A method for rapid optimization of e. coli promoters based on essential genes
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- ANHUI UNIV
- Filing Date
- 2022-08-06
- Publication Date
- 2026-07-14
AI Technical Summary
Existing technologies face challenges in constructing artificially synthesized promoter libraries, including operational difficulties, cumbersome screening processes, long processing times, and high costs. These limitations make it difficult to rapidly optimize E. coli promoters to achieve precise regulation of gene expression.
By constructing a plasmid containing the target promoter, the essential gene dapA, and the ribosome binding site RB0033, and designing mutation primers to randomly mutate the core region of the promoter, the promoter with the strongest expression was screened out. The screening was then carried out using bacterial growth competition under conditions without added nutrients.
It enables rapid, simple, and low-cost screening of the strongest promoters, simplifies the operation process, and improves gene expression efficiency and bacterial growth rate.
Smart Images
Figure CN115216476B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of synthetic biology and metabolic engineering, specifically to a method for rapidly optimizing Escherichia coli promoters based on essential genes, particularly a method for rapidly optimizing target promoters based on the dapA gene in Escherichia coli WM3064. Background Technology
[0002] Metabolic engineering involves the targeted regulation and modification of microbial metabolic pathways using multi-gene recombination technology to construct new metabolic pathways and accumulate target products. Despite increasing understanding of microbial metabolic networks, systems capable of precise multi-gene, multi-level regulation required for metabolic engineering are still rare. The rise of synthetic biology offers a new approach to solving problems encountered in metabolic engineering. Synthetic biology utilizes standardized biological components to easily construct biological pathways and achieve biosynthetic goals, such as producing structurally diverse natural products using microorganisms. It offers advantages such as simplicity, efficiency, and environmental friendliness.
[0003] With the development of synthetic biology, gene expression elements have shown great application potential in the field of metabolic engineering. Microbial gene expression elements mainly include transcription-related promoters, terminators, and ribosome-binding sites necessary for translation. Among them, promoters are the most widely used expression elements in synthetic biology. They are located upstream of the target gene and can bind to RNA polymerase to control the pattern and intensity of gene expression. Based on their strength, promoters can be divided into strong promoters, moderately strong promoters, and weak promoters. Strong and moderately strong promoters are often used for high gene expression, while weak promoters are used for low-level expression of specific genes, thereby regulating the metabolic balance of substances and energy in the cell. The strength of a promoter depends on its affinity for RNA polymerase and the isomerization rate of the transcription initiation complex. The affinity between the promoter and RNA polymerase is mainly determined by the promoter core region. The core region of a prokaryotic promoter is generally located within 200 bp upstream to 100 bp downstream of the transcription start site and contains four important sequence elements. The -10 and -35 regions are located 10 bp and 35 bp upstream of the transcription start site, respectively, and are recognized by domains 2 and 4 of the RNA polymerase σ factor. Furthermore, the sequence of the bases in the -10 and -35 regions determines their binding affinity to the σ factor, thus affecting the strength of the promoter.
[0004] Essential genes are those indispensable for the basic survival and metabolism of organisms, and are considered the foundation of life activities. When these genes are knocked out or mutated under specific conditions, bacteria cannot perform normal growth and metabolism, leading to bacterial death. *Escherichia coli* WM3064 (E. coli WM3064 for short) is a mutant strain of the *E. coli* dapA gene, requiring the addition of the nutrient 2,6-diaminopimelic acid for growth. Expressing the dapA gene on a plasmid and transforming it into *E. coli* WM3064 allows the strain to grow normally; the higher the dapA gene expression, the faster the bacterial growth. Therefore, the expression level of the dapA gene can be used as an indicator of the growth rate of *E. coli* WM3064.
[0005] To optimize gene expression and achieve precise regulation at the transcriptional level and intensification of expression, it is necessary to find suitable promoters to control the expression of target genes. Typically, methods such as non-conserved sequence randomization, error-prone PCR, and rationally designed transcription factor binding sites are used to construct artificially synthesized promoter libraries, which are then screened using microplate readers or flow cytometry to select the desired promoters. These methods generally face challenges such as operational difficulties, cumbersome screening processes, high time consumption, and high costs. Summary of the Invention
[0006] Current methods for constructing synthetic promoter libraries suffer from drawbacks such as high cost and complex screening methods. This invention uses target promoters to control the expression of essential genes and constructs promoter libraries by artificially mutating the core region of the promoter. After multiple passages, bacteria can screen for promoters with the highest expression of essential genes through growth competition.
[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0008] A method for rapidly optimizing E. coli promoters based on essential genes includes the following steps:
[0009] (1) Construct a structure containing the target promoter, the essential gene dapA gene, and the ribosome binding site R. B0033 plasmids;
[0010] (2) Based on the target promoter sequence, design mutation primers based on the "-10 region" and "-35 region" sequences;
[0011] (3) Using the target promoter, essential genes and R from step (1) B0033 Using the plasmid as a template, PCR amplification was performed with the primers designed in step (2) to obtain the plasmid of the promoter library of the essential gene expression.
[0012] (4) The plasmid containing the promoter library in step (3) is transferred into the host cell to obtain mutants with different dapA gene expression. After multiple passages, the bacteria can screen out the promoter with the highest expression of the essential gene through growth competition.
[0013] As a preferred embodiment of the present invention, the target promoter in step (2) is the pJ23119 promoter, whose base sequence is TTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGC, and the ribosome binding site is R. B0033 .
[0014] Furthermore, in step (2), mutation primers are used to mutate each site of the "-35 region" (TTGACA) and the "-10 region" (TATAAT) to N, where N = A, T, C, G.
[0015] As a preferred embodiment of the present invention, the host cell in step (4) is Escherichia coli WM3064 electrocompetent cells.
[0016] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0017] 1. This invention utilizes the influence of the promoter core region sequence on promoter strength and the bacterial dependence on essential genes to quickly and easily screen for the most strongly expressed promoters, thus providing new ideas and methods for promoter screening, strain modification, and genetic engineering technology.
[0018] 2. This invention utilizes target promoters to control the expression of essential genes in auxotrophic strains of *E. coli*. A promoter library containing a large number of promoters is constructed by randomly mutating the core region of the promoter. Without the addition of nutrients, bacteria can autonomously select the optimal promoter from the promoter library through competition, thereby using it for gene expression and bacterial growth. Then, through continuous subculturing and passage of the bacteria, strong promoters are selected.
[0019] 3. This invention provides a novel and rapid promoter screening method based on essential gene optimization. This method can screen for the strongest promoters for gene expression under optimal bacterial growth conditions, offering advantages such as simple operation, low time consumption, and low cost. The promoter optimization method established in this invention has significant application value in fields such as strong promoter screening, synthetic biology, and metabolic engineering. Attached Figure Description
[0020] Figure 1 This is a schematic diagram of the structure spectrum of the plasmid constructed in Example 1.
[0021] Figure 2 This is a schematic diagram of the structure spectrum of the plasmid constructed in Example 2.
[0022] Figure 3 This is a schematic diagram of the structure spectrum of the plasmid constructed in Example 3.
[0023] Figure 4 The percentage of strong promoters with different screening times in Examples 1-3 is given, where (A) is the percentage of strong promoters with different screening times for replicon PYYDT; (B) is the percentage of strong promoters with different screening times for replicon p15A; and (C) is the percentage of strong promoters with different screening times for replicon RK2.
[0024] Figure 5 The comparison of relative fluorescence values of strong promoters selected by different replicons in Examples 1-3 is as follows: (A) relative fluorescence value of strong promoters selected by PYYDT; (B) relative fluorescence value of strong promoters selected by p15A; (C) relative fluorescence value of strong promoters selected by RK2.
[0025] Figure 6 This is a schematic diagram of the structure of plasmid pBF-J23119-B0035-eGFP.
[0026] Figure 7 This is a schematic diagram of the structure of plasmid pBF-J23119-B0033-eGFP.
[0027] Figure 8 This is a schematic diagram of the structure of plasmid p15A-pBAD-sfGFP.
[0028] Figure 9 This is a schematic diagram of the structure spectrum of plasmid pRK2-Geo2. Detailed Implementation
[0029] The steps for constructing various recombinant plasmids in this embodiment are as follows:
[0030] (1) Using the genome or plasmid as a template, amplify the target fragment;
[0031] PCR amplification system (50 μL) composition
[0032]
[0033] The amplification conditions were: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 56℃ annealing for 15 s, 72℃ extension for 30 s, 31 cycles, and 72℃ extension for 10 min.
[0034] (2) The amplified DNA fragments were recovered and purified using a gel extraction kit (Omega Biotek, Co., USA). The concentration and quality of the DNA were determined using a Quawell Q5000 (Quawell Technology, Inc., USA). The DNA fragments were ligated using the Gibson method. The Gibson assembly system was 20 μL, and the program was 50 °C for 1 h.
[0035] (3) The ligation product was transformed using electroporation and introduced into E. coli WM3064 cells. The procedure was as follows: the ligation product was mixed with E. coli electrocompetent cells and transferred into a 2 mm electroporation cuvette, which was placed on ice for 3 min; electroporation was performed at 2.47 kV using an electroporator, and then 1 mL of LB medium was immediately added to the electroporated cells. The cells were then incubated at 37 °C for 1 h and then plated on LB solid plates containing the corresponding antibiotics.
[0036] (4) Use Taq-Plus PCR Forest Master Mix to perform routine PCR verification on the colonies;
[0037] The composition of a standard PCR amplification system (25 μL)
[0038]
[0039]
[0040] The amplification conditions were: 95℃ pre-denaturation for 10 min, 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 1 min, 31 cycles, and 72℃ extension for 5 min.
[0041] (5) Take 5 μL of PCR product and perform electrophoresis analysis on a 1% agarose gel at a voltage of 140V for 25 min. Finally, verify the size of the PCR fragment in a gel imaging system.
[0042] The primers used to construct plasmids in this embodiment of the invention are shown in Table 1:
[0043] Table 1 Primers used for plasmid construction.
[0044]
[0045]
[0046] The properties and sources of the strains or plasmids used in the embodiments of this invention are shown in Table 2:
[0047] Table 2. Properties and sources of strains or plasmids
[0048]
[0049] The LB medium used in this embodiment of the invention consists of: 16 g / L tryptone, 10 g / L yeast extract, 5 g / L NaCl, and deionized water as the solvent. Solid medium requires the addition of 1.5% agar B.
[0050] The following examples illustrate the optimization method steps of the present invention in detail:
[0051] Example 1
[0052] (1) Constructing the recombinant plasmid pYYDT-dapA( Figure 1 (As shown in A)
[0053] Using the pre-prepared plasmid pBF-J23119-B0035-eGFP as a template, the backbone of the plasmid was amplified using primers BLT-PYYDT F and BLT-PYYDT R; using the E. coli NEB10β genome as a template, the essential gene dapA was amplified using primers PYYDT-dapA F and PYYDT-dapA R.
[0054] (2) Construction of recombinant plasmid pYYDT-B0033-dapA( Figure 1 (as shown in B)
[0055] Using the pre-prepared plasmid pBF-J23119-B0033-eGFP as a template, the RBS-B0033 sequence was amplified using primers BLT-PYYDT F and B0033-PYYDT R, and then integrated into pYYDT-dapA to construct plasmid pYYDT-B0033-dapA.
[0056] (3) Construction of recombinant plasmid pYYDT-SPL-dapA
[0057] By designing primers SPL-dapF and PYYDT-dapAR, the base sequences of the "-10 region" and "-35 region" in the promoter were randomly mutated, and the mutated DNA fragment was integrated into pYYDT-B0033-dapA to construct plasmid pYYDT-SPL-dapA.
[0058] (4) Plasmid transformation and strain verification
[0059] The plasmid pYYDT-SPL-dapA was transformed into E. coli WM3064 electrocompetent cells via electroporation, and 500 μL of bacterial culture was spread on a plate containing kanamycin resistance. After colony formation, all colonies on the plate were scraped off and resuspended in fresh culture medium. 5 μL of bacterial culture was transferred to 5 mL of fresh LB medium, and the transfer was repeated every 24 hours. The first, third, and sixth transfers of bacterial culture were spread, and the resulting single clones were verified by PCR and DNA sequencing.
[0060] (5) After multiple rounds of screening, the high copy number PYYDT replicon can identify three strong promoters. Different proportions of strong promoters T1, T2, and T3 were identified in the first, third, and sixth screenings. Furthermore, the proportion of strong promoters gradually increases with the number of generations. (See...) Figure 4 A.
[0061] Example 2
[0062] (1) Constructing the recombinant plasmid p15A-dapA( Figure 2 (As shown in A)
[0063] Using the pre-prepared plasmid p15a-pBAD-sfGFP as a template, the backbone of the plasmid was amplified using primers TT-p15A F and tet-p15A R; using the E. coli NEB10β genome as a template, the essential gene dapA was amplified using primers p15A-dapA F and p15A-dapA R.
[0064] (2) Construction of recombinant plasmid p15A-B0033-dapA( Figure 2 (as shown in B)
[0065] Using the plasmid pYYDT-B0033-dapA constructed in Example 1 as a template, the RBS-B0033 sequence was amplified using primers p15A-B0033dap F and p15A-dap R, and then integrated into p15A-dapA to construct plasmid p15A-B0033-dapA.
[0066] (3) Constructing plasmid p15A-SPL-dapA
[0067] By designing primers SPL-dapF and p15A-dapAR, the base sequences of the "-10 region" and "-35 region" in the promoter were randomly mutated, and the mutated DNA fragment was integrated into p15A-B0033-dapA to construct plasmid p15A-SPL-dapA.
[0068] (4) Plasmid transformation and strain verification
[0069] The plasmid p15A-SPL-dapA was transformed into E. coli WM3064 electrocompetent cells via electroporation, and 500 μL was plated on a plate containing chloramphenicol resistance. After colony formation, all colonies on the plate were scraped off and resuspended in fresh culture medium. 5 μL of the bacterial culture was transferred to 5 mL of fresh LB medium, and the transfer was repeated every 24 hours. The first, third, and sixth transfers were plated, and the resulting single clones were verified by PCR and DNA sequencing.
[0070] (5) After multiple rounds of screening, the p15A replicon with a medium copy number can be screened to select two strong promoters. Different proportions of strong promoters A1 and A2 were selected in the first, third, and sixth screenings. Furthermore, the proportion of strong promoters gradually increases with the number of generations. (See...) Figure 4 B.
[0071] Example 3
[0072] (1) Construction of recombinant plasmid RK2-dapA( Figure 3 (As shown in A)
[0073] Using the pre-prepared plasmid pRK2-Geo2 as a template, primers BLT-RK2 F and BLT-RK2 R were used to amplify the plasmid backbone. Using the E. coli NEB10β genome as a template, primers RK2-dapA F and RK2-dapA R were used to amplify the essential gene dapA.
[0074] (2) Construction of recombinant plasmid RK2-B0033-dapA( Figure 3 (as shown in B)
[0075] Using the plasmid pYYDT-B0033-dapA constructed in Example 1 as a template, the RBS-B0033 sequence was amplified using primers RK2-B0033dapF and RK2-dapA R, and then integrated into RK2-dapA to construct plasmid RK2-B0033-dapA.
[0076] (3) Construction of recombinant plasmid RK2-SPL-dapA
[0077] By designing primers SPL-dap F and RK2-dapA R, the base sequences of the "-10 region" and "-35 region" in the promoter were randomly mutated, and the mutated DNA fragment was integrated into RK2-B0033-dapA to construct plasmid RK2-SPL-dapA.
[0078] (4) Plasmid transformation and strain verification
[0079] Plasmid RK2-SPL-dapA was transformed into E. coli WM3064 electrocompetent cells via electroporation, and 500 μL was plated on a kanamycin-resistant plate. After colony formation, all colonies on the plate were scraped off and resuspended in fresh culture medium. 5 μL of the bacterial culture was transferred to 5 mL of fresh LB medium, and the transfer was repeated every 24 hours. The first, third, and sixth transfers were plated, and the resulting single clones were verified by PCR and DNA sequencing.
[0080] (5) After multiple rounds of screening, the low copy number RK2 replicon can be screened to select a relatively strong promoter. A strong promoter K1 was selected in the first, third, and sixth screenings, and the proportion of strong promoters gradually increased with the number of generations. See Figure 4 C.
[0081] Example 4
[0082] (1) Construct a recombinant plasmid containing the green fluorescent protein expression gene.
[0083] Using pBF-J23119-B0035-eGFP plasmid as a template, the green fluorescent protein expression gene was amplified using primers SPL-eGFP F and SPL-eGFP R. The expression was then controlled using the strong promoters screened in Examples 1, 2, and 3 to verify the strength of the obtained promoters.
[0084] (2) Fluorescence detection was performed on promoters such as T1, T2, T3, A1, A2, and K1.
[0085] Fluorescence detection experiments were performed in 96-well plates, with 200 μL of bacterial culture containing the target promoter added to each well. The 96-well plates were then placed in a microplate reader for continuous detection, with the excitation wavelength of the fluorescence detector at 488 nm and the emission wavelength at 525 nm. Finally, the fluorescence values at 6, 12, 18, 24, and 32 hours were compared. Figure 5 It can be seen that the expression levels of the strong promoters selected by different replicons are all higher than those of the original promoter J23119.
[0086] The above description is merely an example and illustration of the concept of the present invention. Those skilled in the art can make various modifications or additions to the specific embodiments described or use similar methods to replace them, as long as they do not deviate from the concept of the invention or exceed the scope defined in the claims, they should all fall within the protection scope of the present invention.
Claims
1. A method for rapidly optimizing E. coli promoters based on essential genes, characterized in that, Includes the following steps: (1) Construct a system containing the target promoter and essential genes dapA Gene and ribosome binding site R B0033 plasmids; (2) Based on the target promoter sequence, design mutation primers based on the "-10 region" and "-35 region" sequences; The target promoter is the pJ23119 promoter, with the base sequence TTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGC and the ribosome binding site R. B0033 Using mutation primers, each site of TTGACA in the "-35 region" and TATAAT in the "-10 region" was mutated to N, where N = A, T, C, G; (3) The target promoter, essential genes and R in step (1) are used. B0033 Using the plasmid as a template, PCR amplification was performed with the primers designed in step (2) to obtain the plasmid of the promoter library of the essential gene expression. (4) The plasmid containing the promoter library from step (3) is transferred into the host cell to obtain dapA Mutants with different gene expression; the host cell is Escherichia coli WM3064 electrocompetent cells; after multiple passages, bacteria can select promoters with the highest expression of essential genes through growth competition.