Primer set for identification of mitochondrial maternal inheritance of hybrid fish between large yellow croaker and small yellow croaker and its application

Abstract

The application discloses a primer set for identifying mitochondrial maternal inheritance of hybrid fish of Larimichthys crocea and Larimichthys polyactis and application thereof, and belongs to the technical field of biotechnology.The primer set comprises specific primers based on a cox1 gene and RT-PCR primers thereof, and specific primers based on a tfam nuclear gene and RT-PCR primers thereof. By using the primer set, the mitochondrial genetic mode of the hybrid fish can be identified only by performing genomic DNA PCR and RT-PCR amplification on experimental samples, and the identification method has the characteristics of rapidness and high resolution.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to primer sets for identifying mitochondrial maternal inheritance in hybrid fish such as large yellow croaker and small yellow croaker, and their applications. Background Technology

[0002] Small yellow croaker (Larimichthys polyactis) and large yellow croaker (Larimichthys crocea) both belong to the order Perciformes, family Sciaenidae, and genus Larimichthys. They are different species within the same genus, each possessing advantages in morphology, growth, and stress resistance. Hybrid breeding is a widely used breeding method in aquaculture. It integrates genomes from different parents, leading to variations in the genetic composition of the hybrid offspring, thereby obtaining superior new traits that surpass the parents and achieving hybrid vigor. This method is considered an effective tool for genetic improvement of aquatic animals. Prior to this invention application, the applicant had already established a normally growing hybrid line (large yellow croaker ♀ × small yellow croaker ♂) using artificial insemination with large yellow croaker (♀) and small yellow croaker (♂).

[0003] Mitochondrial heterogeneity can affect embryonic development and even cause disease. A crucial mechanism for maintaining mitochondrial homogeneity is strict maternal inheritance. Typically, paternal mitochondrial DNA is transferred to the egg during fertilization and then selectively removed; this mechanism has been reported in many species, including zebrafish, killifish, and goldfish. Maternal inheritance of mitochondrial genes is present in most eukaryotes but not in all species. Whether hybrid fish (large yellow croaker ♀ × small yellow croaker ♂) follow maternal mitochondrial inheritance is currently unknown. There are currently no patent reports on molecular markers for identifying the mode of mitochondrial inheritance in hybrid fish. Summary of the Invention

[0004] To address the problems existing in the prior art, the purpose of this invention is to design and provide a primer set for identifying the mitochondrial maternal inheritance of hybrid fish such as large yellow croaker and small yellow croaker, and the technical solution for its application.

[0005] This invention is specifically achieved through the following technical solutions:

[0006] The first aspect of the present invention provides a primer set for identifying the mitochondrial maternal inheritance of hybrid fish of large yellow croaker and small yellow croaker, wherein the hybrid fish is a hybrid fish of large yellow croaker ♀ × small yellow croaker ♂, and the primer set includes specific primers based on the cox1 gene and its RT-PCR primers and specific primers based on the tfam nuclear gene and its RT-PCR primers.

[0007] The specific primers based on the cox1 gene include cox1-LC-R, cox1-LP-R, cox1-LC&LP-F, and cox1-LC&LP-R, and their nucleotide sequences are shown in SEQ ID NO.1 to SEQ ID NO.4;

[0008] The RT-PCR primers based on the cox1 gene include cox1-LC-RT-F, cox1-LC-RT-R, cox1-LP-RT-F, cox1-LP-RT-R, cox1-LC&LP-RT-F, and cox1-LC&LP-RT-R, and their nucleotide sequences are shown in SEQ ID NO.5 to SEQ ID NO.10;

[0009] The specific primers based on the tfam nuclear gene include tfam-LC-R, tfam-LP-R, tfam-LC&LP-F, and tfam-LC&LP-R, and their nucleotide sequences are shown in SEQ ID NO.11 to SEQ ID NO.14;

[0010] The RT-PCR primers based on the tfam nuclear gene include tfam-LC-RT-F, tfam-LC-RT-R, tfam-LP-RT-F, tfam-LP-RT-R, tfam-LC&LP-RT-F, and tfam-LC&LP-RT-R, and their nucleotide sequences are shown in SEQ ID NO.15 to SEQ ID NO.20.

[0011] The second aspect of this invention provides the application of the above-mentioned primer set in identifying mitochondrial maternal inheritance in hybrid fish of large yellow croaker and small yellow croaker.

[0012] Furthermore, the hybrid fish of large yellow croaker and small yellow croaker is a hybrid fish of large yellow croaker ♀ × small yellow croaker ♂.

[0013] A third aspect of this invention provides a method for identifying mitochondrial maternal inheritance in hybrid fish of large yellow croaker and small yellow croaker using the above-mentioned primer set, comprising the following steps:

[0014] 1) Using genomic DNA from hybrid fish (♀ large yellow croaker × ♂ small yellow croaker), small yellow croaker, and large yellow croaker as templates, genomic DNA was amplified by PCR using primer pairs cox1-LC﹠LP-F / cox1-LC-R, cox1-LC﹠LP-F / cox1-LP-R, cox1-LC﹠LP-F / cox1-LC﹠LP-R and tfam-LC﹠LP-F / tfam-LC-R, tfam-LC﹠LP-F / tfam-LC﹠LP-R, tfam-LC﹠LP-F / tfam-LC﹠LP-R, to obtain specific sequences of the cox1 and tfam genes in the three fish species;

[0015] 2) Using single-stranded cDNAs of hybrid fish (♀ large yellow croaker × ♂ small yellow croaker), small yellow croaker, and large yellow croaker as templates, RT-PCR amplification was performed using primer pairs cox1-LC-RT-F / cox1-LC-RT-R, cox1-LP-RT-F / cox1-LP-RT-R, cox1-LC﹠LP-RT-F / cox1-LC﹠LP-RT-R, and tfam-LC-RT-F / tfam-LC-RT-R, tfam-LP-RT-F / tfam-LP-RT-R, tfam-LC﹠LP-RT-F / tfam-LC﹠LP-RT-R, respectively, to obtain specific cDNA sequences of the cox1 and tfam genes in the three fish species;

[0016] 3) After the PCR amplification reaction was completed, the amplification products were detected by 1.2% agarose gel electrophoresis, and the electrophoresis results were then recorded by taking pictures using a gel imaging system.

[0017] This invention utilizes the mitochondrial genes of the parents of hybrid fish to develop a set of species-specific primers. Using these primers, the mitochondrial inheritance pattern of hybrid fish can be identified simply by performing genomic DNA PCR and RT-PCR amplification on the experimental samples. This identification method is characterized by its speed and high resolution. Attached Figure Description

[0018] Figure 1 Transmission of the parental mitochondrial gene cox1 at different developmental stages in hybrid fish (large yellow croaker ♀ × small yellow croaker ♂), where LC: large yellow croaker; LP: small yellow croaker; LCP: hybrid fish (large yellow croaker ♀ × small yellow croaker ♂).

[0019] Figure 2 Transcription of the parental mitochondrial gene cox1 at different developmental stages in hybrid fish (large yellow croaker ♀ × small yellow croaker ♂), where LC: large yellow croaker; LP: small yellow croaker; LCP: hybrid fish (large yellow croaker ♀ × small yellow croaker ♂). Detailed Implementation

[0020] The present invention will be further illustrated below with reference to the embodiments.

[0021] Example 1

[0022] 1. Experimental Materials

[0023] In this embodiment, all experimental materials, including hybrid fish (large yellow croaker ♀ × small yellow croaker ♂) and their parents (small yellow croaker and large yellow croaker), were obtained from Ningbo Xiangshan Harbor Aquatic Seedling Co., Ltd. Two samples each of embryos (blastocyst stage, tail bud stage, heartbeat stage), larvae stage, juvenile stage, and young fish stage were taken and preserved in 95% ethanol and RNAStore sample preservation solution (TIANGEN), respectively, for the extraction of genomic DNA and RNA.

[0024] 2. Genomic DNA extraction

[0025] Genomic DNA was extracted from samples of hybrid fish (female large yellow croaker × male small yellow croaker) and their parents (small yellow croaker and large yellow croaker) at various embryonic stages (blastocyst stage, tail bud stage, heartbeat stage), larval stage, juvenile stage, and young stage using the Marine Animal Tissue Genomic DNA Extraction Kit (TIANGEN). The DNA was then analyzed using a Therom Fisher Scientific NanoDrop spectrophotometer. TM One) Determine the concentration and mass of each DNA sample, and then dilute all DNA samples to 100 ng / ul and store them at -20°C for later use.

[0026] 3. Total RNA extraction and cDNA strand synthesis

[0027] Total RNA extraction kit for cells / tissues ( Total RNA was extracted from samples at each embryonic stage (blastocyst, tail bud, and heartbeat stage), larval, juvenile, and young fish using the YEASEN Cell / Tissue Total RNA Kit. After DNase treatment, the concentration and mass of each RNA sample were determined, and the samples were stored at -80°C. A reverse transcription kit was used... The 1st Strand cDNA Synthesis SuperMix for qPCR (gDNA digester plus, YEASEN) reverse transcribes RNA into single-stranded cDNA. During cDNA synthesis, an equal amount of RNA (800 ng) is used for reverse transcription to ensure consistent cDNA concentration.

[0028] 4. Specific primer design

[0029] The full-length mitochondrial DNA sequences of large yellow croaker (GenBank accession no. NC 011710.1) and small yellow croaker (GenBank accession no. NC 013754.1) were downloaded from the NCBI database (https: / / www.ncbi.nlm.nih.gov / ). Comparison analysis using BioEdit software revealed that the cox1 gene of the two species is relatively long and has significant sequence differences, making it suitable for designing species-specific primers. Four primers were designed for genomic DNA PCR: large yellow croaker-specific (cox1-LC-R: CCTGCGAGGTGTAGGGAAA), small yellow croaker-specific primer (cox1-LP-R: AAGGCACGAGTCAGTTTCC), and shared primers (cox1-LC&LP-F: ACAAAGACATCGGCACCCT; cox1-LC&LP-R: TCCGGCCCCTGCTTCAAC). Six primers were designed for RT-PCR: one for large yellow croaker (cox1-LC-RT-F: CGTTACGGCACATGCTTTCG; cox1-LC-RT-R: GAGGCGAGGAGCAGTAGGAA), one for small yellow croaker (cox1-LP-RT-F: CCTCATCAGCGGTTGAAGCA; cox1-LP-RT-R: AGACACCCGCAAGGTGTAGA), and a common primer (cox1-LC&LP-RT-F: GCATGAGCCGGAATAGTGG; cox1-LC&LP-RT-R: TCGGGGGCGCCAATTATT) (Table 1).

[0030] Meanwhile, as a control for the mitochondrial gene, this invention also designed species-specific primers for the nuclear gene tfam. Specifically, four primers were designed for genomic DNA PCR: one specific for large yellow croaker (tfam-LC-R: GTATTCAAAGCCAAACCACA), one specific for small yellow croaker (tfam-LP-R: CTCCGTGATGCTGATGGTC), and a common primer (tfam-LC&LP-F: GCACGAGCGTCCTCACAAG; tfam-LC&LP-R: TACTGGGTTGATGTAAGAAGC). Six primers were designed for RT-PCR: one for large yellow croaker (tfam-LC-RT-F: CTTGGACCTCCAGGGCTACA; tfam-LC-RT-R: GCCAACCTCTGCCTCTTCTC), one for small yellow croaker (tfam-LP-RT-F: AGATTGGCCAAGAGGAAGGC; tfam-LP-RT-R: TCCTCGAAGTGCTCCGACAT), and a common primer (tfam-LC&LP-RT-F: GTCTGAGCTCTCAGGCCAGT; tfam-LC&LP-RT-R: AGGCTTCCTGAAAGGGCTGT) (Table 1).

[0031] Table 1 Species-specific primers

[0032]

[0033]

[0034] 5. PCR amplification

[0035] Using genomic DNA from hybrid fish (♀ large yellow croaker × ♂ small yellow croaker), small yellow croaker, and large yellow croaker as templates, genomic DNA was amplified by PCR using primer pairs (cox1-LC﹠LP-F / cox1-LC-R, cox1-LC﹠LP-F / cox1-LP-R, cox1-LC﹠LP-F / cox1-LC﹠LP-R) and (tfam-LC﹠LP-F / tfam-LC-R, tfam-LC﹠LP-F / tfam-LC-R, tfam-LC﹠LP-F / tfam-LC﹠LP-R), respectively, to obtain specific sequences of the cox1 and tfam genes from the three experimental fish species. The PCR reaction conditions were: 94℃ for 5 min; 94℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s, 27 cycles; 72℃ for 10 min; and storage at 12℃.

[0036] Using single-stranded cDNA from hybrid fish (large yellow croaker ♀ × small yellow croaker ♂), small yellow croaker, and large yellow croaker as templates, RT-PCR amplification was performed using primer pairs (cox1-LC-RT-F / cox1-LC-RT-R, cox1-LP-RT-F / cox1-LP-RT-R, cox1-LC&LP-RT-F / cox1-LC&LP-RT-R) and (tfam-LC-RT-F / tfam-LC-RT-R, tfam-LP-RT-F / tfam-LP-RT-R, tfam-LC&LP-RT-F / tfam-LC&LP-RT-R) to obtain specific cDNA sequences of the cox1 and tfam genes from the three experimental fish species. The PCR reaction conditions were as follows: 94℃ for 5 min; 94℃ for 30 s, 61.5℃ (cox1-LC-RT-F / cox1-LC-RT-R, cox1-LP-RT-F / cox1-LP-RT-R), 60℃ (cox1-LC & LP-RT-F / cox1-LC & LP-RT-R), 62℃ (tfam-LC-RT-F / tfam-LC-RT-R), 61℃ (tfam-LP-RT-F / tfam-LP-RT-R), 62.5℃ (tfam-LC & LP-RT-F / tfam-LC & LP-RT-R) for 30 s, 72℃ for 30 s, for 30 cycles; 72℃ for 10 min, and stored at 12℃.

[0037] 6. Results Analysis

[0038] After the PCR amplification reaction was completed, the amplification products were detected by 1.2% agarose gel electrophoresis, and the electrophoresis results were then photographed and recorded using a gel imaging system (BIO-RAD, BIO-RAD Gel Doc XR+).

[0039] Genomic DNA PCR amplification results showed that the maternal (large yellow croaker) mitochondrial gene cox1-specific band (located at 427 bp) was easily detected in the hybrid fish (large yellow croaker ♀ × small yellow croaker ♂) during the blastocyst, tail bud, heartbeat, larval, juvenile, and young stages. The paternal (small yellow croaker) mitochondrial gene cox1-specific band (located at 219 bp) was detectable in the blastocyst and tail bud stages, but gradually disappeared during the heartbeat stage. As a control, the maternal and paternal nuclear gene tfam-specific bands (located at 225 bp and 328 bp, respectively) were detected in all stages of the hybrid fish. Figure 1RT-PCR amplification results showed that a specific band of the maternal mitochondrial gene cox1 transcript (located at 174 bp) was detectable in the hybrid fish during the blastocyst, tail bud, heartbeat, larval, juvenile, and young stages, while a specific band of the paternal mitochondrial gene cox1 transcript (located at 126 bp) was not detected at any stage. Similarly, as a control, specific bands of the maternal and paternal nuclear gene tfam transcripts (located at 81 bp and 110 bp, respectively) were detected at all stages. Figure 2 ).

[0040] The above results indicate that although paternal mitochondrial DNA is briefly present in the early embryonic development of hybrid fish, its transcripts are not present in the hybrid fish. This transcriptional silencing prevents paternal mitochondrial DNA from affecting the embryonic development of hybrid offspring, ensuring that hybrid offspring follow the rule of maternal mitochondrial inheritance. sequence list <110> Zhejiang Academy of Agricultural Sciences <120> Primer set for identifying mitochondrial maternal inheritance in hybrid fish of large yellow croaker and small yellow croaker and its application <160> 20 <170> SIPOSequenceListing 1.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <400> 1 cctgcgaggt gtagggaaa 19 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <400> 2 aaggcacgag tcagtttcc 19 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <400> 3 acaaagacat cggcaccct 19 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <400> 4 tccggcccct gcttcaac 18 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 cgttacggca catgctttcg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <400> 6 gaggcgagga gcagtaggaa 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <400> 7 cctcatcagc ggttgaagca 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <400> 8 agacacccgc aaggtgtaga 20 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <400> 9 gcatgagccg gaatagtgg 19 <210> 10 <211> 18 <212> DNA <213> Artificial Sequence <400> 10 tcgggggcgc caattatt 18 <210> 11 <211> twenty one <212> DNA <213> Artificial Sequence <400> 11 gtatttcaaa gccaaaccac a 21 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <400> 12 ctccgtgatg ctgatggtc 19 <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <400> 13 gcacgagcgt cctcacaag 19 <210> 14 <211> twenty one <212> DNA <213> Artificial Sequence <400> 14 tactgggttg atgtaagaag c 21 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <400> 15 cttggacctc cagggctaca 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <400> 16 gccaacctct gcctcttctc 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <400> 17 agattggcca agaggaaggc 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <400> 18 tcctcgaagt gctccgacat 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <400> 19 gtctgagctc tcaggccagt 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <400> 20 aggcttcctg aaagggctgt 20

Claims

1. Primer set for identifying the maternal mitochondrial inheritance of hybrid fish consisting of female large yellow croaker and female small yellow croaker. ♂ Hybrid fish, characterized by The primer set includes those based on cox1 Gene-specific primers and their RT-PCR primers and based on tfam Specific primers for nuclear genes and their RT-PCR primers; The basis cox1 Gene-specific primers include cox1-LC-R, cox1-LP-R, cox1-LC&LP-F, and cox1-LC&LP-R, and their nucleotide sequences are shown in SEQ ID NO.1 to SEQ ID NO.4; The basis cox1 The RT-PCR primers for the gene include cox1-LC-RT-F, cox1-LC-RT-R, cox1-LP-RT-F, cox1-LP-RT-R, cox1-LC&LP-RT-F, and cox1-LC&LP-RT-R, and their nucleotide sequences are shown in SEQ ID NO.5 to SEQ ID NO.10; The basis tfam The specific primers for nuclear genes include tfam-LC-R, tfam-LP-R, tfam-LC&LP-F, and tfam-LC&LP-R, and their nucleotide sequences are shown in SEQ ID NO.11 to SEQ ID NO.

14. The basis tfam The RT-PCR primers for nuclear genes include tfam-LC-RT-F, tfam-LC-RT-R, tfam-LP-RT-F, tfam-LP-RT-R, tfam-LC&LP-RT-F, and tfam-LC&LP-RT-R, and their nucleotide sequences are shown in SEQ ID NO.15 to SEQ ID NO.

20.

2. The application of the primer set as described in claim 1 in identifying mitochondrial maternal inheritance in hybrid fish of large yellow croaker and small yellow croaker, wherein the hybrid fish of large yellow croaker and small yellow croaker is large yellow croaker ♀ × small yellow croaker. ♂ In hybrid fish, if the maternal mitochondrial gene Cox1 specific band can be detected in the blastocyst, tail bud, heartbeat, larval, juvenile, and young stages, while the paternal mitochondrial gene Cox1 specific band can be detected in the blastocyst and tail bud stages but gradually disappears in the heartbeat stage; and if the maternal mitochondrial gene Cox1 transcript specific band can be detected in the blastocyst, tail bud, heartbeat, larval, juvenile, and young stages, while the paternal mitochondrial gene Cox1 transcript specific band is not detected in any stage, then it can be determined as maternal mitochondrial inheritance.

3. A method for identifying mitochondrial maternal inheritance in hybrid fish of large yellow croaker and small yellow croaker using the primer set described in claim 1, characterized in that... Includes the following steps: 1) Using female large yellow croaker and female small yellow croaker ♂ Using genomic DNA from hybrid fish, small yellow croaker, and large yellow croaker as templates, genomic DNA was amplified by PCR using primer pairs cox1-LC﹠LP-F / cox1-LC-R, cox1-LC﹠LP-F / cox1-LP-R, cox1-LC﹠LP-F / cox1-LC﹠LP-R, tfam-LC﹠LP-F / tfam-LC-R, tfam-LC﹠LP-F / tfam-LC﹠LP-R, and tfam-LC﹠LP-F / tfam-LC﹠LP-R, respectively, yielding genomic DNA from three fish species. cox1 and tfam Gene-specific sequences; 2) Using female large yellow croaker × female small yellow croaker ♂ Using single-stranded cDNA from hybrid fish, small yellow croaker, and large yellow croaker as templates, RT-PCR amplification was performed using primer pairs cox1-LC-RT-F / cox1-LC-RT-R, cox1-LP-RT-F / cox1-LP-RT-R, cox1-LC&LP-RT-F / cox1-LC&LP-RT-R, tfam-LC-RT-F / tfam-LC-RT-R, tfam-LP-RT-F / tfam-LP-RT-R, and tfam-LC&LP-RT-F / tfam-LC&LP-RT-R, respectively, to obtain three types of fish. cox1 and tfam Gene-specific cDNA sequences; 3) After the PCR amplification reaction, the amplification products were detected by 1.2% agarose gel electrophoresis, and the electrophoresis results were recorded by a gel imaging system. If the maternal mitochondrial gene Cox1 specific band can be detected in the hybrid fish during the blastocyst, tail bud, heartbeat, larval, juvenile, and young stages, while the paternal mitochondrial gene Cox1 specific band can be detected in the blastocyst and tail bud stages but gradually disappears during the heartbeat stage; at the same time, if the maternal mitochondrial gene Cox1 transcript specific band can be detected in the hybrid fish during the blastocyst, tail bud, heartbeat, larval, juvenile, and young stages, while the paternal mitochondrial gene Cox1 transcript specific band is not detected at any stage, then it can be determined as maternal mitochondrial inheritance.

Images