One-pot single-stranded dna circularization amplification and crisper / cas-mediated nucleic acid molecule detection method

Abstract

The application discloses a one-pot single-stranded DNA circular amplification and CRISPR / Cas-mediated nucleic acid molecule detection method, and comprises single-stranded DNA probe circularization, rolling circle amplification, double-probe CRISPR / Cas cleavage recognition of single-stranded DNA and single-tube one-pot detection reaction. The application mainly aims at the problem that circularization, amplification and cleavage recognition cannot be simultaneously performed, adopts an OPERATOR technology of simultaneously connecting circularization, amplification and cleavage recognition three-step reactions, and accurately, sensitively and rapidly detects nucleic acid molecules in a single reaction tube system in vitro. Compared with a traditional nucleic acid molecule detection method, the application has the following advantages: being suitable for sensitive and rapid detection of single-stranded DNA, double-stranded DNA and RNA molecules. In particular, when detecting RNA, reverse transcription is not needed; one-pot detection is directly performed, and step-by-step reactions are not needed, so that the application has a wide application prospect in the field of nucleic acid molecule detection.

Description

Technical Field

[0001] This invention belongs to the field of biological nucleic acid molecular detection, specifically involving a one-pot method for single-stranded DNA circularization amplification and CRISPR / Cas-mediated nucleic acid molecular detection. This invention is a novel integrated detection technology for isothermal nucleic acid amplification and target signal readout. It utilizes DNA ligase, strand displacement DNA polymerase, and CRISPR / Cas proteins to rapidly, in one step, and in a single tube complete the amplification and detection reaction of specific DNA or RNA under room temperature conditions. Background Technology

[0002] Deoxyribonucleic acid (DNA) amplification and detection using quantitative real-time polymerase chain reaction (qPCR) is currently the gold standard for molecular diagnostics. For in vitro detection of ribonucleic acid (RNA), it often requires two steps: first, the RNA sample needs to be reverse transcribed into cDNA; then, the cDNA sample is amplified and analyzed using conventional qPCR. Although commercially available reverse transcription quantitative polymerase chain reaction (RT-qPCR) kits exist, their quality varies considerably, with single-test sensitivities ranging from 45% to 60% (Al-Tawfiq & Memish, 2020). Furthermore, RT-qPCR requires expensive thermal cyclers, experienced operators, and high-quality extracted RNA. Additionally, the long testing time (at least 2-4 hours from sample processing to result readout) limits its application in point-of-care testing (POCT).

[0003] In recent years, with the development of isothermal nucleic acid amplification technology, its role in nucleic acid molecular diagnostics has become increasingly prominent. Isothermal amplification technology mainly utilizes the displacement property of amplifying enzymes in a constant temperature environment and the characteristics of polymerases, enabling efficient amplification of specific targets through the spontaneous action of primers. Currently, various isothermal nucleic acid amplification methods have been developed, such as loop-mediated isothermal amplification (LAMP), which uses 4-6 pairs of primers to recognize target-specific sites and utilizes Bst DNA polymerase with displacement enzyme activity at 60-65℃ to achieve efficient (within 1 hour) amplification and detection of nucleic acids. Recombinase polymerase amplification (RPA) technology, under isothermal conditions of 37-42℃, simulates the in vivo nucleic acid replication mechanism. It involves three key enzymes or proteins: recombinase, single-strand binding protein, and DNA polymerase, assisting DNA polymerase amplification. The entire reaction generally yields detectable products within 20-30 minutes. The NASBA (Neural Sequence Amplification Based on RNA) technique consists of reverse transcriptase (RT), T7 RNA polymerase, RNase H, and two oligonucleotide primers. It can rapidly amplify RNA in approximately 60 minutes.

[0004] However, all of the above-mentioned isothermal amplification techniques have their own shortcomings. For example, LAMP amplification requires a large number of primers (4-6), and aerosol contamination during on-site testing can easily lead to false positive results. Amplification of mutation sites is almost unavoidable. RPA amplification involves complex enzyme components, making it unable to detect mutation sites, and a reverse transcription step is still required for RNA samples. Rolling circle amplification (RCA) is an isothermal amplification reaction catalyzed by a strand displacement-active DNA polymerase (Phi29). This method requires only one lock probe to hybridize with the target sequence and ligate it into a circular template. Using universal primers matched with the circular template, the DNA polymerase extends along the circle, continuously displacing the previously generated extended strands, ultimately producing repeating long single-stranded DNA products. It has the advantage of direct and efficient amplification at 30-37℃. However, there is a lack of effective and specific methods for detecting the amplified single-stranded DNA products.

[0005] CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) systems are a type of natural "immune system" widely found in bacteria and archaea. As an adaptive immune mechanism, CRISPR recognizes foreign genetic material and integrates it into its own CRISPR sequence. When the foreign genetic material re-invades, Cas nucleases precisely cleave the foreign nucleic acid. Cas nucleases are important CRISPR-related proteins. Several CRISPR-related proteins have been identified, such as Cas9, Cas12, Cas13, and Cas14. The latter three (Cas12, Cas13, and Cas14) are widely used in nucleic acid diagnostics due to their cis- and trans-cutting activities. In 2019, Wang Jin's research group developed the HOLMES (SYLi et al., 2018) and HOLMESv2 (L.Li et al., 2019) detection systems using Cas12 combined with LAMP isotherms. These systems have a sensitivity of approximately 10⁻⁸ nM. However, the HOLMES method cannot directly detect RNA samples, and due to the temperature difference between amplification and detection, it cannot achieve integrated, single-tube detection. Summary of the Invention

[0006] The purpose of this invention is to overcome the aforementioned deficiencies of existing technologies. This invention provides a one-pot method for single-stranded DNA circularization amplification and CRISPR / Cas-mediated nucleic acid molecule detection, a single-tube, one-pot, ultrasensitive nucleic acid molecule detection technology named OPERATOR. It involves single-stranded DNA probe circularization, rolling circle replication, and CRISPR / Cas12a shearing signal amplification detection. Specifically, it involves a novel detection method combining DNA ligase and substitutional amplification enzyme rolling circle amplification with CRISPR-Cas nuclease shearing, performing the detection reaction simultaneously with amplification. This invention optimizes the reaction buffer system, allowing ligation, amplification, and detection reactions to be performed in the same reaction tube, enabling the detection of RNA, ssDNA, and dsDNA samples in a single tube. This method has advantages such as ultrasensitivity, specificity, and rapid detection speed. For RNA sample detection, the OPERATOR technology eliminates the need for a reverse transcription step, directly amplifying and detecting RNA molecules.

[0007] The present invention achieves the above objectives using the following technical solutions:

[0008] This invention provides a one-pot method for single-stranded DNA circularization amplification and CRISPR / Cas-mediated nucleic acid detection, the nucleic acid detection method comprising the following steps:

[0009] (1) Extracting nucleic acid samples from the test samples;

[0010] (2) Prepare a reaction system mixture comprising: single-stranded DNA probes, dual fluorescently labeled single-stranded DNA probes (cis probe CP, trans probe TP), oligonucleotide primers, DNA ligase or its variants, strand displacement DNA polymerase or its variants, guide RNA (crRNA) or its derivatives, CRISPR-associated Cas protein or its variants, and OPERATOR reaction buffer; wherein the guide RNA or its derivatives contain a sequence identical to the target sequence of the nucleic acid molecule to be detected, and the single-stranded DNA probe is specifically complementary to one strand of the nucleic acid molecule to be detected; and the backbone sequence of the single-stranded DNA refers to, in addition to the complementary target sequence or its derivatives, also including the PAM site sequence and the random ligation sequence;

[0011] (3) Add the nucleic acid sample to the reaction mixture and carry out the reaction at a constant temperature;

[0012] (4) After the fluorescent probe is cut, a detectable fluorescent signal is generated. The generated fluorescent signal is read and recorded to obtain the nucleic acid detection result.

[0013] Single-stranded DNA probes are converted into single-stranded circular DNA probes by DNA ligase; the single-stranded circular DNA probes hybridize with the nucleic acid molecules to be tested and are converted into circular DNA by DNA ligase; oligonucleotide primers use circular DNA as a template, can randomly bind to the circular DNA template, and are continuously extended by strand displacement DNA polymerase to form long-chain DNA containing repeating single-stranded DNA probe sequences.

[0014] Further, in step (1), the nucleic acid molecules to be detected in the nucleic acid sample include one or more of single-stranded DNA, double-stranded DNA, and single-stranded RNA. If the nucleic acid to be detected is dsDNA, the dsDNA is pre-denatured before the reaction.

[0015] Further, in step (2), the single-stranded DNA probe includes a 5' end, a 3' end, and a backbone sequence. The 5' end and 3' end are complementary to the sequence of the nucleic acid molecule to be detected, respectively; the backbone sequence refers to the sequence or its derivative excluding the complementary target portion, including PAM site sequences and random linkage sequences. The random linkage sequence is generally 40-80 bp in length and has a GC content of 30%-70%. The single-stranded DNA probe introduces a "TTT" PAM site at the 3' end of the sequence. This site is used for recognizing the target sequence, circularization, and as a template for amplification, ensuring that the amplified product is not constrained by PAM.

[0016] Further, in step (2), the oligonucleotide primer is a base-modified random primer (6-10 nt) or a primer (10-20 nt) consistent with the sequence of the nucleic acid molecule to be detected. The number of modified bases is 1-10. The random primer is a random hexamer primer. A random hexamer primer is a random sequence primer containing 6 bases.

[0017] Further, in step (2), the sequence of the dual fluorescently labeled single-stranded DNA probe is complementary to the sequence of the nucleic acid molecule to be tested. The 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group. The fluorescent group at the 5' end of the probe includes one of FAM, HEX, VIC, Cy5, Cy3, ROX, FITC, and Joe, and the fluorescent quenching group at the 3' end includes one of TAMRA, BHQ1, MGB, and BHQ2.

[0018] Further, in step (2), the DNA ligase is a ligase that ligates single-stranded DNA gaps in double-stranded DNA molecules or RNA / DNA hybrid double strands. The DNA ligase includes one of T4 DNA ligase, E. coli DNA ligase, SplintR ligase, and HiFi Taq DNA ligase. This enzyme may include wild-type, modified, codon-optimized, evolved, thermophilic, chimeric, engineered, and / or mixtures of one or more DNA ligases. The preferred DNA ligase is T4 DNA ligase. The DNA ligase can specifically ligate phosphodiester bonds of ssDNA complementary to the target.

[0019] Further, in step (2), the strand substitution DNA polymerase includes one of Phi29, Klenow, and Vent. The DNA polymerase is preferably Phi29 DNA polymerase. This enzyme may include wild-type, modified, codon-optimized, evolved, thermophilic, chimeric, engineered, and / or a mixture of one or more reverse transcriptases. The DNA polymerase is capable of recognizing and generating ssDNA in a strand substitution amplification reaction triggered by random primers.

[0020] Further, in step (2), the CRISPR-related Cas protein is a CRISPR-Cas nuclease with double-stranded or single-stranded DNA recognition and cleavage functions and trans DNA single-strand cleavage functions. The CRISPR-Cas nuclease includes one or a variant of SpyCas9, FnCas9, FnCas12a, LbCas12, BhCas12b, Bs3Cas12b, LsCas12b, SbCas12b, AaCas12b, AkCas12, AmCas12b, BsCas12b, DiCas12b, TcCas12b, AacCas12b, LwCas13, and Cas14. The enzyme may include wild-type, modified, codon-optimized, evolved, thermophilic, chimeric, engineered, and / or mixtures of more than one Cas protein. The preferred CRISPR-Cas nuclease is Cas12a. CRISPR-Cas nuclease-binding guide RNA can be specifically activated by the target nucleic acid sequence, thereby acquiring non-specific DNA nuclease activity and enabling the cleavage of DNA fluorescent probes.

[0021] Furthermore, the spacer sequence of the guide RNA or its derivative described in step (2) is complementary to the target nucleic acid molecule sequence.

[0022] Further, in step (2), the OPERATOR reaction buffer comprises 1-5 mM dNTP, 10-100 mM Tris-HCl, 5-25 mM MgCl2, 0.01-20 mM ATP, 0.5-10 mM DTT and 0.5-1.5 mg / ml bovine serum albumin, and the pH of the buffer is between 6.5 and 8.0.

[0023] The circularized key probe initiates a highly efficient strand displacement amplification reaction triggered by random primers. These random primers are 6 nt long DNA random primers, used at a final concentration of no less than 10 μM. The random primers can trigger highly efficient rolling circle amplification, with efficiency far exceeding that of traditional single-primer-triggered amplification.

[0024] Further, in step (3), the isothermal reaction temperature is 37°C and the reaction time is 1 hour. The single-stranded DNA probe forms a single-stranded circular DNA probe under the action of DNA ligase; during the isothermal reaction, the single-stranded circular DNA probe hybridizes with the nucleic acid molecule to be tested, and is converted into circular DNA under the action of DNA ligase; the oligonucleotide primer uses the circular DNA as a template, and can randomly bind to the circular DNA template, and continuously extend under the action of strand displacement DNA polymerase to form a long-chain DNA containing a repeating single-stranded DNA probe sequence; the long-chain DNA binds to the dual-fluorescently labeled single-stranded DNA probe to form complementary double-stranded DNA; the formed double-stranded DNA is recognized by the crRNA and Cas protein complex, and the dual-fluorescently labeled single-stranded DNA probe is cleaved, generating a detectable fluorescent signal.

[0025] A second objective of this invention is to provide an isothermal nucleic acid detection kit based on the aforementioned nucleic acid molecule detection method. This kit enables accurate, rapid, and highly sensitive detection of specific RNA or DNA molecules under isothermal conditions.

[0026] Preferably, the kit includes an enzyme mixture, a single-stranded DNA probe, a guide RNA, a dual-fluorescent labeled single-stranded DNA probe, oligonucleotide primers, and an OPERATOR reaction buffer; the enzyme mixture includes CRISPR-Cas nuclease, DNA ligase, and strand displacement DNA polymerase.

[0027] Further, the CRISPR-Cas nuclease is FnCas12a. The key probe (single-stranded DNA probe) consists of a sequence complementary to the target sequence and a circular backbone sequence, with a "TTT" PAM site introduced at the 3' end of the key probe sequence; the oligonucleotide primer is a random hexamer primer; the DNA ligase is T4 DNA ligase; the DNA polymerase is Phi29 DNA polymerase; and the DNA fluorescent probe is single-stranded DNA labeled with a fluorescent group at the 5' end and a fluorescence quencher group at the 3' end.

[0028] In one specific embodiment, the buffer comprises 1-5 mM dNTPs, 10-100 mM Tris-HCl, 5-25 mM MgCl2, 0.01-20 mM ATP, 0.5-10 mM DTT, and 0.1-1.5 mg / ml bovine serum albumin, wherein the pH of the buffer is between 6.5 and 8.0. Random primers 6Ns (10 μM-100 μM); FAM-labeled fluorescent probes 1-4 nM; enzyme mixture (T4 DNA ligase, 5 U-200 U; Phi29 DNA polymerase, 5 U-20 U; Cas12a protein, 0.1 μg-5 μg).

[0029] In the kit of this invention, target DNA, guide RNA and Cas12a protein form a complex that cleaves other single-stranded DNA molecules in the system.

[0030] The detection method and kit of the present invention can detect nucleic acid molecules of bacteria, fungi, humans or other animal and plant tissues.

[0031] The present invention also provides a reaction system comprising: a single-stranded DNA probe, a dual-fluorescently labeled single-stranded DNA probe, oligonucleotide primers, a DNA ligase and its variants, a strand displacement DNA polymerase and its variants, clustered regularly spaced short palindromic repeat (crRNA) or derivatives thereof, a CRISPR-associated (Cas) protein or a variant thereof, and an OPERATOR reaction buffer. The crRNA or its derivative contains a target sequence identical to that of the nucleic acid molecule to be detected.

[0032] This invention enables rapid detection of DNA or RNA molecules under isothermal conditions. First, RNA, single-stranded DNA, or double-stranded DNA of the sample to be tested is obtained through nucleic acid extraction. Then, a combination enzyme of ligase, amplification enzyme, and CRISPR-related protein, a single-stranded DNA probe, and a nucleic acid fluorescent probe are used to react with the nucleic acid to be tested at an isothermal temperature. Finally, the presence of the target nucleic acid in the sample is determined by detecting the fluorescence signal.

[0033] Compared with the prior art, the present invention has the following beneficial effects:

[0034] (1) High sensitivity: The present invention can detect nucleic acid molecules (ssDNA, dsDNA and RNA) at the single copy level.

[0035] (2) Versatility: This invention can be used to detect DNA or RNA;

[0036] (3) Multi-channel: It can realize multi-channel detection and detect multiple samples at one time;

[0037] (4) Fast: The present invention can complete the detection in as little as 30 minutes;

[0038] (5) Convenience: This invention realizes the isothermal reaction of a single tube and a single buffer solution, which is convenient to operate and simple in steps;

[0039] (6) Low false positive rate: Although the reaction system of this invention includes an amplification step, the detection and amplification products are RNA and DNA, respectively. The single-stranded DNA probe can only be circularized and thus initiate the amplification reaction when the RNA target is present, overcoming the characteristics of easy contamination in LAMP, quantitative real-time PCR, etc. At the same time, this method is a closed-tube reaction, which physically isolates the sample and minimizes the possibility of contamination.

[0040] (7) Room temperature isothermal detection: Three engineered enzymes and chemical components work together to create an environment that simulates the amplification of nucleic acids in the body to the greatest extent. Each engineered enzyme performs its own function and works at its optimal reaction temperature, thus achieving the highest working efficiency.

[0041] (8) One-step method: Three reaction compatible buffers were constructed. The single-stranded DNA probe circularization, amplification, and Cas12a shearing detection reactions were carried out in the same reaction tube. The sample detection was completed by adding the sample at once, so the operation was simpler. Attached Figure Description

[0042] Other features, objects, and advantages of the present invention will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings:

[0043] Figure 1 This is a schematic diagram of the sample detection process of the present invention.

[0044] Figure 2 This is a schematic diagram of the process for detecting ssDNA or RNA samples according to the present invention.

[0045] Figure 3 This is a schematic diagram of the DNA sample detection process of the present invention.

[0046] Figure 4 This invention relates to the detection of RNA, dsDNA, and ssDNA molecules.

[0047] Figure 5 This invention provides the detection sensitivity for single-stranded RNA samples.

[0048] Figure 6 This invention is used to detect the N gene of the novel coronavirus.

[0049] Figure 7 This is a comparison diagram of the step-by-step detection method and the one-pot method of the present invention. Detailed Implementation

[0050] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments. The following examples are implemented under the premise of the technical solution of the present invention, providing detailed implementation methods and specific operating procedures, which will help those skilled in the art to further understand the present invention. It should be noted that the scope of protection of the present invention is not limited to the following embodiments; any adjustments and improvements made under the concept of the present invention are all within the scope of protection of the present invention.

[0051] This invention is a one-pot method for single-stranded DNA circularization amplification and CRISPR / Cas-mediated nucleic acid molecular detection, the procedure of which is as follows: Figure 1 As shown.

[0052] The primer and probe sequences used in the examples are listed below:

[0053]

[0054] Example 1: Detection of dsDNA targets using the present invention

[0055] dsDNA (Target 1) was selected as the target sequence. The Target 1 sequence is shown in SEQ ID NO.1, and is as follows:

[0056] GGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACCTTCTTTTTACGTTTACTCTCGTGTTAAAAATCTGAATTCTTCTAGAGTTCCTGATCTTCTGGTCTA

[0057] Preparation of guide RNA: A long, inverse complementary primer crRNA-target-R containing the T7 sequence was synthesized as shown in SEQ ID NO. 2.

[0058] The T7 forward primer crRNA-F, as shown in SEQ ID NO.3, is: GAAATTAATACGACTCACTATAGGG. Incomplete double-stranded DNA is prepared by annealing with the two primers. After preparation, store at -20°C or -80°C.

[0059] The single-stranded DNA probe sequence of Target 1 is PL target 1, 2, 3 as shown in SEQ ID NO.4, which is: AAGGTTTTACActttccgtctttatagtctgtcgtattaatttctctttAACGTAAAAAG

[0060] like Figure 3As shown, the amplification and detection reaction was performed as follows: First, 100 nM single-stranded DNA probe and the double-stranded DNA to be tested were annealed at high temperature (85-95℃) for 5 minutes, and then allowed to cool naturally before being added to the reaction system. The reaction system included a 1× buffer containing 4 mM dNTP, 40 mM Tris-HCl, 10 mM MgCl2, 0.5 mM ATP, 10 mM DTT, and 0.5 mg / ml bovine serum albumin. The pH of the buffer was 7.5. Random primers 6Ns (NpNpNpNpNpsNs) (10 μM); guide RNA 100 nM; FAM dual fluorescently labeled probe 200 nM; and an enzyme mixture (T4 DNA ligase, 5 U; Phi29 DNA polymerase, 10 U; Cas12a protein, 250 nM).

[0061] Fluorescence detection: After the reaction mixture was mixed, the temperature was set to 37 degrees in a 7900HT Fast Real-Time RCR system. The fluorescence detection probe was FAM, and the TP sequence was shown in SEQ ID NO.9: TTATTATT. The CP sequence was shown in SEQ ID NO.10: TTTAACGTAAAAAGAAGGTTTTACACTT.

[0062] The fluorescence signal acquisition time interval was 1 minute, and the detection time was 1 hour.

[0063] The specific reaction process is as follows: The above single-stranded DNA probe and the double-stranded DNA to be tested are annealed at high temperature (85-95℃) for 5 minutes, and then naturally cooled and added to the integrated system of amplification and reaction. The reaction is carried out at 37℃ for 1 hour. Simultaneously, a 7900HT Fast Real-Time RCR system is used to detect the fluorescence signal. The fluorescence signal acquisition time interval is 1 minute and the detection time is 1 hour.

[0064] Result: As Figure 4 As shown, this method can be used to detect double-stranded DNA.

[0065] Example 2: Detection of ssDNA targets using the present invention

[0066] ssDNA (Target 2) was selected as the target sequence. The Target 2 sequence is as shown in SEQ ID NO.5: TATTGTTAACGTGAGTCTTGTAAAACCTTCTTTTTACGTTTACTCTCGTGTTAAAAAT.

[0067] The method for preparing the target single-stranded DNA is as follows: synthesize primer (Target 2) as shown in SEQ ID NO.5, which is: TATTGTTAACGTGAGTCTTGTAAAACCTTCTTTTTACGTTTACTCTCGTGTTAAAAAT, and dissolve it in water to dilute to 10uM.

[0068] Preparation of guide RNA: A long, inverse complementary primer crRNA-target-R containing the T7 sequence was synthesized as shown in SEQ ID NO. 2.

[0069] For:TGTAAAACCTTTCTTTTTACGTTATCTACAACAGTAGAAATTAC CCTATAGTGAGTCGTATTA The forward primer crRNA-F for ATTTC,T7, as shown in SEQ ID NO.3, is: GAAATTAATACGACTCACTATAGGG. Incomplete double-stranded DNA is prepared by annealing with the double primers. After preparation, store at -20°C or -80°C.

[0070] The single-stranded DNA probe sequence for Target 2 is PL target 1, 2, 3, as shown in SEQ ID NO.4: AAGGTTTTACActttccgtctttatagtctgtcgtattaatttctctttAACGTAAAAAG

[0071] like Figure 2 As shown, the amplification and detection reaction is as follows: The ssDNA to be tested is added to the reaction system, which includes: a 1× buffer containing 4 mM dNTPs, 40 mM Tris-HCl, 10 mM MgCl2, 0.5 mM ATP, 10 mM DTT, and 0.5 mg / ml bovine serum albumin (pH 7.5); a 100 nM single-stranded DNA probe; random primers 6Ns (NpNpNpNpNpsNs) (10 μM); guide RNA 100 nM; FAM dual-fluorescent labeled probe 200 nM; and an enzyme mixture (T4 DNA ligase, 5 U; Phi29 DNA polymerase, 10 U; Cas12a protein, 250 nM).

[0072] Fluorescence detection: After the reaction was mixed, the temperature was set to 37 degrees in the 7900HT Fast Real-Time RCR system, and the fluorescence detection probe was FAM, as shown in the table. The fluorescence signal acquisition time interval was 1 minute, and the detection time was 1 hour.

[0073] Result: As Figure 4 As shown, this method can be used to detect single-stranded DNA.

[0074] Example 3: Detection of RNA targets using the present invention

[0075] RNA (Target 3) was selected as the target sequence. The Target 3 sequence is as shown in SEQ ID NO.6: GGAAGAGACAGGUACGUUAAUAGUUAAUAGCGUACUUCUUUUUCUUGCUUUCGUGGUAUUCUUGCUAGUUACACUAGCCAUCCUUACUGCGCUUCGAUUGUGUGCGUACUGCUGCAAUAUUGUUAACGUGAGUCUUGUAAAACCUUCUUUUUACGUUUACUCUCGUGUUAAAAAUCUGAAUUCUUCUAGAGUUCCUGAUCUUCUGGUCUA;

[0076] Preparation of guide RNA: A long, inverse complementary primer crRNA-target-R containing the T7 sequence was synthesized as shown in SEQ ID NO. 2.

[0077] The DNA is: TGTAAAACCTTCTTTTTACGTTATCTACAACAGTAGAAATTACCCTATAGTGAGTCGTATTAATTTC. The forward primer for T7, crRNA-F, is shown in SEQ ID NO.3: GAAATTAATACGACTCACTATAGGG. Incomplete double-stranded DNA is prepared by annealing with two primers. After preparation, store at -20°C or -80°C.

[0078] The single-stranded DNA probe sequence of Target 3 is shown in SEQ ID NO.4, and is as follows:

[0079] AAGGTTTTACActttccgtctttatagtctgtcgtattaatttctctttAACGTAAAAAG;

[0080] Amplification and detection reaction: The RNA to be tested was added to the reaction system, which included: a 1× buffer containing 4 mM dNTPs, 40 mM Tris-HCl, 10 mM MgCl2, 0.5 mM ATP, 10 mM DTT, and 0.5 mg / ml bovine serum albumin (pH 7.5); a 100 nM single-stranded DNA probe; random primers 6Ns (NpNpNpNpNpsNs) (10 μM); guide RNA 100 nM; FAM dual fluorescently labeled probe 200 nM; and an enzyme mixture (T4 DNA ligase, 5 U; Phi29 DNA polymerase, 10 U; Cas12a protein, 250 nM).

[0081] Fluorescence detection: After the reaction was mixed, the temperature was set to 37 degrees in the 7900 HT Fast Real-Time RCR system, and the fluorescence detection probe was FAM, as shown in the table. The fluorescence signal acquisition time interval was 1 minute, and the detection time was 1 hour.

[0082] The specific reaction process is as follows: The above single-stranded DNA probe and the RNA to be tested are added to the integrated system for amplification and reaction, and the reaction is carried out at 37°C for 1 hour. Simultaneously, a 7900 HT Fast Real-Time RCR system is used to detect the fluorescence signal. The fluorescence signal acquisition time interval is 1 minute, and the detection time is 1 hour.

[0083] Result: As Figure 4 As shown, this method can be used to detect single-stranded RNA; Figure 5 As shown, this method can detect single-stranded RNA molecules as low as 1.625 copies / µL.

[0084] Example 4: Using the present invention to detect the novel coronavirus

[0085] The novel coronavirus is an RNA virus. Total RNA is extracted from the nasopharyngeal sample to be tested, and the extracted total RNA is used as the RNA to be tested.

[0086] The SARS-CoV-2 N gene sequence was selected as the target sequence. The conserved region sequence of SARS-CoV-2 N is shown in SEQ ID NO.7, which is: AAUGGCUGGCAAUGGCGGUGAU.

[0087] The key probe sequence of the SARS-CoV-2 N gene sequence was selected as shown in SEQ ID NO.8, PL-N:TGCCAGCCATTctttccgtctttatagtctgtcgtattaatttctctttATCACCGCCAT.

[0088] Preparation of guide RNA: Synthesize the reverse complementary long primer crRNA-NR containing the T7 sequence as shown in SEQ ID NO. 9:

[0089] The forward primer crRNA-F for T7 is shown in SEQ ID NO. 3: (ATCACCGCCATTGCCAGCCATTATCTACAACAGTAGAAATTACCCTATAGTGAGTCGTATTAATTTC)

[0090] GAAATTAATACGACTCACTATAGGG, incomplete double-stranded DNA was prepared by annealing with two primers. After preparation, it was stored at -20°C or -80°C.

[0091] Amplification and detection reaction: The RNA to be tested is added to the reaction system, which includes a buffer solution containing 1-5 mM dNTPs, 10-100 mM Tris-HCl, 5-25 mM MgCl2, 0.01-20 mM ATP, 0.5-10 mM DTT, and 0.1-1.5 mg / ml bovine serum albumin. The pH of the buffer solution is between 6.5 and 8.0. Random primer 6N is used. s (10μM-100μM); Single-stranded DNA probe (100nM-400nM); Guide RNA (100nM-400nM); FAM dual fluorescently labeled probe 1-4nM; Enzyme mixture (T4 DNA ligase, 5U-200U; Phi29 DNA polymerase, 5U-20U; Cas12a protein, 0.1ug-5ug).

[0092] Fluorescence detection: After the reaction was mixed, the temperature was set to 37 degrees in the 7900 HT Fast Real-Time RCR system, and the fluorescence detection probe was FAM, as shown in the table. The fluorescence signal acquisition time interval was 1 minute, and the detection time was 1 hour.

[0093] The specific reaction process is as follows: The above single-stranded DNA probe and the RNA to be tested are added to the integrated system for amplification and reaction, and the reaction is carried out at 37°C for 1 hour. Simultaneously, a 7900 HT Fast Real-Time RCR system is used to detect the fluorescence signal. The fluorescence signal acquisition time interval is 1 minute, and the detection time is 1 hour.

[0094] Result: As Figure 6 As shown, this invention can be used for the detection of the novel coronavirus.

[0095] Comparative Example 1

[0096] The one-pot single-stranded DNA circularization amplification and CRISPR / Cas-mediated nucleic acid detection method in Comparative Example 1 are basically the same as those in the examples, except that: the single-stranded DNA circularization buffer 1 (B1) used in the steps is: 40mM Tris-HCl, 10mM MgCl2, 10mM DTT, 0.5mM ATP, pH 7.8 at 25℃; the Phi29 amplification buffer 2 (B2) is: 50mM Tris-HCl, 10mM MgCl2, 10mM (NH4)2SO4, 4mM DTT, pH 7.5 at 25℃; and the CRISPR / Cas-mediated nucleic acid detection buffer 3 (B3) is: 50mM NaCl, 10mM Tris-HCl, 10mM MgCl2, 100μg / ml bovine serum albumin, pH 7.5 at 25℃. 7.9@25℃The optimized one-pot reaction buffer (B) was prepared as follows: 4 mM dNTPs, 40 mM Tris-HCl, 10 mM MgCl2, 0.5 mM ATP, 10 mM DTT, and 0.5 mg / ml bovine serum albumin (pH 7.5). To verify the optimization effect, the above RNA (Target 3) was selected as the target sequence for comparison with B1, B2, B3, and the one-pot reaction B. The Target 3 sequence is shown in SEQ ID NO. 7.

[0097] GGAAGAGACAGGUACGUUAAUAGUUAAUAGCGUACUUUUUCUUGCUUUCGUGGUAUUCUUGCUAGUUACACUAGCCAUCCUUACUGCGCUUCGAUUGUGUGCGUACUGCUGCAAUAUUGUUAACGUGAGUCUUGUAAAACCUUCUUUUACGUUACUCUCGUGUUAAAAAUCUGAAUUCUUAGAGUUCCUGAUCUUCUGCUA;

[0098] Preparation of guide RNA: The reverse complementary long primer crRNA-target-R containing the T7 sequence was synthesized as shown in SEQ ID NO. 2: TGTAAAACCTTCTTTTTACGTTATCTACAACAGTAGAAATTACCCTATAGTGAGTCGTATTAATTTC; the forward primer crRNA-F containing the T7 sequence was synthesized as shown in SEQ ID NO. 3.

[0099] GAAATTAATACGACTCACTATAGGG, incomplete double-stranded DNA was prepared by annealing with two primers. After preparation, it was stored at -20°C or -80°C.

[0100] The single-stranded DNA probe sequence of Target 3 is shown in SEQ ID NO.4, and is as follows:

[0101] AAGGTTTTACActttccgtctttatagtctgtcgtattaatttctctttAACGTAAAAAG

[0102] One-pot detection reaction: The RNA to be tested is added to the reaction system. The one-pot B1 reaction system includes a 1× buffer containing 4 mM dNTPs, 40 mM Tris-HCl, 10 mM MgCl2, 10 mM DTT, and 0.5 mM ATP, with a pH of 7.8. The one-pot B2 reaction system includes a 1× buffer containing 4 mM dNTPs, 50 mM Tris-HCl, 10 mM MgCl2, 10 mM (NH4)2SO4, 4 mM DTT, and 0.5 mM ATP, with a pH of 7.5. The one-pot B3 reaction system includes a 1× buffer containing 4 mM dNTPs, 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, and 0.5 mM ATP, with a pH of 7.9. The optimized one-pot reaction system Buffer (B) includes a 1× buffer containing 4 mM dNTPs, 40 mM Tris-HCl, 10 mM MgCl2, 0.5 mM ATP, 10 mM DTT, and 0.5 mg / ml bovine serum albumin. The pH of the buffer is 7.5. Additionally, each system includes: random primers 6Ns (NpNpNpNpNpsNs) (10 μM); a 200 nM FAM-labeled fluorescent probe (as shown in the table); and an enzyme mixture (T4 DNA ligase, 5 U; Phi29 DNA polymerase, 10 U; Cas12a protein, 250 nM). After mixing, the reaction systems were tested in a 7900 HT Fast Real-Time RCR system at 37°C, with the FAM fluorescent probe, a fluorescence signal acquisition interval of 1 min, and a detection time of 1.5 hours.

[0103] The specific reaction process is as follows: The above single-stranded DNA probe and the RNA to be tested are added to the integrated system for amplification and reaction, and the reaction is carried out at 37°C for 1.5 hours. Simultaneously, a 7900 HT Fast Real-Time RCR system is used to detect the fluorescence signal. The fluorescence signal acquisition time interval is 1 minute, and the detection time is 1.5 hours.

[0104] Comparative analysis results: such as Figure 7 As shown, this comparative analysis method enables one-pot detection of single-stranded RNA, and the optimized one-pot detection buffer is superior to B1, B2, and B3. The one-pot detection time can be reduced to 30 minutes.

[0105] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art can make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

[0106]

[0107]

[0108] sequence list <110> Shanghai Jiao Tong University <120> One-pot single-stranded DNA circularization amplification and CRISPR / Cas-mediated nucleic acid molecular detection methods <130> KAG48719 <160> 11 <170> SIPOSequenceListing 1.0 <210> 1 <211> 210 <212> DNA <213> Artificial Sequence <400> 1 ggaagagaca ggtacgttaa tagttaatag cgtacttctt tttcttgctt tcgtggtatt 60 cttgctagtt acactagcca tccttactgc gcttcgattg tgtgcgtact gctgcaatat 120 tgttaacgtg agtcttgtaa aaccttcttt ttacgtttac tctcgtgtta aaaatctgaa 180 ttcttctaga gttcctgatc ttctggtcta 210 <210> 2 <211> 67 <212> DNA <213> Artificial Sequence <400> 2 tgtaaaacct tctttttacg ttatctacaa cagtagaaat taccctatag tgagtcgtat 60 taatttc 67 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <400> 3 gaaattaata cgactcacta taggg 25 <210> 4 <211> 60 <212> DNA <213> Artificial Sequence <400> 4 aaggttttac actttccgtc tttatagtct gtcgtattaa tttctcttta acgtaaaaag 60 <210> 5 <211> 58 <212> DNA <213> Artificial Sequence <400> 5 tattgttaac gtgagtcttg taaaaccttc tttttacgtt tactctcgtg ttaaaaat 58 <210> 6 <211> 210 <212> RNA <213> Artificial Sequence <400> 6 ggaagagaca gguacguuaa uaguuaauag cguacuucuu uuucuugcuu ucgugguauu 60 cuugcuaguu acacuagcca uccuuacugc gcuucgauug ugugcguacu gcugcaauau 120 uguuaacgug agucuuguaa aaccuucuuu uuacguuuac ucucgugua aaaaucugaa 180 uucuucuaga guuccugauc uucugucua 210 <210> 7 <211> twenty two <212> RNA <213> Artificial Sequence <400> 7 aauggcuggc aauggcggug au 22 <210> 8 <211> 60 <212> DNA <213> Artificial Sequence <400> 8 tgccagccat tctttccgtc tttatagtct gtcgtattaa tttctcttta tcaccgccat 60 <210> 9 <211> 67 <212> DNA <213> Artificial Sequence <400> 9 atcaccgcca ttgccagcca ttatctacaa cagtagaaat taccctatag tgagtcgtat 60 taatttc 67 <210> 10 <211> 8 <212> DNA <213> Artificial Sequence <400> 10 ttattatt 8 <210> 11 <211> 28 <212> DNA <213> Artificial Sequence <400> 11 tttaacgtaaaaagaaggttttacactt 28

Claims

1. A one-pot method for single-stranded DNA circularization amplification and CRISPR / Cas-mediated nucleic acid molecular detection, characterized in that, The nucleic acid molecular detection method includes the following steps: (1) Extracting nucleic acid samples from the test samples; (2) Prepare a reaction system mixture, the mixture comprising: a single-stranded DNA probe, a dual fluorescently labeled single-stranded DNA probe, an oligonucleotide primer, a DNA ligase or a variant thereof, a strand displacement DNA polymerase or a variant thereof, a guide RNA or a derivative thereof, a CRISPR-associated Cas protein or a variant thereof, and an OPERATOR reaction buffer; wherein the guide RNA or its derivative comprises a sequence identical to the target sequence of the nucleic acid molecule to be detected, and the single-stranded DNA probe comprises a 5' end, a 3' end, and a backbone sequence; (3) Add the nucleic acid sample to the reaction mixture and carry out the reaction at a constant temperature; (4) After the fluorescent probe is sheared, it generates a detectable fluorescent signal. The generated fluorescent signal is read and recorded to obtain the nucleic acid detection result; The nucleic acid molecules to be detected in the nucleic acid sample described in step (1) include one or more of single-stranded DNA, double-stranded DNA, and single-stranded RNA; The 5' and 3' ends of the single-stranded DNA probe described in step (2) are complementary to the sequence of the nucleic acid molecule to be tested, respectively. The backbone sequence of the single-stranded DNA refers to the PAM site sequence and the random linking sequence in addition to the sequence of the complementary target part or its derivatives. The oligonucleotide primers mentioned in step (2) are base-modified random primers or primers that are consistent with the sequence of the nucleic acid molecule to be detected; The OPERATOR reaction buffer in step (2) comprises 1-5 mM dNTP, 10-100 mM Tris-HCl, 5-25 mM MgCl2, 0.01-20 mM ATP, 0.5-10 mM DTT and 0.5-1.5 mg / ml bovine serum albumin, and the pH of the buffer is between 6.5 and 8.0; The spacer sequence of the guide RNA or its derivative described in step (2) is complementary to the target nucleic acid molecule sequence.

2. The nucleic acid molecular detection method according to claim 1, characterized in that, The sequence of the dual fluorescently labeled single-stranded DNA probe is complementary to the sequence of the nucleic acid molecule to be detected. The 5' and 3' ends of the probe are labeled with fluorescent groups. The fluorescent group at the 5' end of the probe includes one of FAM, HEX, VIC, Cy5, Cy3, ROX, FITC, and Joe. The fluorescent quenching group at the 3' end includes one of TAMRA, BHQ1, MGB, and BHQ2.

3. The nucleic acid molecular detection method according to claim 1, characterized in that, The DNA ligase mentioned in step (2) is a ligase that connects single-stranded DNA gaps in double-stranded DNA molecules or RNA / DNA hybrid double strands; the DNA ligase includes one of T4 DNA ligase, E. coli DNA ligase, SplintR ligase, and HiFi Taq DNA ligase; the strand displacement DNA polymerase includes one of Phi29, Klenow, and Vent.

4. The nucleic acid molecular detection method according to claim 1, characterized in that, The CRISPR-related Cas protein mentioned in step (2) is a CRISPR-Cas nuclease with double-stranded DNA or single-stranded DNA recognition and cleavage function and trans DNA single-strand cleavage function; the CRISPR-Cas nuclease includes one of SpyCas9, FnCas9, FnCas12a, LbCas12, BhCas12b, Bs3Cas12b, LsCas12b, SbCas12b, AaCas12b, AkCas12, AmCas12b, BsCas12b, DiCas12b, TcCas12b, AacCas12b, LwCas13, Cas14 or a variant thereof.

5. An isothermal nucleic acid detection kit based on the nucleic acid molecular detection method of claim 1, characterized in that, The kit comprises the single-stranded DNA probe, guide RNA, dual-fluorescent labeled single-stranded DNA probe, oligonucleotide primers, and OPERATOR reaction buffer as described in claim 1, as well as an enzyme mixture; the enzyme mixture comprises CRISPR-Cas nuclease, DNA ligase, and strand displacement DNA polymerase; the OPERATOR reaction buffer comprises 1-5 mM dNTP, 10-100 mM Tris-HCl, 5-25 mM MgCl2, 0.01-20 mM ATP, 0.5-10 mM DTT, and 0.5-1.5 mg / ml bovine serum albumin, and the pH of the buffer is between 6.5 and 8.0.

Images