Synthetic guide RNAs, compositions thereof, methods and uses

CN114981426BActive Publication Date: 2026-08-21BEAM THERAPEUTICS INC
View PDF 12 Cites 0 Cited by

Patent Information

Application Number
CN202080091197.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2020-05-28
Filing Date
2020-12-03
Publication Date
2026-08-21
Estimated Expiration
2040-12-03

AI Technical Summary

Technical Problem

这些长度明显大于目前市场上基于寡核苷酸的治疗剂中使用的长度(siRNA和反义寡核苷酸(ASO)的长度通常为20-50个核苷酸并且因此更易于纯化);ii)对于这些长度尺度的RNA,标准纯化方法(例如,色谱法、电泳法)目前无法完全去除由不完全偶联(截短产物)、不完全去保护和随机插入核苷酸(加成产物)形成的副产物;以及iii)与全长产物具有相似序列同源性的与全长产物分离的副产物会降低核糖核蛋白复合物的活性并可能导致脱靶编辑

Benefits of technology

[0165]治疗:如本文所用,术语“治疗(treatment)”(还有“治疗(treat/treating)”是指施用治疗性分子(例如,本文所述的CRISPR-Cas治疗性蛋白或系统),所述治疗性分子部分或完全减轻、改善、缓解、抑制疾病、病症和/或病状的一种或多种症状或特征,延迟疾病、病症和/或病状的一种或多种症状或特征的发作,降低疾病、病症和/或病状的一种或多种症状或特征的严重程度和/或降低疾病、病症和/或病状的一种或多种症状或特征的发病率。此治疗可以是针对未出现相关疾病、病症和/或病状的病征的受试者和/或针对出现疾病、病症和/或病状的早期病征的受试者。可替代地或另外,此治疗可以是针对出现相关疾病、病症和/或病状的一种或多种确定病征的受试者。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114981426B_ABST
    Figure CN114981426B_ABST
Patent Text Reader

Abstract

The present disclosure provides, among other things, a method of generating a synthetic RNA using a self-templating method. For example, in some embodiments, generating a synthetic gRNA comprises: contacting a first RNA with a second RNA, wherein the first RNA and the second RNA comprise at least five complementary RNA nucleotides, and wherein the contacting forms a stem structure or a stem loop structure; and ligating, with a ligase, (i) within the stem structure or (ii) at an end of the stem structure, the first RNA and the second RNA, thereby forming a loop at the end of the stem structure.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Cross-reference to related applications

[0002] This application claims the benefit and priority of US62 / 943,158, filed December 3, 2019, and US63 / 031,262, filed May 28, 2020, the contents of each of which are incorporated herein by reference. Background Technology

[0003] Guide RNA molecules (gRNAs), associated with Cas endonucleases and related enzymes including base editors, are used for gene editing. A common form of gRNA used for therapeutic applications is a single, non-natural RNA of approximately 100 nucleotides, which forms a ribonucleoprotein with Cas9. Plasmid DNA synthesized using phosphoramide chemistry and solid-phase synthesis are typical methods for obtaining therapeutic sgRNAs. Using synthetic RNA is advantageous because it allows for incorporation that both increases the chemical stability of the sgRNA and reduces modifications that could edit genomic DNA at undesirable sites (off-target effects).

[0004] Problems persist in gRNA fabrication, including: i) the length of sgRNA molecules (typically 100 nucleotides) pushing the limits of phosphoramidite chemistry. The phosphoramidite chemistry has a conjugation efficiency of approximately 0.985X (where X is the number of nucleotides). For example, the synthesis of 100 nt long gRNAs yields approximately 20% full-length product before isolation. These lengths are significantly larger than those used in currently commercially available oligonucleotide-based therapeutics (siRNA and antisense oligonucleotides (ASOs) are typically 20–50 nucleotides long and therefore easier to purify); ii) for RNAs of these lengths, standard purification methods (e.g., chromatography, electrophoresis) are currently ineffective at completely removing byproducts resulting from incomplete conjugation (truncated products), incomplete deprotection, and random insertion of nucleotides (addition products); and iii) byproducts with similar sequence homology to the full-length product, when separated from the full-length product, can reduce the activity of ribonucleoprotein complexes and potentially lead to off-target editing. Summary of the Invention

[0005] This document describes a method for synthesizing gRNA using chemical and / or enzymatic strategies that overcomes challenges limiting the purity, integrity, and final (post-purified) yield of the synthesized RNA. In some aspects, the invention provides a ligation-based method in which two or more synthetic RNAs are ligated using an enzyme. Surprisingly, the ligation-based method has been found to improve the purity, yield, and integrity of the resulting gRNA. Compared to previous gRNA synthesis methods, the resulting purity, yield, and integrity can improve editing efficiency and reduce off-target editing. Ligation-based methods for synthesizing gRNA include: methods involving the use of two or more partially complementary synthetic RNAs subsequently ligated (“template methods”); and methods that do not require complementarity between the two or more synthetic RNAs (“non-template methods”).

[0006] In some aspects, a method is provided, the method comprising: contacting a first RNA with a second RNA, wherein the first RNA and the second RNA comprise at least five complementary RNA nucleotides, and wherein the contact forms a stem structure or a stem-loop structure; and ligating the first RNA and the second RNA (i) within the stem structure or (ii) at an end of the stem structure with a ligase, thereby forming a loop at the end of the stem structure.

[0007] In some embodiments, the contact forms a stem structure, and the ligase ligates the first RNA and the second RNA at the end of the stem structure, thereby forming a loop at the end of the stem structure.

[0008] In some embodiments, the contact forms a stem-loop structure, and the ligase ligates the first RNA and the second RNA within the stem of the stem-loop structure.

[0009] In some embodiments, the ligase is selected from the group consisting of: T4 RNA ligase 1, T4 RNA ligase 2, RtcB ligase, thermostable 5'App DNA / RNA ligase, ElectroLigase, T4 DNA ligase, T3 DNA ligase, T7 DNA ligase, Taq DNA ligase, SplintR ligase, E. coli DNA ligase, 9°N DNA ligase, CircLigase, CircLigase II, DNA ligase I, DNA ligase III, and DNA ligase IV. Therefore, in some embodiments, the ligase is T4 RNA ligase 1. In some embodiments, the ligase is T4 RNA ligase 2. In some embodiments, the ligase is RtcB ligase. In some embodiments, the ligase is thermostable 5'App DNA / RNA ligase. In some embodiments, the ligase is ElectroLigase. In some embodiments, the ligase is T4 DNA ligase. In some embodiments, the ligase is T3 DNA ligase. In some embodiments, the ligase is T7 DNA ligase. In some embodiments, the ligase is Taq DNA ligase. In some embodiments, the ligase is SplintR ligase or E. coli DNA ligase. In some embodiments, the ligase is 9°N DNA ligase. In some embodiments, the ligase is CircLigase. In some embodiments, the ligase is CircLigase II. In some embodiments, the ligase is DNA ligase I. In some embodiments, the ligase is DNA ligase III. In some embodiments, the ligase is DNA ligase IV.

[0010] In some embodiments, the first RNA and / or the second RNA are chemically synthesized.

[0011] In some embodiments, the first RNA is a clustered regularly spaced short palindromic repeat (CRISPR) RNA (crRNA) and the second RNA is a trans-activating RNA (tracrRNA).

[0012] In some embodiments, guide RNA (gRNA) is generated according to the methods described herein.

[0013] In some embodiments, the first RNA and / or the second RNA are chemically synthesized.

[0014] In some embodiments, the first RNA and / or the second RNA are enzymatically synthesized.

[0015] In some embodiments, the first RNA and / or the second RNA comprises modified bases. Various modified RNA bases are known in the art and comprise, for example, 2'-O-methoxy-ethyl bases (2'-MOE), such as 2-methoxyethoxy A, 2-methoxyethoxy MeC, 2-methoxyethoxy G, and 2-methoxyethoxy T. Other modified bases comprise, for example, 2'-O-methyl RNA bases and fluorinated bases. Various fluorinated bases are known and comprise, for example, fluorinated C, fluorinated U, fluorinated A, and fluorinated G bases. Various 2'-O-methyl modifications may also be used in conjunction with the methods described herein. For example, the following RNAs, including one or more of the following 2'O methyl modifications, can be used with the method: 2'-OMe-5-methyl-rC, 2'-OMe-rT, 2'-OMe-rI, 2'-OMe-2-amino-rA, amino-linker-C6-rC, amino-linker-C6-rU, 2'-OMe-5-Br-rU, 2'-OMe-5-I-rU, 2-OMe-7-Deaza-rG.

[0016] In some embodiments, the first RNA and / or the second RNA includes one or more of the following modifications: phosphate thioester, 2'O-methyl, 2'fluorine (2'F), DNA.

[0017] In some embodiments, the first RNA and / or the second RNA include 2'OMe modifications at the 3' and 5' ends.

[0018] In some embodiments, the first RNA and / or the second RNA includes one or more of the following modifications: 2'-O-2-methoxyethyl (MOE), locked nucleic acid, bridging nucleic acid, unlocking nucleic acid, peptide nucleic acid, morpholino nucleic acid.

[0019] In some embodiments, the first RNA and / or the second RNA includes one or more of the following base modifications: 2,6-diaminopurine, 2-aminopurine, pseudouracil, N1-methyl-pseudouracil, 5'-methylcytosine, 2'-pyrimidinone (zebularine), and thymine.

[0020] Other modified bases include, for example, 2-aminopurine, 5-bromo-dU, deoxyuridine, 2,6-diaminopurine (2-amino-dA), dideoxy-C, deoxyinosine, hydroxymethyl-dC, reverse-dT, Iso-dG, Iso-dC, reverse-dideoxy-T, 5-methyl-dC, 5-methyl-dC, 5-nitroindole, and Super 2'-Fr(C,U), 2'-NH2-r(C,U), 2,2'-dehydration-U, 3'-deoxy-r(A,C,G,U), 3'-O-methyl-r(A,C,G,U), rT, rI, 5-methyl-rC, 2-amino-rA, rSpacer(Abasic), 7-Deaza-rG, 7-Deaza-rA, 8-Oxo-rG, 5-halogenated-rU, ​​N-alkylated-rN.

[0021] Other chemically modified RNAs may be used in this document. For example, the first and / or second RNA may include modified bases such as 5', Int, 3' azide (NHS ester); 5' hexynyl; 5', Int, 3' 5-octadiynyl dU; 5', Int biotin (azide); 5', Int 6-FAM (azide); and 5', Int 5-TAMRA (azide). Other examples of RNA nucleotide modifications that may be used in the methods described herein include, for example, phosphorylation modifications such as 5'-phosphorylation and 3'-phosphorylation. The RNA may also have one or more of the following modifications: amino modification, biotinylation, thiol modification, alkyne modification, adenylate modification, azide (NHS ester), cholesterol-TEG, and digoxigenin (NHS ester).

[0022] In some embodiments, a ligase is used to connect the first RNA and the second RNA to form a phosphodiester bond between the first RNA and the second RNA.

[0023] In some embodiments, the first RNA and / or the second RNA nucleotides are engineered to allow non-covalent assembly.

[0024] In some embodiments, the length of the stem loop is between about 2 and 50 nucleotides.

[0025] In some embodiments, the first RNA and the second RNA comprise at least two RNA nucleotides that are completely complementary.

[0026] In some embodiments, the first RNA and the second RNA comprise at least three, four, five, six, or seven consecutive RNA nucleotides that are completely complementary.

[0027] In some embodiments, the fully complementary RNA nucleotides are present in the top stem and / or bottom stem.

[0028] In some embodiments, the first RNA and the second RNA comprise at least five, six, or seven complementary consecutive RNA nucleotides at the lower stem formed by the first RNA and the second RNA.

[0029] In some embodiments, the first RNA and the second RNA comprise at least four to fourteen complementary consecutive RNA nucleotides at the upper stem.

[0030] In some embodiments, the first RNA and the second RNA comprise four complementary consecutive RNA nucleotides at the upper stem.

[0031] In some embodiments, the first RNA and the second RNA comprise five complementary consecutive RNA nucleotides at the upper stem.

[0032] In some embodiments, the first RNA and the second RNA comprise seven complementary consecutive RNA nucleotides at the upper stem.

[0033] In some embodiments, the first RNA and the second RNA comprise 14 complementary consecutive RNA nucleotides at the upper stem.

[0034] In some embodiments, the first RNA and the second RNA comprise seven complementary consecutive RNA nucleotides at the lower stem.

[0035] In some embodiments, the first RNA and / or the second RNA are engineered to produce ligation sites for ligases.

[0036] In some embodiments, the stem-loop comprises a ring of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 nucleotides. Therefore, in some embodiments, the stem-loop comprises a ring of 4 nucleotides, also referred to herein as a tetracycle. In some embodiments, the stem-loop comprises a ring of 5 nucleotides. In some embodiments, the stem-loop comprises a ring of 6 nucleotides. In some embodiments, the stem-loop comprises a ring of 7 nucleotides. In some embodiments, the stem-loop comprises a ring of 8 nucleotides. In some embodiments, the stem-loop comprises a ring of 9 nucleotides. In some embodiments, the stem-loop comprises a ring of 10 nucleotides. In some embodiments, the stem-loop comprises a ring of 11 nucleotides. In some embodiments, the stem-loop comprises a ring of 12 nucleotides. In some embodiments, the stem-loop comprises a ring of 13 nucleotides. In some embodiments, the stem-loop comprises a ring of 14 nucleotides. In some embodiments, the stem-loop comprises a ring of 15 nucleotides. In some embodiments, the stem-loop comprises a ring of 15 nucleotides.

[0037] In some embodiments, the connection between the first RNA and the second RNA occurs at a connection site at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 base pairs from the loop. Therefore, in some embodiments, the connection between the first RNA and the second RNA occurs at a connection site at least 1 base pair from the loop. In some embodiments, the connection between the first RNA and the second RNA occurs at a connection site at least 2 base pairs from the loop. In some embodiments, the connection between the first RNA and the second RNA occurs at a connection site at least 3 base pairs from the loop. In some embodiments, the connection between the first RNA and the second RNA occurs at a connection site at least 4 base pairs from the loop. In some embodiments, the connection between the first RNA and the second RNA occurs at a connection site at least 5 base pairs from the loop. In some embodiments, the connection between the first RNA and the second RNA occurs at a connection site at least 6 base pairs from the loop. In some embodiments, the connection between the first RNA and the second RNA occurs at a connection site at least 7 base pairs from the loop. In some embodiments, the connection between the first RNA and the second RNA occurs at a connection site at least 8 base pairs from the loop. In some embodiments, the connection between the first RNA and the second RNA occurs at a connection site at least 9 base pairs from the loop. In some embodiments, the connection between the first RNA and the second RNA occurs at a connection site at least 10 base pairs from the loop.

[0038] In some embodiments, the connection site is 2 or 3 base pairs away from the ring.

[0039] In some embodiments, the connection between the first RNA and the second RNA occurs at a connection site at least 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 base pairs from the protrusion. Therefore, in some embodiments, the connection between the first RNA and the second RNA occurs at a connection site at least 3 base pairs from the protrusion. In some embodiments, the connection between the first RNA and the second RNA occurs at a connection site at least 4 base pairs from the protrusion. In some embodiments, the connection between the first RNA and the second RNA occurs at a connection site at least 5 base pairs from the protrusion. In some embodiments, the connection between the first RNA and the second RNA occurs at a connection site at least 6 base pairs from the protrusion. In some embodiments, the connection between the first RNA and the second RNA occurs at a connection site at least 7 base pairs from the protrusion. In some embodiments, the connection between the first RNA and the second RNA occurs at a connection site at least 8 base pairs from the protrusion. In some embodiments, the connection between the first RNA and the second RNA occurs at a connection site at least 9 base pairs from the protrusion. In some embodiments, the connection between the first RNA and the second RNA occurs at a connection site at least 10 base pairs from the protrusion. In some embodiments, the connection between the first RNA and the second RNA occurs at a connection site at least 11 base pairs from the protrusion. In some embodiments, the connection between the first RNA and the second RNA occurs at a connection site at least 12 base pairs from the protrusion.

[0040] In some embodiments, the connection between the first RNA and the second RNA occurs at a connection site 3, 4, 5, or 11 base pairs away from the protrusion.

[0041] In some embodiments, the first RNA and / or the second RNA are produced enzymatically.

[0042] In some embodiments, the first RNA includes a 3' sequence capable of pairing with a portion of the bases of the second RNA.

[0043] In some embodiments, the first RNA includes a phosphate ester at its 5' end.

[0044] In some embodiments, the first RNA is a donor RNA.

[0045] In some embodiments, the second RNA includes a variable prototype spacer subregion.

[0046] In some embodiments, the second RNA is a receptor RNA.

[0047] In some embodiments, the first RNA includes adenosine triphosphate at its 5' end.

[0048] In some embodiments, approximately 8-50 nucleotides are complementary and allow base pairing between the first RNA and the second RNA. In some embodiments, approximately 8-40 nucleotides are complementary and allow base pairing between the first RNA and the second RNA. In some embodiments, approximately 8-30 nucleotides are complementary and allow base pairing between the first RNA and the second RNA. In some embodiments, approximately 8-20 nucleotides are complementary and allow base pairing between the first RNA and the second RNA. In some embodiments, approximately 8-10 nucleotides are complementary and allow base pairing between the first RNA and the second RNA.

[0049] In some embodiments, the 8-50 nucleotides are partially complementary. In some embodiments, about 8-40 nucleotides are partially complementary and allow base pairing between the first RNA and the second RNA. In some embodiments, about 8-30 nucleotides are partially complementary and allow base pairing between the first RNA and the second RNA. In some embodiments, about 8-20 nucleotides are partially complementary and allow base pairing between the first RNA and the second RNA. In some embodiments, about 8-10 nucleotides are partially complementary and allow base pairing between the first RNA and the second RNA.

[0050] In some embodiments, the 8-50 nucleotides are about 50% to 99% complementary.

[0051] In some embodiments, the 8-50 nucleotides are completely complementary. In some embodiments, about 8-40 nucleotides are completely complementary and allow base pairing between the first RNA and the second RNA. In some embodiments, about 8-30 nucleotides are completely complementary and allow base pairing between the first RNA and the second RNA. In some embodiments, about 8-20 nucleotides are completely complementary and allow base pairing between the first RNA and the second RNA. In some embodiments, about 8-10 nucleotides are completely complementary and allow base pairing between the first RNA and the second RNA.

[0052] In some embodiments, the first RNA and the second RNA have different nucleotide lengths.

[0053] In some embodiments, the first RNA has about 20-100 nucleotides. In some embodiments, the first RNA has about 20-90 nucleotides. In some embodiments, the first RNA has about 20-80 nucleotides. In some embodiments, the first RNA has about 20-70 nucleotides. In some embodiments, the first RNA has about 20-60 nucleotides. In some embodiments, the first RNA has about 20-50 nucleotides. In some embodiments, the first RNA has about 20-40 nucleotides. In some embodiments, the first RNA has about 20-30 nucleotides.

[0054] In some embodiments, the second RNA has about 20-70 nucleotides. In some embodiments, the second RNA has about 20-60 nucleotides. In some embodiments, the second RNA has about 20-50 nucleotides. In some embodiments, the second RNA has about 20-40 nucleotides. In some embodiments, the second RNA has about 20-30 nucleotides.

[0055] In some embodiments, base pairing occurs in the lower stem.

[0056] In some embodiments, the seven nucleotides in the lower stem are complementary and allow base pairing between the first RNA and the second RNA.

[0057] In some embodiments, the base pairing occurs in the upper stem.

[0058] In some embodiments, the two nucleotides are complementary in the upper stem and allow base pairing between the first RNA and the second RNA.

[0059] In some embodiments, the length of the gRNA is about 100 nucleotides, about 125 nucleotides, about 150 nucleotides, about 175 nucleotides, about 200 nucleotides, or greater than about 200 nucleotides. Therefore, in some embodiments, the length of the gRNA is about 100 nucleotides. In some embodiments, the length of the gRNA is about 125 nucleotides. In some embodiments, the length of the gRNA is about 150 nucleotides. In some embodiments, the length of the gRNA is about 175 nucleotides. In some embodiments, the length of the gRNA is about 200 nucleotides. In some embodiments, the length of the gRNA is greater than 200 nucleotides.

[0060] In some embodiments, the gRNA is an extension guide RNA, a guide editor guide RNA (pegRNA), or a Cas12 guide RNA, such as Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, Cas12j, or Cas12k guide RNA. Therefore, in some embodiments, the gRNA is an extension guide RNA. In some embodiments, the gRNA is a guide editor guide RNA (pegRNA). In some embodiments, the gRNA is a Cas12 guide RNA. Various Cas12s are known in the art and include, for example, Cas12s from class 2 CRISPR-Cas systems. Exemplary Cas12s include, for example, any Cas12 from a class 2 CRISPR-Cas system. In some embodiments, the methods described herein are applicable to the synthesis of gRNAs of Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, Cas12j, and / or Cas12k. Therefore, in some embodiments, the gRNA is a Cas12a guide RNA. In some embodiments, the gRNA is a Cas12b guide RNA. In some embodiments, the gRNA is a Cas12c guide RNA. In some embodiments, the gRNA is a Cas12d guide RNA. In some embodiments, the gRNA is a Cas12e guide RNA. In some embodiments, the gRNA is a Cas12f guide RNA. In some embodiments, the gRNA is a Cas12g guide RNA. In some embodiments, the gRNA is a Cas12h guide RNA. In some embodiments, the gRNA is a Cas12i guide RNA. In some embodiments, the gRNA is a Cas12j guide RNA. In some embodiments, the gRNA is a Cas12k guide RNA.

[0061] In some embodiments, the gRNA includes one or more of the following: spacers, lower stems, protrusions, upper stems, connectors, and hairpins.

[0062] In some embodiments, the first RNA and the second RNA are present in a ratio of about 0.5:1, 0.6:1, 0.7:1, 0.8:1, 0.9:1, 1:1, 1:0.9, 1:0.8, 1:0.7, 1:0.6, or 1:0.5. Therefore, in some embodiments, the first RNA and the second RNA are present in a ratio of about 0.5:1. In some embodiments, the first RNA and the second RNA are present in a ratio of about 0.6:1. In some embodiments, the first RNA and the second RNA are present in a ratio of about 0.7:1. In some embodiments, the first RNA and the second RNA are present in a ratio of about 0.8:1. In some embodiments, the first RNA and the second RNA are present in a ratio of about 0.9:1. In some embodiments, the first RNA and the second RNA are present in a ratio of about 1:1. In some embodiments, the first RNA and the second RNA are present in a ratio of about 1:0.9. In some embodiments, the first RNA and the second RNA are present in a ratio of about 1:0.8. In some embodiments, the first RNA and the second RNA are present in a ratio of about 1:0.7. In some embodiments, the first RNA and the second RNA are present in a ratio of approximately 1:0.6. In some embodiments, the first RNA and the second RNA are present in a ratio of approximately 1:0.5.

[0063] In some embodiments, the gRNA is produced at a yield of about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or greater. Therefore, in some embodiments, the gRNA is produced at a yield of about 50%. In some embodiments, the gRNA is produced at a yield of about 55%. In some embodiments, the gRNA is produced at a yield of about 60%. In some embodiments, the gRNA is produced at a yield of about 65%. In some embodiments, the gRNA is produced at a yield of about 70%. In some embodiments, the gRNA is produced at a yield of about 75%. In some embodiments, the gRNA is produced at a yield of about 80%. In some embodiments, the gRNA is produced at a yield of about 85%. In some embodiments, the gRNA is produced at a yield of about 90%. In some embodiments, the gRNA is produced at a yield of about 95%. In some embodiments, the gRNA is produced at a yield exceeding 99%.

[0064] In some embodiments, the gRNA is produced at a yield that is 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or higher than that of conventional synthesis methods. Therefore, in some embodiments, the gRNA is produced at a 50% higher yield than that of conventional synthesis methods. In some embodiments, the gRNA is produced at a 55% higher yield than that of conventional synthesis methods. In some embodiments, the gRNA is produced at a 60% higher yield than that of conventional synthesis methods. In some embodiments, the gRNA is produced at a 55% higher yield than that of conventional synthesis methods. In some embodiments, the gRNA is produced at a 60% higher yield than that of conventional synthesis methods. In some embodiments, the gRNA is produced at a 65% higher yield than that of conventional synthesis methods. In some embodiments, the gRNA is produced at a 70% higher yield than that of conventional synthesis methods. In some embodiments, the gRNA is produced at a 75% higher yield than that of conventional synthesis methods. In some embodiments, the gRNA is produced with an 80% higher yield compared to conventional synthesis methods. In some embodiments, the gRNA is produced with an 85% higher yield compared to conventional synthesis methods. In some embodiments, the gRNA is produced with a 90% higher yield compared to conventional synthesis methods. In some embodiments, the gRNA is produced with a 99% higher yield compared to conventional synthesis methods. In some embodiments, the gRNA is produced with a yield greater than 99% higher than conventional synthesis methods.

[0065] In some aspects, a method for generating synthetic guide RNA (gRNA) is provided, the method comprising: providing a first RNA comprising a 5'-monophosphate; providing a second RNA; providing an oligonucleotide partially complementary to the first RNA and the second RNA, wherein the complementarity of the oligonucleotide allows base pairing with the first RNA and the second RNA; and providing a ligase to catalyze the ligation between the first RNA and the second RNA, thereby generating the synthetic gRNA.

[0066] In some aspects, a method for producing synthetic guide RNA (gRNA) is provided, the method comprising: providing a first RNA comprising a 5'-monophosphate; providing a second RNA comprising a blocked 3' end; and providing a ligase to catalyze the ligation between the first RNA and the second RNA, thereby producing the synthetic gRNA.

[0067] In some embodiments, the first RNA is trans-activating RNA (tracrRNA), and the second RNA is clustered regularly spaced short palindromic repeat (CRISPR) RNA (crRNA).

[0068] In some embodiments, the oligonucleotide is about 100 nucleotides in length. In some embodiments, the oligonucleotide is about 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 nucleotides in length.

[0069] In some aspects, a method for producing synthetic guide RNA (gRNA) is provided, the method comprising:

[0070] The method comprises providing two or more RNA fragments; providing an oligonucleotide that is partially complementary to the two or more RNA fragments, wherein the complementarity of the oligonucleotide allows for base pairing with the two or more RNA fragments; and providing a ligase to catalyze the ligation between the two or more RNA fragments, thereby producing the synthetic guide RNA.

[0071] In some embodiments, the two or more RNA fragments are joined at protruding ends, flat ends, or protrusions.

[0072] In some embodiments, the guide RNA (gRNA) or guide editing guide RNA (pegRNA) is synthesized by the methods described herein. In some embodiments, the guide RNA is a Cas9 guide RNA or a Cas12 guide RNA.

[0073] The methods described herein can be used to synthesize Cas12 guide RNAs, such as Cas12b guide RNA. For example, the hairpin loop structure of Cas12b RNA can serve as a site-targeting mechanism for splitting sgRNAs. Various hairpin loop structures can serve as site-targeting mechanisms for splitting sgRNAs, for example... Figure 16 The hairpin loop structures shown herein. Therefore, in some embodiments, Cas12 guide RNA can be synthesized by targeting one or more hairpin loop structures according to the methods described herein. In some embodiments, one or more quadruple loops within the Cas12 RNA are targeted for ligation. For example, in some embodiments, one or more quadruple loops within the Cas12b RNA are targeted for ligation. In some embodiments, the targeted quadruple loop is located at the 5' end of the Cas12 RNA. In some embodiments, the targeted quadruple loop is located at the 3' end of the Cas12 RNA. In some embodiments, the targeted quadruple loop is located within a range of approximately 5-30 nucleotides from the 3' end of the Cas12 RNA. In some embodiments, the targeted quadruple loop is approximately 5-30 nucleotides from the 5' end of the Cas12 RNA.

[0074] In some aspects, a method is provided for targeting transcriptional activation, targeting transcriptional repression, targeting epigenome modification, or targeting genome modification, the method comprising introducing into a eukaryotic cell: (a) a synthetic guide RNA (gRNA) as defined in any of the preceding claims; (b) at least one CRISPR / Cas protein or nucleic acid encoding said at least one CRISPR / Cas protein; wherein the interaction between (a) and (b) and a target sequence in chromosomal DNA causes targeted transcriptional activation, targeted transcriptional repression, targeted epigenome modification, or targeted genome modification.

[0075] In some aspects, a method for targeting RNA modification is provided, the method comprising introducing into a eukaryotic cell: (a) a synthetic guide RNA (gRNA) as defined in any of the preceding claims; (b) at least one CRISPR / Cas protein or nucleic acid encoding said at least one CRISPR / Cas protein; wherein the interaction between (a) and (b) and the RNA expressed by chromosomal DNA causes modification of said RNA expressed by said chromosomal DNA.

[0076] In some embodiments, the RNA expressed by the chromosomal DNA is messenger RNA (mRNA).

[0077] In some embodiments, the CRISPR / Cas protein is selected from Cas9, Cpf1, SaCas, Cas12, Cas13, or a modified form thereof.

[0078] In some embodiments, the method described herein provides a method for generating synthetic guide RNA (gRNA).

[0079] In some embodiments, the second RNA includes a 3' sequence capable of pairing with a portion of the bases of the first RNA.

[0080] In some embodiments, the second RNA includes a variable prototype spacer subregion.

[0081] In some embodiments, the first RNA includes a phosphate ester at its 5' end.

[0082] In some embodiments, the contact forms a stem-loop structure, and the ligase ligates the first RNA and the second RNA within the stem of the stem-loop structure.

[0083] In some embodiments, the ligase is T4 RNA ligase 2.

[0084] In some embodiments, the stem ring includes GC base pairs in the upper stem.

[0085] In some embodiments, the upper stem comprises at least about 80% identical nucleotide sequences to CGAUACGACAGAAC. In some embodiments, the upper stem comprises at least about 85% identical nucleotide sequences to CGAUACGACAGAAC. In some embodiments, the upper stem comprises at least about 90% identical nucleotide sequences to CGAUACGACAGAAC. In some embodiments, the upper stem comprises at least about 95% identical nucleotide sequences to CGAUACGACAGAAC. In some embodiments, the upper stem comprises at least about 99% identical nucleotide sequences to CGAUACGACAGAAC. In some embodiments, the upper stem comprises the same nucleotide sequence as CGAUACGACAGAAC.

[0086] In some embodiments, the upper stem comprises at least about 80% of the nucleotide sequence identical to CGCCG. In some embodiments, the upper stem comprises at least about 85% of the nucleotide sequence identical to CGCCG. In some embodiments, the upper stem comprises at least about 90% of the nucleotide sequence identical to CGCCG. In some embodiments, the upper stem comprises at least about 80% of the nucleotide sequence identical to CGCCG. In some embodiments, the upper stem comprises at least about 95% of the nucleotide sequence identical to CGCCG. In some embodiments, the upper stem comprises at least about 99% of the nucleotide sequence identical to CGCCG. In some embodiments, the upper stem comprises the same nucleotide sequence as CGCCG.

[0087] In some embodiments, the upper stem comprises at least about 80% of the nucleotide sequence identical to CGGCCGC. In some embodiments, the upper stem comprises at least about 85% of the nucleotide sequence identical to CGGCCGC. In some embodiments, the upper stem comprises at least about 90% of the nucleotide sequence identical to CGGCCGC. In some embodiments, the upper stem comprises at least about 95% of the nucleotide sequence identical to CGGCCGC. In some embodiments, the upper stem comprises at least about 99% of the nucleotide sequence identical to CGGCCGC. In some embodiments, the upper stem comprises the same nucleotide sequence as CGGCCGC.

[0088] In some embodiments, the upper stem comprises at least about 80% identical nucleotide sequence to CGCGC. In some embodiments, the upper stem comprises at least about 85% identical nucleotide sequence to CGCGC. In some embodiments, the upper stem comprises at least about 90% identical nucleotide sequence to CGCGC. In some embodiments, the upper stem comprises at least about 95% identical nucleotide sequence to CGCGC. In some embodiments, the upper stem comprises at least about 99% identical nucleotide sequence to CGCGC. In some embodiments, the upper stem comprises the same nucleotide sequence as CGCGC.

[0089] In some embodiments, the upper stem comprises at least about 80% of the nucleotide sequence identical to CGAU. In some embodiments, the upper stem comprises at least about 85% of the nucleotide sequence identical to CGAU. In some embodiments, the upper stem comprises at least about 90% of the nucleotide sequence identical to CGAU. In some embodiments, the upper stem comprises at least about 95% of the nucleotide sequence identical to CGAU. In some embodiments, the upper stem comprises at least about 99% of the nucleotide sequence identical to CGAU. In some embodiments, the upper stem comprises the same nucleotide sequence as CGAU.

[0090] In some embodiments, the stem ring includes GC base pairs in the lower stem.

[0091] In some embodiments, the lower stem does not include GC base pairs.

[0092] In some embodiments, the upper stem does not include GC base pairs.

[0093] In some embodiments, the upper stem comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 GC base pairs. In some embodiments, the stem comprises at least 1 GC base pair. In some embodiments, the stem comprises at least 2 GC base pairs. In some embodiments, the stem comprises at least 3 GC base pairs. In some embodiments, the stem comprises at least 4 GC base pairs. In some embodiments, the stem comprises at least 2 GC base pairs. In some embodiments, the stem comprises at least 5 GC base pairs. In some embodiments, the stem comprises at least 6 GC base pairs. In some embodiments, the stem comprises at least 7 GC base pairs. In some embodiments, the stem comprises at least 8 GC base pairs. In some embodiments, the stem comprises at least 9 GC base pairs. In some embodiments, the stem comprises at least 10 GC base pairs. In some embodiments, the stem comprises at least 11 GC base pairs. In some embodiments, the stem comprises at least 12 GC base pairs.

[0094] In some embodiments, linking the first RNA and the second RNA results in a full-length product yield of at least 60%, 70%, 80%, 90%, or more than 95%. In some embodiments, the first RNA and the second RNA result in a full-length product yield of at least 60%. In some embodiments, the first RNA and the second RNA result in a full-length product yield of at least 70%. In some embodiments, the first RNA and the second RNA result in a full-length product yield of at least 80%. In some embodiments, the first RNA and the second RNA result in a full-length product yield of at least 90%. In some embodiments, the first RNA and the second RNA result in a full-length product yield of at least 95%. In some embodiments, the first RNA and the second RNA result in a full-length product yield of more than 95%.

[0095] In some embodiments, the gRNA is produced in an amount of at least 1 gram.

[0096] In some embodiments, gRNA is produced in amounts of at least 5 grams, 10 grams, 20 grams, 30 grams, 40 grams, 50 grams, 60 grams, 70 grams, 80 grams, 90 grams, or 100 grams. Thus, in some embodiments, gRNA is produced in an amount of at least 5 grams. In some embodiments, gRNA is produced in an amount of at least 10 grams. In some embodiments, gRNA is produced in an amount of at least 20 grams. In some embodiments, gRNA is produced in an amount of at least 30 grams. In some embodiments, gRNA is produced in an amount of at least 40 grams. In some embodiments, gRNA is produced in an amount of at least 50 grams. In some embodiments, gRNA is produced in an amount of at least 60 grams. In some embodiments, gRNA is produced in an amount of at least 70 grams. In some embodiments, gRNA is produced in an amount of at least 80 grams. In some embodiments, gRNA is produced in an amount of at least 90 grams. In some embodiments, gRNA is produced in an amount of at least 100 grams.

[0097] In some embodiments, the gRNA is produced in an amount of less than 1 gram.

[0098] In some embodiments, the gRNA is produced in amounts of about 0.05 g, 0.1 g, 0.2 g, 0.3 g, 0.4 g, 0.5 g, 0.6 g, 0.7 g, 0.8 g, or 0.9 g. In some embodiments, the gRNA is produced in an amount of about 0.05 g. In some embodiments, the gRNA is produced in an amount of about 0.1 g. In some embodiments, the gRNA is produced in an amount of about 0.2 g. In some embodiments, the gRNA is produced in an amount of about 0.3 g. In some embodiments, the gRNA is produced in an amount of about 0.4 g. In some embodiments, the gRNA is produced in an amount of about 0.5 g. In some embodiments, the gRNA is produced in an amount of about 0.6 g. In some embodiments, the gRNA is produced in an amount of about 0.7 g. In some embodiments, the gRNA is produced in an amount of about 0.8 g. In some embodiments, the gRNA is produced in an amount of about 0.9 g.

[0099] In some embodiments, the method produces gRNA with a purity of about 50%, 60%, 70%, 80%, 90%, or more than 90%. In some embodiments, the method produces gRNA with a purity of about 50%. In some embodiments, the method produces gRNA with a purity of about 60%. In some embodiments, the method produces gRNA with a purity of about 70%. In some embodiments, the method produces gRNA with a purity of about 80%. In some embodiments, the method produces gRNA with a purity of about 90%. In some embodiments, the method produces gRNA with a purity of more than 90%.

[0100] In some embodiments, the first RNA is synthesized in a 3' to 5' orientation.

[0101] In some embodiments, the second RNA is synthesized in a 3' to 5' orientation.

[0102] In some embodiments, the length of the gRNA is about 100 nucleotides, about 125 nucleotides, about 150 nucleotides, about 175 nucleotides, about 200 nucleotides, or greater than about 200 nucleotides. In some embodiments, the length of the gRNA is about 100 nucleotides. In some embodiments, the length of the gRNA is about 125 nucleotides. In some embodiments, the length of the gRNA is about 150 nucleotides. In some embodiments, the length of the gRNA is about 175 nucleotides. In some embodiments, the length of the gRNA is about 200 nucleotides. In some embodiments, the length of the gRNA is greater than 200 nucleotides.

[0103] In some embodiments, the ring comprises 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 nucleotides. In some embodiments, the ring comprises 4 nucleotides, also referred to herein as a tetracycle. In some embodiments, the ring comprises 5 nucleotides. In some embodiments, the ring comprises 6 nucleotides. In some embodiments, the ring comprises 7 nucleotides. In some embodiments, the ring comprises 8 nucleotides. In some embodiments, the ring comprises 9 nucleotides. In some embodiments, the ring comprises 10 nucleotides. In some embodiments, the ring comprises 11 nucleotides. In some embodiments, the ring comprises 12 nucleotides. In some embodiments, the ring comprises 13 nucleotides. In some embodiments, the ring comprises 14 nucleotides. In some embodiments, the ring comprises 15 nucleotides. In some embodiments, the ring comprises 16 nucleotides.

[0104] In some embodiments, the connection between the first RNA and the second RNA occurs at a connection site at least about 3 base pairs from the loop.

[0105] In some embodiments, the linker site is 1, 2, 3, 4, 5, 6, or 10 base pairs from the loop. In some embodiments, the linker site is 1 base pair from the loop. In some embodiments, the linker site is 2 base pairs from the loop. In some embodiments, the linker site is 3 base pairs from the loop. In some embodiments, the linker site is 4 base pairs from the loop. In some embodiments, the linker site is 5 base pairs from the loop. In some embodiments, the linker site is 6 base pairs from the loop. In some embodiments, the linker site is 7 base pairs from the loop. In some embodiments, the linker site is 8 base pairs from the loop. In some embodiments, the linker site is 9 base pairs from the loop. In some embodiments, the linker site is 10 base pairs from the loop.

[0106] In some embodiments, the first RNA and / or the second RNA includes one or more backbone modifications.

[0107] In some embodiments, the one or more skeletal modifications include 2'O-methyl or thiophosphate modifications. Therefore, in some embodiments, the one or more skeletal modifications include 2'O-methyl modifications. In some embodiments, the one or more skeletal modifications include thiophosphate modifications.

[0108] In some embodiments, the one or more skeletal modifications are selected from 2'-O-methyl 3'-thiophosphate, 2'-O-methyl, 3'-ribose thiophosphate, deoxygenated, or 5'-phosphate modifications. Therefore, in some embodiments, the one or more skeletal modifications include 2'-O-methyl 3'-thiophosphate modification. In some embodiments, the one or more modifications include 3'-ribose 3'-thiophosphate modification. In some embodiments, the one or more modifications include deoxygenated modification. In some embodiments, the one or more modifications include 5'-phosphate modification.

[0109] In some embodiments, one or more modifications are present at the connection site.

[0110] In some embodiments, the one or more modifications are present in the donor RNA and / or the recipient RNA. Therefore, in some embodiments, the one or more modifications are present in the recipient RNA. In some embodiments, the one or more modifications are present in the recipient RNA. In some embodiments, the one or more modifications are present in the donor RNA and / or the recipient RNA.

[0111] In some embodiments, the 3' and / or 5' ends of the donor RNA have one or more backbone modifications. Therefore, in some embodiments, the 3' end of the donor RNA has one or more backbone modifications. In some embodiments, the 5' end of the donor RNA has one or more backbone modifications.

[0112] In some embodiments, the 3' and / or 5' ends of the receptor RNA have one or more backbone modifications. Therefore, in some embodiments, the 3' end of the receptor RNA has one or more backbone modifications. In some embodiments, the 5' end of the receptor RNA has one or more backbone modifications.

[0113] In some embodiments, the concentrations of the first RNA and / or the second RNA are between about 1 g / L and 5 g / L.

[0114] In some embodiments, the concentration of the first RNA and / or the second RNA is about 1 g / L. In some embodiments, the concentration of the first RNA and / or the second RNA is about 2 g / L. In some embodiments, the concentration of the first RNA and / or the second RNA is about 3 g / L. In some embodiments, the concentration of the first RNA and / or the second RNA is about 4 g / L. In some embodiments, the concentration of the first RNA and / or the second RNA is about 5 g / L.

[0115] In some embodiments, a composition produced by the methods described herein is provided, the composition comprising: a first RNA comprising a phosphate ester at its 5' end; and a second RNA comprising a variable prototype spacer region, wherein the first RNA and the second RNA are non-covalently bound.

[0116] In some embodiments, a composition produced by the methods described herein is provided, the composition comprising: a first RNA comprising a phosphate ester at its 5' end; and a second RNA comprising a variable prototype spacer region, wherein the first RNA and the second RNA are bound to a ligase.

[0117] In some embodiments, the ligase is T4 RNA ligase 2.

[0118] In some aspects, a composition is provided comprising RNA containing at least about 80% of the same nucleotide sequence as CGAUACGACAGAAC. In some embodiments, a composition is provided comprising RNA containing at least about 85% of the same nucleotide sequence as CGAUACGACAGAAC. In some embodiments, a composition is provided comprising RNA containing at least about 90% of the same nucleotide sequence as CGAUACGACAGAAC. In some embodiments, a composition is provided comprising RNA containing at least about 95% of the same nucleotide sequence as CGAUACGACAGAAC. In some embodiments, a composition is provided comprising RNA containing the same nucleotide sequence as CGAUACGACAGAAC.

[0119] In some aspects, a composition is provided comprising RNA containing at least about 80% of the same nucleotide sequence as CGCCG. In some embodiments, a composition is provided comprising RNA containing at least about 85% of the same nucleotide sequence as CGCCG. In some embodiments, a composition is provided comprising RNA containing at least about 90% of the same nucleotide sequence as CGCCG. In some embodiments, a composition is provided comprising RNA containing at least about 95% of the same nucleotide sequence as CGCCG. In some embodiments, the nucleotide sequence is identical to CGCCG.

[0120] In some aspects, a composition is provided comprising RNA containing at least about 80% of the same nucleotide sequence as CGGCCGC. In some embodiments, a composition is provided comprising RNA containing at least about 85% of the same nucleotide sequence as CGGCCGC. In some embodiments, a composition is provided comprising RNA containing at least about 90% of the same nucleotide sequence as CGGCCGC. In some embodiments, a composition is provided comprising RNA containing at least about 95% of the same nucleotide sequence as CGGCCGC. In some embodiments, the nucleotide sequence is identical to CGGCCGC.

[0121] In some aspects, a composition is provided comprising RNA containing at least about 80% of the same nucleotide sequence as CGCGC. In some embodiments, a composition is provided comprising RNA containing at least about 85% of the same nucleotide sequence as CGCGC. In some embodiments, a composition is provided comprising RNA containing at least about 90% of the same nucleotide sequence as CGCGC. In some embodiments, a composition is provided comprising RNA containing at least about 95% of the same nucleotide sequence as CGCGC. In some embodiments, the nucleotide sequence is identical to CGCGC.

[0122] In some embodiments, a kit is provided that includes the compositions described herein.

[0123] In some aspects, a kit is provided comprising: a first RNA comprising a transactivating RNA (tracrRNA) sequence; a second RNA comprising a variable prototype spacer region; and a ligase.

[0124] In some embodiments, the kit includes T4 RNA ligase 2.

[0125] definition

[0126] To facilitate understanding of this invention, certain terms are defined below. Further definitions for these and other terms are set forth throughout the specification.

[0127] One or a kind: The articles “one” and “a kind” in this text refer to one or more (i.e., at least one) grammatical object of the article. For example, “element” means one or more elements.

[0128] Approximately or about: As used herein, the term “approximately” or “about”, when applied to one or more values ​​of interest, refers to a value similar to a specified reference value. In some embodiments, the term “approximately” or “about” refers to a range of values ​​of 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in any direction (greater than or less than) of the stated reference value, unless otherwise stated or otherwise clearly apparent from the context (except where such a figure would exceed 100% of the possible value).

[0129] Related to: If the presence, level, and / or form of one event or entity is related to the presence, level, and / or form of another event or entity, then the two events or entities are “associated” with each other, as the term is used herein. For example, if the presence, level, and / or form of a particular entity (e.g., a polypeptide) is related to the incidence and / or susceptibility to a disease, condition, or symptom (e.g., across relevant populations), then the particular entity is considered to be associated with the particular disease, condition, or symptom. In some embodiments, if two or more entities interact directly or indirectly such that they are physically close to each other and remain close to each other, then they are physically “associated” with each other. In some embodiments, two or more physically associated entities are covalently linked to each other; in some embodiments, two or more physically associated entities are not covalently linked to each other, but are non-covalently associated, for example, through hydrogen bonds, van der Waals interactions, hydrophobic interactions, magnetism, and combinations thereof.

[0130] Base Editor: A "base editor (BE)" or "nucleobase editor (NBE)" refers to an agent that binds to polynucleotides and has nucleobase modification activity. In various embodiments, the base editor comprises a nucleobase-modifying polypeptide (e.g., a deaminase) and a polynucleotide-programmable nucleotide-binding domain and a guide polynucleotide (e.g., guide RNA). In various embodiments, the agent is a biomolecular complex comprising a protein domain having base-editing activity, i.e., a domain capable of modifying bases (e.g., A, T, C, G, or U) within a nucleic acid molecule (e.g., DNA). In some embodiments, the polynucleotide-programmable DNA-binding domain is fused to or linked to a deaminase domain. In one embodiment, the agent is a fusion protein comprising one or more domains having base-editing activity. In another embodiment, the protein domain having base-editing activity is linked to guide RNA (e.g., via an RNA-binding motif on the guide RNA and an RNA-binding domain fused to a deaminase). In some embodiments, the domain having base-editing activity is capable of deaminating bases within a nucleic acid molecule. In some embodiments, the base editor is capable of deaminating one or more bases within a DNA molecule. In some embodiments, the base editor is capable of deaminating cytosine (C) or adenosine (A) within DNA. In some embodiments, the base editor is capable of deaminating both cytosine (C) and adenosine (A) within DNA. In some embodiments, the base editor is a cytidine base editor (CBE). In some embodiments, the base editor is an adenosine base editor (ABE). In some embodiments, the base editor is both an adenosine base editor (ABE) and a cytidine base editor (CBE). In some embodiments, the base editor is a nuclease-inactivated Cas9 (dCas9) fused with an adenosine deaminase. In some embodiments, the base editor is fused with a base excision repair inhibitor, such as a UGI domain or a dISN domain. In some embodiments, the fusion protein comprises a Cas9 nickase fused with a deaminase and a base excision repair inhibitor, such as a UGI or dISN domain. In other embodiments, the base editor is a base-free base editor. Details of the base editor are described in International PCT Applications PCT / 2017 / 045381 (WO2018 / 027078) and PCT / US2016 / 058344 (WO2017 / 070632), each of which is incorporated herein by reference in its entirety.See also Komor, AC et al., “Programmable editing of a target base ingenomic DNA without double-stranded DNA cleavage,” *Nature* 533, 420-424 (2016); Gaudelli, NM et al., “Programmable base editing of A·T to G·C in genomic DNA without DNA cleavage,” *Nature* 551, 464-471 (2017); Komor, AC et al., “Improved baseexcision repair inhibition and bacteriophage Mu Gam protein yields C:G-to-T:A base editors with higher efficiency and product purity.” "Purity" Science Advances 3:eaao4774 (2017) and Rees, HA et al., "Base editing: precision chemistry on the genome and transcriptome of living cells". Nature Reviews Genetics 2018 Dec; 19(12):770-788. doi:10.1038 / s41576-018-0059-1, the full text of the cited references is incorporated herein by reference.

[0131] Base editing activity: "Base editing activity" refers to the chemical alteration of bases within a polynucleotide (e.g., by deamination). In one embodiment, a first base is converted to a second base. In one embodiment, the base editing activity is cytidine deaminase activity, for example, converting target C·G to T·A. In another embodiment, the base editing activity is adenosine or adenine deaminase activity, for example, converting A·T to G·C. In yet another embodiment, the base editing activity is a combination of cytidine deaminase activity, for example, converting target C·G to T·A, and adenosine or adenine deaminase activity, for example, converting A·T to G·C.

[0132] Base Editor System: The term "base editor system" refers to a system for editing the nucleobases of a target nucleotide sequence. In various embodiments, the base editor (BE) system includes (1) a polynucleotide programmable nucleotide binding domain (e.g., Cas9), a deaminase domain, and a cytidine deaminase domain for deaminating nucleobases in the target nucleotide sequence; and (2) one or more guide polynucleotides (e.g., guide RNA) binding to the polynucleotide programmable nucleotide binding domain. In various embodiments, the base editor (BE) system includes a nucleobase editor domain selected from adenosine deaminase or cytidine deaminase, and a domain having nucleic acid sequence-specific binding activity. In some embodiments, the base editor system includes (1) a base editor (BE) comprising a polynucleotide programmable DNA binding domain and a deaminase domain for deaminating one or more nucleobases in the target nucleotide sequence; and (2) one or more guide RNAs binding to the polynucleotide programmable DNA binding domain. In some embodiments, the polynucleotide programmable nucleotide binding domain is a polynucleotide programmable DNA binding domain. In some embodiments, the base editor is a cytidine base editor (CBE). In some embodiments, the base editor is an adenine or adenosine base editor (ABE). In some embodiments, the base editor is an adenine or adenosine base editor (ABE) or a cytidine base editor (CBE).

[0133] Bioactivity: As used herein, the phrase “bioactivity” refers to the property of any agent that is active in a biological system, particularly in an organism. For example, an agent that has a biological effect on an organism when applied to it is considered bioactive. In certain embodiments, when a peptide is bioactive, at least one bioactive portion of the shared peptide is generally referred to as the “bioactive” portion.

[0134] Cleavage: As used herein, cleavage refers to a break in the target nucleic acid produced by the nuclease of the CRISPR system described herein. In some embodiments, the cleavage event is a double-stranded DNA break. In some embodiments, the cleavage event is a single-stranded DNA break. In some embodiments, the cleavage event is a single-stranded RNA break. In some embodiments, the cleavage event is a double-stranded RNA break.

[0135] Complementarity: "Complementarity" or "complementarity" refers to the ability of a nucleic acid to form hydrogen bonds with another nucleic acid sequence via traditional Watson-Crick base pairing or Hoogsteen base pairing. Complementary base pairings include not only GC and AT base pairings but also base pairings involving universal bases such as inosine. The complementarity percentage indicates the percentage of consecutive residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, or 10 nucleotides out of a total of 10 nucleotides in a first oligonucleotide pairing with a second nucleic acid sequence of 10 nucleotides, representing 50%, 60%, 70%, 80%, 90%, and 100%, respectively). To determine that the percentage complementarity is at least a certain percentage, the percentage of consecutive residues in the nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with the second nucleic acid sequence is calculated and rounded to the nearest integer (e.g., 12, 13, 14, 15, 16, or 17 nucleotides out of a total of 23 nucleotides in the first oligonucleotide that pair with the second nucleic acid sequence having 23 nucleotides represent 52%, 57%, 61%, 65%, 70%, and 74%, respectively; and have complementarity of at least 50%, 50%, 60%, 60%, 70%, and 70%, respectively). As used herein, “substantially complementary” refers to complementarity between strands that allows the strands to hybridize under biological conditions. Substantially complementary sequences have 60%, 70%, 80%, 90%, 95%, or even 100% complementarity. Furthermore, techniques for determining whether two strands can hybridize under biological conditions by examining the nucleotide sequences of two strands are well known in the art.

[0136] Clustered Interspaced Short Palindromic Repeats (CRISPR) Related (Cas) Systems: As used herein, a CRISPR-Cas9 system refers to nucleic acids and / or proteins involved in the expression of CRISPR effectors or directing the activity of CRISPR effectors, comprising sequences encoding CRISPR effectors, RNA guides, and other sequences and transcripts from CRISPR loci. In some embodiments, the CRISPR system is an engineered, non-naturally occurring CRISPR system. In some embodiments, components of the CRISPR system may comprise nucleic acids (e.g., vectors), protein components, or combinations thereof encoding one or more components of the system.

[0137] CRISPR array: As used herein, the term "CRISPR array" refers to a nucleic acid (e.g., DNA) segment containing CRISPR repeat sequences and spacers, the segment beginning with the first nucleotide of the first CRISPR repeat and ending with the last nucleotide of the last (terminal) CRISPR repeat. Typically, each spacer in a CRISPR array lies between two repeat sequences. As used herein, the terms "CRISPR repeat sequence," "CRISPR direct repeat sequence," or "direct repeat sequence" refer to multiple short direct repeat sequences that exhibit very little or no sequence variation within the CRISPR array.

[0138] CRISPR-related protein (Cas): As used herein, the terms “CRISPR-related protein,” “CRISPR effector,” “effector,” or “CRISPR enzyme” refer to a protein that performs enzymatic activity and / or binds to a target site on a nucleic acid specified by an RNA guide. In various embodiments, the CRISPR effector has endonuclease activity, nicking enzyme activity, exonuclease activity, transposase activity, and / or excision activity. In other embodiments, the CRISPR effector is nuclease-inactivated.

[0139] crRNA: As used herein, the term “CRISPR RNA” or “crRNA” refers to an RNA molecule containing a guide sequence used by a CRISPR effector to target a specific nucleic acid sequence. Typically, crRNA contains a sequence mediating target recognition and a sequence that forms a double strand with tracrRNA. In some embodiments, the crRNA:tracrRNA double strand binds to a CRISPR effector.

[0140] Double-stranded structure: As used herein, a "double-stranded structure" refers to a double-helix structure formed by the interaction of two single-stranded nucleic acids. Double-stranded structures are typically formed by paired hydrogen bonds between bases, i.e., "base pairing" between two antiparallel single-stranded nucleic acids. Base pairing in a double-stranded structure usually occurs via Watson-Crick base pairing, for example, guanine (G) and cytosine (C) forming a base pair in DNA and RNA, adenine (A) and thymine (T) forming a base pair in DNA, and adenine (A) and uracil (U) forming a base pair in RNA. Conditions under which base pairs can form include physiologically or biologically relevant conditions (e.g., intracellular: pH 7.2, 140 mM potassium ions; extracellular: pH 7.4, 145 mM sodium ions). Furthermore, double-stranded structures are stabilized by interactions between stacked adjacent nucleotides. As used herein, double-stranded structures can be established or maintained through base pairing or stacking interactions. A double-stranded nucleic acid is formed by two complementary nucleic acid strands, which can be substantially complementary or completely complementary. A single-stranded nucleic acid with base pairing at multiple bases is called a "hybrid".

[0141] In vitro: As used herein, the term “in vitro” refers to an event that occurs in cells or tissues grown outside of a multicellular organism rather than inside it.

[0142] Functional equivalents or analogs: As used herein, the terms "functional equivalent" or "functional analog" in the context of a functional derivative of an amino acid sequence refer to a molecule that retains biological activity substantially similar to that of the original sequence (function or structure). Functional derivatives or equivalents can be natural derivatives or synthetically prepared. Exemplary functional derivatives comprise an amino acid sequence having one or more substituted, deleted, or added amino acids, provided that the biological activity of the protein is conserved. The substituted amino acids ideally have similar chemophysical properties to those of the substituted amino acid. Ideally, similar chemophysical properties include similarity in charge, volume, hydrophobicity, hydrophilicity, etc.

[0143] Half-life: As used herein, the term “half-life” is the time required for an amount (such as protein concentration or activity) to decrease to half of its value measured at the beginning of a time period.

[0144] Hybridization: “Hybridization” refers to the formation of a double-stranded molecule between complementary polynucleotide sequences (e.g., the genes described herein) or portions thereof under various stringent conditions. (See, for example, Wahl, GM and SLBerger (1987), Methods Enzymology, 152:399; Kimmel, AR (1987), Methods Enzymology, 152:507). Hybridization occurs via hydrogen bonding between complementary nucleobases, which can be Watson-Crick, Horace, or reverse Horace hydrogen bonds. For example, adenine and thymine are paired complementary nucleobases through the formation of hydrogen bonds.

[0145] Improvement, increase, or decrease: As used herein, the terms “improvement,” “increase,” or “decrease,” or their grammatical equivalents, refer to a value relative to a baseline measurement, such as a measurement in the same individual prior to initiation of the treatment described herein, or a measurement in a control subject (or multiple control subjects) in the absence of the treatment described herein. A “control subject” is a subject with the same form of disease as the subject being treated, and who is approximately the same age as the subject being treated.

[0146] Indel: As used in this article, the term "indel" refers to the insertion or deletion of a base in a nucleic acid sequence. It usually results in a mutation and is a common form of genetic variation.

[0147] Inhibition: As used herein, the terms “inhibition,” “inhibit,” and “inhibiting” refer to a process or method of reducing or decreasing the activity and / or expression of a protein or gene of interest. Generally, inhibiting a protein or gene means reducing the expression or associated activity of a protein or gene by at least 10% or more, for example, 20%, 30%, 40%, or 50%, 60%, 70%, 80%, 90%, or more, or by more than 1, 2, 3, 4, 5, 10, 50, 100, or more, as measured by one or more methods described herein or recognized in the art.

[0148] In vitro: As used herein, the term “in vitro” refers to events that occur in artificial environments, such as test tubes or reaction vessels, cell culture media, etc., rather than in multicellular organisms.

[0149] In vivo: As used herein, the term "in vivo" refers to events occurring within a multicellular organism such as a human or non-human animal. In the context of cell-based systems, the term can be used to refer to events occurring within living cells (e.g., as opposed to in vitro systems).

[0150] Oligonucleotides: As used herein, the term "oligonucleotide" generally refers to a polynucleotide of between about 5 and about 100 nucleotides in single-stranded or double-stranded DNA. Oligonucleotides are also called "oligomers" or "oligosaccharides" and can be isolated from genes or chemically synthesized.

[0151] PAM: The term "PAM" or "prototype spacer adjacent motif" refers to a short nucleic acid sequence (typically 2-6 base pairs in length) located after the nucleic acid region targeted for cleavage by a CRISPR system such as CRISPR-Cas9. Cas nuclease cleavage may require a PAM, which is typically found 3-4 nucleotides downstream of the cleavage site.

[0152] Polypeptide: As used herein, the term "polypeptide" refers to a continuous chain of amino acids linked together by peptide bonds. The term is used to refer to an amino acid chain of any length, but those skilled in the art will understand that the term is not limited to long chains and can refer to the smallest chain comprising two amino acids linked together by peptide bonds. As known to those skilled in the art, polypeptides can be processed and / or modified. As used herein, the terms "polypeptide" and "peptide" are used interchangeably.

[0153] Prevention: As used herein, when used in conjunction with the occurrence of disease, condition and / or symptom, the term “prevent” or “prevention” means reducing the risk of developing a disease, condition and / or symptom.

[0154] Guided editing RNA: The term "guided editing RNA" or "pegRNA" refers to a guide RNA that both specifies a target site and encodes the desired edit. Guided editing RNAs (pegRNAs) are known in the art and have previously been described, for example, in Anzalone AV, "Search-and-replace genome editing without double-strand breaks or donor DNA" Nature. October 21, 2019. doi:10.1038 / s41586-019-1711-4, the entire contents of which are incorporated herein by reference.

[0155] Protein: As used herein, the term "protein" refers to one or more polypeptides used as discrete units. The terms "polypeptide" and "protein" may be used interchangeably if a single polypeptide is a discrete functional unit and does not require permanent or temporary physical association with other polypeptides to form a discrete functional unit. The term "protein" refers to multiple polypeptides that are physically coupled and function together as discrete units if the discrete functional unit consists of more than one polypeptide that is physically associated with each other.

[0156] Reference: A "reference" entity, system, quantity, set of conditions, etc., is an entity, system, quantity, set of conditions, etc., compared to the test entities, systems, quantities, sets of conditions, etc., described herein. For example, in some embodiments, a "reference" antibody is an unengineered control antibody as described herein.

[0157] RNA guide: The term RNA guide refers to an RNA molecule that facilitates the targeting of the protein described herein to a target nucleic acid. Exemplary “RNA guide” or “guide RNA” includes, but is not limited to, crRNA or a combination of crRNA and homologous tracrRNA. The latter may be a standalone RNA or fused into a single RNA using a linker (sgRNA). In some embodiments, the RNA guide is engineered to include chemical or biochemical modifications. In some embodiments, the RNA guide may contain one or more nucleotides.

[0158] Splint: The term "splint" refers to a single-stranded RNA or DNA or other polymer that is capable of hybridizing with at least two, three or more single-stranded RNA nucleotides.

[0159] Subject: As used herein, the term “subject” refers to any subject who requires diagnosis, prognosis, or treatment. For example, a subject can be a mammal, such as a human or a non-human primate (such as an ape, monkey, orangutan, or chimpanzee), a dog, a cat, a guinea pig, a rabbit, a rat, a mouse, a horse, a cow, or a dairy cow.

[0160] sgRNA: The terms “sgRNA”, “single guide RNA” or “guide RNA” refer to a single guide RNA containing (i) a guide sequence (crRNA sequence) and (ii) a Cas9 nuclease recruitment sequence (tracrRNA).

[0161] Fundamental Identity: The phrase “fundamental identity” is used herein to refer to comparisons between amino acid or nucleic acid sequences. As will be understood by those skilled in the art, two sequences are generally considered “fundamentally identical” if they contain the same residues at corresponding positions. As is well known in the art, any of a variety of algorithms can be used to compare amino acid or nucleic acid sequences, including those available in commercial computer programs such as BLASTN for nucleotide sequences and BLASTP for amino acid sequences, BLAST with vacancies, and PSI-BLAST. Exemplary procedures of this kind are described in the following: Altschul et al., Basic Local Alignment Search Tool, J.Mol.Biol., 215(3):403-410, 1990; Altschul et al., Methods in Enzymology; Altschul et al., Nucleic Acids Res., 25:3389-3402, 1997; Baxevanis et al., Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins, Wiley, 1998; and Misener et al. (eds.), Bioinformatics Methods and Protocols (Methods in Molecular Biology, Vol. 132), Humana Press, 1999. In addition to identifying identical sequences, the above procedures typically provide an indication of the degree of identity. In some embodiments, two sequences are considered substantially identical if at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more of the corresponding residues in the relevant extension are identical. In some embodiments, the relevant extension is a complete sequence. In some embodiments, the associated extension is at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 or more residues.

[0162] Target Nucleic Acid: As used herein, the term "target nucleic acid" refers to a nucleotide (oligonucleotide or polynucleotide) of any length to which the CRISPR-Cas9 system binds, including deoxyribonucleotides, ribonucleotides, or analogues. Target nucleic acids can have a three-dimensional structure and can contain coding or non-coding regions, including exons, introns, mRNA, tRNA, rRNA, siRNA, shRNA, miRNA, ribozymes, cDNA, plasmids, vectors, exogenous sequences, and endogenous sequences. Target nucleic acids may include modified nucleotides comprising methylated nucleotides or nucleotide analogues. Target nucleic acids may contain non-nucleic acid components. Target nucleic acids are not limited to single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derived nucleotide bases.

[0163] Therapeutic Effective Amount: As used herein, the term "therapeutic effective amount" refers to the amount of a therapeutic molecule (e.g., the engineered antibody described herein) that imparts a therapeutic effect to a treated subject at a reasonable benefit / risk ratio suitable for any medical treatment. Therapeutic effect can be objective (i.e., measurable by a test or biomarker) or subjective (i.e., indicated or perceived by the subject). Specifically, the "therapeutic effective amount" refers to the amount of a therapeutic molecule or composition that effectively treats, improves, or prevents a particular disease or symptom, or exhibits a detectable therapeutic or preventative effect, such as by improving disease-related symptoms, preventing or delaying disease onset, and / or also reducing the severity or frequency of disease symptoms. Therapeutic effective amounts can be administered in dosing regimens that may include multiple unit doses. For any particular therapeutic molecule, the therapeutic effective amount (and / or the appropriate unit dose within an effective dosing regimen) can vary, for example, depending on the route of administration and combination with other agents. In addition, the specific therapeutically effective dose (and / or unit dose) for any particular subject may depend on a variety of factors, including the condition being treated and its severity; the activity of the specific agent used; the specific composition used; the subject's age, weight, general health status, sex, and diet; the time of administration, route of administration, and the excretion or metabolic rate of the specific therapeutic molecule used; the duration of treatment; and similar factors well known in the medical field.

[0164] tracrRNA: As used herein, the term “tracrRNA” or “trans-activating crRNA” refers to an RNA containing a sequence that forms the structure required for the binding of specific target nucleic acids to CRlSPR-related proteins.

[0165] Treatment: As used herein, the term “treatment” (and “treat / treating”) refers to the administration of a therapeutic molecule (e.g., the CRISPR-Cas therapeutic protein or system described herein) that partially or completely reduces, improves, alleviates, inhibits, or suppresses one or more symptoms or features of a disease, condition, and / or symptom, delays the onset of one or more symptoms or features of a disease, condition, and / or symptom, reduces the severity of one or more symptoms or features of a disease, condition, and / or symptom, and / or reduces the incidence of one or more symptoms or features of a disease, condition, and / or symptom. This treatment may be for subjects without symptoms of the relevant disease, condition, and / or symptom and / or for subjects with early symptoms of the disease, condition, and / or symptom. Alternatively or additionally, this treatment may be for subjects with one or more identified symptoms of the relevant disease, condition, and / or symptom. Attached Figure Description

[0166] The accompanying drawings are for illustrative purposes only and are not intended to be limiting.

[0167] Figure 1 This is a schematic diagram illustrating the standard chemical synthesis of synthetic RNA. Synthetic RNA is typically synthesized through sequence-controlled polymerization on a solid support. The chemical synthesis is carried out in a cyclic manner, with each cycle including, for example... Figure 1 The diagram illustrates each step.

[0168] Figure 2 This is a general schematic diagram illustrating the interaction between sgRNA and target DNA sequence. The diagram shows the various motifs present in the sgRNA, including spacer regions, stem-loops consisting of a lower stem, four loops, and raised regions, linking motifs, and a series of hairpin motifs.

[0169] Figure 3 Figure A illustrates two common methods for synthesizing sgRNA using a ligation-based approach. In one method (1), ligation occurs at the loop portion of the stem-loop. In the second method (2), ligation occurs at the helix of the stem-loop. In each method, the stem-loop is extended and used to associate the segment for enzymatic ligation. Figure 3 Figure B depicts a schematic HPLC chromatogram illustrating the separation between the RNA fragment and the gRNA generated by ligating the fragment, the separation being represented by peaks. After ligation, a final purification step using HPLC is performed to remove unligated RNA fragments. Complete separation of the RNA fragment from the full-length product (FLP) is possible.

[0170] Figure 4This is a schematic diagram illustrating a typical example of click chemistry reactions used in drug synthesis. Previous methods used chemical ligation, employing "click chemistry" to combine RNA fragments into full-length sgRNA.

[0171] Figure 5 The small figure AC depicts the various substrates used for enzymatic ligation. Figure 5 Figure A depicts two RNA oligomers associated on a splint chain. In this case, the nick (e.g., the junction between the first and second RNAs) will be sealed by a ligase, thereby forming a natural phosphodiester backbone connection. Figure 5 Figure B depicts two RNA oligomers that are partially complementary to each other, along with the base pairs that together form a stem-loop structure. Enzymatic ligation can be performed efficiently in the loop segment of the stem-loop. Figure 5 Figure C depicts two RNAs that have paired with the splint chain. Ligation can occur in various RNA associations and can happen without the need for pre-association.

[0172] Figure 6 Figure A depicts the sequences and configurations associated with the most commonly used sgRNAs. Figure 6 Figure B shows two representative RNA sequences and the relevant connection sites used for loop joining. Figure 6 Figure C shows two representative RNA sequences and the connection sites used for helical linkage. The sequences are as follows:

[0173] Small image A:

[0174] XXXXXXXXXXXXXXXXXXXXGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAG

[0175] GCUAGUCCGUUAUCAACUUGAAAAAGUGGGACCGAGUCCGGUGCAGACUUCUCCA

[0176] CAGGAGUCAGGUGCAC

[0177] Small image B:

[0178] XXXXXXXXXXXXXXXXXXXXGUUUUAGAGCUAUGCUGUCUUGCCGA

[0179] pUACAAGACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU

[0180] Small image C:

[0181] XXXXXXXXXXXXXXXXXXXXGUUUUAGAGCUAUGCUGU

[0182] pCUUGGAAACAAGACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAGUGGCACCGAGUCCGUGCUUUU

[0183] Where X is any nucleotide and "p" represents a free phosphate ester, and the RNA is not covalently linked, as shown in the figure.

[0184] Figure 7 Figure A depicts the fragment sequence used in the ligation experiment. Both the acceptor and donor sequences are shown. Base codes: A, adenosine; G, guanosine; U, uridine; C, cytidine; mA, 2'-O-methyl-adenosine; mU, 2'-O-methyl-uridine; mC, 2'-O-methyl-cytidine; pC, 5'-phosphorylated cytidine. Figure B shows the proposed structure of the pre-ligated complex. The acceptor and donor sequences are shown, and the acceptor and donor sequences correspond to... Figure 7 The receptor and donor sequences are shown in inset A. Phosphate esters are indicated by circles. Inset C shows a chromatogram illustrating: 1, the receptor fragment; 2, the donor fragment; 3, the products of the reaction of the receptor and donor fragments with T4 RNA ligase 2. The reaction contained 10 μM of donor fragment, 10 μM of receptor fragment, 40 μL of 1x T4 RNA ligase 2 reaction buffer (NEB), and 20 units of T4 RNA ligase 2, and was performed at 37 °C.

[0185] Figure 8 Figure A illustrates the design of RNA donor 1 (Dnr-01), RNA acceptor 1 (Acp-01), and the RNA fragment design of the ligation complex. The sequences of Dnr-01 and Acp-01 are shown in Table 4. The letter "P" indicates the phosphate ester and the ligation position. Figure 8 Figure B depicts the HPLC chromatograms of the reaction of Acp-1 and Dnr-1 with and without T4 RNA ligase 2. “FLP” stands for “full-length product”.

[0186] Figure 9 Figure A depicts the RNA fragment design of RNA receptor 2 (Acp-02), RNA donor 2 (Dnr-02), and the linker complex. The letter "P" indicates the phosphate ester and the location of the linker. Figure 9 Figure B depicts the HPLC chromatograms of the reaction of Acp-02 and Dnr-02 with and without the ligase T4 RNA ligase 1. The sequences of Acp-02 and Dnr-02 are shown in Table 4. “FLP” indicates “full-length product”.

[0187] Figure 10 Figure A depicts the RNA fragment design of RNA receptor 3 (Acp-03), RNA donor 3 (Dnr-03), and the linker complex. The letter "P" indicates the phosphate ester and the location of the linker. Figure 10 Figure B depicts the HPLC chromatograms of the reactions of Acp-03 and Dnr-03 in the presence and absence of T4 RNA ligase 2. Figure 10 Figure C depicts the fragment design of RNA receptor 4 (Acp-04), RNA donor 4 (Dnr-04), and the linker complex. The letter "P" indicates the location of the linker site. Figure 10 Figure D depicts the HPLC chromatograms of the reaction of RNA receptor 4 (Acp-04) and RNA donor 4 (Dnr-04) with and without T4 RNA ligase 2. The sequences of Acp-03 and Dnr-03 are shown in Table 4. “FLP” indicates “full-length product”.

[0188] Figure 11 Figure A depicts the RNA fragment design of RNA receptor 5 (Acp-05), RNA donor 5 (Dnr-05), and the linker complex. The letter "P" indicates the location of the linker site. Figure 11 Figure B depicts the HPLC chromatograms of the reaction between Acp-05 and Dnr-05 with and without ligase 2. Figure 11 Figure C depicts the RNA fragment design of RNA receptor 6 (Acp-06), RNA donor 6 (Dnr-06), and the linker complex. The letter "P" indicates the location of the linker site. Figure 11 Figure D depicts the HPLC chromatograms of the reactions of Acp-06 and Dnr-06 with and without T4 RNA ligase 2. The sequences of Acp-05 and Dnr-05 are shown in Table 4. The letter "P" indicates the location of the ligation site. "FLP" indicates "full-length product".

[0189] Figure 12 Figure A depicts the fragment design of RNA receptor 7 (Acp-07), RNA donor 7 (Dnr-07), and the linker complex. The letter "P" indicates the location of the linker site. Figure 12 Figure B depicts the HPLC chromatograms of the reaction of Acp-07 and Dnr-07 with and without T4 RNA ligase 2. The sequences of Acp-07 and Dnr-07 are shown in Table 4. “FLP” indicates “full-length product”. Byproducts generated during the reaction are marked with “*”.

[0190] Figure 13This is a graph showing the reaction yield (“FLP”) as a function of the initial fragment concentration (g / L). For these studies, RNA receptor 5 / RNA donor 5 (Acp / Dnr-05) and RNA receptor 6 / RNA donor 6 (Acp / Dnr-6) were used. “FLP” stands for “full-length product”.

[0191] Figure 14 Figure A illustrates the fragment design of the following extensively modified segments: RNA receptor 8 (Acp-08), RNA donor 8 (Dnr-08), and the linker complex. The sequences of Acp-08 and Dnr-08 are shown in Table 4. The nucleotides highlighted / shaded in Figure A indicate positions modified with a 2'-O-methyl group. The letter "P" indicates the location of the linker site. Figure 14 Figure B depicts the HPLC chromatograms of these reactions. The letter "P" indicates the phosphate ester and the location of the linkage. Figure 14 Figure B shows the chromatograms of the reaction in the presence (solid line) and absence (dashed line) of the ligase (T4 RNA ligase 2). “FLP” indicates the full-length product.

[0192] Figure 15 This is a graph showing the percentage of editing in fibroblasts using one of three guide RNAs (AD-08, AD-05, AD-06) synthesized using a self-template ligation method, and an adenine base editor (ABE).

[0193] Figure 16 This is a schematic diagram illustrating the sequence and secondary structure of the *Bacillus hisashii* bhCas12b sgRNA. The diagram shows regions labeled "A," "B," and "C," which represent hairpin loop structures that can be targeted as sites for splitting the sgRNA. The letter "N" in the sequence represents any nucleobase. Detailed Implementation

[0194] This invention provides a method for producing synthetic RNA. Any synthetic RNA can be produced using the methods described herein. For example, in some embodiments, the provided ligation method can be used to produce guide RNA (gRNA), which, when used with site-directed modification peptides such as Cas9, Cpf1, SaCas, Cas12, Cas13, base editors, and guide editors, can be used to modify specific loci in target DNA or RNA. The inventors have surprisingly discovered a method for producing gRNA from RNA fragments that results in gRNA with high purity, integrity, and final (purified) yield.

[0195] Various aspects of the invention are described in detail in the following sections. The use of terms is not intended to limit the invention. Each section may be applied to any aspect of the invention. In this application, unless otherwise stated, the use of "or" means "and / or".

[0196] guide RNA ( gRNA )

[0197] The gRNA comprises a polynucleotide sequence complementary to the target sequence. The gRNA hybridizes to the target nucleic acid sequence and guides the CRISPR complex to bind to the target nucleic acid sequence specifically. In some embodiments, the RNA guide has 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity with the target nucleic acid sequence.

[0198] In some embodiments, the gRNA of the present invention is between about 50 and 250 nucleotides. Therefore, in some embodiments, the length of the gRNA of the present invention is about 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, or 250 nucleotides. In some embodiments, the length of the gRNA is between about 50 and 75 nucleotides. In some embodiments, the length of the gRNA is between about 75 and 100 nucleotides. In some embodiments, the length of the gRNA is between about 100 and 125 nucleotides. In some embodiments, the gRNA is between about 125 and 150 nucleotides in length. In some embodiments, the gRNA is between about 150 and 175 nucleotides in length. In some embodiments, the gRNA is between about 175 and 200 nucleotides in length. In some embodiments, the gRNA is between about 200 and 225 nucleotides in length. In some embodiments, the gRNA is between about 225 and 250 nucleotides in length. In some embodiments, the gRNA is a “guide editing RNA” or a “pegRNA”. See Anzalone et al., Nature, October 21, 2019, the contents of which are incorporated herein by reference.

[0199] In some embodiments, the gRNA comprises linked crRNA and tracrRNA. Various crRNA and tracrRNA sequences are known in the art, such as those associated with several type II CRISPR-Cas9 systems (e.g., WO2013 / 176772), Cpf1, SaCas, Cas12, and guide editing Cas.

[0200] gRNAs can be designed to target any target sequence. Optimal alignment can be determined using any algorithm used for sequence alignment, including the Needleman-Wunsch algorithm, the Smith-Waterman algorithm, the Burrows-Wheeler algorithm, ClustlW, ClustlX, BLAST, Novoalign, SOAP, Maq, and ELAND.

[0201] In some embodiments, the gRNA is programmed to target a unique target sequence within the cell genome. In some embodiments, the gRNA is programmed to lack a PAM sequence. In some embodiments, the gRNA sequence is programmed to have an optimal secondary structure using a folding algorithm including mFold or Geneious. In some embodiments, gRNA expression can be performed under an inducible promoter, such as hormone-inducible, tetracycline or doxycycline-inducible, arabinose-inducible, or photoinducible.

[0202] In some embodiments, the gRNA sequence is a “dead crRNA,” a “dead guide,” or a “dead guide sequence,” which can form a complex with a CRISPR-associated protein and bind to a specific target without any substantial nuclease activity.

[0203] In some embodiments, the gRNA is chemically modified in its sugar phosphate backbone or bases. In some embodiments, the gRNA has one or more modifications of 2'O-methyl, 2'-F, or locked nucleic acid to improve nuclease resistance or base pairing. In some embodiments, the gRNA may contain modified bases such as 2-thioureadiene or N6-methyladenosine.

[0204] In some embodiments, the gRNA is conjugated with other oligonucleotides, peptides, proteins, tags, dyes, or polyethylene glycol.

[0205] In some embodiments, the gRNA comprises an aptamer or riboswitching sequence that binds to a specific target molecule due to its three-dimensional structure.

[0206] In some embodiments, the length of the loop-forming sequence is 3, 4, 5 or more nucleotides. In some embodiments, the loop has the sequences GAAA, AAAAG, CAAA and / or AAAAC.

[0207] In some embodiments, the gRNA has two, three, four, or five hairpins.

[0208] In some embodiments, the gRNA contains a transcription termination sequence comprising a polyT sequence comprising six nucleotides.

[0209] Synthesis Wizard RNA The generation

[0210] This article describes a method for preparing synthetic RNA, such as guide RNA (gRNA). The method produces synthetic RNA, such as gRNA, with high integrity and yield.

[0211] The ligation strategy described in this article differs from previously reported chemical ligation strategies for synthesizing synthetic RNAs such as gRNA, because those strategies form native phosphate bonds at the ligation site. The advantage of using a fragmented synthesis method (as described herein) is that short segments of RNA can be produced with higher purity after purification compared to full-length gRNA. In this method, the 5' acceptor is the smallest RNA fragment (approximately 30-50 nts), and therefore can be purified to a high level prior to ligation. The 3' donor terminates with the desired phosphate ester for synthesis, and therefore only the full-length fragment will be incorporated into the full-length product (i.e., the truncated fragment is not a substrate).

[0212] The advantages of the methods described herein increase when considering gRNAs larger than 100 nts, such as pegRNAs or Cas12b guides. The enzymatic ligation types described herein have very high yields (>80%), and the oligonucleotide starting material can be highly selectively separated from the ligation product, thus ensuring very pure full-length products. These types of enzymatic ligation are relatively inexpensive and scale well.

[0213] Self-template method for generating synthetic gRNA

[0214] In some aspects, methods for preparing synthetic gRNA include: providing a first RNA and a second RNA that are complementary, wherein complementarity allows base pairing and the formation of a stem-loop between the first and second RNAs; and ligating the first and second RNAs within the stem-loop using a ligase to produce synthetic gRNA. This allows the use of a helix or other structure formed between the first and second RNAs to template the enzymatic ligation of the two RNAs. In some embodiments, the length and sequence composition of the structure formed between the first and second RNAs are modified to promote non-covalent assembly and create an optimal ligation site compatible with RNA-ligation enzymes.

[0215] The complementarity between the nucleotide extensions of the first and second RNA can be partial or complete. This complementarity allows for base pairing between complementary nucleotides. In regions of partial complementarity, mismatched nucleotides can lead to the formation of bumps or loops between the first and second RNA molecules. Various structures can be formed between the two RNA molecules based on hybridization between them. Exemplary structures that can be formed between the first and second RNA molecules are shown in […]. Figure 2 The connection between the two RNA molecules can occur at a stem, helix, loop, protrusion, flat end, or protrusion.

[0216] Using this method, the first RNA synthesized has a phosphate ester (called the donor) at its 5' end, which is then linked to the 3' end of a second RNA (called the acceptor) that includes a variable prototype spacer region via one of a variety of ligases.

[0217] In some embodiments, this method is used to ligate two or more RNA fragments. For example, in some embodiments, a self-template method is used to ligate 2, 3, 4, 5, 6, 7, 8, 9, 10, or more RNA fragments. Therefore, in some embodiments, a self-template method for generating synthetic RNA includes: providing two or more RNA fragments; providing oligonucleotides that are partially complementary to the two or more RNA fragments, wherein the complementarity of the oligonucleotides allows base pairing with the two or more RNA fragments; and providing a ligase to catalyze the ligation between the two or more RNA fragments, thereby generating synthetic guide RNA.

[0218] Various ligases can be used in conjunction with the methods described herein. For example, one or more of the following can be used: T4 RNA ligase 1, T4 RNA ligase 2, RtcB ligase, thermostable 5'App DNA / RNA ligase, ElectroLigase, T4 DNA ligase, T3 DNA ligase, T7 DNA ligase, Taq DNA ligase, SplintR ligase, E. coli DNA ligase, 9°N DNA ligase, CircLigase, CircLigase II, DNA ligase I, DNA ligase III, and DNA ligase IV. In some embodiments, T4 RNA ligase 1 is used to ligate the first and second RNA at the terminal loop. In some embodiments, T4 RNA ligase 2 is used to ligate the first and second RNA within a stem formed between the first and second RNA.

[0219] This method allows for various ligation methods, such as ligation within the hairpin loop formed between the first and second RNA molecules. Various ligases are suitable for ligation at the hairpin loop, such as T4 RNA ligase 1. Another possible ligation method is within the double helix formed between the first and second RNA molecules. Various ligases are suitable for ligation at the double helix formed between the two RNA molecules, such as T4 RNA ligase 2 and DNA ligase.

[0220] In some embodiments, the first RNA is trans-activating RNA (tracrRNA), and the second RNA is clustered regularly spaced short palindromic repeat (CRISPR) RNA (crRNA).

[0221] In some embodiments, the length of the first RNA is between about 10 and about 100 nucleotides. Therefore, in some embodiments, the length of the first RNA is between about 10 and 25 nucleotides. In some embodiments, the length of the first RNA is between about 25 and 40 nucleotides. In some embodiments, the length of the first RNA is between about 40 and 45 nucleotides. In some embodiments, the length of the first RNA is between about 45 and 60 nucleotides. In some embodiments, the length of the first RNA is between about 60 and 75 nucleotides. In some embodiments, the length of the first RNA is between about 75 and 90 nucleotides. In some embodiments, the length of the first RNA is between about 90 and 100 nucleotides.

[0222] In some embodiments, the length of the second RNA is between about 10 and about 100 nucleotides. Therefore, in some embodiments, the length of the second RNA is between about 10 and 25 nucleotides. In some embodiments, the length of the second RNA is between about 25 and 40 nucleotides. In some embodiments, the length of the second RNA is between about 40 and 45 nucleotides. In some embodiments, the length of the second RNA is between about 45 and 60 nucleotides. In some embodiments, the length of the second RNA is between about 60 and 75 nucleotides. In some embodiments, the length of the second RNA is between about 75 and 90 nucleotides. In some embodiments, the length of the second RNA is between about 90 and 100 nucleotides.

[0223] Splint strand template method in RNA synthesis

[0224] In some embodiments, a splint chain is used in the production of synthetic RNA. Using a splint chain allows one or more RNA molecules to be physically close together so that the splint chain can be used as a template for the reaction. Using a splint chain facilitates the production of synthetic RNA when more than two RNA molecules need to be ligated.

[0225] The splint chain can be any suitable polymer capable of bringing one or more RNA molecules close together. For example, in some embodiments, the splint chain is an RNA molecule or a DNA molecule.

[0226] In some embodiments, the splint chain is complementary to segments of the first RNA and the second RNA. This complementarity may be partial or complete. Therefore, in some embodiments, a method for producing synthetic RNA such as guide RNA is provided, the method comprising: providing a first RNA comprising a 5' phosphate ester; providing a second RNA comprising a free 3'-hydroxyl group; providing an oligonucleotide that is partially complementary to the first RNA and the second RNA, wherein the complementarity of the oligonucleotide allows base pairing with the first RNA and the second RNA; and providing a ligase to catalyze the ligation between the first RNA and the second RNA, thereby producing gRNA.

[0227] In some embodiments, the splint chain is not complementary to the segments of the first and second RNAs to be coupled. Therefore, in some embodiments, a method for producing synthetic RNA such as guide RNA is provided, the method comprising: providing a first RNA comprising a 5' phosphate ester; providing a second RNA comprising a free 3'-hydroxyl group; providing an oligonucleotide that is not complementary to the nucleotides of the first and second RNAs to be coupled; and providing a ligase to catalyze the ligation between the first and second RNAs, thereby producing gRNA.

[0228] Non-template methods for generating synthetic RNA

[0229] In some embodiments, non-template methods are used to generate synthetic RNA, such as guide RNA.

[0230] In some embodiments of the non-template method, a first RNA having a 5' phosphate ester (e.g., a 5' monophosphate ester) is provided, and a second RNA including a blocked 3' end (e.g., a blocked 3' OH) is provided. The purpose of blocking the 3' OH of the second RNA is to prevent the second RNA from circularizing via a non-template mechanism during ligation. For example, using such a non-template method may include a second RNA comprising a chemically blocked or removed 3' hydroxyl group (e.g., a dideoxynucleotide) at the 3' end of a donor molecule, and an enzyme (particularly via T4 RNA ligase 1) catalyzes the appropriate ligation between the first and second RNA. In some embodiments, this ligation strategy is carried out at high concentrations.

[0231] Therefore, in some aspects, non-template methods for producing synthetic RNA include: providing a first RNA comprising a 5'-monophosphate; providing a second RNA comprising a blocked 3' end; and providing a ligase to catalyze the ligation between the first RNA and the second RNA, thereby producing gRNA.

[0232] Chemically modified RNA

[0233] In some embodiments, the first RNA and / or the second RNA includes chemical modifications to its backbone or one or more bases thereof. For example, the chemically modified RNA may comprise a chemical synthesis that can be used to mount a highly modified monomer containing modified sugars, bases, backbones, or functional groups that are not similar to natural nucleotides.

[0234] Therefore, in some embodiments, the first RNA and / or the second RNA includes modified bases. In some embodiments, the modified RNA comprises one or more of the following: 2'-O-methoxy-ethyl bases (2'-MOE), such as 2-methoxyethoxy A, 2-methoxyethoxy MeC, 2-methoxyethoxy G, 2-methoxyethoxy T. Other modified bases include, for example, 2'-O-methyl RNA bases and fluorinated bases. Various fluorinated bases are known and include, for example, fluorinated C, fluorinated U, fluorinated A, and fluorinated G bases. Various 2'O-methyl modifications may also be used in conjunction with the methods described herein. For example, the following RNAs, including one or more of the following 2'O methyl modifications, can be used with the method: 2'-OMe-5-methyl-rC, 2'-OMe-rT, 2'-OMe-rI, 2'-OMe-2-amino-rA, amino-linker-C6-rC, amino-linker-C6-rU, 2'-OMe-5-Br-rU, 2'-OMe-5-I-rU, 2-OMe-7-Deaza-rG.

[0235] In some embodiments, the first RNA and / or the second RNA includes one or more of the following modifications: phosphate thioester, 2'O-methyl, 2'fluorine (2'F), DNA.

[0236] In some embodiments, the first RNA and / or the second RNA include 2'OMe modifications at the 3' and 5' ends.

[0237] In some embodiments, the first RNA and / or the second RNA includes one or more of the following modifications: 2'-O-2-methoxyethyl (MOE), locked nucleic acid, bridging nucleic acid, unlocking nucleic acid, peptide nucleic acid, morpholino nucleic acid.

[0238] In some embodiments, the first RNA and / or the second RNA includes one or more of the following base modifications: 2,6-diaminopurine, 2-aminopurine, pseudouracil, N1-methyl-pseudouracil, 5'-methylcytosine, 2'-pyrimidinone (zebralin), and thymine.

[0239] Other modified bases include, for example, 2-aminopurine, 5-bromo-dU, deoxyuridine, 2,6-diaminopurine (2-amino-dA), dideoxy-C, deoxyinosine, hydroxymethyl-dC, reverse-dT, Iso-dG, Iso-dC, reverse-dideoxy-T, 5-methyl-dC, 5-methyl-dC, 5-nitroindole, and Super 2'-Fr(C,U), 2'-NH2-r(C,U), 2,2'-dehydration-U, 3'-deoxy-r(A,C,G,U), 3'-O-methyl-r(A,C,G,U), rT, rI, 5-methyl-rC, 2-amino-rA, rSpacer(Abasic), 7-Deaza-rG, 7-Deaza-rA, 8-Oxo-rG, 5-halogenated-rU, ​​N-alkylated-rN.

[0240] Other chemically modified RNAs may be used in this document. For example, the first and / or second RNA may include modified bases such as 5', Int, 3' azide (NHS ester); 5' hexynyl; 5', Int, 3' 5-octadiynyl dU; 5', Int biotin (azide); 5', Int 6-FAM (azide); and 5', Int 5-TAMRA (azide). Other examples of RNA nucleotide modifications that may be used in the methods described herein include, for example, phosphorylation modifications such as 5'-phosphorylation and 3'-phosphorylation. The RNA may also have one or more of the following modifications: amino modification, biotinylation, thiol modification, alkyne modification, adenylate modification, azide (NHS ester), cholesterol-TEG, and digoxigenin (NHS ester).

[0241] Receptor and donor RNA linkage

[0242] In some embodiments, the recipient RNA and donor RNA are joined at a connection site at a predetermined distance from the loop formed between the recipient RNA and the donor RNA. For example, the connection site is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 base pairs from the loop formed between the recipient RNA and the donor RNA. In some embodiments, the connection site is 2 or 3 base pairs from the loop. The loop structure formed between the recipient RNA and the donor RNA can vary in length. For example, the length of the loop formed between the recipient RNA and the donor RNA can be 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 nucleotides. In some embodiments, the loop length is 4. A loop of length 4 is referred to herein as a tetraloop. In some embodiments, the loop comprises 7 nucleotides.

[0243] In some embodiments, the receptor and donor RNA are joined at a junction site at a predetermined distance from the protrusion formed between the receptor and donor RNA. For example, the joining of the receptor and donor RNA occurs at a junction site at least about 3, 4, 5, 6, 7, 8, 10, 11, or 12 base pairs from the protrusion. In some embodiments, the joining of the receptor and donor RNA occurs at a junction site 3, 4, 5, or 11 base pairs from the protrusion.

[0244] Base pairing between the recipient RNA and the donor RNA can occur at the lower stem and / or upper stem. In some embodiments, the recipient RNA and the donor RNA have nucleotide complementarity. This nucleotide complementarity can be partial, for example, the complementarity between the recipient RNA and the donor RNA can be from about 50% to about 99%. In some embodiments, the recipient RNA and the donor RNA have completely complementary nucleotides.

[0245] In some embodiments, the recipient RNA and the donor RNA are present in a ratio of about 0.5:1, 0.6:1, 0.7:1, 0.8:1, 0.9:1, 1:1, 1:0.9, 1:0.8, 1:0.7, 1:0.6, or 1:0.5.

[0246] In some embodiments, the methods described herein allow for the production of gRNAs with improved yields compared to gRNAs produced using conventional synthetic methods. For example, in some embodiments, the gRNAs produced according to the methods described herein exhibit improved yields of approximately 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or more compared to conventional synthetic methods.

[0247] In some embodiments, the GC content of the upper and / or lower stems can affect the yield, productivity, and purity of the RNA ligation reaction.

[0248] In some embodiments, the recipient RNA and donor RNA do not include GC base pairs in the upper stem.

[0249] In some embodiments, a single donor fragment can be used with various recipient fragments. In this way, the donor fragment can serve as a universal donor fragment that can pair with one or more combinations of various recipient fragments.

[0250] In some embodiments, the recipient RNA and donor RNA are engineered to contain GC base pairs in the upper stem. In some embodiments, the recipient RNA and donor RNA comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 GC base pairs in the upper stem. In some embodiments, the recipient RNA and donor RNA comprise 2 GC nucleotides in the upper stem. The exemplary upper stem nucleotides described herein comprise: CGAUACGACAGAAC (SEQ ID NO:1); CGCCG (SEQ ID NO:2); CGGCCGC (SEQ ID NO:3); CGCGC (SEQ ID NO:4); and CGAU (SEQ ID NO:5).

[0251] In some embodiments, the recipient RNA and donor RNA do not include GC base pairs in the lower stem. In some embodiments, the recipient RNA and donor RNA include GC base pairs in the lower stem.

[0252] In some embodiments, the concentrations of the receptor and donor RNA are between about 1 g / L and 5 g / L. In some embodiments, the concentrations of the receptor and donor RNA affect the yield, productivity, and purity of the resulting gRNA.

[0253] In some embodiments, the temperature at which the ligation reaction occurs affects the yield or productivity of the RNA ligation reaction. In some embodiments, the temperature at which the ligation reaction occurs is about 15°C, 16°C, 17°C, 18°C, 19°C, 20°C, 21°C, 22°C, 23°C, 24°C, 25°C, 26°C, 27°C, 28°C, 29°C, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, or 40°C. Therefore, in some embodiments, the temperature at which the ligation reaction occurs is about 15°C. In some embodiments, the temperature at which the ligation reaction occurs is about 16°C. In some embodiments, the temperature at which the ligation reaction occurs is about 17°C. In some embodiments, the temperature at which the ligation reaction occurs is about 18°C. In some embodiments, the temperature at which the ligation reaction occurs is about 19°C. In some embodiments, the temperature at which the ligation reaction occurs is about 20°C. In some embodiments, the temperature at which the ligation reaction occurs is about 21°C. In some embodiments, the temperature at which the ligation reaction occurs is about 22°C. In some embodiments, the temperature at which the ligation reaction occurs is about 23°C. In some embodiments, the connection reaction occurs at a temperature of about 24°C. In some embodiments, the connection reaction occurs at a temperature of about 25°C. In some embodiments, the connection reaction occurs at a temperature of about 26°C. In some embodiments, the connection reaction occurs at a temperature of about 27°C. In some embodiments, the connection reaction occurs at a temperature of about 28°C. In some embodiments, the connection reaction occurs at a temperature of about 29°C. In some embodiments, the connection reaction occurs at a temperature of about 30°C. In some embodiments, the connection reaction occurs at a temperature of about 31°C. In some embodiments, the connection reaction occurs at a temperature of about 32°C. In some embodiments, the connection reaction occurs at a temperature of about 33°C. In some embodiments, the connection reaction occurs at a temperature of about 34°C. In some embodiments, the connection reaction occurs at a temperature of about 35°C. In some embodiments, the connection reaction occurs at a temperature of about 36°C. In some embodiments, the connection reaction occurs at a temperature of about 37°C. In some embodiments, the connection reaction occurs at a temperature of about 38°C. In some embodiments, the connection reaction occurs at a temperature of about 39°C. In some embodiments, the connection reaction occurs at a temperature of about 40°C.

[0254] In some embodiments, the recipient RNA and donor RNA comprise at least two RNA nucleotides that are completely complementary. In some embodiments, the recipient RNA and donor RNA comprise 5 typical base pairs in the lower stem. In some embodiments, the recipient RNA and donor RNA comprise 2 atypical base pairs in the lower stem. In some embodiments, the recipient RNA and donor RNA comprise 2 typical base pairs in the upper stem. In some embodiments, the recipient RNA and donor RNA comprise 8 base pairs. In some embodiments, the base pairs are not consecutive. In some embodiments, the base pairs are consecutive.

[0255] use gRNA Gene editing

[0256] The synthetic gRNAs described herein can be used in conjunction with suitable gene editing systems for targeted gene editing, which can lead to gene silencing events or alterations in the expression of desired target genes (e.g., increases or decreases). Therefore, in some embodiments, the synthetic gRNAs described herein can be used in methods of targeting transcriptional activation, targeting transcriptional repression, targeting epigenome modification, or targeting genome modification, said methods comprising introducing into eukaryotic cells: (a) a synthetic guide RNA (gRNA) as defined herein; (b) at least one CRISPR / Cas protein or nucleic acid encoding said at least one CRISPR / Cas protein; wherein the interaction between (a) and (b) and a target sequence in chromosomal DNA causes targeted transcriptional activation, targeted transcriptional repression, targeted epigenome modification, or targeted genome modification.

[0257] In some embodiments, the synthetic RNA described herein can be used in a gene editing system comprising: the synthetic guide RNA described herein, wherein the RNA guide includes a homologous repeat sequence and a spacer sequence capable of hybridizing with a target nucleic acid; a gene editing protein, and wherein the gene editing enzyme is capable of binding to the RNA guide and causing a break in a target nucleic acid sequence complementary to the RNA guide.

[0258] In some embodiments, the synthetic RNA described herein can be used in a gene editing system comprising: the synthetic guide RNA described herein, wherein the RNA guide includes a homologous repeat sequence and a spacer sequence capable of hybridizing with a target nucleic acid; and a gene editing protein h; wherein the gene editing protein is fused with a deaminase, and wherein the gene editing protein fusion is capable of binding to the RNA guide and editing a target nucleic acid sequence complementary to the RNA guide.

[0259] In some embodiments, the present invention provides a method for altering the expression of a target nucleic acid in eukaryotic cells, the method comprising: contacting the cells with a gene-editing protein and a synthetic guide RNA as described herein, wherein the RNA guide includes a homologous repeat sequence and a spacer sequence capable of hybridizing with the target nucleic acid, and wherein the gene-editing protein is capable of binding to the RNA guide and causing a break in a target nucleic acid sequence complementary to the RNA guide.

[0260] In some embodiments, the present invention provides a method for altering the expression of a target nucleic acid in eukaryotic cells, the method comprising: contacting the cells with a gene-editing protein and a synthetic guide RNA as described herein, wherein the RNA guide includes a homologous repeat sequence and a spacer sequence capable of hybridizing with the target nucleic acid, and wherein the gene-editing protein is capable of binding to the RNA guide and editing a target nucleic acid sequence complementary to the RNA guide.

[0261] In some embodiments, the present invention provides a method for modifying target nucleic acids in eukaryotic cells, the method comprising: contacting the cells with a gene-editing protein and a synthetic guide RNA as described herein, wherein the RNA guide includes a homologous repeat sequence and a spacer sequence capable of hybridizing with the target nucleic acid, and wherein the gene-editing protein is capable of binding to the RNA guide and editing a target nucleic acid sequence complementary to the RNA guide.

[0262] In some embodiments, the gene editing method or system includes a fusion protein having an effector that modifies target DNA in a site-specific manner, wherein the modification activity includes methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin ligase activity, deubiquitination activity, adenylation activity, deadenylation activity, SUMOylation activity, deSUMOylation activity, ribosylation activity, deribosylation activity, myristoylation activity, demyristoylation activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, or nuclease activity, any of which can modify DNA or DNA-related polypeptides (e.g., histones or DNA-binding proteins).

[0263] In some embodiments, the gene editing method or system includes a fusion protein and an enzyme that can edit DNA sequences by chemically modifying nucleotide bases, the enzyme comprising a deaminase that can modify adenosine or cytosine bases and act as a site-specific base editor. For example, the APOBEC1 cytidine deaminase, which typically uses RNA as a substrate, can target single-stranded and double-stranded DNA upon fusion with Cas9, thereby directly converting cytidine to uridine, and has evolved a TadA enzyme to deaminate adenosine to inosine. Thus, “base editing” using deaminases enables the programmable conversion of one target DNA base to another. Various base editors are known in the art and can be used in the methods and systems described herein. Exemplary base editors are described in, for example, Rees and Liu, Nature Review Genetics, 2018, 19(12):770-788, the contents of which are incorporated herein by reference.

[0264] In some embodiments, base editing results in the introduction of a stop codon to silence a gene. In some embodiments, base editing alters protein function by changing the amino acid sequence.

[0265] In some embodiments, the synthetic guide RNA described herein can be used in gene editing methods or systems to regulate the transcription of target DNA. In some embodiments, the synthetic guide RNA can be used in gene editing methods or systems to regulate the expression of target non-coding RNAs, said target non-coding RNAs including tRNA, rRNA, snoRNA, siRNA, miRNA, and long ncRNA.

[0266] In some embodiments, the synthetic guide RNA described herein is used for targeted engineering of chromatin loop structures using a suitable gene editing system. Targeted engineering of chromatin loops regulating genomic regions provides a means of manipulating endogenous chromatin structures and forming novel enhancer-promoter connections to overcome genetic defects or suppress aberrant enhancer-promoter connections.

[0267] In some embodiments, the synthetic guide RNA described herein is used in conjunction with a gene editing system to correct pathogenic mutations by inserting beneficial clinical variants or suppressing mutations.

[0268] Therapeutic applications

[0269] The synthetic guide RNA described herein can be used in gene editing systems for various therapeutic applications. Therefore, in some embodiments, a method for treating a condition or disease in a subject in need is provided, the method comprising administering the synthetic guide RNA described herein to the subject, which has a gene editing system. Various gene editing systems are known in the art and include, for example, CRISPR-Cas9, Cpf1, SpCas9, SaCas, Cas12, and guided editing Cas. The synthetic gRNA described herein can be used with any gene editing system.

[0270] In some embodiments, the synthetic guide RNA described herein can be used in conjunction with gene editing systems to treat a variety of diseases and conditions, such as genetic conditions (e.g., single-gene diseases), diseases that can be treated by nuclease activity, and various cancers.

[0271] In some embodiments, the synthetic guide RNA described herein can be used in conjunction with a gene editing system to edit target nucleic acids, thereby modifying the target nucleic acid (e.g., by inserting, deleting, or mutating one or more nucleic acid residues). For example, in some embodiments, a CRISPR system is used in conjunction with the synthetic gRNA described herein and includes an exogenous donor template nucleic acid (e.g., a DNA molecule or an RNA molecule) comprising the desired nucleic acid sequence. After resolving a cleavage event induced by the CRISPR system, the cell's molecular mechanisms will utilize the exogenous donor template nucleic acid to repair and / or resolve the cleavage event. Alternatively, the cell's molecular mechanisms may utilize an endogenous template to repair and / or resolve the cleavage event. In some embodiments, the synthetic guide RNA described herein is used in conjunction with a gene editing system to alter the target nucleic acid that results in insertion, deletion, and / or point mutation. In some embodiments, the insertion is a seamless insertion (i.e., inserting the intended nucleic acid sequence into the target nucleic acid, resulting in no additional unintended nucleic acid sequence after resolving the cleavage event). The donor template nucleic acid can be a double-stranded or single-stranded nucleic acid molecule (e.g., DNA or RNA).

[0272] On the one hand, the synthetic guide RNA described in this article can be used in conjunction with gene editing systems to treat diseases caused by the overexpression of RNA, toxic RNA, and / or mutant RNA (e.g., splicing defects or truncation).

[0273] In some embodiments, the synthetic guide RNA described herein can be used in conjunction with a gene editing system to target trans-acting mutations that affect RNA-dependent function causing various diseases.

[0274] In some embodiments, the synthetic guide RNA described herein can be used in conjunction with a gene editing system to target and disrupt mutations in cis-acting splicing codes that can cause splicing defects and disease.

[0275] The synthetic guide RNAs described herein can be used in conjunction with gene editing systems to achieve antiviral activity, particularly against RNA viruses. For example, a suitable synthetic RNA guide can be used to target viral RNA, the guide being selected to target the viral RNA sequence.

[0276] The synthetic guide RNA described herein can be used in conjunction with gene editing systems to treat cancer in subjects (e.g., human subjects). For example, it can induce cell death in cancer cells (e.g., through apoptosis) by targeting RNA molecules that are abnormal (e.g., including point mutations or alternative splicing) and found in cancer cells.

[0277] The synthetic guide RNA described herein can be used in conjunction with gene editing systems to treat infectious diseases in subjects. For example, it can target and induce cell death in the cells of an infectious agent by targeting RNA molecules expressed by the agent (e.g., bacteria, viruses, parasites, or protozoa). The synthetic guide RNA described herein can also be used in conjunction with gene editing systems to treat diseases caused by intracellular infectious agents infecting host subject cells.

[0278] In applications where the goal is to insert a polynucleotide sequence into a target DNA sequence, the cell is also provided with a polynucleotide comprising a donor sequence to be inserted. A “donor sequence” or “donor polynucleotide” refers to a nucleic acid sequence to be inserted at a cleavage site induced by a site-directed modified polypeptide. The donor polynucleotide will have sufficient homology at the cleavage site with the genomic sequence, for example, 70%, 80%, 85%, 90%, 95%, or 100% homology with the nucleotide sequence of a flanking cleavage site (e.g., within about 50 bases, such as within about 30 bases, within about 15 bases, within about 10 bases, within about 5 bases, or immediately adjacent to the flanking cleavage site), to support homology-directed repair between itself and the homologous genomic sequence. A sequence homology of approximately 25, 50, 100, or 200 nucleotides, or more (or any integer value between 10 and 200 or more nucleotides), between the donor and genome sequences will support homology-directed repair. The donor sequence can be of any length, such as 10 or more nucleotides, 50 or more nucleotides, 100 or more nucleotides, 250 or more nucleotides, 500 or more nucleotides, 1000 or more nucleotides, 5000 or more nucleotides, etc.

[0279] The donor sequence is typically different from the genomic sequence it replaces. Instead, the donor sequence may contain at least one or more single-base alterations, insertions, deletions, inversions, or rearrangements relative to the genomic sequence, provided there is sufficient homology to support homology-directed repair. In some embodiments, the donor sequence includes non-homologous sequences flanked by two homologous regions, such that homology-directed repair between the target DNA region and the two flanking sequences results in the insertion of the non-homologous sequences at the target region. The donor sequence may also include a vector backbone containing sequences that are dislogged from the DNA region of interest and are not intended to be inserted into the DNA region of interest. Typically, the homologous regions of the donor sequence will have at least 50% sequence identity with the genomic sequence to be recombined. In some embodiments, there are 60%, 70%, 80%, 90%, 95%, 98%, 99%, or 99.9% sequence identity. Depending on the length of the donor polynucleotide, any value between 1% and 100% sequence identity may exist.

[0280] Compared to the genomic sequence, the donor sequence may include certain sequence differences, such as restriction sites, nucleotide polymorphisms, and optional markers (e.g., drug resistance genes, fluorescent proteins, enzymes, etc.). These sequence differences can be used to assess successful insertion of the donor sequence at the cleavage site, or in some cases, for other purposes (e.g., indicating expression at a target genomic locus). In some cases, if located in a coding region, such nucleotide sequence differences will not alter the amino acid sequence or will alter silent amino acids (i.e., do not affect the structure or function of the protein). Alternatively, these sequence differences may include side-joined recombinant sequences, such as FLP, loxP, etc., which can be activated at a later time to remove the marker sequence.

[0281] The donor sequence can be provided to cells as single-stranded DNA, single-stranded RNA, double-stranded DNA, or double-stranded RNA. It can be introduced into cells in a linear or circular form. If introduced in a linear form, the ends of the donor sequence can be protected (e.g., to prevent exonuclease degradation) by methods known to those skilled in the art. For example, one or more dideoxynucleotide residues can be added to the 3' end of a linear molecule and / or a self-complementary oligonucleotide can be attached to one or both ends. Other methods for protecting exogenous polynucleotides from degradation include, but are not limited to, adding terminal amino groups and using modified internucleotide bonds, such as phosphate thioesters, aminophosphates, and O-methylribose or deoxyribose residues. As an alternative to protecting the ends of the linear donor sequence, an additional length of sequence can be included outside the homologous region, which can be degraded without affecting recombination. The donor sequence can be introduced into cells as part of a vector molecule having additional sequences, such as origin of replication, promoters, and genes encoding antibiotic resistance. In addition, the donor sequence can be introduced as a naked nucleic acid, as a nucleic acid complexed with a drug such as liposomes or poloxamer, or delivered via a virus (e.g., adenovirus, AAV), as described above for nucleic acids encoding RNA and / or site-modified polypeptides and / or donor polynucleotides encoding target DNA.

[0282] Following the method described above, the DNA region of interest for "genetic modification" can be cut and modified in vitro. In some embodiments, when an optional marker is inserted into the DNA region of interest, the cell population can be enriched to include the genetically modified cells by separating the genetically modified cells from the remaining cell population. Before enrichment, the genetically modified cells may constitute only about 1% or more of the cell population (e.g., 2% or more, 3% or more, 4% or more, 5% or more, 6% or more, 7% or more, 8% or more, 9% or more, 10% or more, 15% or more, or 20% or more). The separation of the genetically modified cells can be achieved by any convenient separation technique suitable for the optional marker used. For example, if a fluorescent marker has been inserted, cells can be separated by fluorescence-activated cell sorting, while if a cell surface marker has been inserted, cells can be separated from the heterogeneous population by affinity separation techniques, such as magnetic separation, affinity chromatography, "panning" with affinity reagents attached to a solid matrix, or other convenient techniques. Techniques providing precise separation include fluorescence-activated cell sorting instruments, which can have varying degrees of complexity, such as multicolor channels, low-angle and obtuse-angle light scattering detection channels, impedance channels, etc. Cells can be selected by targeting dead cells with a dye that associates with them (e.g., propidium iodide). Any technique that does not unduly impair the viability of the genetically modified cells can be used. This achieves a cell composition highly enriched with modified DNA. "Highly enriched" means that the genetically modified cells will constitute 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, for example, about 95% or more, or 98% or more of the cell composition. In other words, the composition can be a substantially pure composition of genetically modified cells.

[0283] Genetically modified cells produced by the methods described herein can be used immediately. Alternatively, the cells can be frozen and stored long-term at liquid nitrogen temperatures, thawed, and reused. In this case, the cells are typically frozen in 10% dimethyl sulfoxide (DMSO), 50% serum, 40% buffer medium, or some other solution commonly used in the art to preserve the cells at such freezing temperatures, and thawed in a manner known in the art for thawing frozen cultured cells.

[0284] Genetically modified cells can be cultured in vitro under various conditions. These cells can be expanded in culture, i.e., grown under conditions that promote their proliferation. The culture medium can be liquid or semi-solid, for example, containing agar, methylcellulose, etc. The cell population can be suspended in a suitable nutrient medium, such as Iscove-modified DMEM or RPMI 1640, which is typically supplemented with fetal bovine serum (approximately 5-10%).

[0285] L-glutamine, thiols, especially 2-mercaptoethanol, and antibiotics such as penicillin and streptomycin. Cultures may contain growth factors to which regulatory T cells respond. As defined herein, growth factors are molecules that promote cell survival, growth, and / or differentiation in cultures or intact tissues through specific actions on transmembrane receptors. Growth factors include peptide and non-peptide factors.

[0286] Genetically modified cells can be transplanted into subjects for gene therapy and other purposes, such as treating diseases or acting as antiviral, antipathogenic, or anticancer agents, for the production of genetically modified organisms in agriculture, or for biological research. Subjects can be newborns, adolescents, or adults. Particular interest is given to mammalian subjects. Mammal species treated using this method include dogs and cats; horses; cattle; sheep, and primates, especially humans. Animal models, particularly small mammals (e.g., mice, rats, guinea pigs, hamsters, lagomorphs (e.g., rabbits), can be used for experimental research.

[0287] Cells can be provided to the subject alone or together with a suitable substrate or matrix, for example, to support their growth and / or tissue development in the transplanted tissue. Typically, at least 1 × 10⁻⁶ cells will be administered. 3 Cells, for example 5 × 10 3 1 cell, 1×10 4 5 × 10 cells 4 1 cell, 1×10 5 1 cell, 1×10 6 One or more cells. Cells can be introduced into a subject via any of the following routes: parenteral, subcutaneous, intravenous, intracranial, intraspinal, intraocular, or into the cerebrospinal fluid. Cells can be introduced via injection, catheter, etc. For the purpose of producing transgenic animals (e.g., transgenic mice), cells can also be introduced into embryos (e.g., blastocysts).

[0288] The number of treatments administered to a subject can vary. Introducing genetically modified cells into a subject may be a one-time event; however, in some cases, this treatment may produce improvement over a limited period and require a series of continuous repeat treatments. In other cases, multiple administrations of genetically modified cells may be necessary before an effect is observed. The exact protocol depends on parameters such as the disease or symptom, the stage of the disease, and the individual subject being treated.

[0289] In other aspects of the invention, the DNA-targeting RNA and / or site-modified polypeptides and / or donor polynucleotides are used in vivo to modify cellular DNA, also for purposes such as gene therapy, for treating diseases or as antiviral, antipathogenic, or anticancer agents, for producing genetically modified organisms in agriculture, or for biological research. In these in vivo embodiments, the DNA-targeting RNA and / or site-modified polypeptides and / or donor polynucleotides are administered directly to an individual. The DNA-targeting RNA and / or site-modified polypeptides and / or donor polynucleotides can be administered by any of the many well-known methods in the art for administering peptides, small molecules, and nucleic acids to a subject. The DNA-targeting RNA and / or site-modified polypeptides and / or donor polynucleotides can be incorporated into a variety of formulations. More specifically, the DNA-targeting RNA and / or site-modified polypeptides and / or donor polynucleotides of the present invention can be formulated into pharmaceutical compositions by combination with a suitable pharmaceutically acceptable carrier or diluent.

[0290] A pharmaceutical formulation is a composition comprising one or more RNAs and / or site-modified polypeptides and / or donor polynucleotides that target DNA and are present in a pharmaceutically acceptable carrier. A “pharmaceutically acceptable carrier” can be a carrier approved by a federal or state regulatory agency or listed in the United States Pharmacopeia or other recognized pharmacopoeia for use in mammals such as humans. The term “carrier” refers to a diluent, adjuvant, excipient, or carrier with which the compounds of the present invention are formulated for administration to mammals. Such pharmaceutical carriers can be lipids, such as liposomes, such as liposome dendritic structures; liquids, such as water and oils containing petroleum, animal, plant, or synthetic oils, such as peanut oil, soybean oil, mineral oil, sesame oil, etc.; brine; gum arabic, gelatin, starch paste, talc, keratin, colloidal silica, urea, etc. Additionally, adjuvants, stabilizers, thickeners, lubricants, and colorants may be used. Pharmaceutical compositions can be formulated into solid, semi-solid, liquid, or gaseous forms, such as tablets, capsules, powders, granules, ointments, solutions, suppositories, injections, inhalers, gels, microspheres, and aerosols. Therefore, the administration of DNA-targeted RNA and / or site-specific modified peptides and / or donor polynucleotides can be achieved in various ways, including oral, oral, rectal, parenteral, intraperitoneal, intradermal, transdermal, intratracheal, and intraocular administration. The active agent can be systemic after administration or targeted by local, intramural, or implant-based methods, wherein the implant serves to maintain an active dose at the implantation site. The active agent can be formulated for immediate activity or for sustained release.

[0291] For some conditions, particularly those of the central nervous system, it may be necessary to formulate drugs to cross the blood-brain barrier (BBB). One strategy for delivering drugs across the BBB involves disrupting the BBB via permeable means such as mannitol or leukotrienes, or biochemically using vasoactive substances such as bradykinin. Utilizing the potential of BBB opening to target specific drugs to brain tumors is also an option. When the composition is administered via intravascular injection, the BBB disruptor can be co-administered with the therapeutic composition of the present invention. Other strategies across the BBB may require the use of endogenous transport systems, including Caveolin-1-mediated transcytosis, carrier-mediated transport proteins such as glucose and amino acid carriers, receptor-mediated insulin or transferrin transcytosis, and active efflux transport proteins such as p-glycoproteins. Active transport moieties may also be conjugated to the therapeutic compounds used in the present invention to facilitate transport across the vascular endothelial wall.

[0292] Alternatively, the delivery of therapeutic agents following the BBB can be via local delivery, such as intrathecal delivery.

[0293] Typically, an effective amount of the RNA and / or site-modified polypeptide and / or donor polynucleotide targeting DNA is provided. As discussed above regarding in vitro methods, the effective amount or effective dose of the RNA and / or site-modified polypeptide and / or donor polynucleotide targeting DNA in vivo is the amount of recombination observed between two homologous sequences induced relative to a negative control, such as cells contacted with an empty vector or an unrelated polypeptide, by a factor of 2 or more. The amount of recombination can be measured by any convenient method, such as those described above and known in the art. The calculation of the effective amount or effective dose of the RNA and / or site-modified polypeptide and / or donor polynucleotide targeting DNA to be administered is within the skill of a person skilled in the art and is routine for those skilled in the art. The final amount to be administered will depend on the route of administration and the nature of the condition or symptom to be treated.

[0294] The effective dose for a particular patient will depend on a number of factors, some of which vary from patient to patient. A competent clinician will be able to determine the effective dose of the therapeutic agent to administer to a patient to stop or reverse the progression of the disease condition as needed. Using LD50 animal data and other available information about the agent, clinicians can determine the maximum safe dose for an individual based on the route of administration. For example, assuming the therapeutic composition is administered into a larger body fluid, the intravenous dose may be greater than the intrathecal dose. Similarly, compositions that are rapidly cleared from the body may be administered at higher doses or in repeated doses to maintain therapeutic concentrations. With general skills, a competent clinician will be able to optimize the dosage of a particular therapeutic agent during routine clinical trials.

[0295] For inclusion in a drug, the RNA and / or site-modified peptides and / or donor polynucleotides targeting DNA can be obtained from suitable commercial sources. As a general recommendation, the total pharmaceutically effective amount of the RNA and / or site-modified peptides and / or donor polynucleotides targeting DNA per parenteral administration will be within a range measurable by dose-response curves.

[0296] Therapies based on DNA-targeting RNA and / or site-modified peptides and / or donor polynucleotides, i.e., formulations of DNA-targeting RNA and / or site-modified peptides and / or donor polynucleotides for therapeutic administration, must be sterile. Sterility is readily achieved through filtration via a sterile filter membrane (e.g., a 0.2 μm membrane). Therapeutic compositions are typically placed in containers with sterile inlets, such as intravenous solution bags or vials with stoppers that can be punctured by a hypodermic needle. DNA-targeting RNA and / or site-modified peptides and / or donor polynucleotides can be stored as aqueous solutions or as lyophilized formulations in single or multi-dose containers (e.g., sealed ampoules or vials) for reconstitution. As an example of a lyophilized formulation, a 10-mL vial is filled with 5 mL of sterile filtered 1% (w / v) aqueous solution of the compound, and the resulting mixture is lyophilized. The infusion solution is prepared by reconstituted with antibacterial water for injection.

[0297] Depending on the desired formulation, the pharmaceutical composition may contain a pharmaceutically acceptable, non-toxic diluent carrier, defined as a carrier commonly used to formulate pharmaceutical compositions for animal or human administration. The diluent is selected to avoid affecting the biological activity of the composition. Examples of such diluents are distilled water, buffered water, physiological saline, PBS, Ringer's solution, glucose solution, and Hank's solution. Additionally, the pharmaceutical composition or formulation may contain other carriers, adjuvants, or non-toxic, non-therapeutic, non-immunogenic stabilizers, excipients, etc. The composition may also contain additional substances that approximate physiological conditions, such as pH adjusters and buffers, toxicity modifiers, wetting agents, and detergents.

[0298] The composition may also contain any of a variety of stabilizers, such as antioxidants. When the pharmaceutical composition contains a polypeptide, the polypeptide may be complexed with a variety of well-known compounds that enhance the in vivo stability of the polypeptide or otherwise enhance its pharmacological properties (e.g., increase the half-life of the polypeptide, reduce its toxicity, and improve its solubility or absorption). Examples of such modifiers or complexing agents include sulfates, gluconates, citrates, and phosphates. The nucleic acids or polypeptides of the composition may also be complexed with molecules that enhance their in vivo properties. Such molecules include, for example, carbohydrates, polyamines, amino acids, other peptides, ions (e.g., sodium, potassium, calcium, magnesium, manganese), and lipids.

[0299] The pharmaceutical composition can be administered for prophylactic and / or therapeutic treatment. The toxicity and therapeutic efficacy of the active ingredient can be determined according to standard pharmaceutical procedures in cell cultures and / or laboratory animals, including, for example, determining the LD50 (the dose that is lethal to 50% of the population) and ED50 (the dose that is therapeutically effective to 50% of the population). The dose ratio between toxic effects and therapeutic effects is the therapeutic index, and said therapeutic index can be expressed as the ratio LD50 / ED50. Therapies exhibiting a large therapeutic index are preferred.

[0300] Data obtained from cell culture and / or animal studies can be used to formulate a range of dosages for human use. Dosages of the active ingredient are typically within a range of circulating concentrations, including the low-toxicity ED50. Dosages may vary within this range depending on the dosage form and route of administration used.

[0301] The components used to formulate pharmaceutical compositions preferably have high purity and are substantially free of potentially harmful contaminants (e.g., at least National Food (NF) grade, typically at least analytical grade, and more usually at least pharmaceutical grade). Furthermore, compositions for in vivo use are generally sterile. For the purpose of synthesizing a given compound prior to use, the resulting product is generally substantially free of any potential toxic agents, particularly any endotoxins that may be present during synthesis or purification. Compositions for parenteral administration are also sterile, substantially isotonic, and prepared under GMP conditions.

[0302] Delivery system

[0303] The synthetic RNA described herein, along with the desired gene editing system components, can be delivered to the cells of interest via various delivery systems such as vectors, including plasmids and delivery vectors.

[0304] The synthetic RNA described herein can be delivered via nanoparticles, which can be organic or inorganic. Nanoparticles are well known in the art. Any suitable nanoparticle design can be used to deliver components of a genome editing system or nucleic acids encoding such components. For example, organic (e.g., lipids and / or polymers) nanoparticles may be suitable as delivery media in some embodiments of this disclosure. Exemplary lipids for nanoparticle formulations and / or gene transfer are shown in Table 1 (below).

[0305] Table 1

[0306]

[0307] Table 2 lists exemplary polymers for gene transfer and / or nanoparticle formulations.

[0308] Table 2

[0309]

[0310] Table 3 summarizes the delivery methods used to encode the polynucleotides described in this paper for Cas9.

[0311] Table 3

[0312]

[0313]

[0314] On the other hand, delivery of genome editing systems containing synthetic gRNAs described herein can be accomplished by delivering ribonucleoproteins (RNPs) into cells. These RNPs include nucleic acid-binding proteins, such as Cas9, that complex with the target gRNA. RNPs can be delivered into cells using known methods, such as electroporation, nuclear transfection, or cationic lipid-mediated methods, as reported, for example, by Zuris, JA et al., 2015, *Nature Biotechnology*, 33(1):73-80. RNPs are advantageous for use in CRISPR base editing systems, particularly for cells that are difficult to transfect, such as primary cells. Furthermore, RNPs can alleviate difficulties in protein expression in cells, especially when eukaryotic promoters (e.g., CMV or EF1A, which can be used for CRISPR plasmids) are poorly expressed. Advantageously, the use of RNPs does not require the delivery of exogenous DNA into the cells. Moreover, since RNPs, which consist of nucleic acid-binding proteins and gRNA complexes, degrade over time, the use of RNPs has the potential to limit off-target effects. In a manner similar to plasmid-based technologies, RNPs can be used to deliver binding proteins (e.g., Cas9 variants) and to guide homology-directed repair (HDR).

[0315] Promoters used to drive CRISPR systems (e.g., containing the synthetic gRNA described herein) may contain AAVITR. This is advantageous in eliminating the need for additional promoter elements that could take up vector space. The freed-up space can be used to drive the expression of other elements, such as guide nucleic acids or selectable markers. ITR activity is relatively weak, and therefore can be used to reduce potential toxicity from overexpression of selected nucleases.

[0316] Any suitable promoter can be used to drive the expression of Cas9 and, at the appropriate time, guide nucleic acids. For ubiquitous expression, suitable promoters include CMV, CAG, CBh, PGK, SV40, ferritin heavy chain, or light chain. For brain or other CNS cell expression, suitable promoters may include: Synapsin I for all neurons, CaMKIIα for excitatory neurons, and GAD67, GAD65, or VGAT for GABAergic neurons. For hepatocyte expression, a suitable promoter includes the albumin promoter. For lung cell expression, a suitable promoter may include SP-B. For endothelial cells, a suitable promoter may include ICAM. For hematopoietic cells, a suitable promoter may include IFNβ or CD45. For osteoblasts, a suitable promoter may include OG-2.

[0317] In some cases, separate promoters drive the expression of a base editor and a compatible guide nucleic acid within the same nucleic acid molecule. For example, a vector or viral vector may include a first promoter operatively linked to a nucleic acid encoding a base editor and a second promoter operatively linked to a guide nucleic acid.

[0318] Promoters used to drive guided nucleic acid expression may include: Pol III promoters, such as U6 or H1; and Pol II promoters and intron boxes to express gRNA adeno-associated virus (AAV).

[0319] Adeno-associated virus (AAV), lentivirus, adenovirus, or other plasmid or viral vector types can be used to deliver Cas9 and synthesize gRNA, particularly using formulations and dosages derived from, for example, U.S. Patent No. 8,454,972 (Formulations and Doses of Adenovirus), U.S. Patent No. 8,404,658 (Formulations and Doses of AAV), and U.S. Patent No. 5,846,946 (Formulations and Doses of DNA Plasmids), as well as clinical trials involving lentivirus, AAV, and adenovirus, and publications relating to said clinical trials. For example, for AAV, the route of administration, formulation, and dosage can be as described in U.S. Patent No. 8,454,972 and in clinical trials involving AAV. For adenovirus, the route of administration, formulation, and dosage can be as described in U.S. Patent No. 8,404,658 and in clinical trials involving adenovirus. For plasmid delivery, the route of administration, formulation, and dosage can be as described in U.S. Patent No. 5,846,946 and in clinical studies involving plasmids. Dosage can be based on or extrapolated to an average individual of 70 kg (e.g., adult male) and can be adjusted for patients, subjects, and mammals of different weights and species. Administration frequency is within the range for medical or veterinary practitioners (e.g., physicians, veterinarians) and depends on common factors including age, sex, general health status, other conditions of the patient or subject, and the specific symptom or condition being addressed. Viral vectors can be injected into the tissue of interest. For cell type-specific base editing, the expression of the base editor and optional guide nucleic acid can be driven by a cell type-specific promoter.

[0320] For in vivo delivery, AAV may be superior to other viral vectors. In some cases, AAV exhibits low toxicity, possibly because purification methods do not require ultracentrifugation of cellular particles that can activate an immune response. In other cases, AAV is unlikely to cause insertional mutagenesis because it does not integrate into the host genome.

[0321] AAV packaging is limited to 4.5 or 4.75 kb. Constructs larger than 4.5 or 4.75 kb can lead to a significant reduction in viral yield. For example, SpCas9 is quite large, with the gene itself exceeding 4.1 kb, making it difficult to package into AAV. Therefore, embodiments of this disclosure include the use of the disclosed Cas9, which is shorter than conventional Cas9.

[0322] AAVs can be AAV1, AAV2, AAV5, or any combination thereof. The type of AAV can be selected based on the cells to be targeted; for example, AAV serotypes 1, 2, 5, or a mixture of capsid AAV1, AAV2, AAV5, or any combination thereof can be selected for targeting brain or neuronal cells; and AAV4 can be selected for targeting cardiac tissue. AAV8 can be used for delivery to the liver. A list of some AAV serotypes for these cells can be found in Grimm, D. et al., *Journal of Virology* 82:5887-5911 (2008).

[0323] Lentivirals are complex retroviruses that can infect and express their genes in cells during and after mitosis. The most common lentivirus is human immunodeficiency virus (HIV), which uses envelope glycoproteins of other viruses to target a wide range of cell types.

[0324] Lentiviral cells can be prepared as follows. After cloning pCasES10 (containing the lentiviral transfer plasmid backbone), HEK293FT cells at a low passage number (p=5) are seeded in T-75 flasks to achieve 50% confluence in DMEM containing 10% fetal bovine serum without antibiotics one day prior to transfection. After 20 hours, the medium is replaced with OptiMEM (serum-free) medium, and transfection is performed 4 hours later. Cells are transfected with 10 μg of the lentiviral transfer plasmid (pCasES10) and the following packaging plasmids: 5 μg pMD2.G (VSV-g pseudotype) and 7.5 μg psPAX2 (gag / pol / rev / tat). Transfection can be performed in 4 mL of OptiMEM containing cationic lipid delivery agents (50 μl Lipofectamine 2000 and 100 μl Plus reagent). After 6 hours, the medium is replaced with antibiotic-free DMEM containing 10% fetal bovine serum. These methods use serum during cell culture, but serum-free methods are preferred.

[0325] Lentiviral virus can be purified as follows: Collect the viral supernatant after 48 hours. First, remove debris from the supernatant and filter it through a 0.45 μm low protein binding (PVDF) filter. Then, centrifuge the supernatant at 24,000 rpm for 2 hours. Resuspend the viral pellet in 50 μl of DMEM and incubate overnight at 4 °C. Then, aliquot the pellet and freeze immediately at -80 °C.

[0326] In another embodiment, a minimal non-primate lentiviral vector based on equine infectious anemia virus (EIAV) is also considered. In another embodiment, A lentiviral gene therapy vector based on equine infectious anemia virus expresses the angiostatin protein endostatin and angiostatin intended for subretinal injection. In another embodiment, the use of a self-inactivated lentiviral vector is considered.

[0327] Any RNA in the system, such as guide RNA or mRNA encoding Cas9, can be delivered in RNA form. Cas9-encoding mRNA can be generated using in vitro transcription. For example, Cas9 mRNA can be synthesized using a PCR cassette containing the following elements: a T7 promoter, an optional kozak sequence (GCCACC), a nuclease sequence, and a 3'UTR, such as the 3'UTR from the β-globin-polyA tail. This cassette can then be used for transcription via T7 polymerase. Guide polynucleotides (e.g., gRNA) can also be transcribed from a cassette containing a T7 promoter, followed by the sequence "GG" and the guide polynucleotide sequence using in vitro transcription.

[0328] To enhance expression and reduce potential toxicity, the Cas9 sequence and / or guide nucleic acid can be modified to contain one or more modified nucleosides, for example, by using pseudo-U or 5-methyl-C.

[0329] In some embodiments, this disclosure includes methods for modifying cells or organisms. The cells may be prokaryotic or eukaryotic cells. The cells may be mammalian cells. The mammalian cells may be non-human primate, bovine, porcine, rodent, or mouse cells. Introducing cell modifications using the base editors, compositions, and methods of this disclosure can alter cells and their progeny to improve the production of biological products such as antibodies, starch, alcohols, or other desired cellular outputs. Introducing cell modifications using the methods of this disclosure can cause cells and their progeny to contain altered biological products.

[0330] The system may include one or more different vectors. On one hand, Cas9 is codon-optimized to express a desired cell type, preferably eukaryotic cells, and more preferably mammalian or human cells.

[0331] Generally, codon optimization refers to methods of enhancing expression in a host cell of interest by modifying a nucleic acid sequence while maintaining the native amino acid sequence by replacing at least one codon in the native sequence with a codon that is more frequently or most frequently used in the host cell's gene (e.g., about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50 or more codons). Different species exhibit specific preferences for certain codons of particular amino acids. Codon bias (differences in codon use between organisms) is generally associated with the translation efficiency of messenger RNA (mRNA), which is considered to depend on the characteristics of the codons being translated and the availability of specific transfer RNA (tRNA) molecules. The dominance of the selected tRNA in the cell largely reflects the most frequently used codons in peptide synthesis. Therefore, it is possible to tailor genes based on codon optimization to optimize gene expression in a given organism. Codon usage tables are readily available, for example, in the “Codon Usage Database” at www.kazusa.orjp / codon / (accessed July 9, 2002), and these tables can be modified in various ways. See Nakamura, Y. et al., “Codon usage tabulated from the international DNA sequence databases: status for the year 2000,” Nucleic Acid Research 28:292 (2000). Computer algorithms for codon optimization of specific sequences for expression in specific host cells are also available, such as GeneForge (Aptagen, Jacobus, Pa.). In some embodiments, one or more codons (e.g., 1, 2, 3, 4, 5, 10, 15, 20, 25, 50 or more, or all codons) in the sequence encoding an engineered nuclease correspond to the most frequently used codon for a specific amino acid.

[0332] Packaging cells are typically used to form viral particles capable of infecting host cells. Such cells include 293 cells for packaging adenoviruses and psi.2 or PA317 cells for packaging retroviruses. Viral vectors for gene therapy are typically generated by producing cell lines that package nucleic acid vectors into viral particles. These vectors typically contain the minimum viral sequence required for packaging and subsequent integration into the host, along with other viral sequences replaced by expression cassettes of one or more polynucleotides to be expressed. Missing viral functions are often provided by the packaging cell lines in trans form. For example, AAV vectors for gene therapy typically contain only the ITR sequence from the AAV genome, which is essential for packaging and integration into the host genome. Viral DNA can be packaged in cell lines containing helper plasmids encoding other AAV genes, namely rep and cap, but lacking the ITR sequence. These cell lines can also serve as helper infections for adenoviruses. Helper viruses can promote AAV vector replication and the expression of AAV genes from the helper plasmid. In some cases, the helper plasmid is not packaged in large quantities due to the lack of the ITR sequence. Adenovirus contamination can be reduced, for example, by performing heat treatments that are more sensitive to adenovirus than AAV.

[0333] Pharmaceutical Composition

[0334] Other aspects of this disclosure relate to pharmaceutical compositions including gene-editing systems (e.g., those comprising synthetic gRNA as described herein). As used herein, the term "pharmaceutical composition" refers to a composition formulated for pharmaceutical use. In some embodiments, the pharmaceutical composition further includes a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition includes additional agents (e.g., for specific delivery, increasing half-life, or other therapeutic compounds).

[0335] As used herein, the term "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable material, composition, or medium, such as liquid or solid fillers, diluents, excipients, manufacturing aids (e.g., lubricants, magnesium talc, calcium stearate, zinc stearate, or stearic acid), or solvent encapsulation material, relating to carrying or transporting a compound from one site of the body (e.g., delivery site) to another site (e.g., an organ, tissue, or part of the body). A pharmaceutically acceptable carrier is "acceptable" in the sense that it is compatible with other components of the formulation and harmless to the tissues of the subject (e.g., physiologically compatible, sterile, physiologically pH, etc.).

[0336] Some non-limiting examples of materials that can serve as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose, and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethyl cellulose, methyl cellulose, ethyl cellulose, microcrystalline cellulose, and cellulose acetate; (4) powdered tragacanth gum; (5) malt; (6) gelatin; (7) lubricants, such as magnesium stearate, sodium dodecyl sulfate, and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; (1 (0) Diols, such as propylene glycol; (11) Polyols, such as glycerol, sorbitol, mannitol, and polyethylene glycol (PEG); (12) Esters, such as ethyl oleate and ethyl laurate; (13) Agar; (14) Buffers, such as magnesium hydroxide and aluminum hydroxide; (15) Alginate; (16) Atherless water; (17) Isotonic saline; (18) Ringer's solution; (19) Ethanol; (20) pH buffer solution; (21) Polyesters, polycarbonates, and / or polyanhydrides; (22) Fillers, such as peptides and amino acids; (23) Serum alcohols, such as ethanol; and (24) Other non-toxic compatible substances used in pharmaceutical formulations. Wetting agents, colorants, release agents, coating agents, sweeteners, flavoring agents, aroma agents, preservatives, and antioxidants may also be present in formulations. Terms such as “excipients,” “carriers,” “pharmaceutically acceptable carriers,” and “mediators” are used interchangeably in this document.

[0337] Pharmaceutical compositions may include one or more pH buffering compounds to maintain the pH of the formulation at a predetermined level reflecting physiological pH, such as in the range of about 5.0 to about 8.0. pH buffering compounds for aqueous liquid formulations may be amino acids or mixtures of amino acids, such as histidine or mixtures of amino acids, such as histidine and glycine. Alternatively, the pH buffering compound is preferably an agent that maintains the pH of the formulation at a predetermined level, for example, in the range of about 5.0 to about 8.0, and does not chelate calcium ions. Illustrative examples of such pH buffering compounds include, but are not limited to, imidazole and acetate ions. The pH buffering compound may be present in any amount suitable for maintaining the pH of the formulation at the predetermined level.

[0338] The pharmaceutical composition may also contain one or more osmotic modifiers, i.e., compounds that adjust the osmotic properties of the formulation (e.g., tonicity, isotonic friction, and / or osmotic pressure) to levels acceptable to the blood flow and blood cells of the recipient individual. The osmotic modifier may be a non-chelating agent of calcium ions. The osmotic modifier may be any compound known or available to those skilled in the art for adjusting the osmotic properties of the formulation. Those skilled in the art can empirically determine the suitability of a given osmotic modifier in the formulations of the present invention. Illustrative examples of suitable types of osmotic modifiers include, but are not limited to: salts, such as sodium chloride and sodium acetate; sugars, such as sucrose, glucose, and mannitol; amino acids, such as glycine; and one or more of these agents and / or mixtures of agent types. The osmotic modifier may be present at any concentration sufficient to adjust the osmotic properties of the formulation.

[0339] In some embodiments, the pharmaceutical composition is formulated for delivery to a subject, for example, for gene editing. Suitable routes of administration of the pharmaceutical compositions described herein include, but are not limited to: local, subcutaneous, transdermal, intradermal, intralesional, intra-articular, intraperitoneal, intrabladder, transmucosal, gingival, intradental, intracochlear, transtympanic, intra-organ, epidural, intrathecal, intramuscular, intravenous, intravascular, intraosseous, periorbital, intratumoral, intracerebral, and intraventricular administration.

[0340] In some embodiments, the pharmaceutical composition described herein is applied topically to a diseased site. In some embodiments, the pharmaceutical composition described herein is administered to a subject by injection, via a catheter, via a suppository, or via an implant, said implant being a porous, non-porous, or gel-like material comprising a membrane, such as a sialic acid membrane, or fibers.

[0341] In some embodiments, the pharmaceutical composition described herein is delivered in a controlled-release system. In one embodiment, a pump may be used (see, for example, Langer, 1990, Science 249:1527-1533; Sefton, 1989, CRC Crit. Ref. Biomed. Eng. 14:201; Buchwald et al., 1980, Surgery 88:507; Saudek et al., 1989, New England Journal of Medicine 321:574). In another embodiment, a polymeric material may be used. (See, for example, *Medical Applications of Controlled Release* (edited by Langer and Wise, CRC Press, Boca Raton, Fla., 1974); *Controlled Drug Bioavailability, Drug Product Design and Performance* (edited by Smolen and Ball, Wiley, New York, 1984); Ranger and Peppas, 1983, *Macromol. Sci. Rev. Macromol. Chem.* 23:61. See also Levy et al., 1985, *Science* 228:190; During et al., 1989, *Annals of Neurology* 25:351; Howard et al., 1989, *Journal of Neurosurg.* 71:105). Other controlled release systems, such as Langer, have been discussed above.

[0342] In some embodiments, the pharmaceutical composition is formulated according to conventional procedures to be suitable for intravenous or subcutaneous administration to a subject, such as a human. In some embodiments, the pharmaceutical composition for injection is a sterile isotonic solution used as a solubilizer and local anesthetic such as lidocaine to relieve pain at the injection site. Generally, the components are provided separately or mixed together in unit dosage forms, for example, as a dry lyophilized powder or anhydrous concentrate in an hermetically sealed container, such as an ampoule or capsule indicating the amount of active agent. When administering the drug by infusion, it can be dispensed using an infusion bottle containing sterile pharmaceutical-grade water or saline. When the pharmaceutical composition is administered by injection, ampoules of sterile water for injection or saline can be provided so that the components can be mixed prior to administration.

[0343] Pharmaceutical compositions for systemic administration can be liquids, such as sterile saline, lactated Ringer's solution, or Hank's solution. Alternatively, the pharmaceutical composition can be in solid form and be immediately reconstituted or suspended before use. Lyophilized forms are also considered. The pharmaceutical composition can be contained in lipid particles or vesicles, such as liposomes or microcrystals, which are also suitable for parenteral administration. The particles can have any suitable structure, such as monolayer or multilayer, as long as they contain the composition. The compound can be embedded in "stable plasmid lipid particles" (SPLPs) containing a fused lipid dioleoylphosphatidylethanolamine (DOPE), a low level (5-10 mol%) of cationic lipid, and stabilized by a polyethylene glycol (PEG) coating (Zhang Y.P. et al., Gene Ther., 1999, 6: 1438-47). Positively charged lipids such as N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethyl-methylammonium sulfate or "DOTAP" are particularly preferred for such particles and vesicles. The preparation of such lipid particles is well known. See, for example, U.S. Patent Nos. 4,880,635; 4,906,477; 4,911,928; 4,917,951; 4,920,016; and 4,921,757; each of which is incorporated herein by reference.

[0344] For example, the pharmaceutical compositions described herein may be administered or packaged as unit doses. When used to refer to the pharmaceutical compositions of this disclosure, the term "unit dose" means a physically discrete unit suitable as a single dose for use in a subject, each unit containing a predetermined amount of active material calculated to produce the desired therapeutic effect when combined with a desired diluent (i.e., carrier or mediator).

[0345] Furthermore, the pharmaceutical composition may be provided as a pharmaceutical kit comprising (a) a container containing the lyophilized form of the compound of the invention and (b) a second container containing a pharmaceutically acceptable diluent (e.g., a sterile diluent for reconstituted or diluted lyophilized compounds of the invention). Optionally associated with one or more such containers may be a notification in the form prescribed by a government agency regulating the manufacture, use, or sale of a drug or biological product, reflecting the agency's authorization for its manufacture, use, or sale for human application.

[0346] On the other hand, an article comprising a material that can be used to treat the aforementioned diseases is included. In some embodiments, the article includes a container and a label. Suitable containers include, for example, bottles, vials, syringes, and test tubes. The container may be formed of various materials such as glass or plastic. In some embodiments, the container contains a composition that effectively treats the diseases described herein and may have a sterile access port. For example, the container may be an intravenous solution bag or a vial with a stopper that can be punctured by a hypodermic needle. The active agent in the composition is a compound of the present invention. In some embodiments, a label on or associated with the container indicates that the composition is used to treat selected diseases. The article may further include a second container comprising a pharmaceutically acceptable buffer, such as phosphate-buffered saline, Ringer's solution, or dextran solution. The article may further include other materials desirable from a commercial and user perspective, including other buffers, diluents, filters, needles, syringes, and packaging inserts with instructions for use.

[0347] In some embodiments, a CRISPR system (e.g., comprising Cas9 as described herein) is provided as part of a pharmaceutical composition. In some embodiments, the pharmaceutical composition comprises any fusion protein provided herein (e.g., comprising a nucleobase editor comprising LubCas9 as described herein). In some embodiments, the pharmaceutical composition comprises any complex provided herein. In some embodiments, the pharmaceutical composition comprises a ribonucleoprotein complex comprising an RNA-guided nuclease (e.g., Cas9) that forms a complex with gRNA and cationic lipids. In some embodiments, the pharmaceutical composition comprises gRNA, a nucleic acid-programmable DNA-binding protein, cationic lipids, and pharmaceutically acceptable excipients. The pharmaceutical composition may optionally comprise one or more additional therapeutically active substances.

[0348] Reagent test kit

[0349] On the one hand, the synthetic gRNA described herein can be provided and / or generated by a kit containing any one or more elements disclosed in the methods and compositions described above. For example, the kit may contain recipient RNA, donor RNA, ligase, and suitable buffer reagents. The recipient RNA, donor RNA, and ligase may be any substances disclosed herein.

[0350] In some embodiments, the kit further includes a nucleobase editor.

[0351] In some embodiments, the kit includes one or more reagents for use in methods utilizing one or more of the elements described herein. Reagents may be provided in any suitable container. For example, the kit may provide one or more reaction or storage buffers. Reagents may be provided in a form suitable for a particular assay or in a form requiring the addition of one or more other components prior to use (e.g., as a concentrate or lyophilized form). Buffers may be any buffer, including but not limited to sodium carbonate buffer, sodium bicarbonate buffer, borate buffer, Tris buffer, MOPS buffer, HEPES buffer, and combinations thereof. In some embodiments, the buffer is alkaline. In some embodiments, the pH of the buffer is from about 7 to about 10. In some embodiments, the kit includes one or more oligonucleotides corresponding to a guide sequence for insertion into a vector to operatively link the guide sequence and the regulatory element. In some embodiments, the kit includes homologous recombinant template polynucleotides.

[0352] All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. Furthermore, the materials, methods, and examples described are illustrative only and are not intended to be limiting. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While methods and materials similar to or equivalent to those described and used herein may be used to practice or test the invention, suitable methods and materials are described herein.

[0353] Example

[0354] The following examples illustrate some preferred modes of making and practicing the present invention. However, it should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the invention.

[0355] Example 1. Traditional RNA Synthesis

[0356] Traditional RNA synthesis includes solid-phase synthesis using plasmid DNA and solid-phase synthesis using phosphoramide chemistry (“synthetic RNA”). The following section details a comparison between the chemical synthesis and enzyme-based synthesis of synthetic RNA.

[0357] Direction

[0358] Synthetic RNA is typically synthesized in the 3' to 5' direction. For sgRNA, this means that most byproducts are those with truncated portions in the spacer region at the 5' end, which results in lower mid-target editing.

[0359] Substrate

[0360] Chemical synthesis utilizes highly reactive monomers. These monomers are chemically protected by their functional groups to reduce side reactions and ensure that the desired reaction occurs at the correct synthetic stage. These monomers are called "phosphoramides," referring to the phosphoramide functional group they share. The chemical groups surrounding the phosphoramide core can be extensively modified without needing to resemble naturally occurring nucleotides. For this reason, chemical synthesis can be used to assemble highly modified monomers containing modified sugars, bases, backbones, or functional groups that do not resemble natural nucleotides.

[0361] Sequentiality

[0362] Synthetic RNA is typically synthesized through sequence-controlled polymerization on a solid support. Chemical synthesis is carried out in a cyclic manner, with each cycle consisting of multiple steps (see...). Figure 1 This sequence is designed to prevent the insertion of unwanted nucleotides or deletions as much as possible. Oligomers that fail to incorporate into the growing polymer at any given stage are chemically "capped" to prevent them from extending beyond the positions in the sequence they "failed" to incorporate. "Coupling efficiency" is a term referring to the overall efficiency per cycle. This value depends heavily on the nature of the imine but can also be affected by instrument design or reaction scale. Typical DNA coupling efficiency is approximately 98–99.5%, and DNA coupling efficiency is generally higher than that of RNA.

[0363] purification

[0364] Before purification, the oligonucleotide product is first deprotected and cleaved from a solid support. Purification is typically performed by electrophoretic separation (i.e., polyacrylamide gel electrophoresis or "PAGE") or, more commonly, column chromatography (i.e., HPLC). HPLC is performed using a stationary phase with anion exchange or reversed-phase ion-pairing media. Both methods lose resolution exponentially as the length of the full-length product increases. This is particularly problematic because the most common byproducts in the purified mixture with FLP are similar in length to the full-length product. Furthermore, the large-scale synthesis required for GMP-grade materials is characterized by generally lower coupling efficiency compared to the more commonly used small-scale synthesis for producing materials for research purposes, resulting in reduced purity and an increased number of addition products. The most common reason for the difference in coupling efficiency is the need for longer coupling times as the scale of synthesis increases. Oligomers approximately 100 nt in length (i.e., guide RNAs used in base editing) are difficult to physically separate from oligomers only a few nt shorter. Due to these limitations, the purity of gRNA obtained from CMO is typically in the range of 50–90%. For typical synthetic gRNA synthesis strategies, most impurities, including the remaining 10-50%, contain deletions in spacer regions (primarily truncated products) and addition products. These types of impurities can lead to inefficient editing and / or off-target editing.

[0365] Advantages of Improved Methods for Generating Long RNA

[0366] Methods for producing high-purity long RNA (e.g., 100 nucleotides or more) via chemical synthesis are desirable for several reasons, including: reduced off-target editing, efficient editing, increased purity, increased yield, reduced cost, and versatility in modifying nucleotides in the synthesized RNA compared to conventional synthetic methods.

[0367] Improved chemical synthesis methods for producing RNA can reduce off-target editing. Purity and off-target editing may be related. There is evidence that the opposite is true for truncated products (major byproducts), which appear to reduce both off-target and on-target editing; however, addition products may increase off-target editing.

[0368] Improved chemical synthesis methods for producing RNA enable efficient editing. This is at least because most impurities (e.g., truncations) reduce editing activity.

[0369] Compared to traditional synthetic methods, improved chemical synthesis methods for producing RNA can increase purity. Increased purity of synthesized RNA will make it easier for regulatory agencies to approve its use in treating human patients.

[0370] Improved chemical synthesis methods for RNA production can increase yields and reduce costs. The yield of RNA synthesis processes typically decreases exponentially with the length of the synthesized RNA. Typically, only 3-5% of the theoretical yield is obtained after purification, even though 20-30% of the full-length product (FLP) is generated in the reaction (therefore, >90% of the FLP generated in the reaction is lost during purification). For example, the cost of 5 grams of GMP-grade FLP (10 grams of material with 50% purity) could be $1-2 million. If most of the FLP can be isolated during purification, production costs will be reduced by 5-10 times and associated with increased purity.

[0371] Finally, improved chemical synthesis methods for producing RNA can achieve the specialized installation of modified nucleotides and chemical functions, which is impossible with enzymatic synthesis.

[0372] Example 2: Linkage-based RNA synthesis method

[0373] The ligation-based method described in this example utilizes one or more RNA fragments, which are then ligated to produce full-length guide RNA (gRNA). The production of one or more RNA fragments results in a higher yield of purified gRNA due to factors such as better separation of byproducts.

[0374] One aspect of the ligation-based approach uses the helix (called a repeat-anti-repeat helix) formed between crRNA and tracrRNA molecules in the bidirectional guide RNA system used in constitutive biology to template the enzymatic ligation of two synthetic RNAs. This is in Figure 2 It is displayed in the middle.

[0375] In some embodiments, the length and sequence composition of this helix are modified to facilitate proper non-covalent assembly and create an optimal ligation site for an enzyme compatible with RNA ligation. This type of association requires a nucleotide length of 5 to 50. In some embodiments, enzymatic ligation may be more efficient when the donor nucleobase is C and the acceptor is A. In some embodiments, the Tm (melting temperature) of the non-covalently assembled RNA is greater than 0°C, 1°C, 2°C, 3°C, 4°C, 5°C, 6°C, 7°C, 8°C, 9°C, 10°C, 11°C, 12°C, 12°C, 14°C, 15°C, 16°C, 17°C, 18°C, 19°C, 20°C, or higher. For example, the stem length can be modified to be long enough to promote stem-loop formation above the temperature at which ligation will take place, and also to avoid ligation-incompatible self-structures. As another example, variability in the spacer sequence can lead to base pairings incompatible with ligation, which can be avoided by adding an oligonucleotide with a sequence complementary to the spacer sequence before combining with the donor sequence.

[0376] In some embodiments, the synthesized RNA comprising the tracrRNA sequence (referred to as the "donor") has a phosphate ester at its 5' end, which is ligated to the 3' end of a second RNA comprising a variable prototype spacer region (referred to as the "recipient") by one of a variety of ligases. In some embodiments, the RNA comprising the tracrRNA sequence is synthesized such that a portion of the tracrRNA contains a phosphate ester at its 5' end.

[0377] This method may have two connection forms ( Figure 3 Figures A(1) and (2) show two forms, both located within the stem-loop region. The first ligation occurs within the terminal loop of the hairpin, which is the native site of T4 RNA ligase 1. The second ligation occurs within the double strand, which is the native site of T4 RNA ligase 2 and DNA ligase. One advantage of this ligation is that fragment impurities are easily removed because there is a significant difference in elution time between the fused gRNA and the fragment impurities. Figure 3 (Small image B).

[0378] Another ligation-based method of the present invention involves ligating two or more RNA fragments via a template-free approach. In this method, the 3' hydroxyl group at the 3' end of the donor molecule is chemically blocked or removed (e.g., with dideoxynucleotides), and an enzyme (e.g., T4 RNA ligase 1) catalyzes the proper ligation between the two molecules. Typically, this ligation strategy is preferred at higher concentrations.

[0379] The ligation method described in this example utilizes ligases, a class of enzymes that combine nucleic acid fragments together. One advantage of using such ligases is that the resulting ligation between RNA fragments is indistinguishable from that of naturally occurring RNA or DNA. Ligases act on RNA or DNA and react efficiently.

[0380] In some embodiments, by using a nucleic acid template complementary to the first and second RNA fragments, the RNA fragments to be ligated can be physically brought close together for the ligation reaction. This template is referred to herein as a splint strand. Imperfectly paired splint strands can be designed to generate loops suitable for ligation by a specific ligase (e.g., T4 RNA ligase 1). In some embodiments, the splint strand is used to ligate more than two RNA fragments together.

[0381] In some embodiments, the RNA fragments can associate with each other via base pairing prior to the ligation reaction. This method is referred to herein as "self-templating." Using the self-templating method, the location of the stem-loop for ligating the RNA fragments can be selected to include a loop or within a helix in which one of the oligomers contains a short stem-loop (e.g., a self-templating notch). The notch can be contained in a splint chain, a protruding end, a blunt end, and protrusions can also be used (see [link to documentation]). Figure 5 ).

[0382] In some embodiments, the ligation reaction can be carried out in high yield without prior physical association of RNA segments. Therefore, the ligation reaction does not require the use of a splint strand or a self-template.

[0383] The different connection methods of the present invention are as follows: Figure 5 Described in the text.

[0384] Various connection designs are being examined using the connection-based methods described in this paper. Figure 6 ).like Figure 6 As depicted, one of these designs involves linking two RNA fragments at the loop of the stem loop. Figure 6 (Figure B); Another design involves connecting at the spiral of the stem ring (Figure B); Figure 6 (Small image C).

[0385] These ligation strategies differ from other reported chemical ligation strategies for sgRNA synthesis because the described ligation strategies form native phosphate bonds at the ligation site. The advantage of using a fragmented synthesis approach is that short segments of RNA can be produced with higher purity after purification compared to full-length sgRNA. In some embodiments, the 5' acceptor is the smallest RNA fragment (30-50 nucleotides) and can therefore be purified to a high level prior to ligation. The 3' donor terminates with the desired phosphate ester for synthesis, and therefore only the full-length fragment will be incorporated into the full-length product (i.e., the truncated fragment is not a substrate).

[0386] This advantage increases when considering gRNAs longer than 100 nucleotides, such as pegRNA or Cas12b gRNA. Enzymatic ligation yields are very high (>80%), and the oligonucleotide starting material can be highly selectively separated from the ligation product, ensuring very pure full-length products. Furthermore, these types of enzymatic ligation are relatively inexpensive and scale well.

[0387] Example 3: Exemplary Linkage-Based RNA Synthesis Scheme

[0388] The following provides an exemplary scheme for synthesizing synthetic RNA.

[0389] 1. The selection of stem size and ligation site (loop or helix) is based on i) the requirements of the natural substrate of the ligase used (e.g., loop vs. helix design) and ii) the affinity of the bimolecular helix, which is determined using a thermodynamic algorithm for RNA duplex stability.

[0390] 2. RNA fragments were synthesized using standard phosphoramide chemistry. The 3' RNA fragment (donor) contained a terminal 5' phosphate ester, which was included in the final step of the synthesis.

[0391] 3. RNA fragments were purified by HPLC (fragments can also be purified by anion exchange chromatography (AEX) or ion-pair reversed-phase chromatography (IP-RP)).

[0392] 4. Annealing: Combine each oligonucleotide (0.01-1 mM) with annealing buffer (25 mM KCl, 0.025 mM EDTA). Heat to 80°C for 0.5-5 minutes, then cool to 25°C at a rate of 0.1°C / second.

[0393] 5. Ligation: Add RNA ligase buffer to achieve a 1X concentration (50 mM Tris-HCl, 10 mM MgCl2, 1 mM MTT, 1 mM ATP, pH 7.5, temperature between 20-37°C). Add 5-10 U of T4 RNA ligase (1 / nmol) to phosphorylate the 5' end. Incubate overnight at 20-37°C. Stop by adding 0.5 M EDTA.

[0394] 6. Purification is performed using ion-pair reversed-phase chromatography (IP-RP) (or possibly AEX).

[0395] 7. Analyzed by 6% PAGE-D gel stained with SYBR Safe and IP-RP HPLC.

[0396] Exemplary results of the connection experiment are in Figure 7 The reaction is presented in the form of 10 μM donor fragment, 10 μM acceptor fragment, 1x T4 RNA ligase 2 reaction buffer (NEB), and 20 units of T4 RNA ligase 2, and is performed at 37°C. Figure 7 Figure A shows the sequence used for the ligation experiment. The results of the stem ligation are shown in... Figure 7 Figure C shows the full-length product detected by HPLC, as well as the separation of the RNA receptor and donor fragments from the full-length product.

[0397] Example 4: Differences between the described method and previous methods

[0398] The ligation method of the present invention differs from previously described RNA ligation methods because, among other things, previously described ligation methods rely on non-natural bonds between fragment RNA molecules and / or use non-template ligation methods, such as using an azide-alkyne cycloaddition reaction to couple smaller RNA molecules to sgRNA via non-natural tirazole bonds. As previously mentioned, the use of non-natural bonds has several disadvantages, and the inclusion of non-natural bonds may have adverse effects on biological systems.

[0399] The ligation method described in this article also differs from previously used chemical ligation strategies, which employ other versions of "click chemistry" or other chemical-biological conjugation methods to combine RNA fragments into full-length sgRNAs (see [link to article]). Figure 4Other previously described methods for combining RNA fragments involve using amide linking chemistry (e.g., by coupling an 18-atom linker with an amide) and forming sgRNA from a template. These prior methods are disadvantageous, at least because: i) unlike the incorporation of phosphate esters as described herein, the chemical groups used for linking are unlikely to be incorporated in high yields; and ii) the bonds previously used are non-natural and much larger than natural phosphodiester bonds. Due to these limitations, the previously described RNA linking methods may impair efficiency and impose additional regulatory burdens.

[0400] Example 5: sgRNA production – Comparison of ligases

[0401] In this example, two constructs are evaluated: one where connections occur in a loop, and the other where connections occur in a stem. Figure 3 This was used to determine which ligase produced the highest yield of sgRNA product. T4 RNA ligase 1 was used for loop ligation, and T4 RNA ligase 2 was used for stem ligation.

[0402] Figure 3 Figure A depicts two sites of enzymatic ligation being evaluated: (i) within the loop of the stem-loop, and (ii) within the helix. In both cases, the stem-loop is extended and used to associate the segment for enzymatic ligation. Figure 3 Figure B depicts a representative diagram illustrating the final purification steps that can be performed after ligation, including HPLC to remove unligated RNA fragments. Purifying RNA fragments from the full-length product is possible.

[0403] A method for synthesizing single-guide RNA using a combined chemical and enzymatic strategy has been developed, overcoming challenges that limit the purity and final (post-purified) yield of the synthesized RNA. This method, called LONGEST (using enzymes and self-template ligation of nucleic acid guides), employs a ligation-based approach where two or more partially complementary synthetic RNAs are enzymatically ligated. In one embodiment, a helix (called a repeat-anti-repeat helix) is formed between crRNA and tracrRNA molecules constituting the dual-guide RNA system used in biology by SpCas9 to template the enzymatic ligation of the two synthetic RNAs. Figure 3 The length and sequence composition of this helix can be modified to facilitate proper non-covalent assembly and create optimal ligation sites for RNA-ligation compatible enzymes without reducing the activity of the RNP complex. The synthesized RNA, comprising most of the tracrRNA sequence, may have a phosphate ester at its 5' end (called the donor), which is ligated to the 3' end of a second RNA (called the acceptor), including a variable prototypical spacer region, via either T4 RNA ligase 1 or T4 RNA ligase 2. Two forms of ligation are illustrated using this method. Figure 3 The first type is located in the terminal loop of the hairpin (the substrate of T4 RNA ligase 1), and the second type is located in the double strand (the substrate of T4 RNA ligase 2 and DNA ligase).

[0404] In these experiments, T4 RNA ligase 1 and T4 RNA ligase 2, as well as donor / recipient RNA fragment design, were evaluated. The prototype spacer for these gRNAs was α1. It was determined that T4 RNA ligase 2 produced the highest yield and fewest byproducts compared to T4 RNA ligase 1. It was also found that the donor / recipient design added only two bases to the final sgRNA product compared to the "standard" gRNA design, and produced a quantitative yield of sgRNA under the conditions examined here.

[0405] Experimental conditions.

[0406] All reactions involving T4 RNA ligase 2 contained 10 μM donor, 10 μM acceptor, 1x T4 RNA ligase 2 reaction buffer, and 20 units of T4 RNA ligase 2. All reactions were carried out at 37°C for 15 hours.

[0407] For reactions utilizing T4 RNA ligase 1, all reactions contained 10 μM donor, 10 μM acceptor, NEB reaction buffer, 1 mM ATP, and 20 units of T4 RNA ligase 1. Some reactions also contained 25% (wt / vol) PEG 8000. Reactions were carried out at 25°C for 15 hours.

[0408] All reactions were performed in 50 μL volumes using a thermal cycler. To form the pre-ligated complex, the solution was first heated to 70 °C with all components except the ligase, and then slowly cooled to 37 °C or 25 °C, respectively, at a rate of 0.1 °C / sec for T4 RNA ligase 2 or T4 RNA ligase 1.

[0409] RNA donor and RNA acceptor design - T4 RNA ligase 1 and T4 RNA ligase 2

[0410] First, the stem-joint design consisting of RNA receptor 1 (Acp-01) and RNA donor 1 (Dnr-1) was evaluated. The four-loop post-joint helix contained a total of 14 base pairs in the upper helix with mixed GCAU content (10 base pairs between fragments in the pre-joint complex). Figure 8 (See Figure A). The reaction yielded high amounts of fragments, with almost no detectable amount in samples containing T4 RNA ligase 2. Figure 8 (See Figure B). Side reactions are not shown when using ligase and control reactions (not shown) with only Dnr-01 or Acp-01.

[0411] Another RNA donor and RNA acceptor design evaluated was the helical ligation design of RNA acceptor 2 (Acp-02) and RNA donor 2 (Dnr-2). The ligated helix contained 14 base pairs in the upper helix with a mixed GCAU content. Figure 9 (See figures A and B). The yield of this reaction was lower (~60%) compared to the reaction using T4 RNA ligase 2. The control reaction (not shown) using ligase and (phosphorylated) Dnr-02 only shows the formation of a side reaction (using T4 RNA ligase 1 may cause Dnr-02 cyclization). In the presence of T4 RNA ligase 2, the reaction between Acp-02 and Dnr-02 did not form a product because T4 RNA ligase 2 requires a double-stranded complex. The data from these experiments indicate that T4 RNA ligase 2 is superior to T4 RNA ligase 1. The remaining data were generated using T4 RNA ligase 2.

[0412] RNA donor and RNA acceptor design - the effects of GC content and stem nucleotide length

[0413] Two RNA constructs with the following characteristics were evaluated compared to the initial Dnr-01 / Acp-01 quadruple design: i) higher GC content in the upper and lower stems; and ii) a shorter upper stem ( Figure 10 (See inset AD). Although the lower stem is thought to interact with Cas9, previous reports have shown that three of the four bases in the U orbital can be substituted by GC base pairs. Evaluation of sgRNAs with these substitutions revealed that while they possessed activity, it was less than that of standard sgRNA designs.

[0414] The data indicate that the reactions between Acp-03 and Dnr-03 with the ligase are productive and compatible with high-yield synthesis. The reactions between Acp-04 and Dnr-04 with the ligase are productive and appear to be complete, as indicated by the loss of the Dnr-04 peak. The Acp / Dnr-04 system represents a significant improvement over the Acp / Dnr-01 system due to its 7-base-pair reduction, while maintaining the same efficiency.

[0415] After studies using gRNAs that replaced the U orbital portion of the base stem with GC base pairs (as shown in Acp / Dnr-03 and Acp / Dnr-04) reduced editing outcomes, designs that did not alter the U orbital portion of the base stem and also included a shorter upper stem were evaluated. Figure 11 A design (Acp / Dnr-06) was also examined, which has an upper stem sequence similar to that of the sgRNA formed by linking Acp / Dnr-03. However, the linker site was placed one bp away from the fourth ring.

[0416] The data showed that the reactions between Acp-05 and Dnr-05 with ligase were as productive as those with the Acp / Dnr-04 system, suggesting that a higher GC content in the lower stem-loop was not necessary for quantitative reactions in these early designs (at least with the use of the α-1 prototype spacer). The reactions between Acp-06 and Dnr-06 with ligase were also productive. Because the upper stem-loop is similar to that of Acp / Dnr-03, with only the position of the ligation site changing, these results indicate that a ligation site at least three base pairs from the quadruple loop allows for efficient ligation. The Acp / Dnr-06 system demonstrates that minimal changes to the “standard” sgRNA design are compatible with high-yield synthesis because it has only a single additional base pair.

[0417] Examine the "standard" sgRNA design to see if it is compatible with ligation. Figure 12 Because the upper stem-loop contains only four base pairs, the ligation site is only two base pairs away from the fourth loop. In the presence of ligase, the yield of the reaction between Acp-07 and Dnr-07 is very low. Figure 13 Other side reactions also exist, further indicating that well-assembled duplexes can be used for high-yield reactions.

[0418] The same donor fragment (Dnr-05) was also used in RNA ligation reactions with two different receptor fragments (Acp-05 and Acp-05_v2), the receptor fragments varying only in the prototype spacer subsequence that is not required for self-assembly between the donor and receptor fragments. This illustrates the concept of using a universal donor in combination with various receptor fragments.

[0419] RNA donor and acceptor design—the effect of RNA concentration on reaction productivity

[0420] Studies were conducted to assess the effect of RNA concentration on reaction productivity. For these studies, Acp / Dnr-05 and Acp / Dnr-6 were used. Compared to Acp / Dnr-6, Acp / Dnr-05 has a more stable acceptor / donor duplex. In these studies, the concentration of both fragments was evaluated because it is related to the productivity of sgRNA production. Figure 13 The data indicate that a more stable A / D double chain can achieve higher yields at higher substrate concentrations.

[0421] Based on these data, a concentration of 1 mg / ml or higher may be suitable for manufacturing. Furthermore, the temperature of the ligation reaction also affects the data (note that all experiments described here were performed at 37°C). T4 RNA ligase 2 is also shown to be effective at 20°C. Figure 13The highest yield was shown to be approximately 80%, but this may be because the donor fragment contains byproducts such as truncated material that are incompatible with the connection but still increase the absorption of the starting material, and therefore this value is underestimated.

[0422] Thermodynamic effects on sgRNA productivity

[0423] Under the tested conditions, the thermodynamically more stable double strands (formed by increasing length and / or GC content) provided a higher yield to some extent, but these changes to the “standard” design did not require product formation as a 60% yield was still achieved, while only modest modifications could achieve a higher yield. This advantage did not extend linearly as it approached the limit at just 1 extra bp – as the results show, 1 and 10 extra bps provided similar yields, while the yield of the “standard” sgRNA design with 4 bps in the upper helix was significantly lower than that of the design using only 1 extra bp in the upper helix (AD-06).

[0424] It is worth noting that all the studies described here were conducted at 37°C, and this T4 RNA ligase 2 can also tolerate lower temperatures. If so, then using the "standard" 4bp helical upheaven at lower temperatures might yield higher yields. Therefore, changing the conditions can lead to alterations in energy-off assembly. Thus, this goal can be achieved using various parameters, including external or intrinsic parameters related to RNA design. These conditions include, for example, variations in reaction temperature and RNA concentration.

[0425] in conclusion

[0426] These data established design rules for fragments and ligases used in the LONGEST method. Specifically, T4 RNA ligase 2 was found to have higher yields and fewer side reactions than T4 RNA ligase 1. T4 RNA ligase 2 was also found to accommodate double-stranded substrates with ligation sites three or more base pairs away from the tetracycle. A fragment design (Acp / Dnr-06) was also found to have higher yields and contain only one extra base pair compared to the standard sgRNA design (102 nucleotides vs. 100 nucleotides, respectively). Further studies will aim to evaluate the Acp / Dnr-06 design using this system for editing activity and scale-up reactions.

[0427] Example 6: Tolerance to skeleton modification and temperature tolerance

[0428] Tolerance to skeletal modifications

[0429] Analyzed Various fragmentsTo determine tolerance to backbone modifications, the following fragments were analyzed: i) complete RNA; ii) sequences containing a 2'O-methyl and phosphate thioester group at the ends, commonly referred to as "terminal mods"; and iii) sequences containing 48 nucleotides (48%) modified with a 2'O-methyl group, including modifications at the linker site (5' donor nucleotide and 3' acceptor nucleotide). Two sets of modified guides based on Acp / Dnr-05 and Acp / Dnr-6 designs (AD_09 and AD_08, respectively) were tested. Data from these studies are presented in... Figure 14 The data are shown in insets A and B. Together, these data demonstrate the successful response of the extensively modified fragment.

[0430] Temperature tolerance

[0431] sgRNA was produced at 20°C and 37°C. The data from these experiments indicate that the reaction is productive at either test temperature. The finding that the reaction also works at 20°C (room temperature) suggests that the reaction is robust and can be carried out at temperatures that facilitate its production.

[0432] Example 7: Base Editing in Cells

[0433] Base editing activities targeting specific gene objectives with purified products have been successfully performed in mammalian cells. These data were obtained using DA-05, DA-06, and AD-08 from reactions involving Acp-05 and Dnr-05, Acp-06 and Dnr-06, and Acp-08 and Dnr-08, respectively. Figure 15 For these studies, the target sites in fibroblasts were edited using an adenine base editor (ABE), and one of three guide RNAs (AD-08, AD-05, AD-06) was synthesized using a self-template ligation method.

[0434] Example 8: Cas12b guide RNA

[0435] The method disclosed in this paper can be used to synthesize Cas12b sgRNA. Figure 16 This is a schematic diagram depicting the sequence and conformation of exemplary Cas12b sgRNA and bhCas12b sgRNA associated with Bacillus cereus. Various features, including various secondary structures such as tetraloops, can be used as targets for division and ligation to produce the desired Cas12b sgRNA.

[0436] Figure 16 Various exemplary locations are shown that can be targeted to split the sgRNA and then subsequently ligated according to the methods described herein. Figure 16The secondary structure of bhCas12b sgRNA is shown, containing a variable prototypical spacer region and an invariant region. Labels A, B, and C denote hairpin loop structures that can serve as site-targeting mechanisms for sgRNA splitting. The double-stranded form of the hairpin labeled C can extend proximal to its loop to facilitate donor-acceptor hybridization, as this quadruple loop does not contact the Cas protein.

[0437] sequence

[0438] Table 4 (below) shows the sequences referenced in the examples and corresponding diagrams.

[0439] Table 4: The sequence of references

[0440]

[0441] mN represents a nucleotide with 2'OMe modification; N* represents a nucleotide with 3' thiophosphate modification; "p" indicates the position of the phosphate group.

[0442] Equivalents and scope

[0443] Those skilled in the art will recognize, or can determine using only routine experiments, many equivalent forms of the specific embodiments of the invention described herein. The scope of the invention is not intended to be limited to the foregoing description, but rather as set forth in the following claims.

Claims

1. A method for generating linear guide RNA, comprising: Make the first RNA come into contact with the second RNA. The first RNA and the second RNA comprise at least five complementary RNA nucleotides, and the contact forms a stem-loop structure. Using ligase (i) at the helix of the stem-ring structure (ii) Alternatively, the first RNA and the second RNA may be connected at the end of the stem-loop structure to form a loop at the end of the stem structure. The ligation produces linear guide RNA (gRNA), and the ligase is either T4 RNA ligase 1 or T4 RNA ligase 2.

2. The method according to claim 1, wherein the ligase is T4 RNA ligase 1.

3. The method according to claim 1, wherein the ligase is T4 RNA ligase 2.

4. The method according to claim 1, wherein the first RNA and / or the second RNA is chemically synthesized.

5. The method according to claim 1, wherein the first RNA is a clustered regularly spaced short palindromic repeat (CRISPR) RNA (crRNA) and the second RNA is a trans-activating RNA (tracrRNA).

6. The method according to claim 1, wherein the first RNA and / or the second RNA is enzymatically synthesized.

7. The method of claim 1, wherein the first RNA and the second RNA are ligated using the ligase to form a phosphodiester bond between the first RNA and the second RNA.

8. The method of claim 1, wherein the first RNA and / or the second RNA nucleotides are engineered to allow non-covalent assembly.

9. The method of claim 1, wherein the stem loop is less than 50 nucleotides in length.

10. The method according to any one of claims 1-9, wherein the first RNA and the second RNA comprise at least five consecutive RNA nucleotides that are completely complementary.

11. The method of claim 10, wherein the first RNA and the second RNA comprise six or seven consecutive RNA nucleotides that are completely complementary.

12. The method of claim 10, wherein the fully complementary RNA nucleotides are present in the top stem or the bottom stem.

13. The method according to any one of claims 1-9, wherein the first RNA and the second RNA comprise at least five complementary consecutive RNA nucleotides at the lower stem formed by the first RNA and the second RNA.

14. The method according to any one of claims 1-9, wherein the first RNA and the second RNA comprise at least four complementary consecutive RNA nucleotides at the upper stem.

15. The method of claim 14, wherein the first RNA and the second RNA comprise four complementary consecutive RNA nucleotides at the upper stem.

16. The method of claim 14, wherein the first RNA and the second RNA comprise five complementary consecutive RNA nucleotides at the upper stem.

17. The method of claim 14, wherein the upper stem of the first RNA and the second RNA comprises seven consecutive complementary RNA nucleotides.

18. The method of claim 14, wherein the first RNA and the second RNA comprise 14 complementary consecutive RNA nucleotides at the upper stem.

19. The method according to any one of claims 1-9, wherein the first RNA and the second RNA comprise seven complementary consecutive RNA nucleotides at the lower stem.

20. The method according to any one of claims 1-9, wherein the first RNA and / or the second RNA is engineered to produce a ligation site for the ligase.

21. The method according to any one of claims 1-9, wherein the stem-loop comprises a loop of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 nucleotides.

22. The method according to any one of claims 1-9, wherein the stem ring comprises four rings.

23. The method of claim 21, wherein the ring comprises 7 nucleotides.

24. The method of claim 20, wherein the connection between the first RNA and the second RNA occurs at a connection site at least one base pair away from the loop.

25. The method of claim 24, wherein the linking site is 2 or 3 base pairs away from the ring.

26. The method according to any one of claims 1-9, wherein the connection between the first RNA and the second RNA occurs at a connection site at least 3 base pairs from the protrusion.

27. The method of claim 26, wherein the connection between the first RNA and the second RNA occurs at a connection site 3, 4, 5 or 11 base pairs from the protrusion.

28. The method according to any one of claims 1-9, wherein the first RNA comprises a 3' sequence capable of pairing with a portion of the bases of the second RNA.

29. The method according to any one of claims 1-9, wherein the first RNA comprises a phosphate ester at its 5' end.

30. The method of claim 29, wherein the first RNA is a donor RNA.

31. The method according to any one of claims 1-9, wherein the second RNA comprises a variable prototype spacer region.

32. The method of claim 31, wherein the second RNA is a receptor RNA.

33. The method of claim 29, wherein the first RNA comprises adenosine triphosphate at its 5' end.

34. The method according to any one of claims 1-9, wherein 8-50 nucleotides are complementary and allow base pairing between the first RNA and the second RNA.

35. The method of claim 34, wherein the 8-50 nucleotides are partially complementary.

36. The method of claim 35, wherein the 8-50 nucleotides are 50% to 99% complementary.

37. The method of claim 35, wherein the 8-50 nucleotides are completely complementary.

38. The method according to any one of claims 1-9, wherein the first RNA and the second RNA have different nucleotide lengths.

39. The method of claim 38, wherein the first RNA has at least 20 nucleotides.

40. The method of claim 38, wherein the second RNA has at least 20 nucleotides.

41. The method according to any one of claims 1-9, wherein base pairing occurs in the lower stem.

42. The method of claim 41, wherein the seven nucleotides in the lower stem are complementary and allow base pairing between the first RNA and the second RNA.

43. The method according to any one of claims 1-9, wherein the base pairing occurs in the upper stem.

44. The method of claim 43, wherein the two nucleotides in the upper stem are complementary and allow base pairing between the first RNA and the second RNA.

45. The method of claim 1, wherein the length of the gRNA is 100 nucleotides, 125 nucleotides, 150 nucleotides, 175 nucleotides, 200 nucleotides, or greater than 200 nucleotides.

46. ​​The method according to claim 1 or 45, wherein the gRNA is an extension guide RNA, a guide editor guide RNA (pegRNA), or a Cas12 guide RNA, such as Cas12a guide RNA, Cas12b guide RNA, Cas12c guide RNA, Cas12d guide RNA, Cas12e guide RNA, Cas12f guide RNA, Cas12g guide RNA, Cas12h guide RNA, Cas12i guide RNA, Cas12j guide RNA, or Cas12k guide RNA.

47. The method according to claim 1 or 45, wherein the gRNA comprises one or more of the following: spacers, lower stems, protrusions, upper stems, connectors, and hairpins.

48. The method according to any one of claims 1-9, wherein the first RNA and the second RNA are present in a ratio of 0.5:1, 0.6:1, 0.7:1, 0.8:1, 0.9:1, 1:1, 1:0.9, 1:0.8, 1:0.7, 1:0.6 or 1:0.

5.

49. The method according to any one of claims 1-9, wherein the gRNA is produced at a yield of 50% or greater.

50. The method according to any one of claims 1-9, wherein the gRNA is produced in a yield of 50% or more compared to conventional synthesis methods.

51. The method of claim 1, wherein the second RNA comprises a 3' sequence capable of pairing with a portion of the bases of the first RNA.

52. The method of claim 1, wherein the second RNA comprises a variable prototype spacer region.

53. The method of claim 1, wherein the first RNA comprises a phosphate ester at its 5' end.

54. The method of claim 1, wherein the stem loop comprises at least one GC base pair in the upper stem.

55. The method of claim 1, wherein the upper stem of the stem-loop structure comprises at least 80% identical nucleotide sequences to CGAUACGACAGAAC.

56. The method of claim 1, wherein the upper stem of the stem-loop structure comprises at least 80% of the same nucleotide sequence as CGCCG.

57. The method of claim 1, wherein the upper stem of the stem-loop structure comprises at least 80% of the same nucleotide sequence as CGGCCGC.

58. The method of claim 1, wherein the upper stem of the stem-loop structure comprises at least 80% of the same nucleotide sequence as CGCGC.

59. The method of claim 1, wherein the upper stem of the stem-loop structure comprises at least 80% of the same nucleotide sequence as CGAU.

60. The method of claim 1, wherein the stem loop comprises GC base pairs in the lower stem.

61. The method of claim 1, wherein the upper stem of the stem-ring structure does not include GC base pairs.

62. The method according to claim 1, wherein the upper stem of the stem-ring structure comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 GC base pairs.

63. The method of claim 1, wherein the upper portion of the stem comprises two GC nucleotides.

64. The method of claim 1, wherein the ligation of the first RNA and the second RNA results in a yield of at least 60% of the full-length product.

65. The method of claim 1, wherein linking the first RNA and the second RNA results in a yield of at least 80%.

66. The method of claim 1, wherein the gRNA is produced in an amount of at least 1 gram.

67. The method of claim 1, wherein the gRNA is produced in an amount of 5 g, 10 g, 20 g, 30 g, 40 g, 50 g, 60 g, 70 g, 80 g, 90 g, or 100 g.

68. The method of claim 1, wherein the gRNA is produced in an amount of less than 1 gram.

69. The method of claim 1, wherein the gRNA is produced in an amount of 0.05 g, 0.1 g, 0.2 g, 0.3 g, 0.4 g, 0.5 g, 0.6 g, 0.7 g, 0.8 g, or 0.9 g.

70. The method of claim 1, wherein the method produces gRNA with a purity of at least 50%.

71. The method of claim 1, wherein the first RNA is synthesized in a 3' to 5' orientation.

72. The method of claim 1, wherein the second RNA is synthesized in a 3' to 5' orientation.

73. The method according to claim 1, wherein the length of the gRNA is 100 nucleotides, 125 nucleotides, 150 nucleotides, 175 nucleotides, 200 nucleotides, or greater than 200 nucleotides.

74. The method of claim 1, wherein the ring comprises 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 nucleotides.

75. The method of claim 74, wherein the ring is a four-ring.

76. The method of claim 74, wherein the ring comprises 7 nucleotides.

77. The method of claim 1, wherein the connection between the first RNA and the second RNA occurs at a connection site at least 3 base pairs from the loop.

78. The method of claim 77, wherein the linking site is 4, 5, 6 or 10 base pairs away from the ring.

79. The method of claim 1, wherein the first RNA and / or the second RNA comprises one or more backbone modifications.

80. The method of claim 79, wherein the one or more skeleton modifications include 2' O-methyl or thiophosphate modification.

81. The method of claim 79, wherein the one or more skeletal modifications are selected from 2'-O-methyl 3'-thiophosphate, 2'O-methyl, 2'-ribose 3'-thiophosphate, deoxygenated or 5'-phosphate modifications.

82. The method of claim 79, wherein the one or more modifications are present at the connection site.

83. The method of claim 82, wherein the one or more modifications are present in the donor RNA and / or recipient RNA.

84. The method of claim 83, wherein the 3' and / or 5' ends of the donor RNA have one or more backbone modifications.

85. The method of claim 83, wherein the 3' and / or 5' ends of the receptor RNA have one or more backbone modifications.

86. The method of claim 1, wherein the concentration of the first RNA and / or the second RNA is between 1 g / L and 5 g / L.

87. The method of claim 86, wherein the concentration of the first RNA and / or the second RNA is 1 g / L or 3 g / L.

Citation Information

Patent Citations

  • Dehydrated liposomes

    US4880635A

  • Antineoplastic agent-entrapping liposomes

    US4906477A

  • Paucilamellar lipid vesicles

    US4911928A

  • Lipid vesicles formed of surfactants and steroids

    US4917951A

  • Liposomes with enhanced circulation time

    US4920016A