A method for denatured nested isothermal nucleic acid amplification with phosphorylation thiocarboxylate

Abstract

This invention discloses a denaturing nested isothermal nucleic acid amplification method based on phosphorylation. The method includes a phosphorylation-based outer primer, a phosphorylation-based double-stranded inner primer, a linear primer, a nucleotide polymerase, a nucleic acid chimeric dye, a target nucleic acid sequence, and a denaturing agent, urea. The denaturing agent urea assists in primer annealing and self-matching of extension products. The phosphorylation-based sequence is composed of phosphorylation-based nucleotides and is capable of self-matching. The phosphorylation-based double-stranded inner primer has an internal phosphorylation-based double-stranded structure and single-stranded structures on both sides that can recognize the target nucleic acid sequence. The phosphorylation-based outer primer sequence and the single-stranded sequences on both sides of the phosphorylation-based double-stranded inner primer can specifically bind to and be extended by the nested distribution of the target nucleic acid sequence. This invention enables highly specific nucleic acid amplification and detection using a nucleic acid intercalation dye under low-temperature conditions, potentially reducing the design complexity and energy consumption of portable isothermal nucleic acid detection devices.

Description

Technical Field

[0001] This invention relates to the field of molecular biology technology, specifically a method for denatured nested thiophosphorylation isothermal nucleic acid amplification. Background Technology

[0002] Nucleic acid amplification detection technology, as a highly sensitive molecular diagnostic technique, can detect trace amounts of disease-related nucleic acids and has been widely used in pathogen detection and clinical diagnosis. Compared with other molecular diagnostic techniques such as antigen and antibody detection, nucleic acid amplification detection technology has advantages in terms of timeliness and performance, especially nucleic acid amplification detection technology based on polymerase chain reaction (PCR). However, PCR-based nucleic acid amplification methods heavily rely on thermal cycling, making it difficult to meet the urgent needs of current disease control for on-site testing and home use. Therefore, isothermal nucleic acid amplification methods have quietly emerged and continued to develop alongside PCR technology. Compared with PCR, isothermal nucleic acid amplification methods do not require thermal cycling and can achieve efficient amplification of target nucleic acids under isothermal conditions. In addition, isothermal nucleic acid amplification methods have the potential for on-site testing and home use in terms of detection speed, detection performance, and visualization.

[0003] Currently, isothermal nucleic acid amplification methods are mainly divided into two categories: multi-primer isothermal amplification and multi-enzyme isothermal amplification. Multi-primer isothermal amplification methods employ at least two primer pairs to recognize at least four target sites, achieving exponential amplification of DNA targets under the action of strand displacement nucleotide polymerases. Examples include loop-mediated isothermal amplification (LAMP), cross-priming amplification (CPA), isothermal multiple self-matching-initiated amplification (IMSA), and dual-priming isothermal amplification (DAMP). Multi-enzyme isothermal amplification methods, on the other hand, utilize the synergistic action of at least two functional enzymes to achieve exponential amplification of DNA targets with the participation of a single primer pair. Examples include recombinase polymerase amplification (RPA), helicase-dependent amplification (HDA), strand displacement amplification (SDA), and rolling circle amplification (RCA).

[0004] Multiprimer isothermal amplification methods, such as LAMP, require high reaction temperatures, with an optimal range of 60-65°C. This limitation necessitates careful consideration of temperature stability and energy consumption when developing portable multiprimer isothermal amplification detection devices, making the design challenging. The hot-start characteristic of multiprimer isothermal amplification also limits its application, making it difficult to use for in situ molecular detection of cells or tissue sections at 37°C. Furthermore, in establishing digital isothermal amplification detection methods based on polydimethylsiloxane (PDMS) chips, the permeability of PDMS and prolonged high reaction temperatures can easily cause evaporation of water from the reaction solution, leading to a reduction in the size or even drying of the trace reaction system and affecting the accuracy of digital quantification. While multienzyme isothermal amplification, such as RPA, can perform amplification reactions at low temperatures, such as 37°C, its high efficiency requires the addition of crowding reagents such as Carbowax 20M and polyethylene glycol (PEG), increasing the system viscosity, hindering reagent dispersion, and affecting the detection capability of trace molecules. Furthermore, multi-enzyme isothermal amplification methods such as RPA and SDA exhibit strong non-specific amplification, making it impossible to achieve specific amplification and detection using inexpensive nucleic acid intercalation dyes such as SYBR Green and EvaGreen. This necessitates the use of expensive nucleic acid probes and secondary product analysis methods, such as lateral flow test strips. Therefore, there is an urgent need to develop novel multi-primer isothermal nucleic acid amplification methods that can achieve highly specific nucleic acid amplification and detection using nucleic acid intercalation dyes at low temperatures, such as 37°C. This could potentially reduce the design complexity and energy consumption of portable isothermal nucleic acid detection devices. Summary of the Invention

[0005] To address the shortcomings mentioned in the background art, the present invention aims to provide a denaturing nested isothermal nucleic acid amplification method. This method can achieve highly specific nucleic acid amplification and detection using nucleic acid intercalation dyes at low temperatures, such as 37°C. It solves the technical problem that current multi-primer isothermal nucleic acid amplification cannot achieve efficient amplification under low-temperature conditions and has the potential to reduce the design difficulty and energy consumption of portable isothermal nucleic acid detection devices.

[0006] The objective of this invention can be achieved through the following technical solutions:

[0007] A denaturing nested isothermal nucleic acid amplification method based on thiophosphorylation includes denaturing agent urea, melting-assisted primer annealing and extension product self-matching, thiophosphorylation sequence self-matching, and exponential cyclic amplification. The method is characterized in that the reagents used in the isothermal nucleic acid amplification method include an upstream thiophosphorylation primer, a downstream thiophosphorylation primer, a thiophosphorylation double-stranded inner primer, an upstream linear primer, a downstream linear primer, a nucleotide polymerase with strand displacement activity, a nucleic acid chimeric dye, a target nucleic acid sequence, and the denaturing agent urea. The upstream or downstream thiophosphorylation primer is composed of two target nucleic acids. The single-stranded primer is composed of two target nucleic acid sequence sites, which serve as the 5′ and 3′ ends of the primer, respectively. The 5′ end primer sequence nucleotides are all modified with thiophosphorylation. The thiophosphorylated double-stranded inner primer is a complex consisting of four target nucleic acid sequence sites, forming an inner double-stranded and outer single-stranded structure. The inner double-stranded structure is formed by pairing two completely complementary sites, both modified with thiophosphorylation. The outer single-stranded structure refers to the complex containing single strands on both sides that can recognize and be extended by the target nucleic acid sequence. The upstream or downstream linear primer is composed of a single target nucleic acid sequence site.

[0008] The above-mentioned isothermal nucleic acid amplification method is based on the existing multi-primer isothermal amplification technology, which involves new primer design and new system construction. The complete reaction system of this method mainly includes the following components: upstream thiophosphorylated outer primer, downstream thiophosphorylated outer primer, double-stranded inner primer, upstream linear primer, downstream linear primer, nucleotide polymerase with strand displacement activity, nucleic acid chimeric dye, target nucleic acid sequence, denaturing agent urea, reaction buffer, dNTPs and magnesium ions.

[0009] The specific reaction principle of this method is as follows:

[0010] a) With the denaturant urea-assisted denaturation of the target nucleic acid sequence, the upstream and downstream linear primers specifically bind to the target nucleic acid sequence sites, respectively. Under the action of nucleotide polymerase, using the target sequence as a template, the primers extend along the 5′ end of the target sequence. The extension products will further open the target nucleic acid sequence and expose the recognition sites of other primers.

[0011] b) The upstream and downstream thiophosphorylated primers and the thiophosphorylated double-stranded inner primers specifically bind to their respective target nucleic acid sequence sites. Under the action of nucleotide polymerase, the target sequence is used as a template to extend along the 5′ end of the target sequence. The extension product forms a double strand with the target sequence or is replaced to form a single strand with a double-stranded structure at one end.

[0012] c) The double-stranded extension product in b) undergoes self-matching of the thiophosphorylation sequence with the assistance of the denaturing agent urea, thereby exposing the target sequence site again, which is then recognized by the corresponding thiophosphorylation primer and mediated by cyclic amplification.

[0013] d) Using the single-strand extension product described in b) as a template, all primers enter an exponential cyclic amplification stage under the action of nucleotide polymerase, which mainly consists of self-matching and circularization of the 5′ end thiophosphorylated sequence, self-matching and circularization of the 3′ end sequence, and primer recognition and extension of the sequence on the loop.

[0014] The aforementioned upstream thiophosphorylated outer primer sequence, downstream thiophosphorylated outer primer sequence, and the single-stranded sequences on both sides of the thiophosphorylated double-stranded inner primer all specifically bind to the target nucleic acid sequence, and the binding sites are distributed in an inner and outer nested pattern.

[0015] The above-mentioned thiophosphorylated upper or lower primers contain two target sites, which constitute the 5′ and 3′ end sequences of the primer, respectively, wherein the 5′ end sequence is a thiophosphorylated nucleotide.

[0016] The aforementioned thiophosphorylated double-stranded inner primer contains four target sites, which together form a binary complex consisting of an inner double strand and two side single strands. The double strands are all thiophosphorylated nucleotides, and the two side single strands recognize different sites on the target nucleic acid sequence.

[0017] The aforementioned upstream or downstream linear primers are each composed of a single target site with a nucleotide number greater than or equal to 15 and less than or equal to 25. The site sequence overlaps with the 5′ end sequence of the thiophosphorylated upstream or downstream outer primer, with an overlap of nucleotides greater than or equal to 0 and less than or equal to 25.

[0018] The aforementioned thiophosphorylated upstream or downstream primers are characterized in that the number of nucleotides at both sites constituting their 5′ and 3′ ends is greater than or equal to 15 and less than or equal to 25.

[0019] The above-mentioned thiophosphorylated double-stranded inner primer is characterized in that the number of nucleotides at the four target sites constituting the inner double strand and the single strands on both sides is greater than or equal to 15 and less than or equal to 25.

[0020] The target nucleic acid sequence mentioned above can be a DNA sequence in the sample, an RNA sequence in the sample, a mixed DNA and RNA sequence in the sample, a pre-amplified product of a DNA sequence in the sample, or a pre-amplified product of an RNA sequence in the sample.

[0021] The aforementioned nucleotide polymerases with strand substitution activity include, but are not limited to, Bacillus stearothermophilus DNA polymerase, Bacillus smithii DNA polymerase, Bacillus subtilis DNA polymerase, phi29 DNA polymerase, and Vent(exo-) DNA polymerase.

[0022] The aforementioned nucleic acid chimeric dyes include, but are not limited to, the SYBR Green series, the SYTO series, and the EvaGreen series.

[0023] The concentration of the denaturing agent urea is greater than or equal to 0 mol / L and less than or equal to 15 mol / L.

[0024] The aforementioned pre-amplified products are derived from nucleic acid amplification methods including but not limited to polymerase chain reaction, reverse transcription polymerase chain reaction, loop-mediated isothermal amplification, reverse transcription loop-mediated isothermal amplification, recombinase polymerase reaction, reverse transcription recombinase polymerase reaction, helicase amplification, and reverse transcription helicase amplification.

[0025] This invention also provides an isothermal nucleic acid amplification kit, comprising: a thiophosphorylated outer primer, a thiophosphorylated double-stranded inner primer, a linear primer, a nucleotide polymerase, a nucleic acid chimeric dye, a target nucleic acid sequence, a denaturing agent urea, a reaction buffer, dNTPs, magnesium ions, etc. The denaturing agent urea can assist primer annealing and self-matching of extension products. The thiophosphorylated sequence is composed of thiophosphorylated nucleotides and can undergo self-matching. The thiophosphorylated double-stranded inner primer has an internal thiophosphorylated double-stranded structure and single-stranded structures on both sides that can recognize the target nucleic acid sequence. The thiophosphorylated outer primer sequence and the single-stranded sequences on both sides of the thiophosphorylated double-stranded inner primer can specifically bind to and be extended by nested target nucleic acid sequence sites.

[0026] The beneficial effects of this invention are as follows:

[0027] This invention utilizes a combination of reagents, including phosphorylated outer primers, phosphorylated double-stranded inner primers, linear primers, nucleotide polymerase, nucleic acid chimeric dyes, the target nucleic acid sequence, and the denaturing agent urea, to perform exponential cyclic amplification of the target nucleic acid sequence under low-temperature conditions, such as 37°C. This method offers advantages such as high specificity, high sensitivity, and strong versatility, solving the technical problem that current multi-primer isothermal nucleic acid amplification cannot achieve efficient amplification under low-temperature conditions. It also has the potential to reduce the design complexity and energy consumption of portable isothermal nucleic acid detection devices. This method is an important supplement to current nucleic acid amplification and detection techniques and can be used for pathogen detection, clinical diagnosis, food safety testing, environmental health monitoring, and livestock and aquatic product inspection and quarantine. Attached Figure Description

[0028] The invention will now be further described with reference to the accompanying drawings.

[0029] Figure 1 This is a schematic diagram of the primer design and structure for the isothermal nucleic acid amplification method of the present invention.

[0030] Figure 2 This is a schematic diagram of the substrate generation stage in the isothermal nucleic acid amplification method of the present invention.

[0031] Figure 3 This is a schematic diagram illustrating the exponential cyclic amplification mediated by substrates 1 and 4 in the isothermal nucleic acid amplification method of this invention.

[0032] Figure 4 The real-time fluorescence change curve and reaction threshold time bar chart are used to verify the amplification sensitivity of the present invention in Example 1.

[0033] NTC represents the blank control group containing no target nucleic acid molecule; the error bar represents the standard error of three repeated tests; the scatter plot represents the number of repeated tests. Cps represents the copy number of the target nucleic acid molecule.

[0034] Figure 5 The real-time fluorescence change curve and reaction threshold time bar chart are used to verify the amplification sensitivity of the present invention in Example 2.

[0035] NTC represents the blank control group containing no target nucleic acid molecule; the error bar represents the standard error of three repeated tests; the scatter plot represents the number of repeated tests. Cps represents the copy number of the target nucleic acid molecule.

[0036] Figure 6 The real-time fluorescence change curve and reaction threshold time bar chart are used to verify the amplification sensitivity of the present invention in Example 3.

[0037] NTC represents the blank control group containing no target nucleic acid molecule; the error bar represents the standard error of three repeated tests; the scatter plot represents the number of repeated tests. Cps represents the copy number of the target nucleic acid molecule.

[0038] Figure 7 The real-time fluorescence change curve and reaction threshold time bar chart are used to verify the amplification sensitivity of the present invention in Example 4.

[0039] NTC represents the blank control group containing no target nucleic acid molecule; the error bar represents the standard error of three repeated tests; the scatter plot represents the number of repeated tests. Cps represents the copy number of the target nucleic acid molecule. Detailed Implementation

[0040] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0041] The reaction system of this invention mainly includes, for example, the reaction system of this invention. Figure 1The following components are shown: upstream thiophosphorylation primer, downstream thiophosphorylation primer, double-stranded thiophosphorylation primer, upstream linear primer, downstream linear primer, nucleotide polymerase with strand displacement activity, nucleic acid chimeric dye, target nucleic acid sequence, denaturing agent urea, reaction buffer, dNTPs, and magnesium ions; the reaction principle is as follows: Figure 2 and Figure 3 As shown; the specific amplification reaction process is as follows:

[0042] a) With the denaturant urea-assisted denaturation of the target nucleic acid sequence, the upstream and downstream linear primers FL and RL specifically bind to the corresponding sites on the target nucleic acid sequence. Under the action of nucleotide polymerase, using the target sequence as a template, they extend along the 5′ end of the target sequence. The extension product will further open the target nucleic acid sequence and expose the recognition sites of other primers.

[0043] b) The upstream and downstream thiophosphorylation primers (PFO and PRO) and the thiophosphorylation double-stranded inner primer PDI specifically bind to their respective target nucleic acid sequence sites. Under the action of nucleotide polymerase, the target sequence is used as a template to extend along the 5′ end of the target sequence. The extension product forms a double strand with the target sequence (substrate 2 and substrate 3) or is replaced to form a single strand with a double-stranded structure at one end (substrate 1 and substrate 4).

[0044] c) The double-stranded extension products (substrates 2 and 3) in b) undergo thiophosphorylation sequence self-matching with the help of denaturant urea melting, thereby exposing the target sequence site again, which is then recognized by the corresponding thiophosphorylation primer and mediated by cyclic amplification.

[0045] d) Using the single-strand extension products described in b) (substrate 1 and substrate 4) as templates, all primers, under the action of nucleotide polymerase, enter an exponential cyclic amplification phase (e.g., 5′ end thiophosphorylated sequence self-matching to form a loop, 3′ end sequence self-matching to form a loop and extension, primer recognition of the loop sequence and extension) as the main steps. Figure 3 ).

[0046] Example 1:

[0047] In this embodiment, a synthetically produced plasmid containing the target nucleic acid sequence T1 of the human KRAS gene was used as the detection target to verify the feasibility and analytical sensitivity of this method at a low temperature (37°C) using a large fragment of Bsm DNA polymerase for DNA target amplification. Primers were designed based on the KRAS gene target nucleic acid sequence, the reaction system was constructed using a large fragment of Bsm DNA polymerase, and the nucleic acid intercalation dye EvaGreen was used to display real-time fluorescence signal changes. The reaction principle is described in [reference needed]. Figure 2 and Figure 3 The specific steps are as follows:

[0048] (1) Take one EP tube and add an equal volume of 100 μM PDI-KRAS-1 monomers (PDI-KRAS-1-1 and PDI-KRAS-1-2), mix well to form a 50 μM PDI-KRAS-1 composite.

[0049] (2) Take one EP tube and add 25 μL of 10× reaction buffer (200 mM Tris-HCl, 100 mM (NH4)2SO4, 100 mM KCl, 20 mM MgSO4, 1.0% Triton X-100, pH 8.8), 10 μL of dNTPs (concentration 10 mM), 50 μL of urea (concentration 10 M), 2.5 μL of PFO-KRAS-1 primer (concentration 20 μM), 2.5 μL of PRO-KRAS-1 primer (concentration 20 μM), 4 μL of PDI-KRAS-1 primer (concentration 50 μM), 4 μL of FL-KRAS-1 primer (concentration 100 μM) and 4 μL of RL-KRAS-1 primer (concentration 100 μM), mix well to form Mixture I;

[0050] (3) Take 24 EP tubes and add 4.08 μL of the above mixture I to each tube. Divide them into 8 groups and label them as A, B, C, D, E, F, G and H. Then add plasmid templates containing the human KRAS gene target nucleic acid sequence T1 (concentration of 1.2×106~1.2×100 copies / μL) that are serially diluted 10 times to groups A to G. Add 1.0 μL to each of the 3 EP tubes in each group and mix well. At the same time, add 1.0 μL of nuclease-free water to each group H as a blank control group (NTC) and mix well.

[0051] (4) Place the 24 well-mixed EP tubes incubate at 95°C for 5 minutes, then remove them and allow them to cool naturally to room temperature;

[0052] (5) Take one EP tube, add 8 μL of nucleic acid intercalation dye EvaGreen (20×), 10 μL of heat-stable single-stranded binding protein ET SSB (concentration of 0.5 μg / μL), 75 μL of Bsm DNA polymerase large fragment (concentration of 8 U / μL) and 28 μL of nuclease-free water, mix well to form Mixture II;

[0053] (6) Add 4.92 μL of the above mixture II to each of the 24 EP tubes containing mixture I and template, mix well to form the final reaction solution, and incubate at 37°C for 90 min. Measure the change in fluorescence of each solution over time, with a sampling time interval of 1 min.

[0054] The sequence of the target nucleic acid sequence T1 of the human KRAS gene is as follows:

[0055] T1:

[0056] 5′-AAGGTACTGGTGGAGTATTTGATAGTGTATTAACCTTATGTGTGACATGTTCTAATATAGTCACATTTTCATTATTTTTATTATAAGGCCTGCTGAAAATGACTGAATATAAACTTGTGGTAGTTGGAGCTGATGGCGTAGGCAAGAGTGCC TTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGTAAATCTTGTTTTAATATGCATATTACTGGTGCAGGACCATTCTTTGATACAGATAAAGGTTTCTCTGACCATTTTCATGAGTACTTATT-3′(SEQ ID No.1).

[0057] The PFO-KRAS-1 primer sequences are as follows:

[0058] PFO-KRAS-1:

[0059] 5′-G*G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*C*CTTTTATTATAAGGCCTGCTGAA-3′ (SEQ ID No. 2, * refers to thiophosphorylation modification, the same below).

[0060] The PRO-KRAS-1 primer sequences are as follows:

[0061] PRO-KRAS-1:

[0062] 5′-T*T*G*T*G*G*A*C*G*A*A*T*A*T*G*A*T*C*C*A*A*C*A*ATGTATCAAAGAATGGTCCTG-3′ (SEQ ID No. 3).

[0063] The sequences of the above-mentioned PDI-KRAS-1 monomers, PDI-KRAS-1-1 and PDI-KRAS-1-2, are as follows:

[0064] PDI-KRAS-1-1:

[0065] 5′-T*G*A*T*T*C*T*G*A*A*T*T*A*G*C*T*G*T*A*T*C*G*T*CATGACTGAATATAAACTTGTGGT-3′ (SEQ ID No. 4);

[0066] PDI-KRAS-1-2:

[0067] 5′-G*A*C*G*A*T*A*C*A*G*C*T*A*A*T*T*C*A*G*A*A*T*C*ATGCATATTAAAACAAGATTTACCTC-3′ (SEQ ID No. 5).

[0068] The FL-KRAS-1 primer sequences are as follows:

[0069] FL-KRAS-1: 5′-TTGTGGACGAATATGATCCAACAA-3′ (SEQ ID No. 6).

[0070] The RL-KRAS-1 primer sequences are as follows:

[0071] RL-KRAS-1: 5′-GGCACTCTTGCCTACGCC-3′ (SEQ ID No. 7).

[0072] Experimental results are as follows Figure 4 As shown, under incubation conditions at 37°C, the isothermal amplification method of this invention, utilizing Bsm DNA polymerase, can stably detect target copy numbers as low as 1.2, exhibiting exponential real-time fluorescence change curves, while the fluorescence of the NTC control group does not change over time. Therefore, these results demonstrate that the Bsm DNA polymerase of this invention has high analytical sensitivity for DNA targets, capable of detecting human KRAS gene target nucleic acid sequences as low as 1.2 copies.

[0073] Example 2:

[0074] In this embodiment, artificial in vitro reverse-transcribed RNA of the human KRAS gene was used as the detection target to verify the feasibility and analytical sensitivity of this method at a low temperature (37°C) using a large fragment of Bsm DNA polymerase for RNA target amplification. Primers were designed based on the target nucleic acid sequence of the KRAS gene, the reaction system was constructed using a large fragment of Bsm DNA polymerase, and the nucleic acid intercalation dye EvaGreen was used to display real-time fluorescence signal changes. The reaction principle is described in [link to reaction details]. Figure 2 and Figure 3 The specific steps are as follows:

[0075] (1) Take one EP tube and add an equal volume of 100 μM PDI-KRAS-2 monomers (PDI-KRAS-2-1 and PDI-KRAS-2-2), mix well to form a 50 μM PDI-KRAS-2 composite.

[0076] (2) Take 8 EP tubes and pre-amplify the target RNA (concentrations of 1.8 × 10⁶ to 1.8 × 10⁰ copies / μL) in a 10-fold serial dilution. The reagent used for pre-amplification was reverse transcription recombinase polymerase reaction (RT-RPA). The composition of each EP tube system was as follows: 20 μL reaction mixture (containing 38 μL Rehydration buffer, 1 μL RNase H (concentration of 5 U / μL), 0.5 μL SuperScript IV reverse transcriptase (concentration of 200 U / μL), 0.5 μL outer primer mixture (the concentration of PFO-KRAS-2 primer and PRO-KRAS-2 primer in this mixture was 50 μM each)), 1 μL of target RNA solution of each concentration, 3.5 μL of nuclease-free water, and 0.5 μL of magnesium acetate (concentration of 700 mM) added to the EP tube cap. Among them, 1 μL of nuclease-free water was used as a blank control NTC instead of the target RNA solution. Simultaneously centrifuge the EP tube to allow magnesium acetate to enter the system, and incubate at 37°C for 20 min to induce RT-RPA pre-amplification;

[0077] (3) Take one EP tube and add 25 μL of 10× reaction buffer (200 mM Tris-HCl, 100 mM (NH4)2SO4, 100 mM KCl, 20 mM MgSO4, 1.0% Triton X-100, pH 8.8), 10 μL of dNTPs (concentration 10 mM), 50 μL of urea (concentration 10 M), 2.5 μL of PFO-KRAS-2 primers (concentration 20 μM), 2.5 μL of PRO-KRAS-2 primers (concentration 20 μM), 4 μL of PDI-KRAS-2 primers (concentration 50 μM), 4 μL of FL-KRAS-2 primers (concentration 100 μM) and 4 μL of RL-KRAS-2 primers (concentration 100 μM), mix well to form Mixture I;

[0078] (4) Take 24 EP tubes and add 4.08 μL of the above mixture I to each tube. Divide them into 8 groups and label them as A, B, C, D, E, F, G and H. Then add the target RNA of each concentration described in (2) and the pre-amplification product of the blank group to groups A to H respectively. Add 1.0 μL to each of the 3 EP tubes in each group and mix well.

[0079] (5) Take one EP tube, add 8 μL of nucleic acid intercalation dye EvaGreen (20×), 10 μL of heat-stable single-stranded binding protein ET SSB (concentration of 0.5 μg / μL), 75 μL of Bsm DNA polymerase large fragment (concentration of 8 U / μL) and 28 μL of nuclease-free water, mix well to form Mixture II;

[0080] (6) Add 4.92 μL of the above mixture II to each of the 24 EP tubes containing mixture I and template, mix well to form the final reaction solution, and incubate at 37°C for 90 min. Measure the change in fluorescence of each solution over time, with a sampling time interval of 1 min.

[0081] The T2 sequence of the cDNA of the above-mentioned in vitro transcribed RNA is as follows:

[0082] T2:

[0083] 5′-AAGGTACTGGTGGAGTATTTGATAGTGTATTAACCTTATGTGTGACATGTTCTAATATAGTCACATTTTCATTATTTTTATTATAAGGCCTGCTGAAAATGACTGAATATAAACTTGTGGTAGTTGGAGCTGATGGCGTAGGCAAGAGTGCC TTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGTAAATCTTGTTTTAATATGCATATTACTGGTGCAGGACCATTCTTTGATACAGATAAAGGTTTCTCTGACCATTTTCATGAGTACTTATT-3′(SEQ ID No. 1, the same as T1 in Example 1).

[0084] The PFO-KRAS-2 primer sequences are as follows:

[0085] PFO-KRAS-2:

[0086] 5′-G*G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*C*CTTTTATTATAAGGCCTGCTGAA-3′ (SEQ ID No. 2, identical to PFO-KRAS-1 in Example 1).

[0087] The PRO-KRAS-2 primer sequences are as follows:

[0088] PRO-KRAS-2:

[0089] 5′-T*T*G*T*G*G*A*C*G*A*A*T*A*T*G*A*T*C*C*A*A*C*A*ATGTATCAAAGAATGGTCCTG-3′ (SEQ ID No. 3, identical to PRO-KRAS-1 in Example 1).

[0090] The sequences of the PDI monomers PDI1 and PDI2 are as follows:

[0091] PDI-KRAS-2-1:

[0092] 5′-T*G*A*T*T*C*T*G*A*A*T*T*A*G*C*T*G*T*A*T*C*G*T*CATGACTGAATATAAACTTGTGGT-3′ (SEQ ID No. 4, identical to PDI-KRAS-1-1 in Example 1);

[0093] PDI-KRAS-2-2:

[0094] 5′-G*A*C*G*A*T*A*C*A*G*C*T*A*A*T*T*C*A*G*A*A*T*C*ATGCATATTAAAACAAGATTTACCTC-3′ (SEQ ID No. 5, identical to PDI-KRAS-1-2 in Example 1).

[0095] The FL-KRAS-2 primer sequences are as follows:

[0096] FL-KRAS-2: 5′-TTGTGGACGAATATGATCCAACAA-3′ (SEQ ID No. 6, identical to FL-KRAS-1 in Example 1).

[0097] The RL-KRAS-2 primer sequences are as follows:

[0098] RL-KRAS-2: 5′-GGCACTCTTGCCTACGCC-3′ (SEQ ID No. 7, identical to RL-KRAS-1 in Example 1).

[0099] Experimental results are as follows Figure 5 As shown, under incubation conditions at 37°C, the isothermal amplification method of this invention, utilizing Bsm DNA polymerase, can stably detect target RNA molecules with a copy number of up to 180, all exhibiting exponential real-time fluorescence change curves, while the fluorescence of the NTC control group does not change over time. Therefore, these results demonstrate that the Bsm DNA polymerase of this invention has high analytical sensitivity for RNA targets, capable of detecting in vitro transcribed RNA targets of the human KRAS gene down to a copy number of 180.

[0100] Example 3:

[0101] In this embodiment, the plasmid containing the synthetically produced human enterovirus 71 (EV71) VP1 gene target nucleic acid sequence T3 was used as the detection target to verify the feasibility and analytical sensitivity of this method at a low temperature (37°C) using a large fragment of Bst DNA polymerase for DNA target amplification. Primers were designed based on the EV71 VP1 gene target nucleic acid sequence, the reaction system was constructed using a large fragment of Bst DNA polymerase, and the nucleic acid intercalation dye EvaGreen was used to display real-time fluorescence signal changes. The reaction principle is described in [reference needed]. Figure 2 and Figure 3 The specific steps are as follows:

[0102] (1) Take one EP tube and add an equal volume of 100 μM PDI-EV71-1 monomers (PDI-EV71-1-1 and PDI-EV71-2), mix well to form a 50 μM PDI-EV71-1 composite.

[0103] (2) Take one EP tube and add 25 μL of 10× reaction buffer (200 mM Tris-HCl, 100 mM (NH4)2SO4, 100 mM KCl, 20 mM MgSO4, 1.0% Triton X-100, pH 8.8), 10 μL of dNTPs (concentration 10 mM), 12.5 μL of LDMSO (concentration 100%), 55 μL of urea (concentration 10 M), 2.5 μL of PFO-EV71-1 primer (concentration 20 μM), 2.5 μL of PRO-EV71-1 primer (concentration 20 μM), 4 μL of PDI-EV71-1 primer (concentration 50 μM), 10 μL of FL-EV71-1 primer (concentration 40 μM) and 10 μL of RL-EV71-1 primer (concentration 40 μM), mix well to form Mixture I;

[0104] (3) Take 24 EP tubes and add 5.3 μL of the above mixture I to each tube. Divide them into 8 groups and label them as A, B, C, D, E, F, G and H. Then add plasmid template containing the target nucleic acid sequence T3 of EV71VP1 gene (concentration of 2×106 to 2×100 copies / μL) diluted 10 times to groups A to G. Add 1.0 μL to each of the 3 EP tubes in each group and mix well. At the same time, add 1.0 μL of nuclease-free water to each group H as a blank control group (NTC) and mix well.

[0105] (4) Place the 24 well-mixed EP tubes incubate at 95°C for 5 minutes, then remove them and allow them to cool naturally to room temperature;

[0106] (5) Take one EP tube, add 8 μL of nucleic acid intercalation dye EvaGreen (20×), 10 μL of heat-stable single-stranded binding protein ET SSB (concentration of 0.5 μg / μL), 50 μL of Bst DNA polymerase large fragment (concentration of 120 U / μL) and 24.5 μL of nuclease-free water, mix well to form Mixture II;

[0107] (6) Add 3.7 μL of the above mixture II to each of the 24 EP tubes containing mixture I and template, mix well to form the final reaction solution, and incubate at 37°C for 90 min. Measure the change in fluorescence of each solution over time, with a sampling time interval of 1 min.

[0108] The sequence of the target nucleic acid sequence T3 of the EV71 VP1 gene is as follows:

[0109] T3:

[0110] 5′-AACCCCTCGGTTTTTGTCAAGCTGTCAGACCCTCCATCGCAGGTTTCAGTGCCATTCATGTCACCTGCGAGTGCTTATCAATGGTTTTATGACGGATATCCCACATTCGGAGAACACAAACAGGAGAAAGATCTTGAATATGGGGCATGTCC TAATAACATGATGGGCACGTTCTCAGTGCGGACTGTGGGGACCTCCAAGTCCAAGTACCCTTTAGTGGTTAGGATTTACATGAGAATGAAGCACGTCAGGGCGTGGATACCTCGCCCGATGCGTAACCAGAACTACCTATTCAAAGCC-3′(SEQ ID No.8).

[0111] The PFO-EV71-1 primer sequence is as follows:

[0112] PFO-EV71-1:

[0113] 5′-A*C*C*A*T*T*G*A*T*A*A*G*C*A*C*T*C*G*C*A*G*G-GTCAAGCTGTCAGACCCTCC-3′ (SEQ ID No. 9).

[0114] The PRO-EV71-1 primer sequence is as follows:

[0115] PRO-EV71-1:

[0116] 5′-G*A*A*C*A*C*A*A*A*C*A*G*G*A*G*A*A*A*G*A*T*C*T*T*G-TGAGAACGTGCCCATCA-3′ (SEQ ID No. 10).

[0117] The sequences of the above-mentioned PDI-EV71-1 monomers, PDI-EV71-1-1 and PDI-EV71-1-2, are as follows:

[0118] PDI-EV71-1-1:

[0119] 5′-T*C*C*G*A*A*T*G*T*G*G*G*A*T*A*T*C*C*G*T*C*A*T*A*A-GTTTCAGTGCCATTCATGTC-3′ (SEQ ID No. 11);

[0120] PDI-EV71-1-2:

[0121] 5′-T*T*A*T*G*A*C*G*G*A*T*A*T*C*C*C*A*C*A*T*T*C*G*G*A-AGGACATGCCCCGTATT-3′ (SEQ ID No. 12).

[0122] The FL-EV71-1 primer sequence is as follows:

[0123] FL-EV71-1: 5′-ACCATTGATAAGCACTCGCAGG-3′ (SEQ ID No. 13).

[0124] The RL-EV71-1 primer sequence is as follows:

[0125] RL-EV71-1: 5′-GAACACAAACAGGAGAAAGATCTTG-3′ (SEQ ID No. 14).

[0126] Experimental results are as follows Figure 6 As shown, under incubation conditions at 37°C, the isothermal amplification method of this invention, utilizing Bst DNA polymerase, can stably detect target copy numbers up to 20, all exhibiting exponential real-time fluorescence change curves, while the fluorescence of the NTC control group does not change over time. Therefore, this result demonstrates that the Bst DNA polymerase of this invention has high analytical sensitivity for DNA targets, capable of detecting EV71 VP1 gene target nucleic acid sequences as low as 20 copies.

[0127] Example 4:

[0128] In this embodiment, artificial in vitro reverse-transcribed RNA of the EV71 VP1 gene was used as the detection target to verify the feasibility and analytical sensitivity of this method at a low temperature (37°C) using a large fragment of Bst DNA polymerase for RNA target amplification. Primers were designed based on the target nucleic acid sequence of the EV71 VP1 gene, the reaction system was constructed using a large fragment of Bst DNA polymerase, and the nucleic acid intercalation dye EvaGreen was used to display real-time fluorescence signal changes. The reaction principle is described in [link to reaction details]. Figure 2 and Figure 3 The specific steps are as follows:

[0129] (1) Take one EP tube and add an equal volume of 100μM PDI-EV71-2 monomers (PDI-EV71-2-1 and PDI-EV71-2-2), mix well to form a 50μM PDI-EV71-2 composite.

[0130] (2) Take 8 EP tubes and pre-amplify the target RNA (concentrations ranging from 2×10⁶ to 2×10⁰ copies / μL) in a tenfold serial dilution. The reagent used for pre-amplification was reverse transcription recombinase polymerase reaction (RT-RPA). The system composition of each EP tube was: 20 μL of reaction mixture (containing 38 μL of rehydration buffer, 1 μL of RNase H (concentration 5 U / μL), 0.5 μL of SuperScript IV reverse transcriptase (concentration 200 U / μL), 0.5 μL of outer primer mixture (the concentration of PFO-EV71-2 primer and PRO-EV71-2 primer in this mixture was 50 μM each)), 1 μL of target RNA solution of each concentration, 3.5 μL of nuclease-free water, and 0.5 μL of magnesium acetate (concentration 700 mM) added to the EP tube cap. Among them, 1 μL of nuclease-free water was used as a blank control NTC instead of the target RNA solution. Simultaneously centrifuge the EP tube to allow magnesium acetate to enter the system, and incubate at 37°C for 20 min to induce RT-RPA pre-amplification;

[0131] (3) Take one EP tube and add 25 μL of 10× reaction buffer (200 mM Tris-HCl, 100 mM (NH4)2SO4, 100 mM KCl, 20 mM MgSO4, 1.0% Triton X-100, pH 8.8), 10 μL of dNTPs (concentration 10 mM), 12.5 μL of LDMSO (concentration 100%), 55 μL of urea (concentration 10 M), 2.5 μL of PFO-EV71-2 primers (concentration 20 μM), 2.5 μL of PRO-EV71-2 primers (concentration 20 μM), 4 μL of PDI-EV71-2 primers (concentration 50 μM), 10 μL of FL-EV71-2 primers (concentration 40 μM) and 10 μL of RL-EV71-2 primers (concentration 40 μM), and mix well to form Mixture I;

[0132] (4) Take 24 EP tubes and add 5.3 μL of the above mixture I to each tube. Divide them into 8 groups and label them as A, B, C, D, E, F, G and H. Then add the target RNA of each concentration described in (2) and the pre-amplification product of the blank group to groups A to H respectively. Add 1.0 μL to each of the 3 EP tubes in each group and mix well.

[0133] (5) Take one EP tube, add 8 μL of nucleic acid intercalation dye EvaGreen (20×), 10 μL of heat-stable single-stranded binding protein ET SSB (concentration of 0.5 μg / μL), 50 μL of Bst DNA polymerase large fragment (concentration of 120 U / μL) and 24.5 μL of nuclease-free water, mix well to form Mixture II;

[0134] (6) Add 3.7 μL of the above mixture II to each of the 24 EP tubes containing mixture I and template, mix well to form the final reaction solution, and incubate at 37°C for 90 min. Measure the change in fluorescence of each solution over time, with a sampling time interval of 1 min.

[0135] The T4 sequence of the cDNA of the above-mentioned in vitro transcribed RNA is as follows:

[0136] T4:

[0137] 5′-AACCCCTCGGTTTTTGTCAAGCTGTCAGACCCTCCATCGCAGGTTTCAGTGCCATTCATGTCACCTGCGAGTGCTTATCAATGGTTTTATGACGGATATCCCACATTCGGAGAACACAAACAGGAGAAAGATCTTGAATATGGGGCATGTCC TAATAACATGATGGGCACGTTCTCAGTGCGGACTGTGGGGACCTCCAAGTCCAAGTACCCTTTAGTGGTTAGGATTTACATGAGAATGAAGCACGTCAGGGCGTGGATACCTCGCCCGATGCGTAACCAGAACTACCTATTCAAAGCC-3′(SEQ ID No. 8, the same as T3 in Example 3).

[0138] The PFO-EV71-2 primer sequences are as follows:

[0139] PFO-EV71-2:

[0140] 5′-A*C*C*A*T*T*G*A*T*A*A*G*C*A*C*T*C*G*C*A*G*G-GTCAAGCTGTCAGACCCTCC-3′ (SEQ ID No. 9, identical to PFO-EV71-1 in Example 3).

[0141] The PRO-EV71-2 primer sequences are as follows:

[0142] PRO-EV71-2:

[0143] 5′-G*A*A*C*A*C*A*A*A*C*A*G*G*A*G*A*A*A*A*G*A*T*C*T*T*G-TGAGAACGTGCCCATCA-3′ (SEQ ID No. 10, identical to PRO-EV71-1 in Example 3).

[0144] The sequences of the above-mentioned PDI-EV71-2 monomers, PDI-EV71-2-1 and PDI-EV71-2-2, are as follows:

[0145] PDI-EV71-2-1:

[0146] 5′-T*C*C*G*A*A*T*G*T*G*G*G*G*A*T*A*T*C*C*G*T*C*A*T*A*A-GTTTCAGTGCCATTCATGTC-3′ (SEQ ID No. 11, identical to PDI-EV71-1-1 in Example 3);

[0147] PDI-EV71-2-2:

[0148] 5′-T*T*A*T*G*A*C*G*G*A*T*A*T*C*C*C*A*C*A*T*T*C*G*G*A-AGGACATGCCCCGTATT-3′ (SEQ ID No. 12, identical to PDI-EV71-1-2 in Example 3).

[0149] The FL-EV71-2 primer sequences are as follows:

[0150] FL-EV71-2: 5′-ACCATTGATAAGCACTCGCAGG-3′ (SEQ ID No. 13, same as FL-EV71-1 in Example 3).

[0151] The RL-EV71-2 primer sequence is as follows:

[0152] RL-EV71-2: 5′-GAACACAAACAGGAGAAAGATCTTG-3′ (SEQ ID No. 14, identical to FL-EV71-2 in Example 3).

[0153] Experimental results are as follows Figure 7 As shown, under incubation conditions at 37°C, the isothermal amplification method of this invention, utilizing Bst DNA polymerase, can stably detect target RNA molecules with a copy number of up to 200, exhibiting an exponential real-time fluorescence change curve, while the fluorescence of the NTC control group does not change over time. Therefore, this result demonstrates that the Bst DNA polymerase of this invention has high analytical sensitivity for RNA targets, capable of detecting in vitro transcribed RNA targets of the EV71VP1 gene with a copy number as low as 200.

[0154] In the description of this specification, references to terms such as "an embodiment," "example," "specific example," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the invention. In this specification, illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.

[0155] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the claimed invention.

[0156] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and simple improvements made on the substantive content of the present invention should be included within the protection scope of the present invention.

Claims

1. A non-diagnostic in vitro denaturing nested isothermal nucleic acid amplification method, comprising denaturing agent urea, melting primer-assisted annealing and extension product self-matching, thiophosphorylation sequence self-matching, and exponential cyclic amplification, characterized in that, The reagents used in the isothermal nucleic acid amplification method include the upstream thiophosphorylated outer primer PFO, the downstream thiophosphorylated outer primer PRO, the double-stranded inner primer PDI, the upstream linear primer FL, the downstream linear primer RL, a nucleotide polymerase with strand displacement activity, a nucleic acid chimeric dye, the target nucleic acid sequence, and the denaturing agent urea. The target nucleic acid sequence contains seven different target nucleic acid sequence sites, which are F3, F2, F1, T, R1c, R2c and R3c in order from 5′ end to 3′ end. The complementary sequence of the target nucleic acid sequence also contains seven different target nucleic acid sequence sites, which are R3, R2, R1, Tc, F1c, F2c and F3c in order from 5′ end to 3′ end. Among them, the target nucleic acid sequence sites F3 and F3c are complementary, the target nucleic acid sequence sites F2 and F2c are complementary, the target nucleic acid sequence sites F1 and F1c are complementary, the target nucleic acid sequence sites T and Tc are complementary, the target nucleic acid sequence sites R1 and R1c are complementary, the target nucleic acid sequence sites R2 and R2c are complementary, and the target nucleic acid sequence sites R3 and R3c are complementary. Both the upstream thiophosphorylation primer PFO and the downstream thiophosphorylation primer PRO are single-stranded compounds composed of two target nucleic acid sequence sites. The upstream thiophosphorylation primer PFO is composed of target nucleic acid sequence sites F1c and F3, where F1c constitutes the 5′ end sequence of PFO, F3 constitutes the 3′ end sequence of PFO, and the 5′ end sequence formed by F1c is a thiophosphorylated nucleotide. The downstream thiophosphorylation primer PRO is composed of target nucleic acid sequence sites R1c and R3, where R1c constitutes the 5′ end sequence of PRO, R3 constitutes the 3′ end sequence of PRO, and the 5′ end sequence formed by R1c is a thiophosphorylated nucleotide. The phosphorylated double-stranded inner primer PDI is a complex consisting of an inner double-stranded inner primer and an outer single-stranded inner primer, which are composed of four target nucleic acid sequence sites T, Tc, F2, and R2. The inner double-stranded structure is formed by pairing two completely complementary target nucleic acid sequence sites T and Tc, both of which are modified by phosphorylation. The outer single-stranded structure refers to the presence of single strands on both sides of the complex that can recognize and be extended by the target nucleic acid sequence, which are composed of target nucleic acid sequence sites F2 and R2, respectively. The target nucleic acid sequence sites T and R2 combine to form a single strand, with T forming the 5′ end sequence of the single strand and R2 forming the 3′ end sequence of the single strand. Similarly, the target nucleic acid sequence sites Tc and F2 combine to form a single strand, with Tc forming the 5′ end sequence of the single strand and F2 forming the 3′ end sequence of the single strand. The upstream linear primer FL and the downstream linear primer RL are composed of a single target nucleic acid sequence site, wherein the upstream linear primer FL is composed of the target nucleic acid sequence site F1c and the downstream linear primer RL is composed of the target nucleic acid sequence site R1c. The upstream outer primer sequence of thiophosphorylation, the downstream outer primer sequence of thiophosphorylation, and the single-stranded sequences on both sides of the double-stranded inner primer of thiophosphorylation all specifically bind to the target nucleic acid sequence, and the binding sites are distributed in an inner and outer nested pattern. The isothermal nucleic acid amplification process includes: a) With the denaturant urea-assisted denaturation of the target nucleic acid sequence, the upstream and downstream linear primers specifically bind to the target nucleic acid sequence sites, respectively. Under the action of nucleotide polymerase, using the target sequence as a template, the primers extend along the 5′ end of the target sequence. The extension products will further open the target nucleic acid sequence and expose the recognition sites of other primers. b) The upstream and downstream thiophosphorylated primers and the thiophosphorylated double-stranded inner primers specifically bind to their respective target nucleic acid sequence sites. Under the action of nucleotide polymerase, the target sequence is used as a template to extend along the 5′ end of the target sequence. The extension product forms a double strand with the target sequence or is replaced to form a single strand with a double-stranded structure at one end. c) The double-stranded extension product in b) will undergo self-matching of the thiophosphorylation sequence with the assistance of the denaturing agent urea, thereby exposing the target sequence site again, which will be recognized by the corresponding thiophosphorylation primer and mediated by cyclic amplification. d) Using the single-strand extension product described in b) as a template, all primers enter an exponential cyclic amplification stage under the action of nucleotide polymerase, which mainly consists of self-matching and circularization of the 5′ end thiophosphorylated sequence, self-matching and circularization of the 3′ end sequence, and primer recognition and extension of the sequence on the loop.

2. The method for in vitro denaturing nested phosphorylation isothermal nucleic acid amplification for non-diagnostic purposes according to claim 1, characterized in that, The upstream and downstream linear primers each have nucleotide numbers greater than or equal to 15 and less than or equal to 25.

3. The method for in vitro denaturing nested phosphorylation isothermal nucleic acid amplification for non-diagnostic purposes according to claim 1, characterized in that, The sequence of the upstream linear primer coincides with the 5′ thiophosphorylation sequence of the upstream thiophosphorylation primer, and the sequence of the downstream linear primer coincides with the 5′ thiophosphorylation sequence of the downstream thiophosphorylation primer.

4. The method for in vitro denaturing nested phosphorylation isothermal nucleic acid amplification for non-diagnostic purposes according to claim 3, characterized in that, In the upstream and downstream thiophosphorylation primers, the number of nucleotides at the two sites constituting the 5′ and 3′ ends of the sequence is greater than or equal to 15 and less than or equal to 25.

5. The method for in vitro denaturing nested phosphorylation isothermal nucleic acid amplification for non-diagnostic purposes according to claim 1, characterized in that, In the thiophosphorylated double-stranded inner primer, the number of nucleotides at the four target nucleic acid sequence sites constituting the inner double strand and outer single strand is greater than or equal to 15 and less than or equal to 25.

6. The method for in vitro denaturing nested phosphorylation isothermal nucleic acid amplification for non-diagnostic purposes according to claim 1, characterized in that, The target nucleic acid sequence is a DNA sequence in the sample, an RNA sequence in the sample, a mixed DNA and RNA sequence in the sample, a pre-amplified product of a DNA sequence in the sample, or a pre-amplified product of an RNA sequence in the sample.

7. The method for in vitro denaturing nested phosphorylation isothermal nucleic acid amplification for non-diagnostic purposes according to claim 1, characterized in that, The nucleotide polymerase with strand substitution activity is one or more of the following: Bacillus stearothermophilus (Bst) DNA polymerase, Bacillus smithii (Bsm) DNA polymerase, Bacillus subtilis (Bsu) DNA polymerase, phi29 DNA polymerase, and Vent (exo-) DNA polymerase.

8. The method for in vitro denaturing nested phosphorylation isothermal nucleic acid amplification for non-diagnostic purposes according to claim 1, characterized in that, The nucleic acid chimeric dye is one of the SYBR Green series, SYTO series, and EvaGreen series.

9. The method for in vitro denaturing nested phosphorylation isothermal nucleic acid amplification for non-diagnostic purposes according to claim 1, characterized in that, The denaturant urea is present at a concentration of 2 mol / L in the final reaction system.

10. A method for in vitro denaturing nested phosphorylation isothermal nucleic acid amplification for non-diagnostic purposes according to claim 6, characterized in that, The pre-amplified product is derived from one of the following nucleic acid amplification methods: polymerase chain reaction, reverse transcription polymerase chain reaction, loop-mediated isothermal amplification, reverse transcription loop-mediated isothermal amplification, recombinase polymerase reaction, reverse transcription recombinase polymerase reaction, helicase amplification, and reverse transcription helicase amplification.

11. An isothermal nucleic acid amplification kit, comprising: Thiophosphorylation upstream outer primer PFO, thiophosphorylation downstream outer primer PRO, thiophosphorylation double-stranded inner primer PDI, upstream linear primer FL, downstream linear primer RL, nucleotide polymerase with strand displacement activity, nucleic acid chimeric dye, target nucleic acid sequence, and denaturing agent urea. The target nucleic acid sequence contains seven different target nucleic acid sequence sites, which are F3, F2, F1, T, R1c, R2c and R3c in order from 5′ end to 3′ end. The complementary sequence of the target nucleic acid sequence also contains seven different target nucleic acid sequence sites, which are R3, R2, R1, Tc, F1c, F2c and F3c in order from 5′ end to 3′ end. Among them, the target nucleic acid sequence sites F3 and F3c are complementary, the target nucleic acid sequence sites F2 and F2c are complementary, the target nucleic acid sequence sites F1 and F1c are complementary, the target nucleic acid sequence sites T and Tc are complementary, the target nucleic acid sequence sites R1 and R1c are complementary, the target nucleic acid sequence sites R2 and R2c are complementary, and the target nucleic acid sequence sites R3 and R3c are complementary. Both the upstream thiophosphorylation primer PFO and the downstream thiophosphorylation primer PRO are single-stranded compounds composed of two target nucleic acid sequence sites. The upstream thiophosphorylation primer PFO is composed of target nucleic acid sequence sites F1c and F3, where F1c constitutes the 5′ end sequence of PFO, F3 constitutes the 3′ end sequence of PFO, and the 5′ end sequence formed by F1c is a thiophosphorylated nucleotide. The downstream thiophosphorylation primer PRO is composed of target nucleic acid sequence sites R1c and R3, where R1c constitutes the 5′ end sequence of PRO, R3 constitutes the 3′ end sequence of PRO, and the 5′ end sequence formed by R1c is a thiophosphorylated nucleotide. The phosphorylated double-stranded inner primer PDI is a complex consisting of an inner double-stranded inner primer and an outer single-stranded inner primer, which are composed of four target nucleic acid sequence sites T, Tc, F2, and R2. The inner double-stranded structure is formed by pairing two completely complementary target nucleic acid sequence sites T and Tc, both of which are modified by phosphorylation. The outer single-stranded structure refers to the presence of single strands on both sides of the complex that can recognize and be extended by the target nucleic acid sequence, which are composed of target nucleic acid sequence sites F2 and R2, respectively. The target nucleic acid sequence sites T and R2 combine to form a single strand, with T forming the 5′ end sequence of the single strand and R2 forming the 3′ end sequence of the single strand. Similarly, the target nucleic acid sequence sites Tc and F2 combine to form a single strand, with Tc forming the 5′ end sequence of the single strand and F2 forming the 3′ end sequence of the single strand. The upstream linear primer FL and the downstream linear primer RL are composed of a single target nucleic acid sequence site, wherein the upstream linear primer FL is composed of the target nucleic acid sequence site F1c and the downstream linear primer RL is composed of the target nucleic acid sequence site R1c. The upstream outer primer sequence of thiophosphorylation, the downstream outer primer sequence of thiophosphorylation, and the single-stranded sequences on both sides of the double-stranded inner primer of thiophosphorylation all specifically bind to the target nucleic acid sequence, and the binding sites are distributed in an inner and outer nested pattern. The nucleotide polymerase is one or a combination of Bacillus stearothermophilus (Bst) DNA polymerase, Bacillus smithii (Bsm) DNA polymerase, Bacillus subtilis (Bsu) DNA polymerase, phi29 DNA polymerase and Vent (exo-) DNA polymerase. The isothermal nucleic acid amplification process includes: a) With the denaturant urea-assisted denaturation of the target nucleic acid sequence, the upstream and downstream linear primers specifically bind to the target nucleic acid sequence sites, respectively. Under the action of nucleotide polymerase, using the target sequence as a template, the primers extend along the 5′ end of the target sequence. The extension products will further open the target nucleic acid sequence and expose the recognition sites of other primers. b) The upstream and downstream thiophosphorylated primers and the thiophosphorylated double-stranded inner primers specifically bind to their respective target nucleic acid sequence sites. Under the action of nucleotide polymerase, the target sequence is used as a template to extend along the 5′ end of the target sequence. The extension product forms a double strand with the target sequence or is replaced to form a single strand with a double-stranded structure at one end. c) The double-stranded extension product in b) will undergo self-matching of the thiophosphorylation sequence with the assistance of the denaturing agent urea, thereby exposing the target sequence site again, which will be recognized by the corresponding thiophosphorylation primer and mediated by cyclic amplification. d) Using the single-strand extension product described in b) as a template, all primers enter an exponential cyclic amplification stage under the action of nucleotide polymerase, which mainly consists of self-matching and circularization of the 5′ end thiophosphorylated sequence, self-matching and circularization of the 3′ end sequence, and primer recognition and extension of the sequence on the loop.

Images