High affinity single domain antibodies or antigen binding fragments thereof and uses thereof

By optimizing the amino acid sequence of the CDR region of the VHH antibody, an antibody that binds to anterior pituitary hormones with high efficiency was prepared, which solved the problem of poor binding activity of existing antibodies and achieved high-sensitivity detection.

CN115160436BActive Publication Date: 2026-08-04SUZHOU SHENGJI PHARM CO LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SUZHOU SHENGJI PHARM CO LTD
Filing Date
2021-09-07
Publication Date
2026-08-04

AI Technical Summary

Technical Problem

Existing antibodies exhibit poor binding activity when detecting anterior pituitary hormones such as FSH, HCG, TSH, hLH, and FSH-CTP, and cannot efficiently bind to these protein molecules.

Method used

Using heavy chain variable region (VHH) antibodies, the binding activity and sensitivity of antibodies can be improved by inserting, deleting or replacing amino acid sequences in the CDR region, thus preparing highly efficient antibodies or their antigen-binding fragments.

Benefits of technology

It achieves efficient binding to protein molecules such as FSH, HCG, TSH, hLH, and FSH-CTP, improving detection sensitivity and ease of operation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003745842480000041
    Figure BDA0003745842480000041
  • Figure BDA0003745842480000101
    Figure BDA0003745842480000101
  • Figure BDA0003745842480000102
    Figure BDA0003745842480000102
Patent Text Reader

Abstract

This invention discloses a high-affinity single-domain antibody or its antigen-binding fragment and its applications. Specifically, it relates to an antibody or its antigen-binding fragment, wherein the antibody includes a heavy chain variable region (VHH), the heavy chain variable region including the following complementarity-determining regions (CDRs) or mutations thereof according to Kabat numbering: CDR1 with an amino acid sequence as shown in SEQ ID NO:9; CDR2 with an amino acid sequence as shown in SEQ ID NO:13; and CDR3 with an amino acid sequence as shown in SEQ ID NO:11 or 14; wherein the mutation is an insertion, deletion, or substitution of 5, 4, 3, 2, or 1 amino acid, respectively, based on the amino acid sequences of CDR1, CDR2, and CDR3 of the VHH. The antibody prepared by this invention has high affinity binding to antigens containing the human α chain as shown in SEQ ID NO:1, and has a novel sequence.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of nanobody technology, and more specifically, to an antibody or its antigen-binding fragment, as well as a method for preparing the antibody or its antigen-binding fragment and its application. Background Technology

[0002] Anterior pituitary hormones include human chorionic gonadotropin (HCG), follicle-stimulating hormone (FSH), follicle-stimulating hormone-CTP fusion protein (FSH-CTP), human luteinizing hormone (hLH), and hormones secreted by the anterior pituitary gland (TSH). All of them are composed of two units, α and β, linked together by ionic and hydrophobic bonds. The α subunit is a common subunit of anterior pituitary hormones, while the β subunits differ and can be distinguished by their immune activity.

[0003] HCG is a glycoprotein produced by the syncytiotrophoblast of the placental chorionic villi. Serum HCG level testing can provide clinical evidence for the diagnosis of early pregnancy and for the diagnosis, differential diagnosis, and prognosis of HCG-related diseases such as ectopic pregnancy, hydatidiform mole, incomplete abortion, and seminoma of the testis.

[0004] FSH is a gonadotropin released by the anterior pituitary gland, playing a crucial role in follicle development and maturation in women and sperm development in men. Measuring serum follicle-stimulating hormone (FSH) is significant for understanding pituitary endocrine function, indirectly assessing the functional status of the hypothalamus and ovaries, predicting ovulation time, and diagnosing and treating infertility and endocrine disorders. FSH-CTP refers to the CTP fusion protein of FSH, which prolongs the in vivo half-life of FSH.

[0005] hLH is a gonadotropin secreted by the anterior pituitary gland. Its main effects are on the gonads, leading to follicle maturation, further androgen secretion, ovulation, and the formation and maintenance of the corpus luteum. Clinically, it can be used to differentiate the causes of amenorrhea and monitor the ovulation period. Monitoring the ovulation period is helpful in diagnosing infertility and studying the mechanisms of action of contraceptive drugs.

[0006] TSH is one of the hormones secreted by the anterior pituitary gland, and its main function is to control and regulate thyroid activity. Measuring serum (plasma) thyroid-stimulating hormone (TSH) is an important indicator for diagnosing and treating hyperthyroidism and hypothyroidism, as well as for studying the hypothalamic-pituitary-thyroid axis. It is an indispensable tool in diagnosing hypothyroidism and differentiating between primary and secondary (hypothalamic or pituitary) hypothyroidism. During the treatment of hyperthyroidism and hypothyroidism, TSH levels can serve as an indicator of treatment efficacy. Furthermore, it can be used to observe pituitary TSH reserve function and further differentiate between hypothalamic and pituitary lesions. TSH testing is a primary screening test for thyroid function. Even small changes in free thyroid hormone concentration can lead to significant adjustments in TSH concentration in the opposite direction.

[0007] These hormones are present in low concentrations in the blood, requiring sensitive, efficient, and stable antibodies for effective detection or monitoring. Existing antibodies suffer from drawbacks such as low binding activity and lack the ability to efficiently bind to the common α-chain of HCG, FSH, hLH, TSH, and FSH-CTP.

[0008] Alpaca serum contains naturally occurring antibodies lacking the light chain, known as heavy-chain antibodies (hcAbs). Single-domain antibodies (sdAbs) are genetically engineered antibodies composed solely of the variable region of the heavy chain antibody; they are also called VHH antibodies (variable domain of heavy-chain antibody), nanobodies (Nb), or single-domain antibodies. Compared to traditional antibodies, single-domain antibodies have advantages such as small molecular weight, high stability, and good water solubility. Summary of the Invention

[0009] The technical problem this invention aims to solve is to overcome the shortcomings of existing technologies, such as poor binding activity of antibodies to heterodimeric proteins containing the α chain (SEQ ID NO:1), such as FSH, HCG, TSH, hLH, and FSH-CTP. This invention provides an antibody or its antigen-binding fragment, its preparation method, and its application in detecting the aforementioned heterodimeric proteins or in drug preparation. The antibody of this invention exhibits good binding activity and high sensitivity to protein molecules containing the sequence shown in SEQ ID NO:1 (e.g., FSH, HCG, TSH, hLH, FSH-CTP), and the method for detecting protein molecules containing the sequence shown in SEQ ID NO:1 is convenient and simple to operate.

[0010] A first aspect of the present invention provides an antibody or an antigen-binding fragment thereof, the antibody comprising a heavy chain variable region (VHH), wherein the heavy chain variable region comprises a complementarity-determining region (CDR) or a mutation thereof numbered according to Kabat: CDR1 with an amino acid sequence as shown in SEQ ID NO:9; CDR2 with an amino acid sequence as shown in SEQ ID NO:13; and CDR3 with an amino acid sequence as shown in SEQ ID NO:11 or 14; wherein the mutation is an insertion, deletion, or substitution of 5, 4, 3, 2, or 1 amino acid, respectively, based on the amino acid sequences of CDR1, CDR2, and CDR3 of the VHH.

[0011] Preferably, the mutation of CDR1 is an amino acid substitution of R2N / G, T3L, F4V / A, S5D, S6V / R / G / N, Y7D / H, and / or A8N / D in the amino acid sequence shown in SEQ ID NO:9, and its amino acid sequence is preferably as shown in any one of SEQ ID NO:12, 15, 18, 21, 22, 25; the mutation of CDR2 is an amino acid substitution of M2T / S / N, W3Q, D6G, and / or S7N in the amino acid sequence shown in SEQ ID NO:13, and its amino acid sequence is preferably as shown in any one of SEQ ID NO:10, 16, 19, 23, 26; the mutation of CDR3 is an amino acid substitution of L4I / T or deletion, Q5D, E6G / V, and / or E7Q / S / P in the amino acid sequence shown in SEQ ID NO:14, or is an amino acid substitution of R2N / G, T3L, F4V / A, S5D, S6V / R / G / N, Y7D / H, and / or A8N / D in the amino acid sequence shown in SEQ ID NO:9, and its amino acid sequence is preferably as shown in any one of SEQ ID NO:12, 15, 18, 21, 22, 25; the mutation of CDR3 is an amino acid substitution of L4I / T or deletion, Q5D, E6G / V, and / or E7Q / S / P in the amino acid sequence shown in SEQ ID NO:14, or is an amino acid substitution of R2N / G, T3L, F4V / A, S5D, S6V / R / G / N, Y7D / H, and / or A8N / D in the amino acid sequence shown in SEQ ID NO:14, and / or A8N / D in the amino acid sequence shown in SEQ ID NO:15, SEQ ID NO:16 The amino acid sequence shown in NO:11 has an amino acid substitution of G9D and / or Y14F, and its amino acid sequence is preferably as shown in any one of SEQ ID NO:17, 20, 24, 27.

[0012] In a preferred embodiment, the heavy chain variable region includes the following sequences: the CDR1 amino acid sequence as shown in SEQ ID NO:9; the CDR2 amino acid sequence as shown in SEQ ID NO:10; and the CDR3 amino acid sequence as shown in SEQ ID NO:11.

[0013] In a preferred embodiment, the heavy chain variable region includes the following sequences: the CDR1 amino acid sequence as shown in SEQ ID NO:12; the CDR2 amino acid sequence as shown in SEQ ID NO:13; and the CDR3 amino acid sequence as shown in SEQ ID NO:14.

[0014] In a preferred embodiment, the heavy chain variable region includes the following sequences: the CDR1 amino acid sequence as shown in SEQ ID NO:15; the CDR2 amino acid sequence as shown in SEQ ID NO:16; and the CDR3 amino acid sequence as shown in SEQ ID NO:17.

[0015] In a preferred embodiment, the heavy chain variable region includes the following sequences: the CDR1 amino acid sequence as shown in SEQ ID NO:18; the CDR2 amino acid sequence as shown in SEQ ID NO:19; and the CDR3 amino acid sequence as shown in SEQ ID NO:20.

[0016] In a preferred embodiment, the heavy chain variable region includes the following sequences: the CDR1 amino acid sequence as shown in SEQ ID NO:21; the CDR2 amino acid sequence as shown in SEQ ID NO:13; and the CDR3 amino acid sequence as shown in SEQ ID NO:14.

[0017] In a preferred embodiment, the heavy chain variable region includes the following sequences: the CDR1 amino acid sequence as shown in SEQ ID NO:22; the CDR2 amino acid sequence as shown in SEQ ID NO:23; and the CDR3 amino acid sequence as shown in SEQ ID NO:24.

[0018] In a preferred embodiment, the heavy chain variable region includes the following sequences: the CDR1 amino acid sequence as shown in SEQ ID NO:25; the CDR2 amino acid sequence as shown in SEQ ID NO:26; and the CDR3 amino acid sequence as shown in SEQ ID NO:27.

[0019] Please refer to Table 1 for details.

[0020] Table 1: CDR sequences corresponding to different antibodies (according to Kabat's definition rules)

[0021]

[0022] It is well known to those skilled in the art that antibody CDRs can be defined in various ways, such as the Kabat definition based on sequence variability (see, Kabat et al., Protein Sequences in Immunology, 5th Edition, National Institutes of Health, Bethesda, Maryland (1991)) and the Chothia definition based on the location of structural loop regions (see J MolBiol 273:927-48, 1997). In this application, the amino acid sequences of the CDRs listed above are as shown in the Kabat definition; however, it should be understood by those skilled in the art that, unless otherwise specified, the terms “CDR” and “complementarity-determining region” for a given antibody or its region (e.g., a variable region) should be understood to encompass complementarity-determining regions as defined by any of the CDR definition rules known to those skilled in the art. Although the scope of protection claimed in this invention is based on the sequences shown in the Kabat definition, amino acid sequences corresponding to other CDR definition rules should also fall within the scope of protection of this invention.

[0023] The heavy chain variable region preferably also includes the framework region (FWR) of the alpaca antibody or human antibody.

[0024] Preferably, the antibody or its antigen-binding fragment is a VHH, a heavy chain antibody, a bispecific antibody, or a multispecific antibody, and is preferably a VHH.

[0025] More preferably, the VHH comprises an amino acid sequence as shown in any of SEQ ID NO:2-8.

[0026] In a preferred embodiment, the VHH is any of the amino acid sequences shown in SEQ ID NO:2-8.

[0027] In a preferred embodiment, the antibody or its antigen-binding fragment targets a protein containing the amino acid sequence shown in SEQ ID NO:1, wherein the protein containing the amino acid sequence shown in SEQ ID NO:1 is preferably one or more of FSH, HCG, TSH, FSH-CTP and hLH.

[0028] A second aspect of the present invention provides an isolated nucleic acid that encodes an antibody or an antigen-binding fragment thereof as described in the first aspect of the present invention.

[0029] The method for preparing the nucleic acid is a conventional method in the art, and preferably includes the following steps: obtaining the nucleic acid molecule encoding the antibody by gene cloning technology, or obtaining the nucleic acid molecule encoding the antibody by artificial full-sequence synthesis.

[0030] Those skilled in the art will understand that the base sequence encoding the amino acid sequence of the above-mentioned antibody can be appropriately substituted, deleted, altered, inserted, or added to provide a homologue of a polynucleotide. The homologue of the polynucleotide in this invention can be prepared by substituting, deleting, or adding one or more bases of the gene encoding the antibody sequence, while maintaining antibody activity.

[0031] A third aspect of the present invention provides a recombinant expression vector comprising the isolated nucleic acid as described in the second aspect of the present invention.

[0032] The recombinant expression vector can be obtained by conventional methods in the art, namely, by linking the nucleic acid molecules described in this application to various expression vectors. The expression vector can be any conventional vector in the art, as long as it can accommodate the aforementioned nucleic acid molecules. Preferably, the recombinant expression vector is a plasmid, granulosome, bacteriophage, or viral vector, and the viral vector is preferably a retroviral vector, lentiviral vector, adenovirus vector, or adeno-associated virus vector.

[0033] A fourth aspect of the present invention provides a transformant comprising a recombinant expression vector as described in the third aspect of the present invention contained in a host cell.

[0034] The preparation method of the transformant can be a conventional method in the art, such as transforming the above-mentioned recombinant expression vector into host cells. The host cells of the transformant can be any conventional host cells in the art, as long as they can stably and spontaneously replicate the above-mentioned recombinant expression vector and effectively express the nucleic acid it carries. Transforming the aforementioned recombinant expression plasmid into host cells yields the preferred recombinant expression transformant of the present invention. The transformation method is a conventional transformation method in the art, preferably a chemical transformation, heat shock method, or electroporation method.

[0035] Preferably, the host cell is yeast, such as Saccharomyces cerevisiae, mold, bacteria, or a cell expression system.

[0036] A fifth aspect of the present invention provides a chimeric antigen receptor comprising an antibody or an antigen-binding fragment thereof as described in the first aspect of the present invention.

[0037] A sixth aspect of the present invention provides a genetically modified cell comprising a chimeric antigen receptor as described in a fifth aspect of the present invention.

[0038] Preferably, the genetically modified cells are eukaryotic cells, more preferably isolated human cells; more preferably immune cells such as T cells or NK cells.

[0039] The seventh aspect of the present invention provides a method for preparing an antibody or an antigen-binding fragment thereof as described in the first aspect of the present invention, comprising the following steps: culturing a transformant as described in the fourth aspect of the present invention, and obtaining the antibody or an antigen-binding fragment thereof from the culture.

[0040] The eighth aspect of the present invention provides an antibody-drug conjugate comprising an antibody portion and a conjugation portion, wherein the antibody portion comprises an antibody or an antigen-binding fragment thereof as described in the first aspect of the present invention.

[0041] Preferably, the conjugation portion includes a detectable marker, drug, toxin, cytokine, radionuclide, enzyme, or combination thereof, and the antibody portion and the conjugation portion are conjugated by a chemical bond or adapter.

[0042] A ninth aspect of the present invention provides a pharmaceutical composition comprising an antibody or an antigen-binding fragment thereof as described in the first aspect of the present invention, a chimeric antigen receptor as described in the fifth aspect of the present invention, a genetically modified cell as described in the sixth aspect of the present invention, and / or an antibody-drug conjugate as described in the eighth aspect of the present invention.

[0043] Preferably:

[0044] The pharmaceutical composition further includes a pharmaceutically acceptable carrier; and / or, the pharmaceutical composition is a liquid, gaseous, solid, or semi-solid dosage form; and / or, the pharmaceutical composition can be administered orally, by injection, nasal administration, transdermal administration, or mucosal administration.

[0045] The tenth aspect of the present invention provides a medicine box set, which includes medicine box A and medicine box B, wherein:

[0046] The kit A contains an antibody or its antigen-binding fragment as described in the first aspect of the present invention, a chimeric antigen receptor as described in the fifth aspect of the present invention, a genetically modified cell as described in the sixth aspect of the present invention, an antibody-drug conjugate as described in the eighth aspect of the present invention, and / or a pharmaceutical composition as described in the ninth aspect of the present invention.

[0047] The kit B contains one or more of the following: hormone preparations, targeted small molecule preparations, proteasome inhibitors, imaging agents, diagnostic agents, chemotherapeutic agents, radiotherapy agents, immunosuppressants, oncolytic drugs, cytotoxic agents, cytokines, activators of co-stimulatory molecules, inhibitors of inhibitory molecules, and vaccines.

[0048] The eleventh aspect of the present invention provides a kit comprising an antibody or antigen-binding fragment thereof as described in the first aspect of the present invention, a chimeric antigen receptor as described in the fifth aspect, genetically modified cells as described in the sixth aspect, an antibody-drug conjugate as described in the eighth aspect, and / or a pharmaceutical composition as described in the ninth aspect.

[0049] Preferably, the kit further includes (i) a means of administering an antibody or its antigen-binding fragment or chimeric antigen receptor or genetically modified cell or antibody-drug conjugate or pharmaceutical composition; and / or (ii) instructions for use.

[0050] The twelfth aspect of the present invention provides the use of an antibody or antigen-binding fragment thereof as described in the first aspect of the present invention, a chimeric antigen receptor as described in the fifth aspect of the present invention, a genetically modified cell as described in the sixth aspect of the present invention, an antibody-drug conjugate as described in the eighth aspect of the present invention, a pharmaceutical composition as described in the ninth aspect of the present invention, a kit as described in the tenth aspect of the present invention, and / or a reagent kit as described in the eleventh aspect of the present invention in the preparation of a medicament for treating and / or preventing a protein-mediated disease or condition containing an amino acid sequence as shown in SEQ ID NO:1.

[0051] Preferably, the protein containing the amino acid sequence shown in SEQ ID NO:1 is selected from one or more of FSH, HCG, TSH, FSH-CTP and hLH.

[0052] The thirteenth aspect of the present invention provides the use of an antibody or antigen-binding fragment thereof as described in the first aspect of the present invention in detecting a protein containing the amino acid sequence shown in SEQ ID NO:1.

[0053] Preferably, the protein is selected from one or more of FSH, HCG, TSH, FSH-CTP, and hLH.

[0054] The fourteenth aspect of the present invention provides a method for detecting a protein containing the amino acid sequence shown in SEQ ID NO:1, comprising the steps of using an antibody or antigen-binding fragment thereof as described in the first aspect of the present invention, a chimeric antigen receptor as described in the fifth aspect of the present invention, a genetically modified cell as described in the sixth aspect of the present invention, an antibody-drug conjugate as described in the eighth aspect of the present invention, a pharmaceutical composition as described in the ninth aspect of the present invention, a kit as described in the tenth aspect of the present invention, and / or a reagent kit as described in the eleventh aspect of the present invention.

[0055] In this application, the term "multispecific antibody" is used in its broadest sense to encompass antibodies that have multiple epitope specificity. These multispecific antibodies include, but are not limited to: antibodies containing a heavy chain variable region (VH) wherein the VH unit has multiple epitope specificity; antibodies having two or more VH regions, each VH unit binding to a different target or a different epitope of the same target; antibodies having two or more single variable regions, each single variable region binding to a different target or a different epitope of the same target; full-length antibodies, antibody fragments, bispecific antibodies, and triabodies, antibody fragments covalently or non-covalently linked, etc.

[0056] In this application, the term "heavy chain antibody" refers to an antibody containing only one heavy chain variable region (VHH) and two conventional CH2 and CH3 regions, also known as HCAbs.

[0057] In this application, the “VHH (single-domain antibody)”, also known as “nanobody”, refers to the VHH structure cloned from heavy chain antibodies, which is the smallest known unit that can bind to a target antigen.

[0058] The positive and progressive effects of this invention are as follows:

[0059] The antibody of the present invention exhibits good binding activity and high sensitivity to protein molecules (e.g., FSH, HCG, TSH, hLH, FSH-CTP, etc.) containing the sequence shown in SEQ ID NO:1. This antibody provides a convenient and simple method for detecting protein molecules containing the sequence shown in SEQ ID NO:1, such as FSH, HCG, TSH, hLH, and FSH-CTP. Attached Figure Description

[0060] Figure 1 This is an electrophoresis image of the first round of amplification after reverse transcription of RNA extracted from VHH, where M represents the marker and lanes 1-5 represent 5 groups of RNA extractions.

[0061] Figure 2 This is an electrophoresis image of the second round of amplification after reverse transcription of RNA extracted from VHH, where M represents the marker, and lanes 1-2 represent... Figure 1 Electrophoresis images of the second round of PCR amplification after gel extraction and recovery in lanes 1 and 2 of the middle swim bladder.

[0062] Figure 3 A plate plot showing the volume titer of RNA extracted from VHH for library construction.

[0063] Figure 4 Colony PCR was used to identify the insertion rate of the target gene in the library.

[0064] Figure 5For VHH expression with different binding α subunits, lanes 1-7 correspond to the results of proteins 2-8, respectively. Detailed Implementation

[0065] This invention uses HCG to immunize Bactrian camels, and then uses peripheral blood lymphocytes from these camels to establish a VHH phage library containing an HCG heavy chain antibody. In subsequent experiments, HCG and hLH were coated onto ELISA plates, and phage display technology was used to screen for immunogenic nanobody phage libraries, thereby obtaining a specific nanobody gene targeting the shared α chain of HCG and hLH. This gene was then transformed into *E. coli*, thus establishing a nanobody strain that can be efficiently expressed in *E. coli*, and the gene sequence was identified.

[0066] Example 1: Construction of immunized animals and phage libraries

[0067] 1. Immunized animals

[0068] Healthy adult alpacas were used, and HCG was mixed with an adjuvant and administered via subcutaneous injection. The immunization schedule is shown in Table 2. Seven days after the third booster immunization, peripheral blood was collected from the alpacas to construct a phage display library.

[0069] Table 2 Immunization Schedule

[0070] Immunization time Day 0 Day 21 Day 42 Day 63 Immunization dose (mg) 0.5 0.25 0.25 0.25 adjuvant Freund's incomplete adjuvant Freund's incomplete adjuvant Freund's incomplete adjuvant Freund's incomplete adjuvant Immunization methods subcutaneous subcutaneous subcutaneous subcutaneous

[0071] 2. Alpaca lymphocyte isolation:

[0072] Add 6 mL of lymphocyte separation medium to a 15 mL centrifuge tube, then add an equal volume of whole blood sample. Centrifuge at 800 g for 20 min at room temperature. Carefully aspirate the leukocytes suspended in the middle layer to a new centrifuge tube, add twice the volume of PBS, and centrifuge at 800 g for 15 min at room temperature. Carefully discard the supernatant, add erythrocyte lysis buffer, and lyse the erythrocytes. Centrifuge at 450 g for 15 min at room temperature, discard the supernatant, and count the cells. Perform a 10⁻⁶ cycle. 7 Lyse each lymphocyte with 2 mL of Trizol and set aside.

[0073] 3. Total RNA extraction

[0074] Add 1 / 5 volume of chloroform to the above lysis buffer, shake vigorously for 20 seconds to emulsify thoroughly, and let stand on ice for 10 minutes; centrifuge at 12000g for 10 minutes at 4°C, and transfer the supernatant to another fresh centrifuge tube; add an equal volume of isopropanol, mix thoroughly, and let stand on ice for 10 minutes; centrifuge at 12000g for 10 minutes at 4°C, discard the supernatant, add 75% ethanol, and mix thoroughly; centrifuge at 12000g for 10 minutes at 4°C, discard the supernatant; dry at room temperature for 5 minutes, add an appropriate amount of RNase-free water to dissolve the precipitate, and store at -80°C after the RNA precipitate has completely dissolved.

[0075] 4. Antibody gene amplification

[0076] The first round PCR system of Nester is shown in Table 3 below:

[0077] Table 3

[0078]

[0079] Reaction program: 94℃, 5 min; 98℃, 10 s; 50℃, 15 s; 72℃, 1 min, for a total of 30 cycles; after the reaction, gel electrophoresis was performed, and the target fragment of approximately 700 bp was recovered by gel cutting. The Alpvh-LD sequence (5'-3') is as follows: CTTGGTGGTCCTGGCTGC (SEQ ID NO:28); the CH2-R sequence (5'-3') is as follows: GGTACGTGCTGTTGAACTGTTCC (SEQ ID NO:29). Results are as follows... Figure 1 As shown.

[0080] The second round of PCR in the nest is shown in Table 4 below: 94℃, 5min; 98℃, 10s; 57℃, 15s; 72℃, 45s, for a total of 30 cycles.

[0081] Table 4

[0082]

[0083]

[0084] The AlpVh-F1 sequence (5'-3') (SEQ ID NO:30) is as follows:

[0085] CATGCCATGACTGTGGCCCAGGCGGCCCAGKTGCAGCTCGTGGAGTC;

[0086] The AlpVHH-R1 (5'-3') sequence (SEQ ID NO:31) is as follows:

[0087] CATGCCATGACTCGCGGCCGGCCTGGCCATGGGGGTCTTCGCTGTGGTGCG;

[0088] The AlpVHH-R2 (5'-3') sequence (SEQ ID NO:32) is as follows:

[0089] CATGCCATGACTCGCGGCCGGCCTGGCCGTCTTGTGGTTTTGGTGTCTTGGG.

[0090] After the second round of reactions, gel electrophoresis (such as...) Figure 2 After (as shown), the target fragment is recovered by gel extraction and subjected to double enzyme digestion.

[0091] 5. Library Construction

[0092] 5.1 Enzyme digestion of vector and target fragment

[0093] The double enzyme digestion system (160 μL system) for the target fragment is shown in Table 5:

[0094] Table 5

[0095]

[0096] The vector double enzyme digestion system (160 μL) is shown in Table 6:

[0097] Table 6

[0098]

[0099] 5.2 The system for linking the vector to the target fragment is shown in Table 7:

[0100] Table 7

[0101]

[0102]

[0103] The solution was incubated overnight at 16°C. 5 μL (1 / 10 of the volume) of 3M CH3COONa (pH 5.2) and 125 μL (2.5 times the volume) of cold anhydrous ethanol were added. The solution was allowed to stand at -20°C for 30-60 min. The precipitate was recovered by centrifugation at 12000g. The precipitate was washed with 70% cold ethanol, dried at room temperature, and dissolved in 15 μL of deionized water.

[0104] 6. Electroconversion

[0105] A total of 10 electroporation cycles were performed. Immediately after each electroporation, 1 mL of 2YT medium (preheated to 37°C) was added to the electroporation vessel for recovery. The electroporation product was aspirated and the electroporation vessel was washed with 2YT medium, yielding a total of 100 mL of recovery product. The product was then recovered at 37°C and 180 rpm for 45 min, and 100 μL was serially diluted to 10⁻⁶. -3 and 10 -4 The number of transformants in the library was determined, and the samples were spread onto 90 mm plates. The remaining samples were centrifuged, resuspended in 8 mL of 2YT, and spread onto eight 200 mm plates. The next day, the F-mixed primer library 10 was transferred to the plates used for determining the number of transformants. -4 There are 132 clones in total, with a library capacity of 1.32 × 10⁻⁶. 9 (132×1000×10 4 ); Fnew primer library 10-4 There are a total of 110 clones, 1.1 × 10⁻⁶ 9 (110×1000×10 4 ),like Figure 3 As shown.

[0106] 7. Colony PCR validation insertion rate

[0107] Forty-eight clones were randomly selected from the cholesteric titer plate for identification, and the results showed that the insertion rate was 100% for all clones. Figure 4 As shown, the target gene band is 700bp, and the marker band sizes are 5000, 3000, 2000, 1500, 1000, 750, 500, 250, and 100bp.

[0108] Example 2: Antibody Screening

[0109] 1. Friendly Selection

[0110] 1) HCG antigen Dilute with carbonate buffer at pH 9.6 to a final concentration of 5 μg / mL, add 100 μL / well to each well, and coat 8 wells for each target molecule (4 wells for the second round of screening). Coat overnight at 4°C.

[0111] 2) Discard the coating solution, wash 3 times with PBS, add 300 μL of 3% BSA-PBS blocking solution to each well, and block at 37°C for 1 h;

[0112] 3) Wash three times with PBS, add 100 μL of phage library, and incubate at 37°C for 1 h;

[0113] 5) Aspirate unbound phages, wash 6 times with PBST, and wash 2 times with PBS;

[0114] 6) Add 100 μL of Gly-HCl elution buffer and incubate at 37 °C for 8 min to elute the specifically bound phages; transfer the elution buffer to a 1.5 mL sterile centrifuge tube and quickly neutralize with 10 μL of Tris-HCl neutralization buffer;

[0115] 7) Take 10 μL for serial dilution, determine the titer, calculate the panning recovery rate, mix the remaining eluents and amplify and purify them for the next round of affinity panning, change the panning conditions, and the panning conditions for each round are shown in Table 8.

[0116] Table 8 Affinity Selection Criteria

[0117]

[0118] Table 9. Recovery rates after two rounds of acid elution with HCG as the target protein.

[0119]

[0120] Recovery rate = Recovery amount / Library input amount; Enrichment degree = Recovery rate of the next round / Recovery rate of the previous round.

[0121] 2. Expanding the document library after selection

[0122] 1) Mix the selected eluent with 5 mL of E. coli 2738 culture (New England Biolabs) in the early logarithmic growth phase, incubate at 37°C for 15 min, then shake at 220 r / min for 45 min; centrifuge at 1000 g for 15 min, discard the supernatant, resuspend in 500 μl 2×YT and spread on a 200 mm 2×YT-GA plate;

[0123] 2) Scrape the cells with 10 ml of 2×YT liquid medium, take 500 μl of the suspension and add it to 50 ml of 2×YT liquid medium, shake at 37℃ for 30 min; add M13K07 helper phage (Addgene, catalog number: #119819) at a cell:phage ratio of 1:20, incubate at 37℃ for 30 min, shake at 220 rpm for 30 min; aliquot the culture into centrifuge tubes, centrifuge at 25℃ and 5000 rpm for 10 min, resuspend the cell pellet in 50 mL of 2×YT-AK liquid medium, and incubate overnight at 30℃ and 230 rpm with shaking;

[0124] 3) Centrifuge the overnight culture at 10,000 r / min for 20 min at 4℃, transfer the supernatant to a new centrifuge tube, add 1 / 5 volume of PEG-NaCl, mix well and incubate at 4℃ for more than 2 h.

[0125] 4) Centrifuge at 4℃ and 10000r / min for 20min, remove the supernatant, resuspend the precipitate in 1mL PBS, add 1 / 5 volume of PEG / NaCl, mix well and incubate at 4℃ for more than 1h.

[0126] 5) Centrifuge at 4℃ and 12000r / min for 2min, remove the supernatant, and suspend the precipitate in 200μL PBS. This is the amplification product. Measure the titer for the next round of screening or analysis.

[0127] 3. Identification and analysis of specific phage clones

[0128] 3.1 Identification of phage particles

[0129] 1) From the plate of the second round of elution titer, 96 single clones were randomly picked with a sterile toothpick and inoculated into 1 mL of 2×YT-A. The plate was then incubated at 37℃ and 220 r / min for 8 h with shaking.

[0130] 2) Take 200 μL of the above culture, add M13K07 phage at a ratio of cell:phage = 1:20, incubate at 37℃ for 15 min, then shake at 220 r / min for 45 min.

[0131] 3) Add 800 μL of 2×YT-AK, incubate overnight at 30°C with vigorous shaking.

[0132] 4) On the second day, centrifuge at 12,000 rpm for 2 minutes, collect the supernatant, and use it for monoclonal ELISA identification.

[0133] 3.2 Identification of positive phage clones

[0134] 1) HCG or hLH antigen Dilute with carbonate buffer (pH 9.6) to a final concentration of 2 μg / mL, add 100 μL / well to each well, and coat overnight at 4°C.

[0135] 2) Discard the coating solution, wash 3 times with PBST, add 200 μL of 5% skim milk to each well, and block at 37°C for 1 h;

[0136] 3) Wash three times with PBST, add 50 μL of phage culture supernatant and 50 μL of 5% skim milk to each well, and incubate at 37°C for 1 h;

[0137] 4) Wash 6 times with PBST, add 100 μL / well of horseradish peroxidase-labeled anti-M13 antibody (Abcam, catalog number: ab235228), and incubate at 37°C for 1 h;

[0138] 5) Wash the plate 6 times with PBST. Add TMB chromogenic solution (100 μL / well) for color development, incubate at 37℃ for 7 min, add 50 μL / well of stop solution to terminate the reaction, and measure the OD value at 450 nm.

[0139] Seven sequences with high affinity were obtained: sequences 1, 13, 24, 25, 48, 62, and 70 (Table 10). These seven positive clones were sequenced, and the corresponding amino acid sequences are shown in Table 10 below.

[0140] Table 10. ELISA identification and corresponding sequences of HCG and hLH antigen phage.

[0141]

[0142] Example 3: Antibody Expression and Binding Identification

[0143] 1. Sequence synthesis and expression

[0144] The selected sequences were expressed and their affinity for the antigen containing the α subunit was tested. The VHH sequence 1G9E [PMID: 24739391] was selected as a positive control. Nanjing Genscript Biotech Co., Ltd. was commissioned to optimize the codons preferred by *E. coli*, and an N-terminal methionine and C-terminal 6×histidine tag (VHH-sgs-HHHHHH) was added to synthesize a polynucleotide sequence encoding SEQ ID NO: 2-8 and 1G9E. This sequence was inserted into the pET32a expression vector, and after successful sequencing, a recombinant plasmid for peptide expression was obtained. The prepared recombinant plasmid was electroporated into *E. coli* BL21 Star(DE3) and inoculated onto LB agarose plates containing 100 μg / ml ampicillin. The plates were incubated overnight at 37°C until colonies grew. Single colonies were picked and inoculated into 3 ml of LB medium containing 100 μg / ml ampicillin, and incubated overnight at 37°C and 250 rpm. The overnight culture was inoculated into 50 ml of LB medium containing 100 μg / ml ampicillin and incubated at 37°C until the OD600 reached 0.4–0.6. Then, 0.1 mM IPTG was added, and the culture was continued overnight. The final culture was centrifuged to collect the cell pellet, resuspended in PBS to 100 g / L, and then subjected to sonication to lyse the cells. After lysing, the supernatant was collected by centrifugation. The supernatant was purified using a nickel column. The purified protein was then transferred to PBS (pH 7.0) using an ultrafiltration centrifuge tube. The purity of the obtained protein was evaluated using SDS-PAGE. Figure 5 As shown in the figure, the purity of all 8 sequences is ≥97%.

[0145] 2. Evaluation of purified protein binding activity

[0146] The ELISA plate was soaked in 2 μg / ml HCG. The plate was coated overnight at 2–8°C; then washed three times with PBST (PBS containing 0.05% Tween 20, pH 7.4). The washed plate was then blocked with 300 μl of blocking buffer (PBST containing 1% BSA) at 37°C for 2 h, and washed with PBST after blocking.

[0147] Sample dilution: Dilute each sample to a starting point of 200 ng / ml, perform a 2-fold serial dilution at 10 points, and add 100 μl / well replicates to a 96-well plate.

[0148] The microplate was incubated at 37°C with shaking for 1 hour. After washing with PBST, 40 ng / ml of Anti-6×His tag antibody (HRP) (Abcam, catalog number: AB1187) was added to the wells of the plate, and the plate was incubated at 37°C with shaking for 1 hour. After washing with PBST, TMB (Tetramethylbenzidine) was added as the chromogenic substrate for HRP, and the plate was incubated for 15 minutes. The incubation was terminated with 2N H2SO4. The absorbance at 450 nm was measured using a microplate reader. The EC50 value was calculated using a 4-parameter equation.

[0149] Table 11. EC50 values ​​detected by ELISA

[0150] 2 10.28 6 13.75 3 25.90 7 14.01 4 5.05 8 23.46 5 9.46 1G9E N / A*

[0151] *Note: The ELISA detection of sample 1G9E did not produce a complete 4-parameter curve. The OD value at the high concentration point was much lower than that of other VHHs and did not reach saturation. There was no EC50 data.

[0152] The results are shown in Table 11, which show that VHH of SEQ ID NO:2-8 has different binding activities for FSH and HCG, and the binding activities are much greater than those of 1G9E.

Claims

1. A single-domain antibody targeting a protein containing the amino acid sequence shown in SEQ ID NO:1, said single-domain antibody comprising a heavy chain variable region, characterized in that, The heavy chain variable region includes the following complementarity-determining regions (CDRs) numbered according to Kabat: the CDR1 amino acid sequence as shown in SEQ ID NO:22; the CDR2 amino acid sequence as shown in SEQ ID NO:23; and the CDR3 amino acid sequence as shown in SEQ ID NO:

24.

2. The single-domain antibody as described in claim 1, characterized in that, The heavy chain variable region also includes the framework region (FWR) of alpaca antibodies or human antibodies.

3. The single-domain antibody as described in claim 2, characterized in that, The single-domain antibody comprises the amino acid sequence shown in SEQ ID NO:

7.

4. The single-domain antibody according to any one of claims 1-3, characterized in that, The protein containing the amino acid sequence shown in SEQ ID NO:1 is selected from one or more of FSH, HCG, TSH, FSH-CTP and hLH.

5. An isolated nucleic acid encoding a single-domain antibody as described in any one of claims 1-4.

6. A recombinant expression vector comprising the isolated nucleic acid as described in claim 5.

7. The recombinant expression vector as described in claim 6, characterized in that, The recombinant expression vector is a plasmid, granule, bacteriophage, or viral vector.

8. The recombinant expression vector as described in claim 7, characterized in that, The viral vector is a retroviral vector, a lentiviral vector, an adenovirus vector, or an adeno-associated virus vector.

9. A transformant comprising a recombinant expression vector as described in any one of claims 6-8 contained in a host cell.

10. The transformant as described in claim 9, characterized in that, The host cell is yeast, mold, bacteria, or a cell expression system.

11. The transformant as described in claim 10, characterized in that, The yeast mentioned is brewer's yeast.

12. A method for preparing a single-domain antibody according to any one of claims 1-4, comprising the following steps: culturing a transformant according to any one of claims 9-11, and obtaining the single-domain antibody from the culture.

13. An antibody conjugate comprising an antibody portion and a conjugation portion, wherein the antibody portion is a single-domain antibody as described in any one of claims 1-4, the conjugation portion is a detectable marker, and the antibody portion and the conjugation portion are conjugated by a chemical bond or a linker.

14. The antibody conjugate of claim 13, wherein, The detectable marker is a radionuclide, an enzyme, or a combination thereof.

15. A pillbox set comprising pillbox A and pillbox B, wherein: Kit A contains a single-domain antibody as described in any one of claims 1-4 or an antibody conjugate as described in claim 13 or 14; Kit B contains an imaging agent and / or a diagnostic agent.

16. A kit comprising a single-domain antibody as claimed in any one of claims 1-4 or an antibody conjugate as claimed in claim 13 or 14.

17. The kit as claimed in claim 16, characterized in that, The kit also includes (i) a means for administering the single-domain antibody or the antibody conjugate; or (ii) instructions for use.

18. Use of the single-domain antibody according to any one of claims 1-4 in the preparation of a reagent for detecting a protein containing the amino acid sequence shown in SEQ ID NO:

1.

19. The application as described in claim 18, characterized in that, The protein is selected from one or more of FSH, HCG, TSH, FSH-CTP, and hLH.

20. A method for detecting proteins containing the amino acid sequence shown in SEQ ID NO:1 for non-disease diagnostic purposes, characterized in that, It includes the step of using a single-domain antibody as described in any one of claims 1-4, an antibody-drug conjugate as described in claim 13 or 14, a kit as described in claim 15, or a reagent kit as described in claim 16 or 17 for detection.