Method for creating new germplasm of large grain type of rice

Abstract

The present application relates to the technical field of plant breeding, and particularly to a method for creating a new germplasm of large long-grain type of rice.The method for creating a new germplasm of large long-grain type of rice provided by the present application comprises: making the biological functions of OsD-h and LOC_Os01g10460 genes of rice lost.The present application finds that inactivating the OsD-h and LOC_Os01g10460 genes of rice simultaneously can make the grains of rice significantly increase and grow, and the thousand-grain weight significantly improve.The method is simple, easy to implement, low in cost, and high in efficiency, and a high-quality rice variety with significantly increased and grown grain type can be obtained by using the method, which provides an effective strategy for rapidly improving the grain type of a rice variety by using a gene editing technology, and particularly provides a convenient and efficient improvement strategy for a variety with good other traits and yet to be improved grain type.

Description

Technical Field

[0001] This invention relates to the field of plant breeding technology, specifically to a method for creating new long-grained rice germplasm. Background Technology

[0002] Rice is China's main food crop, with over 60% of the population relying on it as their staple food. Grain shape is one of the most important traits affecting yield, with larger grains directly correlated with increased production. Grain shape also influences the appearance and quality of rice, and as people's living standards improve, their demands for rice quality are rising. In the current Chinese catering market, long-grain rice is widely favored. Some rice varieties, despite having excellent other traits, have limited market share due to their shorter grain length.

[0003] Gene editing technology has become a hot topic in molecular breeding in recent years. It enables rapid and precise improvement of target traits in parents without raising concerns about transgenic safety. In breeding, this technology is mostly applied by adding or deleting bases from target genes, thereby inactivating gene function and obtaining the corresponding target trait. Utilizing gene editing technology to modify rice genes and create rice germplasm with larger, longer grains is of great significance for increasing rice yield. Summary of the Invention

[0004] The purpose of this invention is to provide a method for creating new long-grained rice germplasm.

[0005] This invention first discovered novel functions of the OsD-h and LOC_Os01g10460 genes. Simultaneous inactivation of both genes in rice leads to increased grain size and length, and improves the thousand-grain weight. The rice OsD-h gene encodes a protein related to the GA signaling pathway. Existing studies have shown that OsD-h affects plant height and grain size in rice, and a 63bp deletion of the OsD-h gene in japonica rice results in a dwarf and small-grain phenotype. However, there has been no research on the correlation between the OsD-h gene and rice grain size and length. The novel function of combined inactivation of the OsD-h and LOC_Os01g10460 genes discovered in this invention can be used to create new large-grain rice germplasm.

[0006] Specifically, the present invention provides the following technical solutions:

[0007] In a first aspect, the present invention provides the application of the rice OsD-h and LOC_Os01g10460 genes, their encoded proteins, or repressor factors of the rice OsD-h and LOC_Os01g10460 genes in regulating plant grain size or thousand-grain weight.

[0008] Preferably, the regulation of plant grain size is to increase the size and length of rice grains, and the regulation of thousand-grain weight is to increase the thousand-grain weight.

[0009] More preferably, by causing the plant OsD-h and LOC_Os01g10460 genes to lose their biological function, the plant seeds are enlarged and lengthened, and the thousand-seed weight is increased.

[0010] Secondly, this invention provides the application of the rice OsD-h and LOC_Os01g10460 genes, their encoded proteins, or repressor factors of the rice OsD-h and LOC_Os01g10460 genes in plant breeding.

[0011] Preferably, the rice breeding is the breeding of plant grain traits or thousand-grain weight traits.

[0012] More preferably, the plant breeding is for large-grained plants or for increasing the thousand-grain weight.

[0013] Thirdly, this invention provides the application of rice OsD-h and LOC_Os01g10460 genes, their encoded proteins, or repressor factors of rice OsD-h and LOC_Os01g10460 genes in the improvement of plant germplasm resources.

[0014] Preferably, the plant germplasm resource improvement refers to the improvement of plant seed traits or thousand-grain weight traits.

[0015] More preferably, the plant germplasm resource improvement is to improve the plant into a large-grained plant or to improve the germplasm resource with an increased thousand-grain weight.

[0016] In this invention, the amino acid sequence of the protein encoded by the OsD-h gene is as shown in SEQ ID NO:1, or is the amino acid sequence of an active variant that retains its function and has at least 70% sequence identity with it; the amino acid sequence of the protein encoded by the LOC_Os01g10460 gene is as shown in SEQ ID NO:2, or is the amino acid sequence of an active variant that retains its function and has at least 70% sequence identity with it.

[0017] Preferably, the sequence identity is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%.

[0018] In this invention, the nucleotide sequence of the OsD-h gene is as shown in SEQ ID NO:3, or is a nucleotide sequence of an active variant that retains its function and has at least 90% sequence identity with it; the nucleotide sequence of the LOC_Os01g10460 gene is as shown in SEQ ID NO:4, or is a nucleotide sequence of an active variant that retains its function and has at least 90% sequence identity with it.

[0019] Preferably, the sequence identity is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%.

[0020] In this invention, the inhibitors of the OsD-h gene and the LOC_Os01g10460 gene are nucleic acid molecules or protein molecules that can disrupt the biological function of the genes.

[0021] In this invention, the plant is preferably rice, and more preferably japonica rice or indica rice.

[0022] Fourthly, the present invention provides a method for creating new rice germplasm with large and long grains, the method comprising: causing the loss of biological function of the rice OsD-h and LOC_Os01g10460 genes.

[0023] Preferably, the amino acid sequence of the protein encoded by the OsD-h gene is as shown in SEQ ID NO:1, or is the amino acid sequence of an active variant that retains its function and has at least 90% sequence identity with it; the amino acid sequence of the protein encoded by the LOC_Os01g10460 gene is as shown in SEQ ID NO:2, or is the amino acid sequence of an active variant that retains its function and has at least 90% sequence identity with it.

[0024] In the above methods, the loss of biological function of the rice OsD-h and LOC_Os01g10460 genes can be achieved through techniques commonly used in the field, including but not limited to gene editing.

[0025] The present invention preferably uses gene editing methods to cause the loss of biological function of rice OsD-h and LOC_Os01g10460 genes; the gene editing method is carried out by one or more sequence-specific nucleases selected from the following: CRISPR / Cas9, CRISPR / Cpf1, CRISPR / Cas12a, TALEN, a wide range of nucleases and ZFN.

[0026] Preferably, the gene editing is performed using a CRISPR / Cas9 gene editing vector.

[0027] Since the OsD-h gene and the LOC_Os01g10460 gene have partially overlapping regions, this invention uses the overlapping region of the two as the target region to simultaneously inactivate the OsD-h gene and the LOC_Os01g10460 gene through a single CRISPR / Cas9 gene editing.

[0028] Preferably, the CRISPR / Cas9 gene editing vector contains a first sgRNA and a second sgRNA, the first sgRNA and the second sgRNA respectively targeting the nucleotide sequences shown in SEQ ID NO:5-6.

[0029] The aforementioned CRISPR / Cas9 gene editing can result in deletion, insertion, substitution, or a combination thereof in the OsD-h gene, leading to deletion, insertion, substitution, or a combination thereof in the LOC_Os01g10460 locus gene region.

[0030] In some specific implementations, the gene editing results in the deletion, addition, or substitution of multiples of 3 bases, such as 3bp, 6bp, or 9bp, in the OsD-h gene and the LOC_Os01g10460 gene.

[0031] Fifthly, the present invention provides a long-grained rice variety in which the biological functions of the OsD-h and LOC_Os01g10460 genes are lost.

[0032] Preferably, the overlapping regions of the OsD-h and LOC_Os01g10460 genes in the long-grain rice are subject to deletion, insertion, substitution, or a combination of these.

[0033] More preferably, the overlapping regions of the OsD-h and LOC_Os01g10460 genes of the long-grain rice have a number of bases deleted, added, or substituted in multiples of 3, such as 3bp, 6bp, or 9bp.

[0034] This invention provides a long-grain rice variety with a 65bp deletion in the overlapping region of the OsD-h and LOC_Os01g10460 genes.

[0035] Sixthly, the present invention provides the application of rice created using the method for creating new long-grained rice germplasm in rice breeding or germplasm resource improvement.

[0036] In a seventh aspect, the present invention provides a product prepared from rice seeds created by the method for creating new long-grained rice germplasm, the product being selected from one or more of food, feed, or industrial raw materials.

[0037] In an eighth aspect, the present invention provides sgRNAs targeting the rice OsD-h and LOC_Os01g10460 genes, comprising a first sgRNA and a second sgRNA, wherein the first sgRNA contains the nucleotide sequence shown in SEQ ID NO:7 and the second sgRNA contains the nucleotide sequence shown in SEQ ID NO:8.

[0038] In a ninth aspect, the present invention provides a CRISPR / Cas9 gene editing vector targeting the rice OsD-h and LOC_Os01g10460 genes, the vector comprising a first expression cassette and a second expression cassette, the first expression cassette expressing Cas9 and the second expression cassette expressing sgRNA, the sgRNA comprising the nucleotide sequence shown in SEQ ID NO:7 and / or SEQ ID NO:8, or an active variant sequence that retains its function and has at least 70% sequence identity with it.

[0039] Preferably, the Cas9 comprises the nucleotide sequence shown in SEQ ID NO:9 or an active variant sequence of a protein having at least 70% sequence identity and encoding the same function.

[0040] As a preferred embodiment of the present invention, the first expression cassette uses the sugarcane Ubi4 promoter to drive the expression of Cas9, and the second expression cassette uses the rice U3 promoter to drive the expression of sgRNA.

[0041] In a tenth aspect, the present invention provides the application of the sgRNA or the CRISPR / Cas9 gene editing vector in the creation of new rice germplasm with large and long grains.

[0042] The beneficial effects of this invention are as follows: This invention discovers that simultaneous inactivation of the OsD-h and LOC_Os01g10460 genes in rice can significantly increase the size and length of rice grains, and significantly improve the thousand-grain weight. The inactivation of the OsD-h and LOC_Os01g10460 genes in rice can be used for the creation of new germplasm of large-grain rice.

[0043] This invention provides a method for creating new long-grained rice germplasm. This method utilizes gene editing technology to create mutants of the OsD-h gene and the LOC_Os01g10460 locus gene to improve rice grain shape. The targeted gene editing function is used to achieve gene mutation, and specific mutation types are screened out. This method is simple, low-cost, and highly efficient. It can yield high-quality rice varieties with significantly increased grain size. This invention utilizes this method to perform targeted editing of the OsD-h gene and the LOC_Os01g10460 locus gene, successfully obtaining indica rice varieties with significantly increased grain size. This method provides an effective strategy for rapidly improving the grain shape of rice varieties using gene editing technology, especially for varieties with good other traits but requiring further grain shape improvement, offering a convenient and efficient improvement strategy. Attached Figure Description

[0044] Figure 1The images show the sequences of the OsD-h gene and LOC_Os01g10460 gene in Example 1 of this invention, and the sequences of the edited strain OsD-h gene and LOC_Os01g10460 gene in Example 4, as well as the sequence overlap relationship between the two genes. OsD-h and LOC_Os01g10460 represent wild-type genes; 480AH012a and 480AH013a represent edited strains; underlined sequences represent PAM sequences; dashed lines represent deleted sequences; boxes represent exons; and italicized text represents inserted sequences.

[0045] Figure 2 This is a schematic diagram of the structure of the gene editing vector in Embodiment 1 of the present invention.

[0046] Figure 3 The amino acid sequences encoded by the OsD-h gene in the wild-type and edited strains in Example 4 of this invention are shown below. OsD-h: wild type; 480AH012a and 480AH013a: edited strains; dashed lines indicate missing amino acids, and italicized red text indicates amino acids that cannot be matched with the wild type.

[0047] Figure 4 The amino acid sequences encoded by the LOC_Os01g10460 gene in Example 4 of this invention are shown below. LOC_Os01g10460: wild type; 480AH012a and 480AH013a: edited lines; dashed lines indicate missing amino acids, and italicized words indicate amino acids that cannot be matched with the wild type.

[0048] Figure 5 This is a comparison of the grains of the OsD-h gene and LOC_Os01g10460 gene-edited lines and wild-type lines in Example 5 of the present invention, where WT: wild type; 480AH012a and 480AH013a: edited lines; A is a photo of millet, and B is a photo of rice grains. Detailed Implementation

[0049] The following is an explanation of the terminology used in this article:

[0050] The term "gene editing" or "genome edting" used in this article refers to an emerging and relatively precise genetic engineering technique that can modify specific target genes in an organism's genome. Gene editing refers to the ability to precisely "edit" target genes, achieving modifications to specific DNA fragments. Gene editing relies on genetically engineered nucleases, also known as "molecular scissors," to create site-specific double-strand breaks (DSBs) at specific locations in the genome. This induces the organism to repair the DSBs through non-homologous end joining (NHEJ) or homologous recombination (HR). Because this repair process is prone to errors, it can lead to targeted mutations.

[0051] The term "CRISPR / Cas9" as used in this article refers to an endonuclease that uses an RNA guide strand to target the cleavage site of an endonuclease. See Jinek et al., Science 337:816-821 (2013); Cong et al., Science (January 3, 2013); and Mali et al., Science (January 3, 2013). Currently, three different types of CRISPR / Cas9 systems have been discovered: type I, type II, and type III, which are found in approximately 40% of sequenced eubacteria and 90% of sequenced archaea. Type II is relatively simple in composition, with the Cas9 protein and guide RNA (gRNA) as its core components, and is the most thoroughly studied type. When bacteria defend against the invasion of exogenous DNA such as bacteriophages, under the regulation of the leader region, CRISPR is transcribed into a long RNA precursor (pre-crRNA), which is then processed into a series of short mature crRNAs containing conserved repetitive sequences and spacer regions. These crRNAs ultimately recognize and bind to complementary exogenous DNA sequences to perform cleavage. The CRISPR / Cas9 splicing site is located at the NGG site in the 5'-GG-N18-NGG-3' characteristic region of the PAM region (Protospacer Adjacent Motif) downstream of the crRNA complementary sequence, and this characteristic sequence is repeated once in every 128 bp of random DNA sequence.

[0052] The term "CRISPR / Cpf1" used in this article refers to a novel type of CRISPR-Cas system. The widely used CRISPR / Cas9 system frequently experiences off-target effects. As a potential competitor to the CRISPR / Cas9 system, the CRISPR-Cpf1 system, as a novel gene editing tool, further expands the range of gene editing target sites while exhibiting virtually no off-target effects. Cpf1 is a novel CRISPR effector protein with many characteristics different from Cas9, which helps overcome some limitations in the application of CRISPR / Cas9.

[0053] The term "CRISPR / Cas12a" used in this article refers to a novel CRISPR-Cas system. Compared to Cas9, Cas12a is more accurate and safer. When CRISPR / Cas9 works, the Cas9 protein recognizes the PAM sequence (RNA-written genetic code) and unwinds part of the double helix using gRNA. During this process, once the Cas9 protein finds a suitable sequence, it binds tightly to that DNA segment. While some mismatches may occur, this binding is irreversible. Cas12a, on the other hand, is much more intelligent. When searching for its "target," it performs single-base recognition on the DNA sequence along the way. If a mismatch is found, it moves on and searches again. When it finds a PAM sequence, the Cas12a protein forms a semi-closed R-loop with the PAM sequence. Only when the correct sequence is recognized does it fully bind to form a closed R-loop. Therefore, this binding is reversible, demonstrating its greater safety.

[0054] The terms “transcription activator-like effector nucleosidease”, “TAL effector nucleosidease”, or “TALEN” used in this article refer to a class of artificial restriction endonucleases produced by fusing the DNA-binding domain of the TAL effector with the DNA-cutting domain.

[0055] The term "zinc finger nuclease (ZFN)" used in this article consists of a DNA recognition domain and a DNA cleavage domain. The DNA recognition domain is a tandem structure of 3-4 ZFs, each containing approximately 30 amino acids, fixed by a zinc ion, and recognizes and binds to a specific triplet base. The DNA cleavage domain consists of 96 amino acid residues at the carboxyl terminus of the nonspecific endonuclease Fok I. Each Fok I monomer is linked to one ZF to form a ZFN, recognizing a specific site. When two recognition sites are at an appropriate distance (6-8 bp), the two monomeric ZFNs interact to produce enzymatic cleavage, forming a double-strand break, thereby mediating site-specific DNA cleavage.

[0056] The term "meganuclease" as used in this article refers to homing endonucleases capable of recognizing nucleic acid sequences of 14–40 bases in length. Some meganucleases can tolerate small homing site sequence differences, and the large recognition region still ensures the high specificity of these enzymes, which in turn maintains low levels of intragenomic nonspecific cleavage and low toxicity. Meganucleases are encoded by open reading frames within moving sequences of self-splicing RNA introns or self-splicing protein intron sequences.

[0057] As used herein, the term "identity," in the case of two or more nucleic acids or polypeptides, refers to two or more sequences or subsequences that are identical or have the same nucleotides or amino acids (i.e., approximately 60% identity within a specified region, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity when compared and aligned within a comparison window or specified region), as measured using the BLAST or BLAST 2.0 sequence comparison algorithm with default parameters or by manual alignment and visual inspection (see, for example, the NCBI website).

[0058] The specific embodiments of the present invention are described below:

[0059] This invention proposes a method for improving rice grain shape by creating an OsD-h gene inactivation or an LOC_Os01g10460 locus inactivation, or both of these gene loci, using gene editing technology. This method is applicable to all rice varieties containing the functional OsD-h gene or the LOC_Os01g10460 locus gene, and includes the following steps:

[0060] (1) Sequence analysis of the OsD-h gene or LOC_Os01g10460 site gene in the rice variety to be improved, and designing targets at suitable sites, such as the OsD-h gene or LOC_Os01g10460 site or two overlapping sites.

[0061] (2) Construct editing vectors, use callus tissue of rice varieties to be improved as recipient material for genetic transformation, introduce editing vectors into callus tissue cells using Agrobacterium-mediated transformation, and regenerate rice lines.

[0062] (3) Genotyping and analysis of the OsD-h gene and LOC_Os01g10460 site gene-edited lines, phenotypic analysis of the target gene-edited lines, and examination of grain shape;

[0063] (4) After passage, separation, identification and screening, rice germplasm with large and long grain phenotype that is edited homozygous and non-transgenic was obtained.

[0064] The method for creating new long-grained rice germplasm according to the present invention specifically includes the following steps:

[0065] (1) Detection of OsD-h gene and LOC_Os01g10460 site gene in rice;

[0066] (2) Construction of gene editing vectors for OsD-h gene and LOC_Os01g10460 site in rice;

[0067] (3) Indica rice callus was used as the recipient material for genetic transformation. The editing vector was introduced using Agrobacterium-mediated transformation. The editing status of the OsD-h gene and the LOC_Os01g10460 locus gene in the edited lines was identified, and the alleles of the OsD-h gene and the LOC_Os01g10460 locus with different editing types were obtained. After passage, isolation, identification and screening, homozygous edited and non-transgenic lines were obtained, and finally improved lines with larger and longer grain size were obtained.

[0068] The present invention specifically relates to the following technical solutions.

[0069] In a first aspect, the present invention provides the application of the rice OsD-h and LOC_Os01g10460 genes, their encoded proteins, or repressors of the rice OsD-h and LOC_Os01g10460 genes in regulating plant grain size or thousand-grain weight.

[0070] In a second aspect, the present invention provides the application of the rice OsD-h and LOC_Os01g10460 genes, their encoded proteins, or repressor factors of the rice OsD-h and LOC_Os01g10460 genes in plant breeding.

[0071] In a third aspect, the present invention provides the application of the rice OsD-h and LOC Os01g10460 genes, their encoded proteins, or repressor factors of the rice OsD-h and LOC_Os01g10460 genes in the improvement of plant germplasm resources.

[0072] In a fourth aspect, the present invention provides a method for creating new long-grained rice germplasm, which includes modifying the OsD-h gene and the LOC_Os01g10460 site in rice to cause them to lose their biological functions.

[0073] In some implementations, the modification is performed via gene editing.

[0074] In some embodiments, the OsD-h gene comprises or consists of the following sequences: the nucleotide sequence shown in SEQ ID NO:3 or an active variant sequence having at least about 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity with it and encoding a protein with the same function; or an amino acid sequence shown in SEQ ID NO:1 or a nucleotide sequence having at least about 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with it and retaining its function as an active variant sequence.

[0075] In some embodiments, the LOC_Os01g10460 site gene comprises or consists of the following sequences: the nucleotide sequence shown in SEQ ID NO:4 or an active variant sequence having at least about 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity with it and encoding a protein with the same function; or an amino acid sequence shown in SEQ ID NO:2 or a nucleotide sequence having at least about 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with it and retaining its function as an active variant sequence.

[0076] As used herein, the term "active variant sequence" refers to substantially similar sequences. For nucleotide sequences, active variant sequences include those sequences that encode proteins with the same function due to genetic codon degeneracy. Naturally occurring allelic variants, such as those present in nature, can be identified using known molecular biology techniques such as polymerase chain reaction (PCR) and hybridization techniques. For example, in this invention, genes from other rice varieties that have at least about 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity with the OsD-h gene of indica X12 and also encode a functional OsD-h protein are included in the "active variant sequence" as defined herein. Identity is determined by the sequence alignment procedure described herein, using default parameters. The difference between the active variant sequence of the nucleotide and the original nucleotide sequence can be as little as 1-15 nucleotides, as little as 1-10 (e.g., 6-10), as little as 5, as little as 4, 3, 2 or even 1 nucleotide.

[0077] As used herein, the term "active variant sequence" refers to substantially similar sequences. For nucleotide sequences, active variant sequences include those sequences that encode proteins with the same function due to genetic codon degeneracy. Naturally occurring allelic variants, such as those present in the wild, can be identified using known molecular biology techniques such as polymerase chain reaction (PCR) and hybridization techniques. For example, in this invention, genes from other rice varieties that have at least about 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher of identity with the LOC_Os01g10460 gene of indica X12 and also encode the functional LOC_Os01g10460 protein are included in the "active variant sequence" as defined herein. Identity is determined by the sequence alignment procedure described herein, using default parameters. The difference between the active variant sequence of the nucleotide and the original nucleotide sequence can be as little as 1-15 nucleotides, as little as 1-10 (e.g., 6-10), as little as 5, as little as 4, 3, 2 or even 1 nucleotide.

[0078] For protein sequences, the term "active variant sequence" includes polypeptides derived from native proteins, said derivation being achieved by deleting (so-called truncating) one or more amino acids from the N-terminus and / or C-terminus of the native protein or by adding one or more amino acids to the N-terminus and / or C-terminus of said native protein; deleting or adding one or more amino acids at one or more sites in the native protein; or substituting one or more amino acids at one or more sites in the native protein. Thus, for proteins, the term "active variant sequence" includes biologically active fragments of native proteins containing a sufficient number of consecutive amino acid residues that retain the biological activity of the native protein, such as having the function of the OsD-h protein. Such function may be different from or modified relative to the native protein, or may be unchanged, as long as the OsD-h protein function is retained. Identification is determined by the sequence alignment procedure described herein, using default parameters. The difference between the active variant sequence and the protein can be as little as 1-15 amino acid residues, as little as 1-10 (e.g., 6-10), as little as 5, as little as 4, 3, 2, or even 1 amino acid residue.

[0079] For protein sequences, the term "active variant sequence" includes polypeptides derived from a native protein, said derivation being achieved by deleting (so-called truncating) one or more amino acids from the N-terminus and / or C-terminus of the native protein or by adding one or more amino acids to the N-terminus and / or C-terminus of said native protein; deleting or adding one or more amino acids at one or more sites in the native protein; or substituting one or more amino acids at one or more sites in the native protein. Thus, for proteins, the term "active variant sequence" includes a biologically active fragment of a native protein containing a sufficient number of consecutive amino acid residues that retain the biological activity of the native protein, such as having the function of the LOC_Os01g10460 protein. Such function may be different from or modified relative to the native protein, or may be unchanged, as long as the function of the LOC_Os01g10460 protein is retained. Identity is determined by the sequence alignment procedure described herein, using default parameters. The difference between the active variant sequence and the protein can be as little as 1-15 amino acid residues, as little as 1-10 (e.g., 6-10), as little as 5, as little as 4, 3, 2, or even 1 amino acid residue.

[0080] In a preferred embodiment, the rice is indica rice or japonica rice.

[0081] In some embodiments, the gene editing is performed using one or more sequence-specific nucleases selected from the following: CRISPR / Cas9, CRISPR / Cpf1, CRISPR / Cas12a, TALEN, a wide range of nucleases, and ZFN. Preferably, the gene editing is performed using CRISPR / Cas9.

[0082] In some embodiments, the CRISPR / Cas9 comprises Cas9, wherein the Cas9 comprises the nucleotide sequence shown in SEQ ID NO: 9 or an active variant sequence having at least about 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity and encoding a protein with the same function.

[0083] In some implementations, the CRISPR / Cas9 contains a guide RNA (sgRNA) that targets the OsD-h gene.

[0084] In some implementations, the CRISPR / Cas9 contains a guide RNA (sgRNA) that targets the LOC_Os01g10460 gene.

[0085] In some specific implementations, the sgRNA targets the nucleotide sequence shown in SEQ ID NO:5 or SEQ ID NO:6.

[0086] In some specific embodiments, the sgRNA comprises the nucleotide sequence shown in SEQ ID NO:7 or SEQ ID NO:8 or an active variant sequence that retains its function and has at least about 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with it.

[0087] In some implementations, the modification results in deletion, insertion, substitution, or a combination of the above in the OsD-h gene.

[0088] In some implementations, the modification results in a deletion, insertion, substitution, or a combination thereof in the LOC_Os01g10460 gene.

[0089] In some specific implementations, the modification results in loss of function of the OsD-h gene.

[0090] In some specific implementations, the modification results in the loss of function of the LOC_Os01g10460 gene.

[0091] In a fifth aspect, the present invention provides the use of rice created by the method described in the fourth aspect for breeding.

[0092] In a sixth aspect, the present invention provides the use of rice created by the method described in the fourth aspect for improving germplasm resources.

[0093] In a seventh aspect, the present invention provides a product made from rice seeds obtained by the method described in the fourth aspect, which is selected from one or more food, feed, or industrial raw materials.

[0094] In an eighth aspect, the present invention provides an sgRNA capable of targeting the rice OsD-h gene and the LOC_Os01g10460 gene, which comprises or consists of the nucleotide sequence shown in SEQ ID NO:7 or SEQ ID NO:8.

[0095] In a ninth aspect, the present invention provides a CRISPR / Cas9 editing vector capable of targeting the rice OsD-h gene and LOC_Os01g10460, comprising a first expression cassette expressing Cas9 and a second expression cassette expressing sgRNA, wherein the Cas9 comprises the nucleotide sequence shown in SEQ ID NO: 9 or an active variant sequence having at least about 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity and encoding a protein with the same function, and the sgRNA comprises SEQ ID NO: 7 or SEQ ID NO: 9. The nucleotide sequence shown in NO:8 or an active variant sequence that retains its function and has at least about 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity with it.

[0096] In a tenth aspect, the present invention provides a method for creating new long-grained rice germplasm, comprising introducing the OsD-h gene and LOC_Os01g10460 into rice using the CRISPR / Cas9 editing vector described in the ninth aspect.

[0097] In some embodiments, the OsD-h gene comprises or consists of the following sequences: the nucleotide sequence shown in SEQ ID NO:3 or an active variant sequence having at least 90%, 95%, 99% or higher sequence identity with it and encoding a protein with the same function; or a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:1 or an active variant sequence having at least 90%, 95%, 99% or higher sequence identity with it and retaining its function.

[0098] In some embodiments, the LOC_Os01g10460 gene comprises or consists of the following sequences: the nucleotide sequence shown in SEQ ID NO:4 or an active variant sequence having at least 90%, 95%, 99% or higher sequence identity with it and encoding a protein with the same function; or a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:2 or an active variant sequence having at least 90%, 95%, 99% or higher sequence identity with it and retaining its function.

[0099] In a preferred embodiment, the rice is a variety with other good traits but whose grain shape still needs improvement, such as indica or japonica rice. In a preferred embodiment, the rice is indica rice X12.

[0100] In this article, the words “including,” “contains,” and “comprising” mean “including but not limited to,” and are not intended to exclude other parts, additives, components, or steps.

[0101] It should be understood that the features, characteristics, components, or steps described in a particular aspect, embodiment, or example of the invention may be applied to any other aspect, embodiment, or example described herein, unless there is any contradiction.

[0102] The following embodiments are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention.

[0103] Unless otherwise specified, the chemical reagents used in the examples are all commercially available conventional reagents, and the technical means used in the examples are conventional means well known to those skilled in the art.

[0104] The rice variety used in the following examples is indica rice X12, provided by China Seed Group Co., Ltd.

[0105] Example 1: Construction of CRISPR / Cas9 editing vector

[0106] 1. Sequence analysis and gene editing target design of rice OsD-h and LOC_Os01g10460 genes.

[0107] The sequence of the rice OsD-h gene is shown in SEQ ID NO: 3, and the sequence of the rice LOC_Os01g10460 gene is shown in SEQ ID NO: 4 (the overlapping regions of the two genes are shown in...). Figure 1 Sequence analysis showed that the OsD-h gene contains one exon, and the LOC_Os01g10460 gene contains one exon. The target sequence set in this embodiment is located at bases 253-272 (AGCTTGAACGCCGGCTTCTT (SEQ ID NO: 5)) and bases 188-207 (CGGCGGCGGCGGGGAGCAGC (SEQ ID NO: 6)) of the LOC_Os01g10460 gene in the indica rice X12 material. Figure 1 As shown.

[0108] 2. Construction of CRISPR / Cas9 editing vector

[0109] The gene editing technology used in this embodiment is the third-generation gene editing technology CRISPR / Cas9. The vector used was designed according to the method of Liu et al. (Hao Liu, Yuduan Ding, Yanqing Zhou, Wenqi Jin, Kabin Xie*, Ling-LingChen*. CRISPR-P 2.0: an improved CRISPR / Cas9 tool for genome editing in plants. Mol Plant, 2017, 10(3):530-532). The guide RNA (sgRNA) (sgRNA sequence SEQ ID NO:7 or SEQ ID NO:8, sgRNA is a whole molecule composed of guide RNA (gRNA) and backbone RNA (gRNA scaffold) nucleotide sequences linked together) was designed using the CRISPR-P2.0 online tool (http: / / crispr.hzau.edu.cn / CRISPR2 / ). This plant expression vector contains Cas9 (Cas9 sequence SEQ ID NO:8) driven by the sugarcane Ubi4 promoter (i.e., sugarcane ubiquitin 4 promoter). The CRISPR / Cas9 editing vector contains two sgRNA expression cassettes (SEQ ID NO: 9) and a rice U3 promoter-driven sgRNA expression cassette (SEQ ID NO: 8). A map of the constructed CRISPR / Cas9 editing vector is shown below. Figure 2 .

[0110] Example 2: Genetic transformation of indica rice X12

[0111] The editing vector constructed in Example 1 was transformed into Agrobacterium strain EHA105 (a gift from Huazhong Agricultural University) and sequenced for identification. Embryogenic callus was induced from indica rice X12 seeds and co-incubated with Agrobacterium EHA105 containing the above-mentioned editing vector. Genetic transformation was completed through a series of steps including screening and regeneration. The Agrobacterium infection, screening, and differentiation process of rice callus was based on the literature reported by Nishimura et al. (A protocol for Agrobacterium-mediated transformation in rice. Nature protocols, 2006, 6: 2796-2802). The specific process includes: after co-culturing rice callus with Agrobacterium for 3 days, soaking the callus in ddH2O containing 250 mg / L Carbenicillin for 30 min to remove excess Agrobacterium, and then screening it three times on a selection medium containing 250 mg / L Carbenicillin. Then, the resistant callus is transferred to a regeneration medium for culture. After the seedlings differentiate into 2-3 cm seedlings, they are transferred to a rooting medium for further culture for 2 weeks.

[0112] Example 3: Screening and identification of T0 generation OsD-h gene and LOC_Os01g10460 gene-edited rice

[0113] The regenerated plants from Example 2 were sent to a greenhouse for cultivation. Leaves from the regenerated T0 generation seedlings were taken, and plant genomic DNA was extracted using the CTAB method as a template. DNA samples were then tested for positivity using quantitative real-time PCR. The quantitative real-time PCR method selected the screening marker gene CP4 as the target gene and the rice ACTIN1 gene as the internal reference gene. Amplification and fluorescence detection were performed on a quantitative real-time PCR instrument. Plants with positive gene editing were selected based on the RQ value (CP4 gene RQ value > 0.1). The primer sequences used for amplifying the screening marker gene CP4 were csp356: CAGCACAGGTTAAGTCTG (SEQ ID NO: 10) and csp357: GTCTGTCTCAACGGTAAG (SEQ ID NO: 11); the primer sequences used for amplifying the ACTIN1 gene were csp106: TGCTATGTACGTCGCCATCCAG (SEQ ID NO: 12) and csp107: AATGAGTAACCACGCTCCGTCA (SEQ ID NO: 13).

[0114] PCR amplification was performed using target site-specific primers for the OsD-h and LOC_Os01g10460 genes (csp6305: 5'-TCACTGCCGACCAGGAGACT-3' (SEQ ID NO: 14); reverse primer csp6306: 5'-CAGGTGGTCCAGATCCTCAC-3' (SEQ ID NO: 15)) and Q5 superfidelity DNA polymerase. After the reaction, agarose gel electrophoresis was used to determine the success of the PCR amplification. Capillary electrophoresis was then performed using an ABI 3730XL sequencer, and the base length of the amplified fragments was analyzed using software. The results showed that a large deletion occurred in the overlapping region of the OsD-h and LOC_Os01g10460 genes in 39 out of 164 T0 generation rice plants, with a mutation rate of 23.7%. This result indicates targeted editing, i.e., simultaneous editing of both the OsD-h and LOC_Os01g10460 genes. Furthermore, in all the edited lines, both copies of the OsD-h gene were successfully edited. These data demonstrate that the editing vector of Example 1 can efficiently edit the OsD-h gene.

[0115] Example 4: Screening and identification of T1 generation homozygous non-transgenic rice with OsD-h gene and LOC_Os01g10460 gene editing

[0116] The positive rice lines identified in Example 3 were transplanted into a greenhouse for planting, and their self-pollinated T1 generation seeds were collected. Seventeen T1 generation seeds (300 seeds) with large deletions in the editing results were selected, germinated, and raised as seedlings. DNA was extracted from the seedlings for transgenic component detection and PCR detection of the editing sites. Lines containing transgenic components, without editing, or with heterozygous editing sites were removed. Lines without transgenic components and homozygous editing sites were retained. The editing mainly involved two types of large deletions. One line from each editing type was selected and named 480AH012a and 480AH013a, respectively. For the transgenic component detection method, please refer to the "GMO Detection Procedure for Gene-Edited Progeny Materials," which is based on the requirements of the Chinese National Standards Ministry of Agriculture Announcement No. 953-6-2007 GB / T 19495—2004 Transgenic Product Detection Standard. To confirm the editing status of the OsD-h and LOC_Os01g10460 genes in the 480AH012a and 480AH013a edited lines, PCR amplification and sequencing were performed on the target site regions. The results showed that 480AH012a had a 65 bp deletion, and 480AH013a had a 74 nucleotide deletion. Additionally, there were two insertions totaling 7 bp. Figure 1 The amino acid sequences of the proteins encoded by the mutated OsD-h and LOC_Os01g10460 genes are as follows: Figure 3 and Figure 4As shown, the protein sequences encoded by the OsD-h gene and the LOC_Os01g10460 gene of strain 480AH012a are shown in SEQ ID NO.16 and SEQ ID NO.17, respectively, and the protein sequences encoded by the OsD-h gene and the LOC_Os01g10460 gene of strain 480AH013a are shown in SEQ ID NO.18 and SEQ ID NO.19, respectively.

[0117] Example 5: Grain phenotypic identification of edited strains

[0118] Phenotypic photographs were taken of homozygous edited lines of generation T2 of 480AH012a and 480AH013a and control seeds (wild type, WT). Figure 5 As can be seen from the figure, in terms of grain length, both the edited material and the control are significantly larger than the control in both paddy rice and grain width. Overall, the grains of the edited material are significantly larger than those of the control. The length and width of the brown rice grains were measured using a near-infrared spectroscopy instrument, and the length-to-width ratio was calculated (Table 1). The results show that the grain length and length-to-width ratio of the edited material are significantly increased compared to the wild-type control (statistical analysis showed a significant difference).

[0119] Table 1. Length, width, and length-to-width ratio of brown rice grains from OsD-h gene-edited lines and LOC_Os01g10460 gene-edited lines compared to wild-type lines (n>20).

[0120] WT 6.848 1.96 3.507 480AH012a 7.585 2.072 3.669 480AH013a 7.685 2.042 3.777

[0121] Due to the significant increase in grain size, the thousand-grain weight of the rice used in the editing process also increased significantly (Table 2).

[0122] Table 2. Thousand-grain weight of rice from OsD-h gene-edited lines and wild-type lines with LOC_Os01g10460 gene editing.

[0123] WT 23.28±0.56 480AH012a 28.2±0.72** 480AH013a 27.8±0.68**

[0124] Note: 3 replicates, **P < 0.01.

[0125] The results above demonstrate that this invention successfully obtained mutants of the OsD-h and LOC_Os01g10460 genes using CRISPR / Cas9 gene editing technology. Compared to TALEN and ZFN technologies, CRISPR / Cas9 gene editing is simpler, more convenient, and less costly, and can be performed in most laboratories. It is a biotechnological breeding method for rapidly obtaining rice varieties or germplasm resources with increased grain size and growth.

[0126] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention. sequence list <110> China Seed Group Co., Ltd. <120> Methods for creating new long-grained rice germplasm <130> KHP211112824.2 <160> 19 <170> SIPOSequenceListing 1.0 <210> 1 <211> 212 <212> PRT <213> Artificial Sequence <400> 1 Met Ala Thr Thr Ser Thr His Ala Pro Pro Pro His Ser Pro Leu Pro 1 5 10 15 Leu Pro Ala Ala Ala Ala Gly Asp Pro Ser Asn Pro Phe Pro Thr Thr 20 25 30 Phe Val Gln Ala Asp Thr Thr Ser Phe Lys Gln Val Val Gln Ile Leu 35 40 45 Thr Gly Thr Pro Glu Thr Ala Ala Ala Ala Ala Ala Gly Gly Ala Ala 50 55 60 Ala Ala Ala Pro Pro Pro Ala Ala Ala Lys Pro Ala Pro Ala Pro Pro 65 70 75 80 Gly Pro Lys Lys Pro Ala Phe Lys Leu Tyr Glu Arg Arg Ser Ser Met 85 90 95 Lys Ser Leu Lys Met Leu Cys Pro Leu Leu Pro Ala Ala Ala Ala Phe 100 105 110 Ala Ala Gly Gly Gly Gly Gly Phe Ser Pro Ser Pro Arg Gly Phe Ser 115 120 125 Pro Arg Gly Gly Gly Met Glu Val Leu Ser Pro Ser Met Leu Asp Phe 130 135 140 Pro Ser Leu Ala Leu Gly Ser Pro Val Thr Pro Leu Pro Pro Leu Pro 145 150 155 160 Gly Ser Asp Glu Ala Ala Ala Ala Glu Asp Arg Ala Ile Ala Glu Lys 165 170 175 Gly Phe Tyr Leu His Pro Ser Pro Arg Gly Asn Ala Gly Ala Ala Gly 180 185 190 Glu Leu Gln Pro Pro Pro Arg Leu Leu Pro Leu Phe Pro Leu Gln Ser 195 200 205 Pro Gly Arg Gln 210 <210> 2 <211> 255 <212> PRT <213> Artificial Sequence <400> 2 Met Ala Arg Ser Ser Ala Ala Ala Ala Ser Ser Asp Pro Gly Ser Gly 1 5 10 15 Gly Ser Gly Val Thr Gly Leu Pro Ser Ala Ser Asp Gly Lys Ser Ser 20 25 30 Met Leu Gly Asp Ser Thr Ser Ile Pro Pro Pro Arg Gly Glu Asn Pro 35 40 45 Arg Gly Glu Gly Glu Asn Pro Pro Pro Pro Pro Ala Ala Lys Ala Ala 50 55 60 Ala Ala Gly Ser Ser Gly Gln Ser Ile Leu Arg Leu Phe Met Leu Leu 65 70 75 80 Arg Arg Ser Tyr Ser Leu Asn Ala Gly Phe Phe Gly Pro Gly Gly Ala 85 90 95 Gly Ala Gly Phe Ala Ala Ala Gly Gly Gly Ala Ala Ala Ala Ala Pro 100 105 110 Pro Ala Ala Ala Ala Ala Ala Val Ser Gly Val Pro Val Arg Ile Trp 115 120 125 Thr Thr Cys Leu Asn Asp Val Val Ser Ala Cys Thr Asn Val Val Gly 130 135 140 Asn Gly Leu Glu Gly Ser Pro Ala Ala Ala Ala Gly Ser Gly Ser Gly 145 150 155 160 Glu Cys Gly Gly Gly Ala Trp Val Glu Val Val Ala Met Ile Lys Met 165 170 175 Ser Pro Leu Ala Arg Glu Arg Glu Ser Glu Gly Arg Ile Glu Glu Arg 180 185 190 Arg Val Arg Gly Gly Phe Ile Gly Leu Phe Gly Arg Asn Ser Glu Asp 195 200 205 Gln Phe Leu Leu Cys Trp Met Thr Lys Gln Phe Phe Arg Lys Ile Pro 210 215 220 Lys Asp Thr Val Val Ser Gln Ala Gly Ala Ile Phe Lys Ala Leu Cys 225 230 235 240 Cys Phe Arg Lys Gly Thr Ile Gly Lys Ala Glu Lys Ser Arg Thr 245 250 255 <210> 3 <211> 639 <212> DNA <213> Artificial Sequence <400> 3 atggccacca cctccaccca cgcgccgccg ccgcactcgc cgctgccgct gccggcggcg 60 gccgccggcg acccttccaa cccgttcccg accacgttcg tgcaggcgga caccacgtcg 120 ttcaagcagg tggtccagat cctcaccggc accccggaga ccgcggccgc cgccgcggcg 180 ggcggcgcag ccgccgccgc gccgcccccg gcggcggcga agcccgcgcc cgcgccgccg 240 gggccgaaga agccggcgtt caagctgtac gagcggcgga gcagcatgaa gagcctcaag 300 atgctctgcc cgctgctccc cgccgccgcc gccttcgccg cgggcggagg aggggggttc 360 tcgccctcgc cgcgggggtt ctcgccgcgc ggcggcggga tggaggtgct gtccccgagc 420 atgctggact tcccgtcgct ggcgctgggc agccccgtga cgccgctccc gccgctgccc 480 gggtccgacg aggccgccgc ggccgaggac cgcgccatcg ccgagaaggg gttctacctc 540 cacccttccc ctcgcggcaa tgccggcgcc gccggcgagc tccagccgcc tcccaggctc 600 ctccccctct tccccctcca gtctcctggt cggcagtga 639 <210> 4 <211> 768 <212> DNA <213> Artificial Sequence <400> 4 atggcgcggt cctcggccgc ggcggcctcg tcggacccgg gcagcggcgg gagcggcgtc 60 acggggctgc ccagcgccag cgacgggaag tccagcatgc tcggggacag cacctccatc 120 ccgccgccgc gcggcgagaa cccccgcggc gagggcgaga acccccctcc tccgcccgcg 180 gcgaaggcgg cggcggcggg gagcagcggg cagagcatct tgaggctctt catgctgctc 240 cgccgctcgt acagcttgaa cgccggcttc ttcggccccg gcggcgcggg cgcgggcttc 300 gccgccgccg ggggcggcgc ggcggcggct gcgccgcccg ccgcggcggc ggccgcggtc 360 tccggggtgc cggtgaggat ctggaccacc tgcttgaacg acgtggtgtc cgcctgcacg 420 aacgtggtcg ggaacgggtt ggaagggtcg ccggcggccg ccgccggcag cggcagcggc 480 gagtgcggcg gcggcgcgtg ggtggaggtg gtggccatga taaaaatgtc gcctttggca 540 agggagagag agagtgaggg gaggatagag gagagaagag tgaggggggg ttttattggg 600 ctttttggaa ggaactcaga agatcagttc ttgttgtgct ggatgaccaa acagtttttt 660 cgcaaaatcc caaaagatac agttgtcagc caagctgggg cgattttcaa agcattgtgt 720 tgttttagaa aaggtacgat cggtaaggcc gagaagtcaa gaacttga 768 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 agcttgaacg ccggcttctt 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <400> 6 cggcggcggc ggggagcagc 20 <210> 7 <211> 97 <212> DNA <213> Artificial Sequence <400> 7 agcttgaacg ccggcttctt gttttagagc tagaaatagc aagttaaaat aaggctagtc 60 cgttatcaac ttgaaaaagt ggcaccgagt cggtgct 97 <210> 8 <211> 97 <212> DNA <213> Artificial Sequence <400> 8 cggcggcggc ggggagcagc gttttagagc tagaaatagc aagttaaaat aaggctagtc 60 cgttatcaac ttgaaaaagt ggcaccgagt cggtgct 97 <210> 9 <211> 4125 <212> DNA <213> Artificial Sequence <400> 9 atgccgaaga agcgccgccg cgtggacaag aagtactcca tcggcctcga catcggcacc 60 aactccgtgg gctgggccgt gatcaccgac gagtacaagg tgccgtccaa gaagttcaag 120 gtgctcggca acaccgaccg ccactccatc aagaagaacc tcatcggcgc cctcctcttc 180 gactccggcg agaccgccga ggccacccgc ctcaagcgca ccgcccgccg ccgctacacc 240 cgccgcaaga accgcatctg ctacctccag gagatcttct ccaacgagat ggccaaggtg 300 gacgactcct tcttccaccg cctcgaggag tccttcctcg tggaggagga caagaagcac 360 gagcgccacc cgatcttcgg caacatcgtg gacgaggtgg cctaccacga gaagtacccg 420 accatctacc acctccgcaa gaagctcgtg gactccaccg acaaggccga cctccgcctc 480 atctacctcg ccctcgccca catgatcaag ttccgcggcc acttcctcat cgagggcgac 540 ctcaacccgg acaactccga cgtggacaag ctcttcatcc agctcgtgca gacctacaac 600 cagctcttcg aggagaaccc gatcaacgcc tccggcgtgg acgccaaggc catcctctcc 660 gcccgcctct ccaagtcccg ccgcctcgag aacctcatcg cccagctccc gggcgagaag 720 aagaacggcc tcttcggcaa cctcatcgcc ctctccctcg gcctcacccc gaacttcaag 780 tccaacttcg acctcgccga ggacgccaag ctccagctct ccaaggacac ctacgacgac 840 gacctcgaca acctcctcgc ccagatcggc gaccagtacg ccgacctctt cctcgccgcc 900 aagaacctct ccgacgccat cctcctctcc gacatcctcc gcgtgaacac cgagatcacc 960 aaggccccgc tctccgcctc catgatcaag cgctacgacg agcaccacca ggacctcacc 1020 ctcctcaagg ccctcgtgcg ccagcagctc ccggagaagt acaaggagat cttcttcgac 1080 cagtccaaga acggctacgc cggctacatc gacggcggcg cctcccagga ggagttctac 1140 aagttcatca agccgatcct cgagaagatg gacggcaccg aggagctcct cgtgaagctc 1200 aaccgcgagg acctcctccg caagcagcgc accttcgaca acggctccat cccgcaccag 1260 atccacctcg gcgagctcca cgccatcctc cgccgccagg aggacttcta cccgttcctc 1320 aaggacaacc gcgagaagat cgagaagatc ctcaccttcc gcatcccgta ctacgtgggc 1380 ccgctcgccc gcggcaactc ccgcttcgcc tggatgaccc gcaagtccga ggagaccatc 1440 accccgtgga acttcgagga ggtggtggac aagggcgcct ccgcccagtc cttcatcgag 1500 cgcatgacca acttcgacaa gaacctcccg aacgagaagg tgctcccgaa gcactccctc 1560 ctctacgagt acttcaccgt gtacaacgag ctcaccaagg tgaagtacgt gaccgagggc 1620 atgcgcaagc cggccttcct ctccggcgag cagaagagg ccatcgtgga cctccttctc 1680 aagaccaacc gcaagtgac cgtgaagcag ctcaggagg actacttcha gagatcgag 1740 tgcttcgact ccgtggagat ctccggcgtg gaggaccgct tcaacgcctc cctcggcacc 1800 raccoon tcccagat catchcaggy aggacttcc raccoon raccoon tcccagat 1860 gatacctcg aggacatcgt gctcaccctc accctctcg aggaccgcga gatgatcgag 1920 gagcgcctca agacctacgc ccaccctc gacgacaagg tgatgaagca gctcaagcgc 1980 cgccgctaca ccggctgggg ccgccctcc cgcaagctca tcaacggcat ccgcgacaag 2040 cagtccggca agaccatcct cgactcctc aagtccgacg gctcgccaa ccgcaacttc 2100 atgcagctca tccacgacga ctccctcacc ttcaggagg acatccagaa ggcccaggtg 2160 tccggccagg gcgactccct cccacgagcac atcgccacc tcgccggctc cccggccactc 2220 aagaagggca tcctccagac cgtgaaggtg gtggacgagc tcgtgaggt gatggggccgc 2280 cacaagccgg agaacatcgt gatcgagatg gcccgcgaga accagaccac ccagaagggc 2340 cagaagaact cccgcgagcg catgaagcgc atcgaggagg gcatcaagga gctcggctcc cagatcctca aggagcaccc ggtggagaac acccagctcc agaacgaga gctctacctc tactacctcc agaacggccg cgacatgtac gtggaccagg agctcgacat caaccgcctc tccgactacg acgtggacca catcgtgccg cagtccttcc tcaaggacga ctccatcgac aacaaggtgc tcacccgctc cgacaagaac cgcggcaagt ccgacaacgt gccgtccgag gaggtggtga agaagatga gaactactgg cgccagctcc tcaacgccaa gctcatcacc cagcgcaagt tcgacaacct caccaaggcc gagcgcggcg gcctctccga gctcgacaag gccggcttca tcaagcgcca gctcgtggag acccgccaga tcaccaagca cgtggcccag atcctcgact cccgcatgaa caccaagtac gacgagaacg acaagctcat ccgcgaggtg aaggtgatca ccctcaagtc caagctcgtg tccgacttcc gcaaggactt ccagttctac aaggtgcgcg agatcaacaa ctaccaccac gcccacgacg cctacctcaa cgccgtggtg ggcaccgccc tcatcaagaa gtacccgaag ctcgagtccg agttcgtgta cggcgactac 3060. aaggtgtacg acgtgcgcaa gatgatcgcc aagtccgagc aggagatcgg caaggccacc 3120 gccaagtact tcttctactc caacatcatg aacttcttca agaccgagat caccctcgcc 3180 aacggcgaga tccgcaagcg cccgctcatc gagaccaacg gcgagaccgg cgagatcgtg 3240 tgggacaagg gccgcgactt cgccaccgtg cgcaaggtgc tctccatgcc gcaggtgaac 3300 atcgtgaaga agaccgaggt gcagaccggc ggcttctcca aggagtccat cctcccgaag 3360 cgcaactccg acaagctcat cgcccgcaag aaggactggg acccgaagaa gtacggcggc 3420 ttcgactccc cgaccgtggc ctactccgtg ctcgtggtgg ccaaggtgga gaagggcaag 3480 tccaagaagc tcaagtccgt gaaggagctc ctcggcatca ccatcatgga gcgctcctcc 3540 ttcgagaaga acccgatcga cttcctcgag gccaagggct acaaggaggt gaagaaggac 3600 ctcatcatca agctcccgaa gtactccctc ttcgagctcg agaacggccg caagcgcatg 3660 ctcgcctccg ccggcgagct ccagaagggc aacgagctcg ccctcccgtc caagtacgtg 3720 aacttcctct acctcgcctc ccactacgag aagctcaagg gctccccgga ggacaacgag 3780 cagaagcagc tcttcgtgga gcagcacaag cactacctcg acgagatcat cgagcagatc 3840 tccgagttct ccaagcgcgt gatcctcgcc gacgccaacc tcgacaaggt gctctccgcc 3900 tacaacaagc accgcgacaa gccgatccgc gagcaggccg agaacatcat ccacctcttc 3960 accctcacca acctcggcgc cccggccgcc ttcaagtact tcgacaccac catcgaccgc 4020 aagcgctaca cctccaccaa ggaggtgctc gacgccaccc tcatccacca gtccatcacc 4080 ggcctctacg agacccgcat cgacctctcc cagctcggcg gcgac 4125 <210> 10 <211> 18 <212> DNA <213> Artificial Sequence <400> 10 cagcacaggt taagtctg 18 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <400> 11 gtctgtctca acggtaag 18 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <400> 12 tgctatgtac gtcgccatcc ag 22 <210> 13 <211> twenty two <212> DNA <213> Artificial Sequence <400> 13 aatgagtaac cacgctccgt ca 22 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <400> 14 tcactgccga ccaggagact 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <400> 15 caggtggtcc agatcctcac 20 <210> 16 <211> 191 <212> PRT <213> Artificial Sequence <400> 16 Met Ala Thr Thr Ser Thr His Ala Pro Pro Pro His Ser Pro Leu Pro 1 5 10 15 Leu Pro Ala Ala Ala Ala Gly Asp Pro Ser Asn Pro Phe Pro Thr Thr 20 25 30 Phe Val Gln Ala Asp Thr Thr Ser Phe Lys Gln Val Val Gln Ile Leu 35 40 45 Thr Gly Thr Pro Glu Thr Ala Ala Ala Ala Ala Ala Gly Gly Ala Ala 50 55 60 Ala Ala Ala Pro Pro Pro Ala Ala Ala Lys Pro Ala Pro Ala Pro Pro 65 70 75 80 Gly Pro Lys Ala Pro Arg Arg Arg Arg Leu Arg Arg Gly Arg Arg Arg 85 90 95 Gly Val Leu Ala Leu Ala Ala Gly Val Leu Ala Ala Arg Arg Arg Asp 100 105 110 Gly Gly Ala Val Pro Glu His Ala Gly Leu Pro Val Ala Gly Ala Gly 115 120 125 Gln Pro Arg Asp Ala Ala Pro Ala Ala Ala Arg Val Arg Arg Gly Arg 130 135 140 Arg Gly Arg Gly Pro Arg His Arg Arg Glu Gly Val Leu Pro Pro Pro 145 150 155 160 Phe Pro Ser Arg Gln Cys Arg Arg Arg Arg Arg Ala Pro Ala Ala Ser 165 170 175 Gln Ala Pro Pro Pro Leu Pro Pro Pro Val Ser Trp Ser Ala Val 180 185 190 <210> 17 <211> 231 <212> PRT <213> Artificial Sequence <400> 17 Met Ala Arg Ser Ser Ala Ala Ala Ala Ser Ser Asp Pro Gly Ser Gly 1 5 10 15 Gly Ser Gly Val Thr Gly Leu Pro Ser Ala Ser Asp Gly Lys Ser Ser 20 25 30 Met Leu Gly Asp Ser Thr Ser Ile Pro Pro Pro Arg Gly Glu Asn Pro 35 40 45 Arg Gly Glu Gly Glu Asn Pro Pro Pro Pro Pro Ala Ala Lys Ala Ala 50 55 60 Ala Ala Gly Ser Leu Arg Pro Arg Arg Arg Gly Arg Gly Leu Arg Arg 65 70 75 80 Arg Arg Gly Arg Arg Gly Gly Gly Cys Ala Ala Arg Arg Gly Gly Gly 85 90 95 Arg Gly Leu Arg Gly Ala Gly Glu Asp Leu Asp His Leu Leu Glu Arg 100 105 110 Arg Gly Val Arg Leu His Glu Arg Gly Arg Glu Arg Val Gly Arg Val 115 120 125 Ala Gly Gly Arg Arg Arg Gln Arg Gln Arg Arg Val Arg Arg Arg Arg 130 135 140 Val Gly Gly Gly Gly Gly His Asp Lys Asn Val Ala Phe Gly Lys Gly 145 150 155 160 Glu Arg Glu Gly Glu Asp Arg Gly Glu Lys Ser Glu Gly Gly Phe Tyr 165 170 175 Trp Ala Phe Trp Lys Glu Leu Arg Arg Ser Val Leu Val Val Leu Asp 180 185 190 Asp Gln Thr Val Phe Ser Gln Asn Pro Lys Arg Tyr Ser Cys Gln Pro 195 200 205 Ser Trp Gly Asp Phe Gln Ser Ile Val Leu Phe Lys Arg Tyr Asp Arg 210 215 220 Gly Arg Glu Val Lys Asn Leu 225 230 <210> 18 <211> 213 <212> PRT <213> Artificial Sequence <400> 18 Met Ala Thr Thr Ser Thr His Ala Pro Pro Pro His Ser Pro Leu Pro 1 5 10 15 Leu Pro Ala Ala Ala Ala Gly Asp Pro Ser Asn Pro Phe Pro Thr Thr 20 25 30 Phe Val Gln Ala Asp Thr Thr Ser Phe Lys Gln Val Val Gln Ile Leu 35 40 45 Thr Gly Thr Pro Glu Thr Ala Ala Ala Ala Ala Gly Gly Ala Ala 50 55 60 Ala Ala Ala Pro Pro Pro Ala Ala Ala Lys Pro Ala Pro Ala Pro Pro 65 70 75 80 Gly Pro Lys Phe Ala Ala Gly Val Gln Ala Val Arg Ala Ala Glu Gln 85 90 95 His Glu Glu Pro Gln Asp Ala Leu Pro Ala Ser Ser Pro Pro Pro Pro 100 105 110 Pro Ser Pro Arg Ala Glu Glu Gly Gly Ser Arg Pro Arg Arg Gly Gly 115 120 125 Ser Arg Arg Ala Ala Ala Gly Trp Arg Cys Cys Pro Arg Ala Cys Trp 130 135 140 Thr Ser Arg Arg Trp Arg Trp Ala Ala Pro Arg Arg Ser Arg Arg Cys 145 150 155 160 Pro Gly Pro Thr Arg Pro Pro Arg Pro Arg Thr Ala Pro Ser Pro Arg 165 170 175 Arg Gly Ser Thr Ser Thr Leu Pro Leu Ala Ala Met Pro Ala Pro Pro 180 185 190 Ala Ser Ser Ser Arg Leu Pro Gly Ser Ser Pro Ser Ser Pro Ser Ser 195 200 205 Leu Leu Val Gly Ser 210 <210> 19 <211> 223 <212> PRT <213> Artificial Sequence <400> 19 Met Ala Arg Ser Ser Ala Ala Ala Ala Ser Ser Asp Pro Gly Ser Gly 1 5 10 15 Gly Ser Gly Val Thr Gly Leu Pro Ser Ala Ser Asp Gly Lys Ser Ser 20 25 30 Met Leu Gly Asp Ser Thr Ser Ile Pro Pro Pro Arg Gly Glu Asn Pro 35 40 45 Arg Gly Glu Gly Glu Asn Pro Pro Pro Pro Pro Ala Ala Lys Ala Ala 50 55 60 Ala Ala Gly Ser Arg Ala Glu His Leu Glu Ala Leu His Ala Ala Pro 65 70 75 80 Pro Leu Val Gln Leu Glu Arg Arg Arg Arg Arg Arg Pro Arg Ser Pro 85 90 95 Gly Cys Arg Gly Ser Gly Pro Pro Ala Thr Thr Trp Cys Pro Pro Ala 100 105 110 Arg Thr Trp Ser Gly Thr Gly Trp Lys Gly Arg Arg Arg Pro Pro Pro 115 120 125 Ala Ala Ala Ala Ala Ser Ala Ala Ala Ala Arg Gly Trp Arg Trp Trp 130 135 140 Pro Lys Cys Arg Leu Trp Gln Gly Arg Glu Arg Val Arg Gly Gly Arg 145 150 155 160 Arg Glu Glu Gly Gly Val Leu Leu Gly Phe Leu Glu Gly Thr Gln Lys 165 170 175 Ile Ser Ser Cys Cys Ala Gly Pro Asn Ser Phe Phe Ala Lys Ser Gln 180 185 190 Lys Ile Gln Leu Ser Ala Lys Leu Gly Arg Phe Ser Lys His Cys Val 195 200 205 Val Leu Glu Lys Val Arg Ser Val Arg Pro Arg Ser Gln Glu Leu 210 215 220

Claims

1. Application of repressor factors of rice OsD-h and LOC_Os01g10460 genes in regulating rice grain size or thousand-grain weight; In this application, the grain length or thousand-grain weight of rice is increased by inhibiting the expression of the rice OsD-h and LOC_Os01g10460 genes; the inhibitory factors are a first sgRNA and a second sgRNA, the nucleotide sequence of the first sgRNA is shown in SEQ ID NO:7, and the nucleotide sequence of the second sgRNA is shown in SEQ ID NO:

8. The amino acid sequence of the protein encoded by the OsD-h gene is shown in SEQ ID NO:1, and the amino acid sequence of the protein encoded by the LOC_Os01g10460 gene is shown in SEQ ID NO:

2.

2. Application of repressor factors of rice OsD-h and LOC_Os01g10460 genes in rice breeding; In this application, the grain length or thousand-grain weight of rice is increased by inhibiting the expression of the rice OsD-h and LOC_Os01g10460 genes; the inhibitory factors are a first sgRNA and a second sgRNA, the nucleotide sequence of the first sgRNA is shown in SEQ ID NO:7, and the nucleotide sequence of the second sgRNA is shown in SEQ ID NO:

8. The amino acid sequence of the protein encoded by the OsD-h gene is shown in SEQ ID NO:1, and the amino acid sequence of the protein encoded by the LOC_Os01g10460 gene is shown in SEQ ID NO:

2.

3. Application of repressor factors of rice OsD-h and LOC_Os01g10460 genes in rice germplasm resource improvement; In this application, the grain length or thousand-grain weight of rice is increased by inhibiting the expression of the rice OsD-h and LOC_Os01g10460 genes; the inhibitory factors are a first sgRNA and a second sgRNA, the nucleotide sequence of the first sgRNA is shown in SEQ ID NO:7, and the nucleotide sequence of the second sgRNA is shown in SEQ ID NO:

8. The amino acid sequence of the protein encoded by the OsD-h gene is shown in SEQ ID NO:1, and the amino acid sequence of the protein encoded by the LOC_Os01g10460 gene is shown in SEQ ID NO:

2.

4. The application according to any one of claims 1 to 3, characterized in that, The nucleotide sequence of the OsD-h gene is shown in SEQ ID NO:3, and the nucleotide sequence of the LOC_Os01g10460 gene is shown in SEQ ID NO:

4.

5. A method for creating new long-grained rice germplasm, characterized in that, include: It causes the loss of biological function of the rice OsD-h and LOC_Os01g10460 genes; The amino acid sequence of the protein encoded by the OsD-h gene is shown in SEQ ID NO:1; The amino acid sequence of the protein encoded by the LOC_Os01g10460 gene is shown in SEQ ID NO:2; The inhibitory factors used to induce the loss of biological function of the rice OsD-h and LOC_Os01g10460 genes are a first sgRNA and a second sgRNA, the nucleotide sequence of the first sgRNA being shown in SEQ ID NO:7 and the nucleotide sequence of the second sgRNA being shown in SEQ ID NO:

8.

6. The method for creating new long-grained rice germplasm according to claim 5, characterized in that, The loss of biological function of the rice OsD-h and LOC_Os01g10460 genes is achieved through gene editing; the gene editing is performed by one or more sequence-specific nucleases selected from the following: CRISPR / Cas9, CRISPR / Cpf1, CRISPR / Cas12a.

7. The method according to claim 6, characterized in that, The gene editing was performed using the CRISPR / Cas9 gene editing vector.

8. The method according to claim 7, characterized in that, The CRISPR / Cas9 gene editing vector contains a first sgRNA and a second sgRNA, which target the nucleotide sequences shown in SEQ ID NO:5-6, respectively.

9. The application of rice created by the method for creating new long-grained rice germplasm according to any one of claims 5 to 8 in rice breeding or germplasm resource improvement.

10. An sgRNA targeting the rice OsD-h and LOC_Os01g10460 genes, characterized in that, It includes a first sgRNA and a second sgRNA, the nucleotide sequence of the first sgRNA being shown in SEQ ID NO:7 and the nucleotide sequence of the second sgRNA being shown in SEQ ID NO:

8.

11. A CRISPR / Cas9 gene editing vector targeting the rice OsD-h and LOC_Os01g10460 genes, characterized in that, The vector comprises a first expression cassette and a second expression cassette, wherein the first expression cassette expresses Cas9 and the second expression cassette expresses sgRNA. The nucleotide sequence of the sgRNA is shown in SEQ ID NO:7 and SEQ ID NO:

8.

12. The gene editing vector according to claim 11, characterized in that, The nucleotide sequence of the gene encoding Cas9 is shown in SEQ ID NO:9.

Images