Application of BCG gene BCG_1820 in the preparation of recombinant BCG for tuberculosis vaccine

Abstract

This invention provides the application of the BCG gene BCG_1820 in the preparation of recombinant BCG for tuberculosis vaccines, specifically providing a recombinant BCG bacterium ΔBCG_1820 in which the BCG_1820 gene is knocked out. This invention also provides a method for preparing this recombinant BCG bacterium and its application in the preparation of tuberculosis vaccines. The recombinant BCG bacterium ΔBCG_1820 provided by this invention can significantly induce macrophages to produce more antimicrobial peptides, giving the host a stronger ability to resist tuberculosis infection, and has the potential to serve as a candidate vaccine for tuberculosis.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, specifically to the application of the BCG gene BCG_1820 in the preparation of recombinant BCG for tuberculosis vaccines. Background Technology

[0002] Tuberculosis is a leading cause of death from bacterial infectious diseases worldwide. Due to the lack of an effective preventative vaccine against pulmonary tuberculosis in adults, the global tuberculosis situation remains serious. Currently, the only vaccine approved for clinical use in the prevention of tuberculosis is BCG (Mycobacterium bovisbacille Calmette-Guérin), a live attenuated vaccine. BCG was first administered to newborns in Paris in 1921. 1 By 2019, 88% of children worldwide had received the BCG vaccine in their first year of life. 2 BCG vaccine has a protective effect of more than 70% against tuberculous meningitis in newborns and school-aged children. 3 However, the protective effect against tuberculosis in adults is very limited. In the early 21st century, global efforts to develop new tuberculosis vaccines increased significantly. These include subunit adjuvants of the Mtb fusion protein, viral vector vaccines expressing one or more Mtb antigens, inactivated mycobacterial vaccines, and attenuated mycobacterial vaccines. 4,5 .

[0003] The development of new tuberculosis vaccines follows two basic approaches. 6,7 The first approach is to replace BCG with a modified recombinant BCG vaccine (rBCG) or a gene-knockout attenuated Mycobacterium tuberculosis. The characteristics of genetically modified rBCG should be: a) safer; b) stronger immunogenicity; c) inducing more durable protection; d) protection against highly virulent clinical isolates, such as Mycobacterium tuberculosis Beijing strain, multidrug-resistant strains (MDR), and extensively drug-resistant tuberculosis strains (XDR). One method for recombinant BCG is to introduce immunogenic tuberculosis-specific antigens lacking in BCG, such as the tuberculosis antigen gene encoded by RD1 (ESAT6, CFP10); or by overexpressing BCG autoantigens (homogenes of the Ag85 complex, etc.). Another method for recombinant BCG is to genetically edit existing BCG to better enhance the host's innate immune response. 8 Besides these two rBCG vaccine approaches, another strategy for developing tuberculosis vaccines is to attenuate the virulence of Mycobacterium tuberculosis. This involves deleting essential metabolic genes to create auxotrophic mutants, or primarily deleting virulence genes and their regulatory factors. One study showed that expressing the RD1 antigen of Mycobacterium tuberculosis on Mycobacterium voles significantly improved the host's resistance to tuberculosis infection. 9Furthermore, studies have found that recombinant Mycobacterium smegmatis can also serve as a tuberculosis vaccine. When the esx-3 gene of Mycobacterium smegmatis is knocked out, a strong innate immune response is observed in immunized mice. When this recombinant Mycobacterium smegmatis is reintroduced into the esx-3 gene of Mycobacterium tuberculosis, better protective activity against the host is observed in a mouse model of Mycobacterium tuberculosis challenge.

[0004] The second major approach to developing tuberculosis vaccines is the construction of subunit vaccines. These vaccines are either in vivo or non-replicating vaccines using a viral vector. Tuberculosis subunit vaccines primarily use recombinant proteins or attenuated viral vectors. While subunit vaccines can theoretically be used as starter vaccines, the prevailing view is that they should only be used as booster vaccines on top of BCG, recombinant BCG, or attenuated Mtb vaccines.

[0005] Currently, the BCG vaccine used clinically offers limited protection against pulmonary tuberculosis patients, making the development of recombinant BCG vaccines a major research direction. The primary research strategy for recombinant BCG vaccines involves knocking out BCG virulence genes to activate the host's immune response and enhance the protective efficacy of existing BCG vaccines. However, it remains unclear which genes are important immunosuppressive factors of BCG, and there is a lack of theoretical basis for determining which target-based gene editing of BCG can improve its protective effect.

[0006] Antimicrobial peptides (AMPs) are considered an ancient defense mechanism of the organism's innate immune system, possessing broad activity against Gram-positive and Gram-negative bacteria, fungi, parasites, and viruses. AMPs typically consist of 12-15 amino acids, carrying a cation (composed of positively charged arginine and lysine residues). 10 Its mechanism of action involves interaction with the negatively charged bacterial membrane, resulting in phospholipid replacement, membrane structure disorder, and internalization. 11 Because AMPs have different mechanisms of action, microorganisms rarely develop resistance. This invention, based on host antimicrobial peptides, seeks BCG virulence genes that significantly inhibit their expression, providing a strategy for constructing more effective recombinant BCG vaccines. Summary of the Invention

[0007] To overcome the shortcomings of existing technologies, this invention has discovered that recombinant BCG strains constructed by deleting the virulence gene BCG_1820 from wild-type BCG strains can significantly improve the immunoprotective effect of BCG and provide a candidate for tuberculosis vaccine development. Based on this, this invention provides the application of the BCG gene BCG_1820 in the preparation of recombinant BCG for tuberculosis vaccines.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] A first aspect of the present invention is to provide a BCG recombinant bacterium ΔBCG_1820, in which the gene BCG_1820 is knocked out.

[0010] Furthermore, the BCG_1820 gene in the BCG recombinant bacteria was knocked out using CRISPR / Cas9 technology.

[0011] Furthermore, the BCG_1820 gene gRNA sequence used in the knockout process is SEQ ID No.:2.

[0012] A second aspect of the present invention is to provide a method for constructing the above-mentioned BCG recombinant bacteria, wherein the BCG_1820 gene in the wild-type BCG strain is knocked out by CRISPR / Cas9 technology to obtain the BCG recombinant bacteria.

[0013] A third aspect of the present invention is to provide the use of the above-mentioned BCG recombinant bacteria in the preparation of a tuberculosis vaccine, the tuberculosis vaccine comprising the BCG recombinant bacteria.

[0014] Furthermore, the tuberculosis vaccine also includes an adjuvant.

[0015] A fourth aspect of the present invention is to provide a tuberculosis vaccine recombinant BCG, which is a BCG vaccine with the gene BCG_1820 knocked out.

[0016] Furthermore, the BCG_1820 gene was knocked out using CRISPR / Cas9 technology.

[0017] Furthermore, the BCG_1820 gene gRNA sequence used in the knockout process is SEQ ID No.:2.

[0018] The fifth aspect of the present invention is to provide a gene knockout vector for the BCG strain BCG_1820, which is a gRNA expression vector based on the CRISPR / Cas9 system, wherein the gRNA sequence is SEQ ID No.:2.

[0019] A sixth aspect of the present invention is to provide the application of the BCG strain BCG_1820 gene knockout vector in the preparation of a tuberculosis vaccine.

[0020] The present invention adopts the above technical solution and has the following technical effects compared with the prior art:

[0021] The BCG recombinant bacterium ΔBCG_1820 provided by this invention can significantly induce macrophages to produce more antimicrobial peptides, giving the host a stronger ability to resist tuberculosis infection, and has the potential to be a candidate vaccine for tuberculosis. Attached Figure Description

[0022] Figure 1This shows the results of PCR identification of the BCG_1820 gene knockout strain in one embodiment of the present invention;

[0023] Figure 2 This invention demonstrates that, in one embodiment, strain ΔBCG_1820 significantly promotes the expression of antimicrobial peptide genes in macrophages; Figures A and D show the effects of strain ΔBCG_1820 on the expression levels of Camp, Hamp, Defb3, and Defb4 in macrophages, respectively.

[0024] Figure 3 This is a flowchart of a mouse immune challenge experiment in one embodiment of the present invention;

[0025] Figure 4 This invention presents the comparative results of bacterial load in lung tissue of mice 30 days after immunization and challenged 30 days later, according to one embodiment of the invention.

[0026] Figure 5 The results of HE staining (Figure A) and acid-fast staining (Figure B) of the lung pathology of mice immunized 30 days after infection are shown in one embodiment of the present invention. Detailed Implementation

[0027] This invention provides the application of the BCG gene BCG_1820 in the preparation of recombinant BCG for tuberculosis vaccine, wherein the amino acid sequence of the gene BCG_1820 (source database: https: / / www.uniprot.org / uniprot / A0A0H3M6W4) is SEQ ID No.:1.

[0028] The present invention will now be described in detail with reference to specific embodiments and accompanying drawings to enable a better understanding of the invention. However, the following embodiments do not limit the scope of the invention.

[0029] Unless otherwise specified, the methods used in the embodiments are conventional methods, and the reagents used are commercially available reagents or reagents prepared according to conventional methods, unless otherwise specified.

[0030] Example 1

[0031] In this study, a strain with the BCG_1820 gene deletion was constructed from the wild-type BCG strain. The specific construction process and results are as follows:

[0032] A BCG_1820 gene deletion strain (ΔBCG_1820) was constructed from the wild-type BCG Danish strain using Cas9 technology.

[0033] First, competent cells of BCG:pYC1759 were prepared. The pYC1759 plasmid was electroporated into wild-type BCG Danish strain. Successfully transfected BCG single clones were picked and amplified in K+ 7H9+OADC medium. The cells were then washed three times with glycerol and collected for freezing at -80°C for later use. Cas9 and the sgRNA expression plasmid of the BCG_1820 gene (the BCG_1820 gene gRNA sequence is ATCGGCTCCGCATTGAACGC (SEQ ID No.:2)) were electroporated into BCG:pYC1759 competent cells. After amplification, the plasmids were plated on K+ Zeo resistant plates. Single clones were picked and identified by PCR and sequencing. The results are shown below. Figure 1 As shown.

[0034] Example 2

[0035] This embodiment, based on Example 1, verifies that strain ΔBCG_1820 can induce macrophages to produce more antimicrobial peptides. The specific experimental steps and results are as follows:

[0036] Using a mouse peritoneal primary macrophage infection model, wild-type BCG strain and ΔBCG_1820 strain (MOI=5) were infected for 12 hours and 24 hours. Trizol was used to lyse the cells, extract total RNA, reverse transcribe it into cDNA, and then quantify Camp, Hamp, Defb3 and Defb4 in the cells by qPCR.

[0037] like Figure 2 As shown, knocking out the BCG_1820 gene significantly promotes the expression of antimicrobial peptides, suggesting that the protein encoded by the BCG_1820 gene can inhibit the expression of host antimicrobial peptides and is a virulence factor of BCG.

[0038] Example 3

[0039] This embodiment verifies at the animal level that the ΔBCG_1820 strain has stronger immunoprotective function than the BCG strain. The specific experimental steps and results are as follows:

[0040] refer to Figure 3 The flowchart shows that wild-type C57BL / 6 mice were injected intravenously with PBS and 1×10⁻⁶ PBS, respectively. 6 CFU BCG strain, or 1×10 6CFU strain ΔBCG_1820. Thirty days after immunization, mice in each group were infected with Mycobacterium tuberculosis H37Rv via respiratory tract in a biosafety level 3 laboratory. Thirty days after infection, mice were euthanized by cervical dislocation, and lung tissue was isolated for CFU counting to confirm the bacterial load in the lung tissue of each group. Simultaneously, the lung tissue of each group was fixed with 4% PFA, embedded in paraffin, and the tissue sections and H&E staining were used to observe the pathological changes in the lung tissue among the groups.

[0041] like Figure 4 As shown, the ΔBCG_1820 strain exhibited a 30-fold decrease in lung tissue and bacterial count compared to the immune wild-type BCG strain, while also showing less neutrophil infiltration and more intact alveolar tissue (e.g., Figure 5 ).

[0042] In conclusion, the ΔBCG_1820 strain provides better protection against tuberculosis infection than the BCG strain.

[0043] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to the present invention are also within the scope of the present invention. Therefore, all equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

[0044] References:

[0045] 1. Tidjani, O., Grunitzky, B., Sadjo, H. & Guérin, N. [The prophylaxis of tuberculosis and vaccination with BCG. A recent study]. Ann Pediatr (Paris) 39 (1992).

[0046] 2.Chard,AN,Gacic-Dobo,M.,Diallo,MS,Sodha,SV&Wallace,ASRoutineVaccination Coverage-Worldwide,2019.MMWR Morb Mortal Wkly Rep69,1706-1710,doi:10.15585 / mmwr.mm6945a7(2020).

[0047] 3.Mangtani,P.et al.Protection by BCG vaccine against tuberculosis:asystematic review of randomized controlled trials.Clin Infect Dis58,470-480,doi:10.1093 / cid / cit790(2014).

[0048] 4.Ginsberg,A.M.Designing tuberculosis vaccine efficacy trials-lessonsfrom recent studies. Expert Rev Vaccines18,423-432,doi:10.1080 / 14760584.2019.1593143(2019).

[0049] 5.Ottenhoff,T.H.M.&Kaufmann,S.H.E.Vaccines against tuberculosis:whereare we and where do we need to go PLoS Pathog8,e1002607,doi:10.1371 / journal.ppat.1002607(2012).

[0050] 6.Kaufmann,S.H.E.Future vaccination strategies against tuberculosis:thinking outside the box.Immunity33,567-577,doi:10.1016 / j.immuni.2010.09.015(2010).

[0051] 7.Ottenhoff,T.H.M.Overcoming the global crisis:"yes,we can",but alsofor TB...Eur J Immunol39,2014-2020,doi:10.1002 / eji.200939518(2009).

[0052] 8. Reece, ST&Kaufmann, SHEFloating between the poles of pathology and protection: can we pin down the granuloma in tuberculosis Curr OpinMicrobiol15,63-70, doi:10.1016 / j.mib.2011.10.006(2012).

[0053] 9.Brodin,P.et al.Enhanced protection against tuberculosis byvaccination with recombinant Mycobacterium microti vaccine that induces Tcell immunity against region of difference 1antigens.J Infect Dis190,115-122(2004).

[0054] 10. Hancock, RE & Lehrer, R. Cationic peptides: a new source ofantibiotics. Trends Biotechnol 16, 82-88 (1998).

[0055] 11. Lakshmaiah Narayana, J. & Chen, J.-Y. Antimicrobial peptides: Possible anti-infective agents. Peptides72, 88-94, doi:10.1016 / j.peptides.2015.05.012(2015). sequence list <110> Shanghai Pulmonary Hospital <120> Application of BCG gene BCG_1820 in the preparation of recombinant BCG for tuberculosis vaccine <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 99 <212> PRT <213> Mycobacterium bovis <400> 1 Met Ser Phe Val Thr Thr Gln Pro Glu Ala Leu Ala Ala Ala Gly 1 5 10 15 Ser Leu Gln Gly Ile Gly Ser Ala Leu Asn Ala Gln Asn Ala Ala Ala 20 25 30 Path Thr Pro Thr Thr Gly Val Val Pro Path Path Path Asp Glu Val Ser 35 40 45 Ala Leu Thr Ala Ala Gln Phe Ala Ala His Ala Gln Ile Tyr Gln Ala 50 55 60 Val Ser Ala Gln Ala Ala Ala Ile His Glu Met Phe Val Asn Thr Leu 65 70 75 80 Gln Met Ser Ser Gly Ser Tyr Ala Ala Thr Glu Ala Ala Asn Ala Ala 85 90 95 Pathway Gly <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 atcggctccg cattgaacgc 20

Claims

1. A BCG recombinant bacterium, characterized in that, The strain is ΔBCG_1820, in which the BCG_1820 gene in the BCG recombinant bacteria is knocked out; the gRNA sequence of the BCG_1820 gene used in the knockout process is SEQ ID No:

2.

2. The BCG recombinant bacteria according to claim 1, characterized in that, The gene BCG_1820 in the BCG recombinant bacteria was knocked out using CRISPR / Cas9 technology.

3. The application of the BCG recombinant bacteria as described in any one of claims 1-2 in the preparation of a tuberculosis vaccine, characterized in that, The tuberculosis vaccine contains the BCG recombinant bacteria.

4. The application according to claim 3, characterized in that, The tuberculosis vaccine also includes an adjuvant.

5. A tuberculosis vaccine based on recombinant BCG, characterized in that, This is a BCG vaccine with the BCG_1820 gene knocked out.

6. The tuberculosis vaccine recombinant BCG according to claim 5, characterized in that, The BCG_1820 gene was knocked out using CRISPR / Cas9 technology; the BCG_1820 gene gRNA sequence used in the knockout process is SEQ ID No:2.

Images