polynucleotides can be added throughout the reaction to optimize certain aspects of the procedure, such as yield.

[0103] In some embodiments of any aspect disclosed herein, the cyclic target polynucleotide or cyclic polynucleotide comprises genomic DNA. In some embodiments, the cyclic target polynucleotide or cyclic polynucleotide is derived from genomic DNA. Genomic DNA can be obtained from cell samples using a variety of available methods and commercial kits, such as the Qiagen DNeasy Tissue Kit. Genomic DNA can be obtained from and purified from samples using any of the extraction, separation, and purification methods previously described elsewhere herein. Other non-limiting examples of extraction techniques include: (1) organic extraction followed by ethanol precipitation, for example, using phenol / chloroform organic reagents (Ausubel et al., 1993), with or without an automated nucleic acid extractor, such as the 341 DNA type extractor available from Applied Biosystems (Foster City, Calif); (2) stationary phase adsorption (US Patent No. 5,234,809; Walsh et al., 1991); and (3) salt-induced nucleic acid precipitation (Miller et al., 1988), a precipitation method generally referred to as “salting out”. Another example of nucleic acid isolation and / or purification involves using magnetic particles that allow nucleic acids to bind specifically or nonspecifically, then using a magnet to separate the beads, and washing and eluting the nucleic acids from the beads (see, for example, U.S. Patent No. 5,705,628). For example, solid-phase reversible fixation (SPRI) beads (Agencourt AMPureXP) can be used for nucleic acid isolation and purification. In some embodiments, an enzymatic digestion step may be performed prior to the above isolation methods to help remove unwanted proteins from the sample, such as digestion with proteinase K or other similar proteases. If necessary, an RNase inhibitor may be added to the lysis buffer. For specific cell or sample types, a protein denaturation / digestion step may need to be added to the protocol. Purification methods can be targeted at isolating DNA, RNA, or both. When DNA and RNA are isolated together during or after the extraction procedure, further steps can be used to purify one or both separately from the other. Subfractions of the extracted nucleic acids can also be generated, for example, purified based on size, sequence, or other physical or chemical properties. In addition to the initial nucleic acid isolation step, nucleic acid purification can be performed after any step of the disclosed method, for example, to remove excess or unwanted reagents, reactants, or products. Various methods are available for determining the amount and / or purity of nucleic acids in a sample, such as by detection of absorbance (e.g., light absorption at 260 nm, 280 nm, and their ratio) and markers (e.g., fluorescent dyes and intercalating agents, such as SYBR Green, SYBR Blue, DAPI, propidium iodide, Hoechst staining agent, SYBR Gold, ethidium bromide).

[0104] In some embodiments, the circular target polynucleotide or circular polynucleotide comprises fragmented cell-free DNA or fragmented genomic DNA. Various methods can be used to fragment polynucleotides, including but not limited to chemical methods, enzymatic methods, and mechanical methods such as sonication, cleavage, and contact with restriction enzymes. In some embodiments, the cell-free DNA fragment is of substantially uniform length. In some embodiments, the cell-free DNA fragment is not of substantially uniform length. In some embodiments, the cell-free DNA fragment has an average length of about 50 to about 1000 nucleotides. In some embodiments, the cell-free DNA fragment has an average length of about 50 to about 500 nucleotides. In some embodiments, the cell-free DNA fragment has an average length of about 50 to about 250 nucleotides. In some embodiments, the cell-free DNA fragment has an average length of about 50 to about 200 nucleotides. In some embodiments, the cell-free DNA fragment has an average length of about 50 to about 100 nucleotides. In some embodiments, the cell-free DNA fragment has an average length of about 40 to about 1000 nucleotides. In some embodiments, the cell-free DNA fragment has an average length of about 40 to about 500 nucleotides. In some embodiments, the cell-free DNA fragment has an average length of about 40 to about 250 nucleotides. In some embodiments, the cell-free DNA fragment has an average length of about 40 to about 200 nucleotides. In some embodiments, the cell-free DNA fragment has an average length of about 40 to about 100 nucleotides. In some embodiments, the genomic DNA is fragmented into shorter polynucleotides. In some embodiments, the genomic DNA fragments are substantially the same length. In some embodiments, the genomic DNA fragments are substantially different in length. In some embodiments, the genomic DNA fragment has an average length of about 50 to about 100 nucleotides. In some embodiments, the genomic DNA fragment has an average length of about 50 to 250 nucleotides. In some embodiments, the genomic DNA fragment has an average length of about 50 to 500 nucleotides. In some embodiments, the genomic DNA fragment has an average length of about 50 to 750 nucleotides. In some embodiments, the genomic DNA fragment has an average length of about 100 to 1000 nucleotides.

[0105] Circular target polynucleotides or cyclic polynucleotides can be formed from linear target polynucleotides using various methods. In some embodiments, a single linear target polynucleotide is cyclized by end-joining. In some embodiments, a first linear target polynucleotide is joined to a second linear target polynucleotide, and then the unjoined end of the first target polynucleotide is joined to the unjoined end of the second linear target polynucleotide to form a cyclic target polynucleotide or cyclic polynucleotide comprising the first and second target polynucleotides. The polynucleotide to be cyclized can be single-stranded or double-stranded. When a single-stranded cyclization is desired, the polynucleotide can be a single-stranded polynucleotide as initially isolated, or it can be treated to make the polynucleotide single-stranded (e.g., by denaturation). In some embodiments, the method for cyclizing the polynucleotide involves an enzyme, such as a ligase (e.g., an RNA ligase or a DNA ligase). Non-limiting examples of enzymes that can be used to join linear target polynucleotides into cyclic target polynucleotides or cyclic polynucleotides are ATP-dependent double-stranded polynucleotide ligases, NAD+-dependent DNA or RNA ligases, and single-stranded polynucleotide ligases. Non-restrictive examples of ligases include CircLigase I and CircLigase II (Epicentre; Madison, WI), *Escherichia coli* DNA ligase, *Thermophyton floccosum* DNA ligase, Tth DNA ligase, *Aquaticus niger* DNA ligase (types I and II), T3 DNA ligase, T4 DNA ligase, T4 RNA ligase, T7 DNA ligase, Taq ligase, and Ampligase. Technologies Corp.), VanC-type ligase, 9°N DNA ligase, Tsp DNA ligase, DNA ligase type I, DNA ligase type III, DNA ligase type IV, Sso7-T3 DNA ligase, Sso7-T4 DNA ligase, Sso7-T7 DNA ligase, Sso7-Taq DNA ligase, Sso7-E. coli DNA ligase, Sso7-Ampligase DNA ligase, and thermostable ligases. The ligases can be wild-type, mutant isoforms, and genetically engineered variants. The ligation reaction may contain buffer components, small molecule ligation enhancers, and other reaction components. In some embodiments, the concentrations of polynucleotides and enzymes are adjusted to promote intermolecular ligation rather than intramolecular ligation. In some embodiments, the reaction temperature and reaction time, or the length of the reaction, are adjusted. The reaction temperature and time can also be adjusted. In some embodiments, 60°C is used to promote the formation of intramolecular loops. In some embodiments, the reaction time is 12-16 hours. The reaction conditions can be those specified by the manufacturer of the selected enzyme. In some embodiments, linking the ends of a polynucleotide to form a cyclic polynucleotide (either directly linked to itself or linked to one or more other polynucleotides, such as a cyclic target polynucleotide or cyclic polynucleotide containing two target polynucleotides) produces a conjugation with a linker sequence. In some embodiments, an exonuclease step may be included to digest any unlinked nucleic acids after the cyclization reaction. That is, the closed loop does not contain a free 5' or 3' end, so the introduction of a 5' or 3' exonuclease will not digest the closed loop but will digest the unlinked component. This is particularly useful in multiplexing systems.

[0106] Following cyclization, the reaction product can be purified prior to amplification or sequencing to improve the relative concentration or purity of the cyclized polynucleotides that can participate in subsequent steps (e.g., by the separation of the cyclic polynucleotides or the removal of one or more other molecules during the reaction). For example, the cyclization reaction or its components can be treated to remove single-stranded (uncyclized) polynucleotides, for example by exonuclease treatment. As a further example, the cyclization reaction or its portions can be subjected to size exclusion chromatography, thereby retaining and discarding small reagents, or retaining and releasing the cyclization product in a separate volume. A variety of kits for cleaning ligation reactions are available, such as the kits provided by the Zymo Oligonucleotide Purification Kit manufactured by Zymo Reaserch. In some embodiments, purification includes treatments for removing or degrading the ligase used in the cyclization reaction and / or purifying the cyclized polynucleotides from the ligase. In some embodiments, treatments for degrading the ligase include treatment with a protease such as proteinase K. Proteinase K treatment can follow manufacturer-specified or standard protocols (e.g., as provided in Sambrook and Green, Molecular Cloning: A Laboratory Manual, 4th Edition (2012)). Following protease treatment, extraction and precipitation can be performed. In one example, cyclized polynucleotides are purified as follows: treatment with proteinase K (Qiagen) in the presence of 0.1% SDS and 20 mM EDTA, extraction with 1:1 phenol / chloroform and chloroform, and precipitation with ethanol or isopropanol. In some embodiments, precipitation is performed in ethanol.

[0107] Some embodiments of this disclosure include primer extension and amplification reactions, such as generating multiples, generating multiple extension products, and amplifying one or more of multiple extension products. Primer extension reactions may involve temperature variations (thermal cycling) or isothermal reactions. In some embodiments, primer extension reactions include polymerase chain reaction (PCR). PCR involves cycling through multiple stages of denaturation, primer pair and reverse strand annealing, and primer extension to exponentially increase the copy number of the target sequence, at least some of which typically occur at different reaction temperatures. Non-limiting examples of PCR amplification techniques are quantitative PCR (qPCR or real-time PCR), reverse transcription PCR (RT-PCR), digital PCR (dPCR or dePCR), target-specific PCR, and quantitative reverse transcription PCR (qRT-PCR). Examples of polymerases that can be used for PCR are thermostable polymerases, including but not limited to *Thermus HB8*; mutant *Thermus oshimai*; *Thermus aquaticus*; *Thermus 1B21*; *Thermus GK24*; and *Thermus aquaticus* polymerase (…). FS or Taq(G46D;F667Y), Taq(G46D;F667Y;E6811) and Taq(G46D;F667Y;T664N;R660G)); *Porcine gorgonarius* polymerase; *Thermococcus gorgonarius* polymerase; *Porcine genus* GB-D polymerase; *Thermococcus* (strain 9°N-7) polymerase; *Bacillus stearothermophilus* polymerase; Tsp polymerase; ThermalAce TM Polymerases (Invitrogen); Thermus litoralis polymerase; Thermus litoralis polymerase; Thermus Z05 polymerase; δZ05 polymerase (e.g., δZ05 Gold DNA polymerase); and their mutants, variants, and derivatives. Other examples of polymerases that can be used for PCR are thermostable polymerases, including but not limited to DNA polymerase I; mutant DNA polymerase I, including but not limited to Klenow fragments and Klenow fragments (3' to 5' exonuclease(-)); T4 DNA polymerase; mutant T4 DNA polymerase; T7 DNA polymerase; mutant T7 DNA polymerase; phi29 DNA polymerase; and mutant phi29 DNA polymerase. In some embodiments, hot-start polymerases are used. Hot-start polymerases are modified forms of DNA polymerases that require thermal activation. Such polymerases can be used, for example, to further improve sensitivity, specificity, and yield; and / or to further improve the amplification of low-copy targets. Typically, hot-start enzymes are provided in an inactive state. Upon thermal activation, the modifier or modifier is released, thereby generating an active enzyme. Many hot-start polymerases are available from a variety of commercial sources, such as Applied Biosystems; Bio-Rad; eEnzyme LLC; Eppendorf North America; Finnzymes Oy; GeneChoice, Inc.; Invitrogen; Jena Bioscience GmbH; MIDSCI; MinervaBiolabs GmbH; New England Biolabs; Novagen; Promega; QIAGEN; Roche Applied Science; Sigma-Aldrich; Stratagene; Takara Mirus Bio; USB Corp.; Yorkshire Bioscience Ltd; and so on.

[0108] In some implementations, primer extension and amplification reactions include isothermal reactions. Non-limiting examples of isothermal amplification techniques are ligase chain reaction (LCR) (e.g., U.S. Patent Nos. 5,494,810 and 5,830,711); transcription-mediated amplification (TMA) (e.g., U.S. Patent Nos. 5,399,491, 5,888,779, 5,705,365, and 5,710,029); nucleic acid sequence-based amplification (NASBA) (e.g., Malek et al., U.S. Patent No. 5,130,238); signal-mediated RNA amplification (SMART) (e.g., Wharam et al., Nucleic Acids Res. 2001, 29, e54); strand displacement amplification (SDA) (e.g., U.S. Patent No. 5,455,166); and thermophilic SDA (Spargo et al., Mol Cell Probes). 1996, 10:247-256; European Patent No. 0684315); Rolling Circle Amplification (RCA) (e.g., Lizardi, “Rolling Circle Replication Reporter Systems,” US Patent No. 5,854,033); Circle-Mediated DNA Isothermal Amplification (LAMP) (e.g., Notomi et al., “Process for Synthesizing Nucleic Acid,” US Patent No. 6,410,278); Helicase-Dependent Amplification (HDA) (e.g., US Patent Application US 20040058378); Single Primer Isothermal Amplification (SPIA) (e.g., WO2001020035 and US Patent No. 6,251,639); and Circle Helicase-Dependent Amplification (cHDA) (e.g., US Patent Application US. 10 / 594,095).

[0109] In some embodiments, the primer extension reaction is performed by a polymerase with strand displacement activity, as in RCA. In some embodiments, isothermal amplification includes rolling circle amplification (RCA). The RCA reaction mixture may contain one or more primers, a polymerase with strand displacement activity, and dNTPs. Strand displacement refers to the ability to displace downstream DNA during synthesis. Polymerases with strand displacement activity may have varying degrees of strand displacement activity. In some embodiments, the polymerase may have weak or no strand displacement activity. In some embodiments, the polymerase may have strong strand displacement activity. In some embodiments, polymerases with strand displacement activity may have different levels of strand displacement activity at different reaction temperatures. In some embodiments, the polymerase may exhibit strand displacement activity at moderate temperatures, such as 20°C–37°C. In some embodiments, the polymerase may exhibit strand displacement activity at elevated temperatures, such as 65°C. The reaction temperature can be adjusted to favor the activity level of the polymerase with strand displacement activity. In some embodiments, the reaction temperature is at least 20°C, 25°C, 30°C, 35°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, 70°C, 75°C, 80°C, 85°C, or 90°C. In some embodiments, the reaction temperature is from 20°C to 80°C. In some embodiments, the reaction temperature is from 20°C to 70°C. In some embodiments, the reaction temperature is from 20°C to 60°C. In some embodiments, the reaction temperature is from 20°C to 50°C. In some embodiments, different reaction temperatures can be cycled through different stages to increase or decrease the strand displacement activity of the polymerase. Non-limiting examples of polymerases with strand displacement activity are Bst DNA polymerase, large fragment; Bsu DNA polymerase, large fragment; Deep Vent. R TM DNA polymerase; Deep Vent R TM (exo-)DNA polymerase; Klenow fragment (3'-5'exo-); DNA polymerase I, large fragment; M-MuLV reverse transcriptase; phi29 DNA polymerase; PyroPhage 3173 polymerase; DNA polymerase; and (exo-)DNA polymerase.

[0110] The multiply generated as a product of an amplification reaction (including thermal cycling, isothermal methods, and combinations thereof) may contain two or more copies of the target polynucleotide. The multiply may contain about 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of the target polynucleotide. In some embodiments, the multiply is generated as a product of a primer extension reaction from a plurality of target polynucleotides, wherein the components of said plurality of target polynucleotides are of non-uniform length and contain multiple sequences.

[0111] In some embodiments of any aspect of this disclosure, primers may comprise one or more portions. For example, primers may comprise one or more amplification primer annealing sequences or their complements; one or more sequencing primer annealing sequences or their complements; one or more barcode sequences; one or more common sequences shared among multiple different primers; one or more restriction enzyme recognition sites; one or more probe binding sites or sequencing adaptors (e.g., for attachment to a sequencing platform, such as a flow cell for massively parallel sequencing); one or more random or near-random sequences (e.g., one or more nucleotides randomly selected from a set of two or more distinct nucleotides at one or more locations, wherein each of the distinct nucleotides selected at one or more locations is represented in a primer pool containing a random sequence); and combinations thereof. In some embodiments, primers such as third primers comprise sequencing adaptor elements (also referred to herein as adaptors), which generally refer to oligonucleotides incorporated at the 5' and / or 3' ends of a polynucleotide to facilitate one or more steps in a polynucleotide sequencing reaction. In some embodiments, sequencing adaptors are used to bind polynucleotides containing sequencing adaptors to a flow cell for next-generation sequencing. Non-limiting examples of next-generation sequencing methods include single-molecule real-time sequencing, ion semiconductor sequencing, pyrosequencing, synthetic sequencing, ligation sequencing, and chain termination. Sequencing adaptors used for flow cell attachment may include any suitable sequence compatible with next-generation sequencing systems (e.g., 454 sequencing, Ion TorrentProton, or PGM and Illumina X10). Non-limiting examples of sequencing adaptors for next-generation sequencing methods include P5 and P7 adaptors suitable for use with Illumina sequencing systems; TruSeq universal adaptors; and TruSeq index adaptors. In some embodiments, sequencing adaptors may be used to enrich polynucleotides containing the adaptor sequence, for example, by amplification such as polymerase chain reaction (PCR). Sequencing adaptors may further include barcode sequences and / or sample index sequences.

[0112] In some other embodiments, primers, such as a third primer, contain barcode sequences. A barcode sequence is a known nucleic acid sequence that allows identification of certain characteristics of the polynucleotide associated with the barcode. Each barcode may have a length of 5 to 35 nucleotides, 6 to 30 nucleotides, or 8 to 20 nucleotides. In some embodiments, the length of the barcode is at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In some embodiments, the length of the barcode is less than 6 nucleotides. In some embodiments, barcodes associated with some target polynucleotides may have a different length than barcodes associated with other target polynucleotides. The melting temperatures of barcodes within a group may be within ±10°C, ±5°C, or ±2°C of each other. Barcodes may be members of a minimal cross-hybridization group. For example, the nucleotide sequence of each member in such a group may be significantly different from the nucleotide sequence of each other member in the group, such that under moderate or strict hybridization conditions, no member can form a stable double strand with the complement of any other member. The nucleotide sequence of each member of the minimal crossover group can differ from the nucleotide sequence of each other member by at least two nucleotides. Some barcode techniques are described in Winzeler et al., (1999) Science 285:901; Brenner (2000) Genome Biol. 1:1; Kumar et al., (2001) Nature Rev. 2:302; Giaever et al., (2004) Proc. Natl. Acad. Sci. USA 101:793; Eason et al., (2004) Proc. Natl. Acad. Sci. USA 101:1104; and Brenner (2004) Genome Biol. 5:240, each of which is incorporated herein by reference in its entirety.

[0113] Some embodiments of this disclosure involve sequencing multiple amplicones. Various sequencing methods can be used to sequence multiple amplicones. In some embodiments, high-throughput sequencing methods are used. Non-limiting examples of sequencing methods that can be used include sequencing systems manufactured by Illumina (such as...). and sequencing systems), sequencing systems manufactured by Life Technologies (Ion) (e.g., Roche's 454LifeSciences system, Pacific Biosciences system, etc.). In some implementations, sequencing includes using... and The system produces reads of approximately 50, 75, 100, 125, 150, 175, 200, 250, 300, or more nucleotides in length. In some implementations, sequencing includes a synthetic sequencing process in which individual nucleotides are iteratively identified as they are added to the growing primer extension product. Pyrosequencing is an example of synthetic sequencing that identifies nucleotide incorporation by analyzing the presence of pyrophosphate, a sequencing reaction byproduct, in the resulting synthetic mixture. Specifically, the primer / template / polymerase complex contacts a type of nucleotide. If this nucleotide is incorporated, the polymerization reaction cleaves the triphosphate nucleoside between the α and β phosphates of the triphosphate chain, releasing pyrophosphate. The presence of the released pyrophosphate is then identified using a chemiluminescent reporter system that converts the AMP-containing pyrophosphate into ATP, which is then measured with luciferase to generate a measurable light signal. When light is detected, the base has been incorporated; when no light is detected, the base has not been incorporated. Following appropriate washing steps, the complex is periodically contacted with various bases to sequentially identify subsequent bases in the template sequence. See, for example, U.S. Patent No. 6,210,891.

[0114] In some embodiments, the amplicon is sequenced to detect sequence variants, such as inversions, deletions, duplications, translocations, and rare somatic mutations, relative to a reference sequence or in a mutation-free background. In some embodiments, the sequence variant is associated with a disease. In some embodiments, the sequence variant is not associated with a disease. Generally, a sequence variant with statistical, biological, and / or functional evidence of association with a disease or trait is referred to as a “causal genetic variant.” A single causal genetic variant may be associated with more than one disease or trait. In some cases, a causal genetic variant may be associated with Mendelian traits, non-Mendelian traits, or both. Causal genetic variants may manifest as polynucleotide variations, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more sequence differences (e.g., sequence differences between polynucleotides containing the causal genetic variant and polynucleotides lacking the causal genetic variant at the same relative genomic location). Non-restrictive examples of causal genetic variant types include single nucleotide polymorphisms (SNPs), deletion / insertion polymorphisms (DIPs), copy number variants (CNVs), short tandem repeats (STRs), restriction fragment length polymorphisms (RFLPs), simple sequence repeats (SSRs), variable number tandem repeats (VNTRs), random amplified polymorphic DNA (RAPDs), amplified fragment length polymorphisms (AFLPs), intertransposon amplification polymorphisms (IRAPs), long sporadic elements and sporadic elements (LINEs / SINEs), long tandem repeats (LTRs), mobile elements, retrotransposon microsatellite amplification polymorphisms, retrotransposon-based insertion polymorphisms, sequence-specific amplification polymorphisms, and heritable epigenetic modifications (e.g., DNA methylation). Causal genetic variants can also be a closely related group of causal genetic variants. Some causal genetic variants may exert the same effects as sequence variations in RNA polynucleotides. At this level, some causal genetic variants can also be indicated by the presence or absence of RNA polynucleotide material. In addition, some causal genetic variants result in sequence variations of protein peptides. Many causal genetic variants have been reported. Examples of causal genetic variants for SNPs include the hemoglobin HbS variant causing sickle cell anemia. Examples of causal genetic variants for DIPs include the δ508 mutation in the CFTR gene causing cystic fibrosis. Examples of causal genetic variants for CNVs include trisomy 21, which causes Down syndrome. Examples of causal genetic variants for STRs include tandem duplications causing Huntington's disease. Other non-limiting examples of causal genetic variants are described in WO2014015084. Other non-limiting examples of methods for identifying rare sequence variants are described in WO2015089333.

[0115] In certain embodiments of any aspect of this disclosure, the amplicon is purified prior to sequencing. Amplicon purification can be performed using various methods. Amplicon purification can remove excess or unwanted reagents, reactants, or products. Amplicon can be further purified by size, sequence, or other physical or chemical properties. In some embodiments, amplicon may undergo size exclusion chromatography, thereby retaining and discarding amplicon containing only one copy of the target polynucleotide and / or smaller reagents (e.g., primers), or retaining amplicon containing two or more copies of the target polynucleotide and releasing it in a separate volume. In some embodiments, amplicon may undergo fragment excision from a gel and gel filtration (e.g., for enriching fragments longer than about 300, 400, 500, or more nucleotides); and for size selection using SPRI beads (Agencourt AMPure XP) by fine-tuning the binding buffer concentration. For example, a 0.6x binding buffer can be used during mixing with DNA fragments to preferentially bind DNA fragments longer than about 500 base pairs (bp). In some implementations, particularly when amplification has been performed using B2B primers, the amplification products are processed to filter the resulting amplicons according to size, thereby reducing and / or removing the number of monomers in the mixture containing multiples. This can be accomplished using any purification techniques as described elsewhere herein.

[0116] The implementations of the disclosure provided herein can be used to enrich amplicon containing various sequence variants associated with one or more cancers. Suitable target sequences of oncological significance that can be used in the methods of this disclosure include, but are not limited to, alterations in the TP53 gene, ALK gene, KRAS gene, PIK3CA gene, BRAF gene, EGFR gene, and KIT gene. Target sequences that can be specifically amplified and / or specifically analyzed for sequence variants can be entire portions of cancer-associated genes. In some implementations, one or more sequence variants are identified in the TP53 gene. TP53 is one of the most frequently mutated genes in human cancers; for example, TP53 mutations are found in 45% of ovarian cancers, 43% of colorectal cancers, and 42% of upper respiratory and digestive tract cancers (see, e.g., M. Olivier et al., TP53Mutations in Human Cancers: Origins, Consequences, and Clinical Use. Cold Spring Harb Perspect Biol. January 2010; 2(1)). Characterization of TP53 mutation status can aid in clinical diagnosis, provide prognostic value, and influence treatment for cancer patients. For example, TP53 mutations can be used as a predictor of poor prognosis in patients with CNS tumors originating from glial cells and as a predictor of rapid disease progression in patients with chronic lymphocytic leukemia (see, for example, McLendon RE et al., Cancer. Oct 15, 2005; 104(8):1693-9; Dicker F et al., Leukemia. Jan 2009; 23(1):117-24). Sequence variations can occur anywhere in the gene. Therefore, all or part of the TP53 gene may be evaluated in this paper. In other words, as described elsewhere in this paper, when using target-specific components (e.g., target-specific primers), multiple TP53-specific sequences can be used, for example, to amplify and detect fragments across the gene, rather than just one or more selected subsequences that can be used for a selected target (e.g., mutation “hotspots”). Alternatively, target-specific primers can be designed to hybridize upstream or downstream of one or more selected subsequences (e.g., nucleotides or nucleotide regions also covered by the term “hotspots” that are associated with increased mutation rates among a class of subjects). Standard primers can be designed across this seed sequence, and / or B2B primers can be designed for hybridization upstream or downstream of this seed sequence.

[0117] In some implementations, one or more sequence variants are identified in all or part of the ALK gene. ALK fusions have been reported in up to 7% of lung tumors, some of which are associated with resistance to EGFR tyrosine kinase inhibitors (TKIs) (see, e.g., Shaw et al., J Clin Oncol. 2009 Sep 10; 27(26):4247–4253). As of 2013, several distinct point mutations across the entire ALK tyrosine kinase domain have been identified in patients with secondary resistance to ALK tyrosine kinase inhibitors (TKIs) (Katayama R 2012 Sci Transl Med. 2012 Feb 8; 4(120)). Therefore, mutation detection in the ALK gene can be used to aid in cancer therapy decisions.

[0118] In some implementations, one or more sequence variants are identified in all or part of the KRAS gene. Approximately 15–25% of patients with lung adenocarcinoma and 40% of patients with colorectal cancer have been reported to carry tumor-associated KRAS mutations (see, e.g., Neuman 2009, Pathol Res Pract. 2009; 205(12):858–62). Most mutations are located at codons 12, 13, and 61 of the KRAS gene. These mutations activate the KRAS signaling pathway, triggering tumor cell growth and proliferation. Some studies suggest that patients with tumors carrying KRAS mutations are unlikely to benefit from anti-EGFR antibody therapy alone or in combination with chemotherapy (see, e.g., Amado et al., 2008 J Clin On col. 2008 Apr 1; ​​26(10):1626–34, Bokemeyer et al., 2009 J Clin On col. 2009 Feb 10; 27(5):663–71). A specific "hotspot" of sequence variants that can be used to identify sequence variations is located at position 35 of the gene. Identification of KRAS sequence variants can be used for treatment selection, such as for patients with colorectal cancer.

[0119] In some implementations, one or more sequence variants are identified in all or part of the PIK3CA gene. Somatic mutations in PIK3CA are frequently found in various types of cancer, such as in 10–30% of colorectal cancers (see, for example, Samuels et al., 2004 Science. April 23, 2004; 304(5670):554). These mutations are most commonly located in two “hotspot” regions within exon 9 (the helical domain) and exon 20 (the kinase domain), and these two “hotspot” regions can be specifically targeted for amplification and / or analysis for sequence variant detection. Position 3140 can also be specifically targeted.

[0120] In some implementations, one or more sequence variants are identified in all or part of the BRAF gene. Somatic mutations in BRAF have been reported in nearly 50% of all malignant melanomas (see, e.g., Maldonado et al., J Natl Cancer Inst. 2003 Dec 17; 95(24):1878-90). BRAF mutations are found in all melanoma subtypes, but are most common in melanomas originating from skin without chronic sun-induced damage. The most common BRAF mutation in melanoma is the missense mutation V600E, which replaces valine at position 600 with glutamine. BRAF V600E mutations are associated with clinical benefit from BRAF inhibitor therapy. Detection of BRAF mutations can be used for melanoma treatment selection and resistance studies against targeted therapies.

[0121] In some implementations, one or more sequence variants are identified in all or part of the EGFR gene. EGFR mutations are frequently associated with non-small cell lung cancer (approximately 10% in the US and 35% in East Asia; see, for example, Pao et al., ProcNatl Acad Sci US A. 2004 Sep 7; 101(36):13306-11). These mutations typically occur within EGFR exons 18–21 and are usually heterozygous. Approximately 90% of these mutations are exon 19 deletions or exon 21 L858R point mutations.

[0122] In some implementations, one or more sequence variants are identified in all or part of the KIT gene. Nearly 85% of gastrointestinal stromal tumors (GISTs) have been reported to carry KIT mutations (see, e.g., Heinrich et al., 2003 J Clin Oncol. 2003 Dec 1; 21(23):4342-9). Most KIT mutations are found in the juxtamembrane domain (exon 11, 70%), the extracellular dimerization motif (exon 9, 10-15%), the tyrosine kinase I (TKI) domain (exon 13, 1-3%), and the tyrosine kinase 2 (TK2) domain and activation loop (exon 17, 1-3%). Secondary KIT mutations are typically identified after targeted therapy with imatinib and after the patient has developed resistance to that therapy.

[0123] Other non-limiting examples of cancer-related genes (whose sequence variants, in whole or in part, can be analyzed according to the methods described herein) include, but are not limited to, PTEN; ATM; ATR; EGFR; ERBB2; ERBB3; ERBB4; Notch1; Notch2; Notch3; Notch4; AKT; AKT2; AKT3; HIF; HIF1a; HIF3a; Met; HRG; Bcl2; PPARα; PPARγ; WT1 (Wilms tumors); FGF receptor family members (5 members: 1, 2, 3, 4, 5); CDKN2a; APC; RB (retinoblastoma); MEN1; VHL; BRCA1; BRCA2; AR (androgen receptor); TSG101; IGF; IGF receptor; Igf1 (4 variants); Igf2 (3 variants); Igf1 receptor; Igf 2 receptors; Bax; Bcl2; the caspase family (9 members: 1, 2, 3, 4, 6, 7, 8, 9, 12); Kras; and Apc. Other examples are provided elsewhere in this article. Examples of cancers that can be diagnosed based on the discrimination of one or more sequence variants according to the methods disclosed herein include, but are not limited to, acanthoma, acinar cell carcinoma, acoustic neuroma, acral chromatographic melanoma, apical spiral tumor, acute eosinophilic leukemia, acute lymphoblastic leukemia, acute megakaryoblastic leukemia, acute monocytic leukemia, mature acute myeloid leukemia, acute myeloid dendritic cell leukemia, acute myeloid leukemia, acute promyelocytic leukemia, amelomas, adenocarcinomas, adenoid cystic carcinomas, adenomas, odontogenic adenomatoid tumors, adrenocortical carcinomas, adult T-cell leukemia, aggressive NK-cell leukemia, AIDS-related cancers, AIDS-related lymphomas, soft tissue alveolar sarcoma, ameloblastic fibroma, anal cancer, anaplastic large cell lymphoma, undifferentiated thyroid carcinoma, angioimmunoblastic T-cell lymphoma, angiomyolipoma, angiosarcoma, appendiceal cancer, and astrocytoma. Basal cell carcinoma, atypical teratoid rhabdoid tumor, basal cell carcinoma, basal cell-like carcinoma, B-cell leukemia, B-cell lymphoma, Bellini duct carcinoma, biliary tract cancer, bladder cancer, blastoma, bone cancer, osteoma, brainstem glioma, brain tumor, breast cancer, Brenner's tumor, bronchoma, bronchioloalveolar carcinoma, brown tumor, Burkitt lymphoma, cancer of unknown primary origin, carcinoid tumor, carcinoma, carcinoma in situ, penile cancer, cancer of unknown primary origin, carcinosarcoma Castleman's disease, embryonal tumor of the central nervous system, cerebellar astrocytoma, cerebral astrocytoma, cervical cancer, chondrocyte carcinoma, chondroma, chondrosarcoma, chordoma, choriocarcinoma, choroid plexus papilloma, chronic lymphocytic leukemia, chronic monocytic leukemia, chronic myeloid leukemia, chronic myeloproliferative disorders, chronic neutrophilic leukemia, leukocyte tumor, colon cancer, colorectal cancer, craniopharyngioma, cutaneous T-cell lymphoma.Degos' disease, dermatofibrosarcoma protuberans, dermoid cyst, connective tissue proliferative small round cell tumor, diffuse large B-cell lymphoma, dysplastic neuroepithelial tumor, embryonal carcinoma, endodermal sinus tumor, endometrial cancer, endometrial uterine cancer, endometrioid tumor, enteropathy-associated T-cell lymphoma, ependymoblastoma, ependymoma, epithelioid sarcoma, erythroleukemia, esophageal cancer, nasal glioma, Ewing family tumor, Ewing family sarcoma, Ewing sarcoma, extracranial germ cell tumor, gonadal germ cell tumor, extrahepatic bile duct carcinoma, non-mammary Paget's disease, fallopian tube cancer, fetus in fetus, fibroma, fibrosarcoma, follicular lymphoma, follicular thyroid carcinoma, gallbladder cancer, ganglioglioma, ganglioma, gastric cancer, gastric lymphoma, gastrointestinal cancer Gastrointestinal carcinoid tumors, gastrointestinal stromal tumors, germ cell tumors, germ cell tumors, gestational choriocarcinoma, gestational trophoblastoma, giant cell tumor of bone, glioblastoma multiforme, glioma, cerebral glioma, glomus tumor, glucagonoma, gonadotropinoma, granulosa cell tumor, piloblastic leukemia, head and neck cancer, cardiac cancer, hemangioblastoma, hemangiopericytoma, angiosarcoma, malignant hematologic malignancies, hepatocellular carcinoma, hepatosplenic T-cell lymphoma, hereditary breast cancer-ovarian cancer syndrome, Hodgkin's lymphoma, Hodgkin's lymphoma, hypopharyngeal cancer, hypothalamic glioma, inflammatory breast cancer, intraocular melanoma, islet cell carcinoma, islet cell tumor, juvenile myelomonocytic leukemia, Kaposi's sarcoma, Kaposi's sarcoma, renal cell carcinoma, Klatskin Tumors, Krukenberg tumors, laryngeal cancer, malignant lentigines, melanoma, leukemia, lip and oral cancer, liposarcoma, lung cancer, corpus luteum, lymphangioma, lymphangiosarcoma, lymphoepithelioma, lymphoid leukemia, lymphoma, macroglobulinemia, malignant fibrous histiocytoma, malignant fibrous histiocytoma, bone malignant fibrous histiocytoma, malignant glioma, malignant mesothelioma, malignant peripheral nerve sheath tumor, malignant rod tumor, malignant Triton's tumor, MALT lymphoma, mantle cell lymphoma, mast cell lymphoma, mediastinal germ cell tumor, mediastinal tumor, medullary thyroid carcinoma, medulloblastoma, medullary epithelioma, melanoma, meningioma, Merkel cell carcinoma, mesothelioma, occult metastatic squamous cell carcinoma of the primary site, metastatic urothelial carcinoma, mixed Mullerian tumor, monocytic leukemia, oral cancer, myxoma, multiple endocrine tumor syndrome, multiple myeloma, mycosis fungoides, myelodysplastic disorders, myelodysplastic syndrome, myeloid leukemia, myeloid sarcoma, myeloproliferative disorders, myxoma, nasal cavity carcinoma, nasopharyngeal carcinoma, nasopharyngeal carcinoma, vegetations, schwannoma, neuroblastoma, neurofibroma, neuroma, nodular melanoma, non-Hodgkin's lymphoma, non-melanoma skin cancer, non-small cell lung cancer, eye tumors, oligodendroastrocytoma, oligodendroglioma, eosinophilic adenoma, optic nerve schwannoma, oral cancer, oropharyngeal cancer, osteosarcoma, ovarian cancer, ovarian epithelial carcinoma, ovarian germ cell tumor, low-potency ovarian tumors, Paget's disease of the breast.Pancoast tumor, pancreatic cancer, papillary thyroid carcinoma, papilloma, paraganglioma, paranasal sinus carcinoma, parathyroid carcinoma, penile cancer, perivascular epithelioid cell tumor, pharyngeal carcinoma, pheochromocytoma, moderately differentiated pineal parenchymal tumor, pineoblastoma, pituitary cell tumor, pituitary adenoma, pituitary adenoma, plasmacytoma, pleural pulmonary blastoma, polyembryonic tumor, precursor T-cell lymphoblastic lymphoma, primary central nervous system lymphoma, primary exudative lymphoma. Primary hepatocellular carcinoma, primary liver cancer, primary peritoneal cancer, primitive neuroectodermal tumor, prostate cancer, pseudomyxoma peritonei, rectal cancer, renal cell carcinoma, respiratory tract cancer involving the NUT gene on chromosome 15, retinoblastoma, rhabdomyosarcoma, rhabdomyosarcoma, Richter transformation, sacrococcygeal teratoma, salivary gland cancer, sarcoma, Schwannoma, sebaceous gland cancer, secondary tumors, seminoma, serous tumors, Sertoli-Leydig cell tumor, sex cord-stromal tumor, Sezary syndrome, Signet cell carcinoma, skin cancer, small blue round cell tumor, small cell carcinoma, small cell lung cancer, small cell lymphoma, small intestinal cancer, soft tissue sarcoma, somatostatinoma, somnoloma, spinal cord tumor, spinal cord tumor, splenic marginal zone lymphoma, squamous cell carcinoma, gastric cancer, superficial diffuse melanoma, supratentorial primitive neuroectodermal tumor, surface epithelial-stromal tumor Synovial sarcoma, T-cell acute lymphoblastic leukemia, T-cell large granular lymphoblastic leukemia, T-cell leukemia, T-cell lymphoma, T-cell prolymphoblastic leukemia, teratoma, advanced lymphoma, testicular cancer, theca cell tumor, laryngeal cancer, thymic carcinoma, thymoma, thyroid cancer, transitional cell carcinoma of the renal pelvis and ureter, transitional cell carcinoma, urachal carcinoma, urethral cancer, urogenital tumors, uterine sarcoma, uveal melanoma, vaginal cancer, Verner Morrison syndrome, verrucous carcinoma, optic pathway glioma, vulvar cancer, Waldenström macroglobulinemia, Warthin's tumor, Wilms' tumor, and combinations thereof.

[0124] Table 2 provides other non-limiting examples of cancer-related genes (sequence variants of which can be analyzed in whole or in part (e.g., promoter regions, introns, exons, etc.) according to the methods described herein).

[0125] Table 2

[0126]

[0127]

[0128]

[0129]

[0130]

[0131]

[0132]

[0133]

[0134]

[0135]

[0136]

[0137]

[0138]

[0139]

[0140]

[0141]

[0142]

[0143] In one aspect, this disclosure provides a kit for enriching amplicones of multiplys containing at least two or more copies of a target polynucleotide. The kit may contain one or more elements disclosed herein in any combination of any aspect thereof. In some embodiments, the kit comprises: (a) a first primer comprising a first 3' end that specifically hybridizes to the target polynucleotide via sequence complementarity and a first 5' end that does not specifically hybridize to the target polynucleotide via sequence complementarity, comprising a first common sequence; (b) a second primer comprising a second 3' end that specifically hybridizes to the multiply via sequence complementarity and a second 5' end that does not specifically hybridize to the multiply via sequence complementarity, wherein the first common sequence and the second common sequence each comprise at least 10 consecutive nucleotides at their 5' ends and are at least 90% identical when optimally aligned; and (c) a third primer having a sequence that specifically hybridizes to either the first common sequence or the second common sequence via sequence complementarity. The reagents and other materials in the kit can be contained in any suitable container and can be in ready-to-use form or require combination with other reagents in the kit or user-supplied reagents (e.g., dilution of concentrated compositions or reconstitution of lyophilized compositions). The kit may provide buffers, non-limiting examples of which include sodium carbonate buffer, sodium bicarbonate buffer, borate buffer, Tris buffer, MOPS buffer, HEPES buffer, and combinations thereof. The kit may contain control samples, such as purified DNA, as positive controls or quantitative standards. In some embodiments, the kit contains one or more enzymes for amplifying polynucleotides, such as reverse transcriptase and polymerase. Where desired, the kit may further contain one or more detectable biomarkers to enable, for example, monitoring of amplification product accumulation, such as real-time monitoring. Non-limiting examples of detectable biomarkers have been described above, and these include dyes that preferentially or exclusively bind to double-stranded DNA during the amplification step, such as SYBR green dye or BEBO dye. In some embodiments, the kit contains probe oligonucleotides containing a fluorophore and a quencher to detect the progress of the amplification reaction or the products. In some embodiments, the kit includes instructions for use according to one or more methods disclosed herein. In some embodiments, the first common sequence and the second common sequence are identical. In some embodiments, the hybridization sequences of the first common sequence, the second common sequence, and the third primer all have melting temperatures (Tm) within ±5°C of each other. In some embodiments, the combined length of the target polynucleotide sequence portion corresponding to (i) the sequence complementary to the first 3' end, (ii) the sequence identical to the second 3' end, and (iii) the interpolated sequence between (i) and (ii) is 75 nucleotides or less.

[0144] In one aspect, this disclosure provides a system for designing primers for enriching amplicons containing at least two or more copies of a target polynucleotide. With respect to any aspect of this disclosure, primers may include any of the features described herein. In some embodiments, the system includes: (a) a computer configured to receive client requests to design primers for amplifying a specified target sequence; and (b) a computer-readable medium containing code that, when executed by one or more processors, designs at least three primers for amplifying the target sequence, wherein said at least three primers comprise: (i) a first primer comprising a first 3' end that specifically hybridizes to the target polynucleotide via sequence complementarity and a first 5' end comprising a first common sequence that does not specifically hybridize to the target polynucleotide via sequence complementarity; and (ii) a second primer comprising a first 3' end that specifically hybridizes to the target polynucleotide via sequence complementarity. The first common sequence and the second common sequence each contain at least 10 consecutive nucleotides at their 5' ends and are at least 90% identical when optimally aligned, and the multiply is an extension of the first primer; (iii) a third primer having a sequence that specifically hybridizes to the first common sequence or the second common sequence through sequence complementarity; and (c) a report generator that sends a report to a recipient, wherein the report contains the sequences of the at least three primers. In some embodiments, the first common sequence and the second common sequence are identical. In some embodiments, the hybridization sequences of the first common sequence, the second common sequence, and the third primer all have melting temperatures (Tm) within ±5°C of each other. In some embodiments, the combined length of the target polynucleotide sequence portion corresponding from 5' to 3' along the target polynucleotide is 75 nucleotides or less, consisting of (i) the sequence complementary to the first 3' end, (ii) the sequence identical to the second 3' end, and (iii) the interpolated sequence between (i) and (ii).

[0145] In some embodiments, the computer includes one or more processors. The processor may be associated with one or more controllers, computing units, and / or other units of the computer system, or may be embedded in firmware as needed. If implemented in software, routines may be stored in any computer-readable storage medium, such as RAM, ROM, flash memory, disk, laser disk, or other storage media. Similarly, the software may be transmitted to the computing device via any known transmission method, including, for example, communication channels such as telephone lines, the Internet, or wireless connections, or via removable media such as computer-readable disks or flash drives. The various steps may be implemented as blocks, operations, tools, modules, or techniques, which may then be implemented in hardware, firmware, software, or a combination thereof. When implemented in hardware, some or all of the blocks, operations, techniques, etc., may be implemented, for example, in custom integrated circuits (ICs), application-specific integrated circuits (ASICs), field-programmable arrays (FPGAs), programmable arrays (PLAs), etc. In some embodiments, the computer is configured to receive customer requests to design primers for amplifying specified target sequences (which may also be provided by the customer). The computer may receive customer requests directly (e.g., via an input device such as a keyboard, mouse, or touchscreen operated by the customer, or via user input of a customer request) or indirectly (e.g., via a wired or wireless connection, including via the Internet).

[0146] In some embodiments, the system includes a report generator that sends a report to a recipient, wherein the report contains the sequences of the at least three primers. The report generator may send the report automatically in response to a customer request. Alternatively, the report generator may send the report in response to an instruction from an operator. The report can be transmitted to a recipient at a local or remote location using any suitable communication medium. For example, the communication medium may be a network connection, a wireless connection, or an internet connection. The report can be transmitted via such a network or connection (or any other suitable means of transmitting information, including but not limited to mailing medical reports, such as printed outputs) for receipt and / or review by the recipient. The recipient may be, but is not limited to, a customer or an electronic system (e.g., one or more computers, and / or one or more servers). In some embodiments, the report generator sends the report to the recipient's device, such as a personal computer, telephone, tablet, or other device. The report can be viewed online, stored on the recipient's device, or printed.

[0147] In one aspect, this disclosure provides a computer-readable medium containing code that, once executed by one or more processors, implements a method according to any of the methods disclosed herein. The computer-readable medium can take many forms, including but not limited to tangible storage media, carrier media, or physical transmission media. Non-volatile storage media include, for example, optical discs or magnetic disks (such as any storage device in any computer), and storage media that can be used to implement computational steps, processing steps, etc. Volatile storage media include dynamic memory, such as the main memory of a computer. Tangible transmission media include coaxial cables, copper wires, and optical fibers, including wires constituting a bus within a computer system. Carrier transmission media can take the form of electrical or electromagnetic signals or sound or light waves, such as electrical or electromagnetic signals or sound or light waves generated during radio frequency (RF) and infrared (IR) data communications. Therefore, common forms of computer-readable media include, for example: floppy disks, flexible disks, hard disks, magnetic tapes, any other magnetic media, CD-ROMs, DVDs or DVD-ROMs, any other optical media, punched card tapes, any other physical storage media with a perforated pattern, RAM, PROMs and EPROMs, FLASH-EPROMs, any other memory chips or cartridges, carrier waves carrying data or instructions, cables or links carrying such carrier waves, or any other media from which a computer can read programming code and / or data. Many of these forms of computer-readable media can participate in transmitting one or more sequences of one or more instructions to a processor for execution.

[0148] This invention provides, but is not limited to, the following embodiments:

[0149] 1. A method for enriching amplicones of multinucleotide polynucleotides comprising at least two or more copies of a target polynucleotide, the method comprising:

[0150] (a) By extending a first primer to generate a multiply containing a single-stranded polynucleotide from a cyclic target polynucleotide, the first primer containing a first 3' end that specifically hybridizes with the target polynucleotide through sequence complementarity and a first 5' end containing a first common sequence that does not specifically hybridize with the target polynucleotide through sequence complementarity.

[0151] (b) Generating multiple extension products comprising one or more copies of the target polynucleotide by extending a second primer, the second primer comprising a second 3' end that hybridizes specifically to the polynucleotide via sequence complementarity and a second 5' end that does not hybridize specifically to the polynucleotide via sequence complementarity, wherein the first common sequence and the second common sequence each comprise at least 10 consecutive nucleotides at their 5' ends and are at least 90% identical when optimally aligned; and

[0152] (c) Amplify the multiple extension products of step (b) under conditions that generate multiple amplicons, wherein amplicons containing at least 2 or more copies of the target polynucleotide are enriched.

[0153] 2. The method as described in Embodiment 1, wherein step (a) is performed by a polymerase having chain displacement activity.

[0154] 3. The method as described in Embodiment 1, wherein the first common sequence and the second common sequence are identical.

[0155] 4. The method as described in Embodiment 1, wherein the amplification in step (c) includes primer extension of a third primer, wherein the third primer comprises a sequence that specifically hybridizes to the first common sequence or the second common sequence through sequence complementarity.

[0156] 5. The method as described in Embodiment 1, wherein the percentage of amplicon having two or more copies of the target polynucleotide produced by the amplification step (c) is greater than the percentage of amplicon having fewer than two copies of the target polynucleotide.

[0157] 6. The method of embodiment 5, wherein the percentage of amplicon having two or more copies of the target polynucleotide is at least 90%.

[0158] 7. The method of embodiment 5, wherein the percentage of amplicon having two or more copies of the target polynucleotide is at least 80%.

[0159] 8. The method of embodiment 5, wherein the percentage of amplicon having two or more copies of the target polynucleotide is at least 60%.

[0160] 9. The method of embodiment 1, wherein the extended product forms a stem-loop structure, the stem-loop structure comprising (i) intramolecular hybridization between the complement of the first common sequence and the second common sequence, or (ii) intramolecular hybridization between the second common sequence and the complement of the first common sequence.

[0161] 10. The method of embodiment 9, wherein the formation of the stem-loop structure is achieved by amplification in step (c) while the temperature of the annealing step is maintained within ±5°C of the melting temperature of the third primer.

[0162] 11. The method of embodiment 9, wherein the formation of the stem-ring structure is achieved by amplification in step (c) while the annealing step is maintained at a temperature below 70°C.

[0163] 12. The method of embodiment 9, wherein the stem-loop structure comprises intramolecular hybridization of at least 9 base pairs.

[0164] 13. The method of embodiment 9, wherein the stem-loop structure comprises intramolecular hybridization of at least 15 base pairs.

[0165] 14. The method of embodiment 9, wherein the stem-loop structure comprises intramolecular hybridization of at least 20 base pairs.

[0166] 15. The method of embodiment 9, wherein the stem-loop structure comprises intramolecular hybridization of at least 25 base pairs.

[0167] 16. The method of embodiment 9, wherein the stem-loop structure comprises intramolecular hybridization of at least 30 base pairs.

[0168] 17. The method as described in Embodiment 1, wherein step (b) includes an extension of the second primer for no more than 6 cycles.

[0169] 18. The method as described in Embodiment 1, wherein step (b) includes an extension of the second primer for no more than eight cycles.

[0170] 19. The method as described in Embodiment 1, wherein step (b) includes an extension of the second primer for no more than 10 cycles.

[0171] 20. The method as described in Embodiment 4, wherein the hybridization sequences of the first common sequence, the second common sequence, and the third primer all have melting temperatures (Tm) within ±5°C of each other.

[0172] 21. The method of embodiment 1, wherein the circular target polynucleotide is circularized cell-free DNA.

[0173] 22. The method of embodiment 1, wherein the circular target polynucleotide is a circularized fragment of genomic DNA.

[0174] 23. The method of embodiment 1, wherein the circular target polynucleotide comprises a sequence generated by chromosomal rearrangement.

[0175] 24. The method of embodiment 23, wherein the chromosomal rearrangement is at least one of deletion, duplication, inversion and translocation.

[0176] 25. The method as described in Embodiment 1 or 23, wherein the combined length of the sequence portion of the target polynucleotide from 5' to 3' corresponding to (i) a sequence complementary to the first 3' end, (ii) a sequence identical to the second 3' end, and (iii) an interpolated sequence between (i) and (ii) is 75 nucleotides or less.

[0177] 26. The method of embodiment 1, wherein at least 50% of the polynucleotides comprise a target polynucleotide of at least 75 nucleotides in length.

[0178] 27. The method of embodiment 1, wherein the cyclic target polynucleotide is single-stranded.

[0179] 28. The method of embodiment 1, further comprising sequencing the plurality of amplicones generated in step (c).

[0180] 29. The method of embodiment 28, wherein the sequencing is performed without selectively purifying the amplicon containing two or more copies of the target polynucleotide relative to the amplicon containing only one copy of the target polynucleotide.

[0181] 30. The method of embodiment 1, further comprising purifying the amplicon of the plurality of amplicon generated in step (c) that contains two or more copies of the target polynucleotide.

[0182] 31. The method of embodiment 30, further comprising sequencing the purified amplicon.

[0183] 32. The method as described in Embodiment 1, wherein multiple different target polynucleotides are amplified in the same reaction mixture.

[0184] 33. A reaction mixture for enriching amplicones of multinucleotide polynucleotides comprising at least two or more copies, the reaction mixture comprising:

[0185] (a) Circular target polynucleotides;

[0186] (b) A first primer comprising a first 3' end that specifically hybridizes to the target polynucleotide via sequence complementarity and a first 5' end comprising a first common sequence that does not specifically hybridize to the target polynucleotide via sequence complementarity; and

[0187] (c) A second primer comprising a second 3' end that hybridizes specifically to the polyp through sequence complementarity and a second 5' end that does not hybridize specifically to the polyp through sequence complementarity, wherein the first common sequence and the second common sequence each comprise at least 10 consecutive nucleotides at their 5' ends and are at least 90% identical when optimally aligned.

[0188] 34. The reaction mixture as described in embodiment 33, wherein the first common sequence and the second common sequence are identical.

[0189] 35. The reaction mixture as described in embodiment 33, wherein the reaction mixture is contained in a container.

[0190] 36. The reaction mixture as described in embodiment 35, wherein the container is an orifice, plate, tube, chamber, flow cell, or chip.

[0191] 37. The reaction mixture as described in embodiment 33, further comprising a third primer having a sequence that specifically hybridizes with the first common sequence or the second common sequence through sequence complementarity.

[0192] 38. The reaction mixture as described in Embodiment 37, wherein the hybridization sequences of the first common sequence, the second common sequence, and the third primer all have melting temperatures (Tm) within ±5°C of each other.

[0193] 39. The reaction mixture as described in embodiment 33, wherein the first common sequence and the second common sequence each comprise at least 15 nucleotides.

[0194] 40. The reaction mixture as described in Embodiment 33, wherein the circular target polynucleotide is circularized cell-free DNA.

[0195] 41. The reaction mixture as described in Embodiment 33, wherein the circular target polynucleotide is a circularized fragment of genomic DNA.

[0196] 42. The reaction mixture as described in embodiment 33, wherein the cyclic target polynucleotide comprises a sequence generated by chromosomal rearrangement.

[0197] 43. The reaction mixture as described in embodiment 42, wherein the chromosomal rearrangement is at least one of deletion, duplication, inversion, and translocation.

[0198] 44. The reaction mixture as described in embodiment 33 or 42, wherein the combined length of the sequence portion of the target polynucleotide corresponding from 5' to 3' to (i) the sequence complementary to the first 3' end, (ii) the sequence identical to the second 3' end, and (iii) the interpolated sequence between (i) and (ii) is 75 nucleotides or less.

[0199] 45. The reaction mixture as described in Embodiment 33, wherein the cyclic target polynucleotide is single-stranded.

[0200] 46. ​​A kit for enriching amplicon of a multiply containing at least two or more copies of a target polynucleotide, the kit comprising:

[0201] (a) A first primer comprising a first 3' end that specifically hybridizes with the target polynucleotide through sequence complementarity and a first 5' end comprising a first common sequence that does not specifically hybridize with the target polynucleotide through sequence complementarity;

[0202] (b) A second primer comprising a second 3' end that specifically hybridizes to the polyp via sequence complementarity and a second 5' end comprising a second common sequence that does not specifically hybridize to the polyp via sequence complementarity, wherein the first common sequence and the second common sequence each comprise at least 10 consecutive nucleotides at their 5' ends and are at least 90% identical when optimally aligned, and the polyp is an extension of the first primer; and

[0203] (c) A third primer having a sequence that specifically hybridizes with the first common sequence or the second common sequence through sequence complementarity.

[0204] 47. The kit as described in embodiment 46, wherein the first common sequence and the second common sequence are identical.

[0205] 48. The kit as described in embodiment 46, wherein the hybridization sequences of the first common sequence, the second common sequence and the third primer all have melting temperatures (Tm) within ±5°C of each other.

[0206] 49. The kit as described in embodiment 46, wherein the combined length of the sequence portion of the target polynucleotide corresponding from 5' to 3' to (i) the sequence complementary to the first 3' end, (ii) the sequence identical to the second 3' end, and (iii) the interpolated sequence between (i) and (ii) is 75 nucleotides or less.

[0207] 50. A system for designing primers for enriching amplicon of a multiply containing at least two or more copies of a target polynucleotide, said system comprising:

[0208] (a) A computer configured to receive client requests to design primers for amplifying a specified target sequence;

[0209] (b) A computer-readable medium containing code that, when executed by one or more processors, designs at least three primers for amplifying the target sequence, wherein the at least three primers comprise:

[0210] (i) A first primer comprising a first 3' end that specifically hybridizes with the target polynucleotide through sequence complementarity and a first 5' end comprising a first common sequence that does not specifically hybridize with the target polynucleotide through sequence complementarity;

[0211] (ii) a second primer comprising a second 3' end that specifically hybridizes to the polyp via sequence complementarity and a second 5' end comprising a second common sequence that does not specifically hybridize to the polyp via sequence complementarity, wherein the first common sequence and the second common sequence each comprise at least 10 consecutive nucleotides at their 5' ends and are at least 90% identical when optimally aligned, and the polyp is an extension of the first primer; and

[0212] (iii) A third primer having a sequence that specifically hybridizes to the first or second common sequence through sequence complementarity; and

[0213] (c) A report generator that sends a report to a recipient, wherein the report contains the sequences of the at least three primers.

[0214] 51. The system as described in embodiment 50, wherein the first common sequence and the second common sequence are identical.

[0215] 52. The system of embodiment 50, wherein the hybridization sequences of the first common sequence, the second common sequence and the third primer all have melting temperatures (Tm) within ±5°C of each other.

[0216] 53. The system of embodiment 50, wherein the combined length of the sequence portion of the target polynucleotide corresponding from 5' to 3' to (i) the sequence complementary to the first 3' end, (ii) the sequence identical to the second 3' end, and (iii) the interpolated sequence between (i) and (ii) is 75 nucleotides or less.

[0217] 54. A method for performing rolling circle amplification, comprising:

[0218] (a) Provide a cyclic polynucleotide containing the target polynucleotide;

[0219] (b) subjecting the amplification reaction mixture to multiple cycles of rolling circle amplification to generate multiple amplification products comprising polynucleotides, wherein the amplification reaction mixture comprises (i) a polymerase with chain displacement activity, (ii) the cyclic polynucleotide, and (iii) primers; and wherein each cycle of the multiple cycles of rolling circle amplification comprises denaturation at a denaturation temperature, primer annealing at an annealing temperature, and primer extension at an extension temperature for a given extension time, thereby generating the multiple amplification products; and

[0220] The multiple amplification products generated therefrom are characterized by containing a higher proportion of multiplyings of the target polynucleotide with at least two copies, compared to multiple amplification products generated by an amplification cycle using denaturation and primer annealing conditions but with an extension time equivalent to the sum of the extension times of the multiple cycles.

[0221] 55. A method for increasing the proportion of multiplys having at least two copies of a target polynucleotide generated by rolling circle amplification, the method comprising:

[0222] (a) Provide a cyclic polynucleotide containing the target polynucleotide;

[0223] (b) subjecting the amplification reaction mixture to multiple cycles of rolling circle amplification to generate multiple amplification products comprising multiple nucleotides, wherein the amplification reaction mixture comprises (i) a polymerase having chain displacement activity, (ii) the cyclic polynucleotide, and (iii) primers; and wherein each cycle of the multiple cycles of rolling circle amplification comprises denaturation at a denaturation temperature, primer annealing at an annealing temperature, and primer extension at an extension temperature for a given extension time, thereby generating the multiple amplification products;

[0224] This increases the proportion of multiplyes of the target polynucleotide having at least two copies.

[0225] 56. The method of embodiment 55, wherein the proportion of polynucleotides having at least two copies of the target polynucleotide is increased in the multiple amplification products compared to multiple amplification products generated by an amplification cycle using denaturation and primer annealing conditions that are equivalent but the extension time is equivalent to the sum of the extension time of the multiple cycles.

[0226] 57. The method as described in embodiment 54 or 55, wherein the polymerase is selected from: Bsu DNA polymerase, Vent polymerase, Bst DNA polymerase, phi29 DNA polymerase, PyroPhage 3173 polymerase, any variant thereof, and any fragment thereof.

[0227] 58. The method as described in embodiment 54 or 55, wherein when the cyclic polynucleotide used in the reaction mixture comprises human cell-free DNA (cfDNA), the multiple amplification products exhibit an average fragment length of about 180 base pairs.

[0228] 59. The method as described in embodiment 54 or 55, wherein when the cyclic polynucleotide used in the reaction mixture comprises human cell-free DNA (cfDNA), the multiple amplification products exhibit a median fragment length of approximately 170 base pairs.

[0229] 60. The method as described in embodiment 54 or 55, wherein when the cyclic polynucleotide used in the reaction mixture comprises human cell-free DNA (cfDNA), the plurality of amplification products exhibit a fragment length distribution of about 40 to about 450 bases.

[0230] 61. The method of embodiment 54 or 55, wherein when the cyclic polynucleotide used in the reaction mixture comprises human cell-free DNA (cfDNA), the plurality of amplification products exhibit a fragment length distribution of about 100 to about 200 bases.

[0231] 62. The method of embodiment 56, wherein the proportion of multiplys having at least two copies of the target polynucleotide is increased by at least about 1%.

[0232] 63. The method as described in embodiment 54 or 55, further comprising replenishing the reaction mixture with the polymerase after at least one cycle of the plurality of cycles of rolling circle amplification.

[0233] 64. The method as described in embodiment 54 or 55, wherein the cyclic polynucleotide has a length of about 40 bases to about 500 bases.

[0234] 65. The method of embodiment 54 or 55, wherein the cyclic polynucleotide comprises cell-free DNA (cfDNA).

[0235] 66. The method of embodiment 54 or 55, wherein the cyclic polynucleotide comprises a fragment of genomic DNA.

[0236] 67. The method as described in embodiment 54 or 55, wherein the cyclic polynucleotide comprises a sequence generated by chromosomal rearrangement.

[0237] 68. The method of embodiment 67, wherein the chromosomal rearrangement is at least one of deletion, duplication, inversion and translocation.

[0238] 69. The method as described in embodiment 54 or 55, wherein the cyclic polynucleotide is double-stranded.

[0239] 70. The method as described in embodiment 54 or 55, wherein the cyclic polynucleotide is single-stranded.

[0240] 71. The method as described in embodiment 54 or 55, wherein a variety of different cyclic polynucleotides are amplified in the amplification reaction mixture.

[0241] 72. The method as described in embodiment 54 or 55, wherein the plurality of cycles comprises at least two cycles.

[0242] 73. The method as described in embodiment 54 or 55, wherein each of the plurality of cycles comprises (ii) denaturation at a denaturation temperature of about 75°C to about 95°C for about 5 seconds to about 60 seconds, (iii) primer annealing at an annealing temperature of about 45°C to about 65°C for about 5 seconds to about 60 seconds, and (iii) primer extension at an extension temperature of about 65°C to about 75°C for about 30 seconds to about 10 minutes.

[0243] 74. The method as described in embodiment 54 or 55, wherein each of the plurality of cycles comprises (ii) denaturation at a denaturation temperature of about 80°C for about 15 seconds to about 30 seconds, (iii) primer annealing at an annealing temperature of about 50°C for about 15 seconds to about 45 seconds, and (iii) primer extension at an extension temperature of about 70°C for an extension period of about 3 minutes to about 10 minutes.

[0244] 75. The method as described in embodiment 54 or 55, wherein the primer comprises a random sequence.

[0245] 76. The method as described in embodiment 54 or 55, wherein the primer comprises a gene-specific sequence.

[0246] 77. The method of embodiment 54 or 55, wherein the primer comprises a first primer comprising (i) a first 3' end that specifically hybridizes to the cyclic polynucleotide via sequence complementarity, and (ii) a first 5' end comprising a first common sequence that does not specifically hybridize to the target polynucleotide via sequence complementarity, wherein during the plurality of cycles of rolling circle amplification, the first primer is extended by using the cyclic polynucleotide as a template to generate a multiply comprising a single-stranded polynucleotide.

[0247] 78. The method of embodiment 77, wherein the primer comprises a second primer comprising (i) a second 3' end that specifically hybridizes with the polynucleotide comprising a single-stranded polynucleotide via sequence complementarity, and (ii) a second 5' end comprising a second common sequence that does not specifically hybridize with the polynucleotide via sequence complementarity, wherein during the plurality of cycles of rolling circle amplification, the second primer is extended using the polynucleotide as a template to generate a plurality of extension products comprising one or more copies of the target polynucleotide.

[0248] 79. The method of embodiment 78, wherein the first common sequence and the second common sequence each contain at least 10 consecutive nucleotides at the 5' end and are at least 90% identical when optimally aligned.

[0249] 80. The method as described in embodiment 79, wherein the first common sequence and the second common sequence are identical.

[0250] 81. The method of embodiment 78, further comprising amplifying the plurality of extension products under conditions of generating a plurality of amplicons, wherein amplicons containing at least two or more copies of the target polynucleotide are enriched.

[0251] 82. The method of embodiment 81, wherein the amplification includes primer extension of a third primer, wherein the third primer comprises a sequence that specifically hybridizes to the first common sequence or the second common sequence through sequence complementarity.

[0252] 83. The method of embodiment 81, wherein the percentage of amplicon generated by amplification having two or more copies of the target polynucleotide is greater than the percentage of amplicon having fewer than two copies of the target polynucleotide.

[0253] 84. The method of embodiment 83, wherein the percentage of amplicon having two or more copies of the target polynucleotide is at least 5%.

[0254] 85. The method of embodiment 84, wherein the percentage of amplicon having two or more copies of the target polynucleotide is at least 10%.

[0255] 86. The method of embodiment 85, wherein the percentage of amplicon having two or more copies of the target polynucleotide is at least 20%.

[0256] 87. The method of embodiment 86, wherein the percentage of amplicon having two or more copies of the target polynucleotide is at least 30%.

[0257] 88. The method of embodiment 87, wherein the percentage of amplicon having two or more copies of the target polynucleotide is at least 40%.

[0258] 89. The method of embodiment 88, wherein the percentage of amplicon having two or more copies of the target polynucleotide is at least 60%.

[0259] 90. The method of embodiment 89, wherein the percentage of amplicon having two or more copies of the target polynucleotide is at least 80%.

[0260] 91. The method of embodiment 90, wherein the percentage of amplicon having two or more copies of the target polynucleotide is at least 90%.

[0261] 92. The method of any one of embodiments 78-80, wherein the plurality of extended products form a stem-loop structure, the stem-loop structure comprising (i) intramolecular hybridization between the complement of the first common sequence and the second common sequence, or (ii) intramolecular hybridization between the second common sequence and the complement of the first common sequence.

[0262] 93. The method of embodiment 92, wherein the formation of the stem-loop structure is achieved by amplification while the temperature of the annealing step is maintained within ±5°C of the melting temperature of the third primer.

[0263] 94. The method of embodiment 92, wherein the formation of the stem-ring structure is achieved by amplification while the annealing step is maintained at a temperature below about 70°C.

[0264] 95. The method of embodiment 92, wherein the stem-loop structure comprises intramolecular hybridization of at least 9 base pairs.

[0265] 96. The method of embodiment 95, wherein the stem-loop structure comprises intramolecular hybridization of at least 15 base pairs.

[0266] 97. The method of embodiment 96, wherein the stem-loop structure comprises intramolecular hybridization of at least 20 base pairs.

[0267] 98. The method of embodiment 97, wherein the stem-loop structure comprises intramolecular hybridization of at least 25 base pairs.

[0268] 99. The method of embodiment 98, wherein the stem-loop structure comprises intramolecular hybridization of at least 30 base pairs.

[0269] 100. The method as described in embodiment 82, wherein the hybridization sequences of the first common sequence, the second common sequence, and the third primer all have melting temperatures (Tm) within ±5°C of each other.

[0270] 101. The method of any one of embodiments 78-80, wherein the combined length of the sequence portion of the target polynucleotide corresponding from 5' to 3' to (i) the sequence complementary to the first 3' end, (ii) the sequence identical to the second 3' end, and (iii) the interpolated sequence between (i) and (ii) is 75 nucleotides or less.

[0271] 102. The method of any one of embodiments 54-101, further comprising sequencing the multiple amplification products containing the polymers.

[0272] 103. The method of embodiment 102, wherein the sequencing is performed without selectively separating multiplyes having at least two copies of the target polynucleotide from multiplyes containing fewer than two copies of the target polynucleotide.

[0273] 104. The method of any one of embodiments 54-101, further comprising separating a multiplex containing at least two copies of the target polynucleotide from a multiplex containing less than two copies of the target polynucleotide.

[0274] 105. The method of embodiment 104, further comprising sequencing the multiply containing at least two copies of the target polynucleotide.

[0275] Example

[0276] The following embodiments are given to illustrate various embodiments of the invention and are not intended to limit the invention in any way. These embodiments and the methods described therein represent preferred embodiments, are exemplary, and should not be construed as limiting the scope of the invention. Those skilled in the art will recognize variations and other uses encompassed within the spirit of the invention as defined by the claims.

[0277] Example 1: Comparison of products from one RCA amplification cycle and multiple RCA amplification cycles

[0278] Genomic DNA was sonicated to an average fragment size of approximately 180 bp. The fragmented DNA was purified using 0.9x Ampure beads to remove fragments smaller than 100 bp. The sonicated genomic DNA was then ligated to form circular target polynucleotides. For ligation, 12 μl of purified DNA fragments (>10 ng) were denatured by heating at 95 °C for 30 seconds and cooling on ice for 2 minutes. An 8 μl ligation mixture containing 2 μl of 10x CircLigase buffer, 4 μl of 5M betaine, 1 μl of 50 mM MnCl2, and 1 μl of CircLigase II was then added to the denatured DNA sample, and the reaction was incubated at 60 °C for at least 12 hours. At the end of the ligation process, any remaining linear single-stranded DNA molecules were removed by an exonuclease treatment step. For exonuclease treatment, the ligation product was heated at 80°C for 45 seconds, followed by the addition of 1 μl of an exonuclease mixture (ExoI 20 U / μl: ExoIII 100 U / μl, a ratio of 1:2). The sample was incubated at 37°C for 30 minutes on a thermal cycler, followed by incubation at 80°C for 20 minutes. After exonuclease treatment, 1 μl of 50 mM EDTA was added to each tube.

[0279] The circular target polynucleotide was subjected to one or multiple RCA amplification cycles. For both one and multiple RCA amplification cycles, 10 ng of circularized DNA sample was used as the starting material. For each reaction, 0.34 μL of 1M Tris-HCl (pH 9.2), 1 μL of 100 mM MgSO4, 2.78 μL of 180 mM (NH4)2SO4, 0.75 μL of a 25 mM dNTP mixture, 0.5 μL of 10% Tween 20, 1.20 μL of 1M KCl, 2 μL of 10 μM back-to-back forward and reverse primers, and 18.28 μL of water were added per 10 ng of DNA sample. The reaction was heated at 80 °C for 1 min, incubated at 63 °C for 5 min, and then cooled to 4 °C. Next, 15 units of Bst 2.0 hot-start DNA polymerase were added to each reaction. For one RCA amplification cycle, the reaction was incubated at 63°C for 2 hours. For multiple RCA amplification cycles, the reaction was incubated in a thermal cycler with the following program: 8 cycles at 60°C for 30 seconds; 70°C for 4.5 minutes; 94°C for 20 seconds; and 58°C for 10 seconds. At the end of every two cycles, 15 units of Bst 2.0 hot-start DNA polymerase were added.

[0280] Following the manufacturer's instructions for the remaining washing steps, purify all amplification products by adding 50 μl of Ampure beads. For elution, add 55 μl of elution buffer to each tube and incubate the beads at 65°C for 5 minutes. After a brief rotation, return the tube to the magnet. Recover approximately 50 μl of elution product from each reaction.

[0281] For adapter attachment of amplification products from one RCA cycle, each 50 μl eluent was mixed with 5.7 μl of 10x AccuPrime buffer, 1 μl of 25 μM adapter primer (complementary to the common sequence at the 3' end of the primers used in previous amplification reactions), and 2 units of AccuPrime HiFi Taq polymerase. Adapter attachment was performed using the following PCR program: 95°C for 2 min; 30 cycles of 95°C for 30 s, 60°C for 30 s, 72°C for 2.5 min; and a final extension at 72°C for 7 min. For amplification products from multiple RCA cycles, sequencing adapters were attached using Illumina's KAPA hyperprep kit. The PCR-amplified library products were analyzed by agarose gel electrophoresis or next-generation sequencing. For bioinformatics analysis of the sequencing data, FASTQ files were obtained from HiSeq runs. The FASTQ files were aligned with a reference file containing the target sequence. The insert size was calculated based on the sequencing data.

[0282] like Figure 5 Qualitative analysis on agarose gels showed that, compared to one RCA cycle, amplification using B2B primers and temperature cycling produced amplicones containing more polynucleotide copies and amplicones with longer target polynucleotides. Figure 6 The table provides a semi-quantitative comparison of the ratios of products containing one replicate (approximately 150 bp), two replicates (approximately 300 bp), or three replicates (approximately 450 bp) by agarose gel intensities analysis. Multiple RCA cycles reduced the relative amount of product with only one replicate compared to one RCA cycle.

[0283] Sequencing analysis of the amplified products also showed that the proportion of larger DNA fragments increased when multiple RCA cycles were used compared to one RCA cycle. Figure 7 The fragment size distribution is shown by read counts, while Figure 8 The distribution of observed molecular sizes is shown as a percentage of molecules.

[0284] Example 2: Comparison of products generated by multiple RCA cycles using primers with or without stem structures.

[0285] Genomic DNA was sonicated to an average fragment size of approximately 150 bp. The fragmented DNA was purified using 0.9x Ampure beads to remove fragments smaller than 100 bp. The sonicated genomic DNA was then ligated to form circular target polynucleotides. For ligation, 12 μl of purified DNA fragments (>10 ng) were denatured by heating at 95 °C for 30 seconds and cooling on ice for 2 minutes. An 8 μl ligation mixture containing 2 μl of 10x CircLigase buffer, 4 μl of 5M betaine, 1 μl of 50 mM MnCl2, and 1 μl of CircLigase II was then added to the denatured DNA sample, and the reaction was incubated at 60 °C for at least 12 hours. At the end of the ligation process, any remaining linear single-stranded DNA molecules were removed by an exonuclease treatment step. For exonuclease treatment, the ligation product was heated at 80°C for 45 seconds, followed by the addition of 1 μl of an exonuclease mixture (ExoI 20 U / μl: ExoIII 100 U / μl, a ratio of 1:2). The sample was incubated at 37°C for 30 minutes on a thermal cycler, followed by incubation at 80°C for 20 minutes. After exonuclease treatment, 1 μl of 50 mM EDTA was added to each tube.

[0286] The circular target polynucleotide is subjected to multiple RCA amplification cycles using primers capable of forming a 19-mer stem structure or primers designed to be stemless. Exemplary common sequences capable of forming stem structures include those sequences and any fragments provided in Table 1.

[0287] For each reaction, add 0.34 μL of 1M Tris-HCl (pH 9.2), 1 μL of 100 mM MgSO4, 2.78 μL of 180 mM (NH4)2SO4, 0.75 μL of a 25 mM dNTP mixture, 0.5 μL of 10% Tween 20, 1.20 μL of 1M KCl, 2 μL of 10 μM back-to-back forward and reverse primers, and 18.28 μL of water to each 10 ng DNA sample. Heat the reaction at 80 °C for 1 min, incubate at 63 °C for 5 min, and then cool to 4 °C. Next, add 15 units of Bst 2.0 hot-start DNA polymerase to each reaction. Incubate the reaction in a thermal cycler with the following program: 8 cycles of 60 °C for 30 sec; 70 °C for 4.5 min; 94 °C for 20 sec; and 58 °C for 10 sec. At the end of every two cycles, add 15 units of Bst 2.0 hot-start DNA polymerase.

[0288] Following the manufacturer's instructions for the remaining washing steps, purify all amplification products by adding 50 μl of Ampure beads. For elution, add 55 μl of elution buffer to each tube and incubate the beads at 65°C for 5 minutes. After a brief rotation, return the tube to the magnet. Recover approximately 50 μl of elution product from each reaction.

[0289] Illumina's KAPA hyperprep kit was used to attach sequencing adaptors. The PCR-amplified library products were analyzed by agarose gel electrophoresis, and products ranging from 550 bp to 1000 bp were further collected for sequencing. The resulting amplified products were analyzed by sequencing. For bioinformatics analysis of the sequencing data, FASTQ files were obtained from HiSeq runs. The FASTQ files were aligned with a reference file containing the target sequence. The insert size was calculated based on the sequencing data.

[0290] As shown in Table 3, amplification using B2B primers with a stem structure and temperature cycling produced amplicons containing more polynucleotide copies. Table 3 lists the percentage of sequencing reads containing more than one repeat. Compared to primers without a stem, amplification using primers with a 19-base stem significantly increased the percentage of reads with more than one repeat.

[0291] Table 3

[0292] Primers for 19-mer stem 64.62％ Stemless primers 31.49％

[0293] Example 3: Detection of low-frequency fusion alleles from mixed genomic DNA samples

[0294] Chromosomal rearrangements have been observed in many cancer types. This embodiment describes a method for detecting fusion alleles using circularized DNA molecules and back-to-back (B2B) primer design. This method enables the detection of fusions in DNA samples without prior knowledge of the 'partner' gene and can be applied to screen for gene rearrangement events in cell-free DNA or genomic DNA samples.

[0295] Genomic DNA from an EML4 / ALK DNA standard reference (HD664 Horizon Diagnostics) containing 50% EML4 / ALK fusion alleles and reference genomic DNA were sonicated to an average fragment size of approximately 150 bp. The fragmented DNA was purified using 0.9x Ampure beads to remove fragments smaller than 100 bp. For ligation, 12 μl of purified DNA fragments (>10 ng) were denatured by heating at 95 °C for 30 seconds and cooling on ice for 2 minutes. Then, an 8 μl ligation mixture containing 2 μl of 10x CircLigase buffer, 4 μl of 5M betaine, 1 μl of 50 mM MnCl2, and 1 μl of CircLigase II was added to the denatured DNA sample, and the reaction was incubated at 60 °C for at least 12 hours. At the end of the ligation process, any remaining linear single-stranded DNA molecules were removed by an exonuclease treatment step. For exonuclease treatment, the ligation product was heated at 80°C for 45 seconds, then 1 μl of an exonuclease mixture (ExoI 20 U / μl: ExoIII 100 U / μl, ratio 1:2) was added and incubated at 37°C for 30 minutes on a thermal cycler, followed by incubation at 80°C for 20 minutes. After exonuclease treatment, 1 μl of 50 mM EDTA was added to each tube.

[0296] The sonicated genomic DNA was then ligated to form circular target polynucleotides. The two circularized DNA samples, HD664, and the reference genomic DNA were quantified by qPCR and then mixed together to obtain fusion alleles at concentrations of 2.5%, 0.5%, 0.05%, and 0%. Figure 9 For rolling circle amplification, 10 ng of each mixed DNA sample was used as starting material. For each reaction, 0.34 μL of 1M Tris-HCl (pH 9.2), 1 μL of 100 mM MgSO4, 2.78 μL of 180 mM (NH4)2SO4, 0.75 μL of a dNTP mixture (25 mM each), 0.5 μL of 10% Tween 20, 1.20 μL of 1M KCl, 2 μL of 10 μM forward and reverse primers specifically designed to target the ALK / EML4 fusion region (primer sequences provided in Table 4), and 18.28 μL of water were added per 10 ng DNA sample. The reaction was heated at 80 °C for 1 min and incubated at 63 °C for 5 min, then cooled to 4 °C. 15 units of Bst2.0 hot-start DNA polymerase were added to each reaction, and then each reaction was incubated at 63 °C for 2 h.

[0297] Table 4. Forward and reverse primer sequences used for ALK fusion detection

[0298] HD664_ALK_F CCTTGGCACCCGAGAATTCCATTTGAGGGATGGCACCATAT HD664_ALK_R GTTCAGAGTTCTACAGTCCGACGATCGGGACAGGATAATAGGAGCTAACA

[0299] Following the manufacturer's instructions for the remaining washing steps, all amplification products were purified by adding 50 μl of Ampure beads. For elution, 55 μl of elution buffer was added to each tube, and the beads were incubated at 65 °C for 5 minutes. After a brief rotation, the tubes were returned to the magnet. Approximately 50 μl of elution product was recovered from each reaction. Each 50 μl of elution buffer was mixed with 5.7 μl of 10x AccuPrime buffer, 1 μl of 25 μM primer for each Illumina sequencing library adaptor, and 2 units of AccuPrime HiFi Taq polymerase. The following PCR program was used to attach the amplified adaptors: 95 °C for 2 minutes; 25 cycles of 95 °C for 30 seconds, 60 °C for 30 seconds, 72 °C for 2.5 minutes; and a final extension at 72 °C for 7 minutes. The PCR products were analyzed by agarose gel electrophoresis, and products in the size range of 550 bp–1000 bp were collected for sequencing.

[0300] To perform bioinformatics analysis on the sequencing data, a FASTQ file was obtained from HiSeq. The FASTQ file was then aligned with a reference file containing the target sequence. Figure 10 As shown, fusion alleles with 2.5%, 0.5%, or 0.05% fusion allele incorporation were found in the samples, but fusion alleles with 0% fusion allele incorporation were not found in the samples.

[0301] Example 4: Target detection in multiplex RCA using B2B primers

[0302] Target polynucleotides were detected in multiple RCA and amplification using B2B primers. 20 ng of control cfDNA extracted from a human serum sample (H6914, Sigma) was resuspended in 12 μl of Tris pH 8 buffer and denatured by heating at 95 °C for 30 s and cooling on ice for 2 min. Then, an 8 μl ligation mixture containing 2 μl 10x CircLigase buffer, 4 μl 5M betaine, 1 μl 50 mM MnCl2, and 1 μl CircLigase II was added to the denatured DNA sample, and the reaction was incubated at 60 °C for at least 12 h. At the end of the ligation process, residual linear single-stranded DNA molecules were removed by an exonuclease treatment step. For exonuclease treatment, the ligation product was heated at 80 °C for 45 s, followed by the addition of 1 μl of an exonuclease mixture (ExoI 20 U / μl: ExoIII 100 U / μl, ratio 1:2). The samples were incubated at 37°C for 30 minutes on a thermal cycler, followed by incubation at 80°C for 20 minutes. After exonuclease treatment, 1 μl of 50 mM EDTA was added to each tube.

[0303] The circular target polynucleotide is subjected to rolling circle amplification and subsequent amplification using B2B primers. Examples of B2B primers are provided in Table 5.

[0304] Table 5. Examples of back-to-back B2B primers

[0305]

[0306]

[0307]

[0308]

[0309] For each reaction, add 0.34 μL of 1M Tris-HCl (pH 9.2), 1 μL of 100 mM MgSO4, 2.78 μL of 180 mM (NH4)2SO4, 0.75 μL of a 25 mM dNTP mixture, 0.5 μL of 10% Tween 20, 1.20 μL of 1M KCl, and 2 μL of 10 μM back-to-back forward and reverse primers to each 10 ng DNA sample. Figure 11 The mixture consisted of 8 paired primers targeting specific targets listed in the target list, and 18.28 μl of water. The reaction was heated at 80 °C for 1 min, incubated at 63 °C for 5 min, and then cooled to 4 °C. Next, 15 units of Bst 2.0 hot-start DNA polymerase were added to each reaction. For isothermal amplification using B2B primers, the reaction was incubated at 63 °C for 2 h.

[0310] Following the manufacturer's instructions for the remaining washing steps, purify all amplification products by adding 50 μl of Ampure beads. For elution, add 55 μl of elution buffer to each tube and incubate the beads at 65°C for 5 minutes. After a brief rotation, return the tube to the magnet. Recover approximately 50 μl of elution product from each reaction.

[0311] For adaptor attachment, 50 μl of elution buffer was mixed with 5.7 μl of 10x AccuPrime buffer, 1 μl of 25 μM adaptor primer (complementary to the common sequence at the 3' end of the primer used in isothermal B2B amplification), and 2 units of AccuPrime HiFi Taq polymerase. Adaptor attachment was amplified using the following PCR program: 95°C for 2 min; 30 cycles of 95°C for 30 s, 60°C for 30 s, 72°C for 2.5 min; and a final extension at 72°C for 7 min. PCR products were analyzed by agarose gel electrophoresis, and products ranging from 550 bp to 1000 bp were collected for sequencing. The resulting amplified products were analyzed by sequencing. Figure 11 The sequence analysis results shown indicate that multiple target polynucleotide sequences can be detected in multiplex reactions.

[0312] While preferred embodiments of the invention have been shown and described herein, it will be apparent to those skilled in the art that these embodiments are provided by way of example only. Various changes, modifications, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein can be used to practice the invention. The scope of the invention is intended to be defined by the following claims, and thereby covers the methods and structures within the scope of these claims and their equivalents.

Claims

1. A method for processing nucleic acids for non-disease diagnostic purposes, the method comprising: (a) Provide a reaction mixture comprising: (i) a polymerase having chain displacement activity, and (ii) a cyclic polynucleotide containing a target polynucleotide; (iii) Primers, the primers comprising a first primer having a first 3' end that specifically hybridizes to the target polynucleotide via sequence complementarity and a first 5' end that does not specifically hybridize to the target polynucleotide via sequence complementarity, comprising a first common sequence; and a second primer having a second 3' end that specifically hybridizes to the multiply of the target polynucleotide via sequence complementarity and a second 5' end that does not specifically hybridize to the multiply via sequence complementarity, wherein the first common sequence and the second common sequence each contain at least 10 consecutive nucleotides at their 5' ends and are at least 90% identical when optimally aligned, and the multiply is an extension of the first primer; (b) In the reaction mixture, the cyclic polynucleotide is subjected to multiple cycles of amplification using the polymerase and the primers to generate multiple amplification products, the multiple amplification products comprising one or more copies of the sequence of the cyclic polynucleotide, wherein the cycles in the multiple cycles include: The primers and the cyclic polynucleotide were annealed at the annealing temperature. The primer extension reaction is carried out at the extension temperature; and The reaction mixture is subjected to denaturation at a denaturation temperature; and (c) subject the multiple amplification products to nucleic acid sequencing to identify the sequence of the circular polynucleotide.

2. The method of claim 1, wherein the cyclic polynucleotide is a cyclic cell-free nucleic acid.

3. The method of claim 1, wherein the cyclic polynucleotide is cyclic ribonucleic acid (RNA).

4. The method of claim 3, wherein the circularized RNA comprises messenger RNA (mRNA) or microRNA (miRNA).

5. The method of claim 1, wherein the cyclic polynucleotide is cyclic deoxyribonucleic acid (DNA).

6. The method of claim 1, wherein the cyclic polynucleotide is derived from a biological sample of the subject.

7. The method of claim 6, wherein the biological sample is a cell-free biological sample.

8. The method of claim 6, wherein the biological sample is serum, plasma, blood, sweat, saliva, urine, feces, semen, mucosal excretions, cerebrospinal fluid, amniotic fluid, or lymph.

9. The method of claim 1, wherein the cyclic polynucleotide is single-stranded.

10. The method of claim 1, wherein the denaturation temperature is different from the annealing temperature and the stretching temperature.

11. The method of claim 10, wherein the denaturation temperature is between 75 °C and 95 °C; the annealing temperature is between 45 °C and 65 °C; and the stretching temperature is between 65 °C and 75 °C.

12. The method of claim 1, wherein the primer comprises a random sequence.

13. The method of claim 1, wherein the primer comprises a gene-specific sequence.

14. The method of claim 1, further comprising processing the sequence of the amplified product to identify variants in the sequence.

15. The method of claim 14, wherein the variant comprises at least one of single nucleotide polymorphism, deletion, insertion, copy number variant, duplication, translocation, fusion, or epigenetic variant.

16. A system for designing primers for enriching amplicon containing at least two copies of a target polynucleotide, the system comprising: (a) a computer configured to receive a client request to design primers for amplifying a specified target sequence; and (b) a computer-readable medium containing code that, when executed by one or more processors, designs at least three primers for amplifying the target sequence, wherein the at least three primers for amplifying the target sequence comprise: (i) a first primer comprising a first 3' end that hybridizes specifically to the target polynucleotide via sequence complementarity and a first 5' end that hybridizes specifically to the target polynucleotide without sequence complementarity; and (ii) a second primer comprising a second 3' end that hybridizes specifically to the polynucleotide via sequence complementarity and a second 5' end that hybridizes specifically to the polynucleotide without sequence complementarity, wherein the first common sequence and the second common sequence each comprise at least 10 consecutive nucleotides at their 5' ends and are at least 90% identical when optimally aligned, and the polynucleotide is an extension of the first primer; And (iii) a third primer having a sequence that specifically hybridizes with the first common sequence or the second common sequence through sequence complementarity; (c) A report generator that sends a report to a recipient, wherein the report contains the sequences of the at least three primers used to amplify the target sequence.

Images