A SNP molecular marker related to prediction of response to antiviral therapy of viral hepatitis and application thereof

By detecting the CD55_rs28371597 genotype, the problem of low response rate in PegIFN-α treatment of chronic hepatitis B was solved, enabling accurate prediction of PegIFN-α treatment efficacy and personalized treatment, thus improving the treatment response rate and accuracy.

CN114921542BActive Publication Date: 2026-07-21NANFANG HOSPITAL OF SOUTHERN MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NANFANG HOSPITAL OF SOUTHERN MEDICAL UNIV
Filing Date
2022-05-30
Publication Date
2026-07-21

AI Technical Summary

Technical Problem

In existing technologies, PegIFN-α treatment for patients with chronic hepatitis B has a low response rate and is expensive, and there is a lack of effective predictive methods to guide personalized treatment.

Method used

A molecular marker for a single nucleotide polymorphism (SNP) associated with the prediction of antiviral treatment response in viral hepatitis is provided, specifically CD55_rs28371597, located in the intron region of the STAT4 gene, with a polymorphism of G/T. The genotype of this SNP locus is detected to predict the patient's response to PegIFN-α treatment.

Benefits of technology

By detecting the CD55_rs28371597 genotype, the therapeutic effect of PegIFN-α can be accurately predicted, improving the treatment response rate and enabling personalized treatment, with an accuracy of 76.53% and a specificity of 94.02%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114921542B_ABST
    Figure CN114921542B_ABST
Patent Text Reader

Abstract

The application relates to the technical field of biomolecular markers, and discloses a SNP molecular marker related to the prediction of the response of viral hepatitis to antiviral treatment and application thereof. The sequence of the SNP molecular marker is shown in SEQ ID NO. 1, the SNP site is located at the 183th position, the polymorphism is G / T, the molecular marker is significantly related to the response of viral hepatitis to antiviral treatment, and can be used for evaluating the curative effect of interferon on viral hepatitis, judging the sensitivity of viral hepatitis patients to interferon, guiding the interferon medication of viral hepatitis patients, and evaluating the prognosis of viral hepatitis patients using interferon.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomolecular marker technology, specifically relating to a SNP molecular marker related to predicting the response to antiviral treatment for viral hepatitis and its application. Background Technology

[0002] Viral hepatitis is a common infectious disease caused by various hepatitis viruses. It is characterized by high infectivity, complex transmission routes, wide prevalence, and a high incidence rate. Clinically, it mainly manifests as fatigue, loss of appetite, nausea, vomiting, hepatomegaly, and impaired liver function. Some patients may experience jaundice and fever. Some patients may also experience urticaria, joint pain, or upper respiratory symptoms. Viral hepatitis is classified into five types: hepatitis A, B, C, D, and E. Chronic hepatitis B (CHB) is one common type of viral hepatitis. Currently, hepatitis B virus (HBV) infection is considered a major risk factor for liver cancer, with approximately 54% of liver cancer patients primarily caused by HBV infection. First-line anti-HBV drugs include pegylated interferon-alpha (PegIFN-α) and nucleoside (acid) analogs (NUCs). PegIFN-α has broad-spectrum antibacterial activity and is also one of the most important cytokines for fighting viral infections. Despite the significant adverse reactions of PegIFN-α, its numerous advantages have kept it a staple in first-line clinical treatment: the once-weekly dosing regimen improves patient compliance and tolerability; its dual immunomodulatory and antiviral effects contribute to long-lasting responses; it is an important component of some newer treatment regimens; and it plays a more significant role than NUCs in preventing CHB patients from progressing to liver cancer. However, currently, PegIFN-α treatment only produces a response in a small percentage of CHB patients (approximately 30%), and the treatment is relatively expensive.

[0003] In 2016, the inventors, through analysis of 466 hepatitis B e antigen (HBeAg)-positive CHB patients, discovered that the SNP rs7574865 located in the intron region of the STAT4 gene was significantly associated with the efficacy of PegIFN-α treatment in CHB patients. Furthermore, STAT4_rs7574865 has recently been shown to be significantly associated with combined response (CR) and HBsAg loss in CHB patients treated with PegIFN-α. In 2020, the inventors discovered another SNP—rs12614 in the coding region of the CFB gene—which is also closely associated with the PegIFN-α treatment response in HBeAg-positive CHB patients. Previously, only a few patent applications have identified gene loci for evaluating the efficacy of PegIFN-α treatment in CHB patients. However, in actual clinical practice, the reliability of predicting drug efficacy through the combined use of multiple variant loci is higher. Therefore, detecting more novel locus variants is particularly important for assessing the efficacy of PegIFN-α. Summary of the Invention

[0004] In order to overcome the shortcomings of the existing technology, the first aspect of the present invention is to provide a SNP molecular marker related to the prediction of antiviral treatment response in viral hepatitis.

[0005] A second aspect of the present invention aims to provide a primer set for amplifying SNP molecular markers associated with the prediction of antiviral treatment response to viral hepatitis in the first aspect.

[0006] A third aspect of the present invention is to provide a reagent for predicting the efficacy of antiviral treatment for viral hepatitis.

[0007] A fourth aspect of the present invention aims to provide the use of the SNP molecular marker of the first aspect, the primer set of the second aspect, or the reagent of the third aspect in the preparation of products for evaluating the efficacy of interferon against viral hepatitis.

[0008] The fifth aspect of the present invention aims to provide the use of the SNP molecular marker of the first aspect, the primer set of the second aspect, or the reagent of the third aspect in the preparation of products for assessing the sensitivity of patients with viral hepatitis to interferon.

[0009] A sixth aspect of the present invention aims to provide the use of the SNP molecular marker of the first aspect, the primer set of the second aspect, or the reagent of the third aspect in the preparation of products that guide the use of interferon in patients with viral hepatitis.

[0010] A seventh aspect of the present invention aims to provide the use of the SNP molecular marker of the first aspect, the primer set of the second aspect, or the reagent of the third aspect in the preparation of products for prognostic assessment of patients with viral hepatitis treated with interferon.

[0011] An eighth aspect of the present invention is to provide a product.

[0012] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0013] In a first aspect, the present invention provides a SNP molecular marker associated with the prediction of response to antiviral therapy for viral hepatitis, the sequence of which is shown in SEQ ID NO.1, the SNP site being located at position 183, and the polymorphism being G / T.

[0014] Preferably, the viral hepatitis includes at least one of hepatitis A, hepatitis B, hepatitis C, hepatitis D, and hepatitis E; more particularly, hepatitis B.

[0015] Preferably, the hepatitis B is chronic hepatitis B.

[0016] Preferably, the antiviral treatment response is a response to interferon treatment; more preferably, it is a combined response to interferon treatment.

[0017] Preferably, the interferon is at least one of IFN-α, IFN-β, and IFN-γ; more preferably, it is IFN-α.

[0018] Preferably, the IFN-α is PegIFN-α.

[0019] A second aspect of the invention provides a primer set for amplifying SNP molecular markers associated with the prediction of antiviral treatment response to viral hepatitis in the first aspect.

[0020] Preferably, the primer set includes rs28371597.F and rs28371597.R; the sequence of rs28371597.F is GAGGCCCAGTGAAGAGTTGT (SEQ ID NO.2); the sequence of rs28371597.R is GCCTATTTCACGCATGGCTT (SEQ ID NO.3).

[0021] A third aspect of the present invention provides a reagent comprising a reagent for detecting SNP molecular markers of the first aspect of the present invention.

[0022] Preferably, the reagent for detecting the SNP molecular marker of the first aspect of the present invention comprises a reagent for detecting the genotype and / or polymorphism of the SNP molecular marker of the first aspect of the present invention.

[0023] Preferably, the reagent for detecting the genotype and / or polymorphism of the SNP molecular marker of the first aspect of the present invention comprises the primer set of the second aspect of the present invention.

[0024] Preferably, the reagent further comprises at least one of polymerase, dNTP, PCR buffer, and MgCl2.

[0025] A fourth aspect of the invention provides the use of any one of (1) to (3) in the preparation of a product for evaluating the efficacy of interferon in patients with viral hepatitis;

[0026] (1) The SNP molecular marker of the first aspect of the present invention;

[0027] (2) Primer set of the second aspect of the present invention;

[0028] (3) The reagent of the third aspect of the present invention.

[0029] Preferably, the viral hepatitis includes at least one of hepatitis A, hepatitis B, hepatitis C, hepatitis D, and hepatitis E; more particularly, hepatitis B.

[0030] Preferably, the hepatitis B is chronic hepatitis B.

[0031] Preferably, the interferon is at least one of IFN-α, IFN-β, and IFN-γ; more preferably, it is IFN-α.

[0032] Preferably, the IFN-α is PegIFN-α.

[0033] Preferably, the product is a reagent kit.

[0034] A fifth aspect of the invention provides the use of any one of (1) to (3) in the preparation of a product, said product being used to determine the sensitivity of patients with viral hepatitis to interferon;

[0035] (1) The SNP molecular marker of the first aspect of the present invention;

[0036] (2) Primer set of the second aspect of the present invention;

[0037] (3) The reagent of the third aspect of the present invention.

[0038] Preferably, the viral hepatitis includes at least one of hepatitis A, hepatitis B, hepatitis C, hepatitis D, and hepatitis E; more particularly, hepatitis B.

[0039] Preferably, the hepatitis B is chronic hepatitis B.

[0040] Preferably, the interferon is at least one of IFN-α, IFN-β, and IFN-γ; more preferably, it is IFN-α.

[0041] Preferably, the IFN-α is PegIFN-α.

[0042] Preferably, the product is a reagent kit.

[0043] A sixth aspect of the present invention provides the use of any one of (1) to (3) in the preparation of a product for guiding interferon use in patients with viral hepatitis;

[0044] (1) The SNP molecular marker of the first aspect of the present invention;

[0045] (2) Primer set of the second aspect of the present invention;

[0046] (3) The reagent of the third aspect of the present invention.

[0047] Preferably, the viral hepatitis includes at least one of hepatitis A, hepatitis B, hepatitis C, hepatitis D, and hepatitis E; more particularly, hepatitis B.

[0048] Preferably, the hepatitis B is chronic hepatitis B.

[0049] Preferably, the interferon is at least one of IFN-α, IFN-β, and IFN-γ; more preferably, it is IFN-α.

[0050] Preferably, the IFN-α is PegIFN-α.

[0051] Preferably, the product is a reagent kit.

[0052] A seventh aspect of the invention provides the use of any one of (1) to (3) in the preparation of a product for prognostic assessment of patients with viral hepatitis treated with interferon;

[0053] (1) The SNP molecular marker of the first aspect of the present invention;

[0054] (2) Primer set of the second aspect of the present invention;

[0055] (3) The reagent of the third aspect of the present invention.

[0056] Preferably, the viral hepatitis includes at least one of hepatitis A, hepatitis B, hepatitis C, hepatitis D, and hepatitis E; more particularly, hepatitis B.

[0057] Preferably, the hepatitis B is chronic hepatitis B.

[0058] Preferably, the interferon is at least one of IFN-α, IFN-β, and IFN-γ; more preferably, it is IFN-α.

[0059] Preferably, the IFN-α is PegIFN-α.

[0060] Preferably, the product is a reagent kit.

[0061] An eighth aspect of the present invention provides a product comprising: a reagent for detecting the SNP molecular marker of the first aspect of the present invention; and

[0062] At least one reagent used in any one of a1) to a4):

[0063] a1) Evaluate the efficacy of interferon in patients with viral hepatitis;

[0064] a2) Assess the sensitivity of patients with viral hepatitis to interferon;

[0065] a3) Instructing patients with viral hepatitis on interferon use;

[0066] a4) Prognostic assessment of viral hepatitis patients treated with interferon.

[0067] Preferably, the product has at least one function among a1) to a4):

[0068] a1) Evaluate the efficacy of interferon in patients with viral hepatitis;

[0069] a2) Assess the sensitivity of patients with viral hepatitis to interferon;

[0070] a3) Instructing patients with viral hepatitis on interferon use;

[0071] a4) Prognostic assessment of viral hepatitis patients treated with interferon.

[0072] Preferably, the reagent for detecting the SNP molecular marker of the first aspect of the present invention comprises a reagent for detecting the genotype and / or polymorphism of the SNP molecular marker of the first aspect of the present invention.

[0073] Preferably, the reagent for detecting the genotype and / or polymorphism of the SNP molecular marker of the first aspect of the present invention comprises the primer set of the second aspect of the present invention.

[0074] Preferably, the at least one reagent used for any one of a1) to a4) includes a reagent for detecting SNP1 and / or a reagent for detecting SNP2, wherein SNP1 is STAT4_rs7574865 with polymorphism G / T, and SNP2 is CFB_rs12614 with polymorphism C / T.

[0075] Preferably, the reagent for detecting SNP1 includes a reagent for detecting the genotype and / or polymorphism of SNP1.

[0076] Preferably, the reagent for detecting SNP2 includes a reagent for detecting the genotype and / or polymorphism of SNP2.

[0077] Preferably, the product is a reagent kit. The beneficial effects of this invention are:

[0078] This invention is the first to discover a SNP molecular marker associated with predicting the response to antiviral therapy for viral hepatitis. The sequence of the SNP molecular marker is shown in SEQ ID NO.1, with the SNP site located at position 183 and a polymorphism of G / T. This molecular marker is significantly associated with the response to antiviral therapy for viral hepatitis and can be used to assess the efficacy of interferon in treating viral hepatitis, determine the sensitivity of viral hepatitis patients to interferon, guide the use of interferon in viral hepatitis patients, and assess the prognosis of viral hepatitis patients using interferon. Attached Figure Description

[0079] Figure 1 This is a flowchart of the SNP screening process in Example 1.

[0080] Figure 2 This is an electrophoresis image of the DNA from the whole blood of five subjects (P1, P2, P3, P4, P5) in Example 2, after primer-specific amplification.

[0081] Figure 3 The following are sequencing results of the DNA from whole blood samples of five subjects (P1, P2, P3, P4, and P5) in Example 2 after primer-specific amplification: A is the sequencing result of the DNA from whole blood sample of P1 after primer-specific amplification; B is the sequencing result of the DNA from whole blood sample of P2 after primer-specific amplification; C is the sequencing result of the DNA from whole blood sample of P3 after primer-specific amplification; D is the sequencing result of the DNA from whole blood sample of P4 after primer-specific amplification; and E is the sequencing result of the DNA from whole blood sample of P5 after primer-specific amplification.

[0082] Figure 4 This is a graph showing the results of the phenotype and genotyping analysis of the PegIFN-α treatment response in Example 2. Detailed Implementation

[0083] The present invention will be further described in detail below with reference to specific embodiments and accompanying drawings.

[0084] It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0085] Unless otherwise specified, experimental methods in the following examples were performed under standard conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. All commonly used chemical reagents used in the examples are commercially available products.

[0086] CD55, also known as decay-accelerating factor (DAF), is a cell surface molecule anchored to glycosylphosphatidylinositol (GPI). CD55 is not only a complement inhibitor but also an immunomodulator.

[0087] Example 1: SNP molecular markers associated with predicting response to antiviral therapy for chronic hepatitis B

[0088] According to such Figure 1 The illustrated process involves screening candidate SNPs from genes encoding complement regulatory proteins. Specifically, the screening process includes: annotating genes encoding complement regulatory proteins using GENCODE, Build 37, and querying the total number of SNPs on these genes using the 1000 Genomes Database. After quality control, a total of 512 SNPs encoding complement regulatory proteins were included (minimum allele frequency > 0.05, deletion rate < 0.05, Hardy-Weinberg equilibrium p-value > 0.05). Next, the focus was on potential functional SNPs that might affect gene expression. The inventors performed quantitative trait loci (eQTL) analysis in whole blood (SNPs with p < 0.01 were considered significant), retaining 103 SNPs. Since some of these 103 SNPs were in high linkage disequilibrium (LD), cluster analysis was used to screen for independent SNPs. Finally, nine independent SNPs were selected for further study.

[0089] For the nine selected SNPs, the association between their alleles and the efficacy of PegIFN-α treatment in CHB patients was assessed in two independent cohorts. The results are shown in Table 1. Among the nine SNPs, only rs28371597 in the CD55 intron region showed a significant association with combined response (CR) rates in both PegIFN-α cohorts (PegIFN-α cohort 1: p = 0.01, OR = 3.72; PegIFN-α cohort 2: p = 8.57 × 10⁻⁶). -3(OR = 2.20). That is, the CR rate of patients carrying allele G is lower than that of patients carrying allele T; the CR rate of carriers of the rs28371597_GG genotype is lower than that of carriers of the rs28371597_GT / TT genotype. Therefore, the SNP molecular marker CD55_rs28371597, which is associated with the prediction of antiviral treatment response in viral hepatitis, was identified. Its nucleotide sequence is: GAGGCCCAGTGAAGAGTT GTTTGGGGGCTAACACAGTAACCGTGTTTGATACTGATACCTAGTAGAATTAAAAGAAATGAAGATTTCTTGTTTTAGGTGAATATACATACAGTCATCCACACCTTATGTGCCCTTTGATTTCATAAAATATATATTGGCATTATCTTGGAGGAAAAAAATCTGTTACTTACATAGCCCTGTATTAGCTTTGAGATATATGAGTAGAGATAAAGATAAAGAGACCCGATAACCTGACTTTGAACAACTTAAATCAATAGAAGCTACTGTAAATACAGAAATTGGCACAAATACCTTTAGAAGCCATGCGTGAAATAGGC (SEQ ID NO.1). The SNP site is located at position 183, and the polymorphism is G / T. GT / TT genotype carriers have a combined response to PegIFN-α treatment, meaning they have good therapeutic efficacy against PegIFN-α; while GG genotype carriers do not have a combined response to PegIFN-α treatment, meaning they have no therapeutic efficacy against PegIFN-α.

[0090] Table 1. Associations between the nine complement regulatory factor-related SNPs and joint response rates in the two PegIFN-α cohorts.

[0091]

[0092] Note: SNP, Single Nucleotide Polymorphism; PegIFN-α, Pegylated Interferon α; MAF, Minor Allele Frequency; OR, Odds Ratio; CI, Confidence Interval. # minor alleles / major alleles.

[0093] Example 2: Application of CD55_rs28371597 as a SNP molecular marker associated with predicting response to antiviral therapy for viral hepatitis.

[0094] 1. DNA was extracted from whole blood of 5 subjects (P1, P2, P3, P4, P5) using QIAamp Blood MiniKit250 and stored at -20℃. The DNA fragments were specifically amplified using primers (rs28371597.F, rs28371597.R). The primer sequences were: rs28371597.F: GAGGCCCAGTGAAGAGTTGT (SEQ ID NO.2); rs28371597.R: GCCTATTTCACGCATGGCTT (SEQ ID NO.3).

[0095] 2. Preparation of PCR reaction solution (Mix) system: Add the components in the order shown in Table 2.

[0096] Table 2 PCR reaction system

[0097] reagents Volume (μL) <![CDATA[H2O]]> 12.4 10×LA Buffer (purchased from TAKARA) 2 dNTPs (2.5mM) (Purchased from TAKARA) 3 LA-Taq (purchased from TAKARA) 0.2 rs28371597.F (20 pmol / mL) 0.2 rs28371597.R (20 pmol / mL) 0.2 DNA (50 ng / μL) was added to each sample separately. 2 Total volume 20

[0098] 3. The PCR reaction procedure is shown in Table 3.

[0099] Table 3 PCR reaction procedure

[0100]

[0101]

[0102] 4. PCR Product Detection: The PCR amplification products were electrophoresed on a 1.5% agarose gel to detect whether they were the target fragment and to confirm their purity. The electrophoresis results of the PCR products showed a single band with no extraneous bands. Figure 2 If no nonspecific amplification occurs and the electrophoretic band position matches the expectation, then it is the target fragment. Based on the primers described above, the target fragment should be 338 bp.

[0103] 5. Purification and sequencing of PCR products: The PCR products were sent to Beijing Liuhe BGI Genomics Co., Ltd. for sequencing. The sequencing results returned by the company included the base sequence and a base sequence diagram of the product, as shown below. Figure 3 As shown.

[0104] 6. The obtained sequences were compared with the standard sequences (NCBI Accession numbers) of the normal CD55 genome using MEGA-11 software to determine whether CD55 contains a heterozygous or homozygous mutation of rs28371597. Electrophoresis results are shown below. Figure 2As shown, lane 1 is DNA marker III (Tiangen Biotech Co., Ltd.), and lanes 2, 3, 4, 5, and 6 are the target bands obtained after primer-specific amplification of patient samples numbered P1, P2, P3, P4, and P5, respectively. The electrophoresis results show that the target bands are located at approximately 200–500 bp, consistent with the predicted target band of 338 bp. The target bands are clear and uniform, with no non-specific bands observed. Furthermore, this method demonstrates high amplification efficiency and reliable results. Sequencing results are as follows... Figure 3 It can be observed that sample P1 is a GT heterozygote, while the other four patient samples are G homozygotes; this is consistent with the patients' actual response to PegIFN-α treatment.

[0105] 7. Analysis of phenotype and genotyping results of PegIFN-α treatment response ( Figure 4 The inventors conducted an association analysis of the phenotype and genotype of PegIFN-α treatment response in 831 CHB patients: 23 out of 62 patients with the GT / TT genotype showed a combined response, and the CR rate was higher than that of patients with the GG genotype (p = 2 × 10⁻⁶). -3 Among 769 patients with the GG genotype, 613 did not show a combined response, meaning that the accuracy of predicting antiviral treatment response in viral hepatitis using CD55_rs28371597 was 76.53%, with a specificity of 94.02%. Therefore, CD55_rs28371597 genotyping before PegIFN-α treatment can be used to predict the therapeutic effect of PegIFN-α on patients, enabling personalized precision treatment.

[0106] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention. SEQUENCE LISTING <110> Southern Medical University Southern Hospital <120> A SNP molecular marker associated with predicting response to antiviral therapy for viral hepatitis and its application <130> <160> 3 <170> PatentIn version 3.5 <210> 1 <211> 338 <212> DNA <213> Homo sapiens <400> 1 gaggcccagt gaagagttgt ttgggggcta acacagtaac cgtgtttgat actgatacct 60 agtagaatta aaagaaatga agatttcttg ttttaggtga atatacatac agtcatccac 120 accttatgtg ccctttgatt tcataaaata tatattggca ttatcttgga ggaaaaaaat 180 ctgttactta catagccctg tattagcttt gagatatatg agtagagata aagataaaga 240 gacccgataa cctgactttg aacaacttaa atcaatagaa gctactgtaa atacagaaat 300 tggcacaaat acctttagaa gccatgcgtg aaataggc 338 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 gaggcccagt gaagagttgt 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 gcctatttca cgcatggctt 20

Claims

1. The use of any one of (1) to (3) in the preparation of a product, wherein the product is used to evaluate the efficacy of PegIFN-α in chronic hepatitis B; (1) Primer set for amplifying SNP molecular markers; (2) A reagent containing the primer set; (3) Reagents for detecting SNP molecular markers; The sequence of the SNP molecular marker is shown in SEQ ID NO.1, with the SNP site located at position 183 and a polymorphism of G / T. GT / TT genotype carriers have a good therapeutic effect on PegIFN-α; GG genotype carriers have no therapeutic effect on PegIFN-α.

2. The application according to claim 1(1) or (2), characterized in that: The primer set includes rs28371597.F and rs28371597.R; the sequence of rs28371597.F is GAGGCCCAGTGAAGAGTTGT; and the sequence of rs28371597.R is GCCTATTTCACGCATGGCTT.

3. The application according to claim 1 (2), characterized in that: The reagent containing the primer set further includes at least one of polymerase, dNTP, PCR buffer, and MgCl2.