Construction of ascc3 polypeptide and application of anti-hepatoma activity thereof

Abstract

The application discloses a kind of ASCC3 polypeptide construction and its inhibition Wnt / β-catenin pathway and the activity of liver cancer cell proliferation;Wherein, the sequence of a kind of ASCC3 polypeptide construction, it includes, its nucleotide sequence is as SEQ ID NO:2, and its coding protein sequence SEQ ID NO:1;A kind of ASCC3 polypeptide construction method, it includes, artificial synthesis and ASCC3 polypeptide coding sequence are connected under the action of T4 ligase with pCMV-Flag eukaryotic expression vector, obtain recombination plasmid;The recombination plasmid is transfected liver cancer cell.The application uses multiple functional means to analyze its antagonism to Wnt / β-catenin pathway and cancer cell proliferation in liver cancer.In cell biology level, it is proved that this ASCC3 polypeptide has the potential of antagonizing Wnt / β-catenin pathway and inhibiting liver cancer cell proliferation.

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, specifically to the construction of an ASCC3 polypeptide and its activity against primary liver cancer, and more specifically to the identification of an ASCC3 antagonistic polypeptide and its application in the targeted therapy of primary liver cancer. Background Technology

[0002] Hepatocellular carcinoma (HCC) is a prevalent malignant tumor worldwide. Current clinical treatment for HCC primarily relies on traditional surgery combined with radiotherapy and chemotherapy. Once recurrence occurs after treatment, the prognosis is typically significantly poor due to a lack of other treatment options. Therefore, developing new treatment methods for HCC is crucial for improving the prognosis and quality of life for HCC patients. The progression and metastasis of HCC involve complex molecular regulatory mechanisms. Among these, the Wnt / β-catenin pathway, as an important oncogenic signaling pathway, plays a pivotal role in the development and progression of HCC. Numerous studies have shown a close link between overactivation of the Wnt / β-catenin pathway and HCC growth, stem cell-like characteristics, metastasis, and drug resistance. Therefore, targeting the Wnt / β-catenin pathway is of paramount value for targeted therapy of HCC.

[0003] The promoting effect of the Wnt / β-catenin pathway on hepatocellular carcinoma (HCC) is closely related to β-catenin-mediated transcription and gene expression. After binding to the promoter regions of downstream oncogenes, β-catenin recruits various epigenetic-related proteins to open the structures of these gene regions, promoting the binding of proteins such as RNA polymerase and the transcription of messenger RNA (mRNA). Therefore, targeting key transcriptional regulatory proteins of β-catenin can serve as an alternative targeting measure to inhibit β-catenin-mediated transcription. Our recent research has revealed that ASCC3 is an important β-catenin-induced transcriptional activation gene in HCC. ASCC3 possesses DNA helicase activity, which can recruit β-catenin, bind to DNA, and induce DNA unwinding and loosening, promoting gene transcription. Based on this, we invented a polypeptide that interferes with the binding of ASCC3 to β-catenin and found that this polypeptide can inhibit the binding of ASCC3 to the promoter regions of β-catenin target genes, thereby antagonizing the transcription of β-catenin target genes and inhibiting the progression of HCC. This ASCC3 polypeptide has the function of specifically inhibiting the transcriptional activity of β-catenin in tumors, and has good tumor specificity and targeting, showing broad application and development prospects in the clinical targeted therapy of liver cancer. Summary of the Invention

[0004] As one aspect of this invention, overcoming the shortcomings of existing technologies, this invention provides a sequence for constructing an ASCC3 polypeptide, the protein sequence of which is SEQ ID NO:1, and the nucleotide sequence of which is SEQ ID NO:2; a method for constructing an ASCC3 polypeptide, comprising: artificially synthesizing and ligating the ASCC3 polypeptide coding sequence with a pCMV-Flag eukaryotic expression vector under the action of T4 ligase to obtain a recombinant plasmid; and transfecting the recombinant plasmid into liver cancer cells. This invention utilizes various functional methods to analyze its antagonistic effect on the Wnt / β-catenin pathway and cancer cell proliferation in liver cancer. At the cell biology level, it has been demonstrated that this ASCC3 polypeptide has the potential to antagonize the Wnt / β-catenin pathway and inhibit the proliferation of liver cancer cells.

[0005] Specifically, it is the construction sequence of an ASCC3 polypeptide, the amino acid sequence of which is shown in SEQ ID NO:1.

[0006] Its encoding cDNA sequence is shown in SEQ ID NO:2.

[0007] Furthermore, this invention provides a method for cloning and expressing the ASCC3 polypeptide, comprising synthesizing the encoding nucleic acid sequence of the antagonistic polypeptide, digesting it with HindIII and KpnI restriction endonucleases, mixing it with the pCMV-Flag expression vector linearized with the same restriction endonucleases, adding T4 DNA ligase buffer and 1 μl of T4 DNA ligase, incubating at 25°C for 2 h to obtain the recombinant expression vector, verifying it by PCR and sequencing, and then introducing the recombinant expression vector into hepatocellular carcinoma cells using liposomes to detect the expression of the ASCC3 polypeptide and its antagonistic effect on the proliferation of hepatocellular carcinoma cells.

[0008] This invention utilizes bioengineering technology to clone the ASCC3 peptide-encoding nucleic acid sequence into the pCMV-Flag eukaryotic expression vector. The construction of the recombinant clone was identified by PCR and DNA sequencing. This eukaryotic expression plasmid was then introduced into hepatocellular carcinoma cells using liposomes. Western blotting was used to verify the expression of the ASCC3 peptide in hepatocellular carcinoma cells. Real-time quantitative PCR was used to clarify the expression of downstream target genes of β-catenin. CCK-8 and EdU nucleoside incorporation experiments were used to analyze changes in cell proliferation. This study validates at the molecular and cellular levels that the ASCC3 peptide can specifically inhibit the expression of β-catenin target genes and antagonize the proliferation of hepatocellular carcinoma cells, demonstrating a targeted antagonistic effect on the progression of hepatocellular carcinoma. Attached Figure Description

[0009] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort. Wherein:

[0010] Figure 1 PCR identification of the ASCC3 polypeptide recombinant vector;

[0011] Figure 2 The expression of ASCC3 polypeptide in liver cancer cells;

[0012] Figure 3 The ASCC3 polypeptide can inhibit the expression of β-catenin target genes;

[0013] Figure 4 ASCC3 peptide can antagonize the proliferation of liver cancer cells;

[0014] Figure 5 The ASCC3 polypeptide can inhibit nucleoside incorporation in liver cancer cells. Detailed Implementation

[0015] Figure 1 PCR identification of ASCC3 polypeptide recombinant vector

[0016] The encoding DNA sequence of the ASCC3 polypeptide was synthesized using whole-genome sequencing technology at Shanghai Ingenic Semiconductor Co., Ltd., and a restriction endonuclease reaction system was constructed: 4 μg of the synthesized ASCC3 polypeptide encoding DNA, 4 μl of 10× restriction buffer, and 1 μl of HindIII and KpnI restriction endonucleases, with sterile water added to a final volume of 40 μl. The mixture was incubated at 37°C for 4 h, and the restriction endonuclease-treated DNA fragment was purified using a PCR recovery kit. 200 ng of the DNA fragment was added to 400 ng of linearized pCMV-Flag vector, along with 4 μl of 10× ligation buffer and 1 μl of T4 DNA ligase, and ligated at room temperature for 30 min. Subsequently, 4 μl of the ligation product was transformed into 100 μl of DH5α competent bacteria, and the transformed bacteria were plated on LB agar plates resistant to Amp antibiotic and incubated overnight at 37°C. The following day, single clones were picked from LB agar plates and placed in Amp-resistant LB broth. After shaking for 12-16 hours, bacterial PCR was performed: 2 μl of 5 μM primers (5'-ACTTCAACCCGGTACAGACTC-3' and 5'-AGTCCGACAATCCTAACTGGC-3'), 1 μl of bacterial culture, 20 μl of 2*PCR mixture (Takara), and 17 μl of dH2O. The PCR cycle was: 95℃ for 5 min pre-deformation, 30 cycles (95℃ for 30 s, 55℃ for 30 s, 72℃ for 40 s), and 72℃ for 10 min. After PCR, the samples were loaded onto 2% agarose gels for electrophoresis analysis. The results showed that multiple picked bacterial clones contained the insertion of the ASCC3 polypeptide encoding nucleic acid. Figure 1 ).

[0017] Figure 2 Expression of ASCC3 peptide in liver cancer cells;

[0018] HepG2 liver cancer cells were cultured in DMEM basal medium supplemented with 10% fetal bovine serum (FBS) and 100 μg / ml double antibiotics. 1×10 6 Cells were seeded in 6-well plates and incubated overnight. The following day, recombinant ASCC3 polypeptide expression vector was transfected into liver cancer cells using lipofectamine 2000.

[0019] 1. Add 2 μg of plasmid to 100 μl of OPTI-MEM basal medium;

[0020] 2. Mix 8 μl of lipofectamine 2000 and 100 μl of opti-mem medium and incubate for 5 min;

[0021] 3. Mix the plasmid and liposome samples, pipette 6-8 times, and incubate for 15 minutes;

[0022] 4. Add the above complex evenly to the cell culture medium, mix well and continue incubation for 6 hours;

[0023] 5. After incubation for 6 hours, replace the culture medium with fresh complete culture medium and continue incubation for 30 hours;

[0024] Thirty-six hours after plasmid transfection, cell samples were collected and 200 μl of SDS loading buffer was added. The cells were boiled in a water bath for 5 min, centrifuged at 13000 g at room temperature for 10 min, and 20 μl of the sample was loaded into a 12% SDS-PAGE membrane. After electrophoresis at 120 V for 1 h, the protein samples were transferred to a PVDF membrane, blocked with TBST solution containing 5% skim milk for 1 h, and incubated overnight with 1:5000 Flag antibody. The next day, the cells were washed three times with TBST for 5 min each time, incubated for 2 h with 1:10000 HRP-labeled goat anti-mouse IgG (Zhongshan Jinqiao), and the target band was visualized using ECL chemiluminescence. The results showed that the ASCC3 peptide could be expressed at a high level in liver cancer cells. Figure 2 ).

[0025] Figure 3 ASCC3 peptide can inhibit the expression of β-catenin target genes.

[0026] In HepG2 cells transfected with empty vector and ASCC3 peptide, 1 ml of Trizol was added to lyse the cells and extract total RNA. 1 μg of total RNA was used to reverse transcribe mRNA into cDNA using the RevertAid reverse transcription kit. Subsequently, real-time quantitative PCR was performed to analyze the expression of downstream target genes of β-catenin, Axin2, c-Myc, ASCL2 and LGR5.

[0027] The primers for real-time quantitative PCR are as follows:

[0028] ASCL2-F GAGCTACTCGACTCCTCCAG ASCL2-R GCTCTCGTCGCTCTCCATTC LGR5-F AGTCTTAAAGTTCTTATGCTGC LGR5-R TAGCTGATGTGGTTAGCATC cMYC-F TCCATGAGGAGACACCG cMYC-R TTTCCACAGAAACAACATCG AXIN2-F GAGTGGACTTGTGCCGACTTCA AXIN2-R GGTGGCTGGTGCAAAGACATAG ACTB-F GCACAGAGCCTCGCCTT ACTB-R GTTGTCGACGACGAGCG

[0029] The reaction system for real-time quantitative PCR was as follows: 0.5 μl cDNA, 1 μl primer (5 μM), 3.5 μl dH2O, and 5 μl 2×SYBR PCR mix. The above system was reacted in a real-time quantitative PCR instrument for a total of 40 cycles (95℃ for 15 s, 60℃ for 30 s). After PCR, the reaction mixture was... △△ Ct assays were used to clarify the expression changes of β-catenin target genes. The results showed that the ASCC3 peptide significantly reduced the expression of β-catenin target genes. Figure 3 ).

[0030] Figure 4ASCC3 peptide can antagonize the proliferation of liver cancer cells.

[0031] HepG2 cells transfected with empty vector and ASCC3 peptide were seeded into 96-well plates at a density of 5000 cells per well. After 12 h of incubation, a CCK-8 cell proliferation assay was performed. Cells were incubated with 10 μl CCK-8 reagent and 100 μl DMEM medium for 2 h. After incubation, the absorbance peak at 450 nm was measured. CCK-8 absorbance was measured every 24 h, and cell growth curves were plotted. The results showed that ASCC3 peptide expression significantly inhibited the growth of liver cancer cells. Figure 4 ).

[0032] Figure 5 ASCC3 peptide can inhibit nucleoside incorporation in liver cancer cells.

[0033] HepG2 cells transfected with empty vector and ASCC3 peptide were seeded into 24-well plates, with 2 × 10⁶ cells per well. 4 Cells were incubated overnight, and then the medium was replaced with DMEM complete medium containing 100 µM EdU, and incubated for 4 h. After incubation, 3.7% paraformaldehyde was added to the medium to fix the cells for 30 min. The medium was then discarded, and 0.5% Triton X-100 permeabilized cells were added. EdU staining was performed using an EdU staining kit (Raybot Biotechnology). After staining, the nuclei were counterstained with 5 μg / ml DAPI. Cells were mounted with mounting medium and observed under a high-power inverted microscope. The proportion of EdU incorporation in each group was counted. The results showed that ASCC3 peptide significantly inhibited the nucleoside incorporation level in liver cancer cells, suggesting that it can inhibit the proliferation of liver cancer cells. Figure 5 ). sequence list <110> Taizhou People's Hospital <120> Construction of an ASCC3 peptide and its application in anti-hepatocellular carcinoma <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 210 <212> PRT <213> Artificial Sequence <400> 1 lynfshfnpv qtqifhtlyh tdcnvllgap tgsgktvaae laifrvfnky ptskavyiap 60 lkalvrermd dwkvrieekl gkkvieltgd vtpdmksiak adlivttpek wdgvsrswqn 120 rnyvqqvtil iideihllge ergpvleviv srtnfissht ekpvrivgls talanardla 180 dwlnikqmgl fnfrpsvrpv plevhiqgfp 210 <210> 2 <211> 630 <212> DNA <213> Artificial Sequence <400> 2 ctttataact tcagccactt caacccggta cagactcaga tattccatac actttaccat 60 accgactgca atgtcctgct tggagcaccg accgggagtg gaaaaactgt cgccgccgaa 120 ttggcgatat tccgagtctt caataaatat ccaactagta aggcggttta tattgcgccc 180 ttgaaagctc tggtacgcga aagaatggac gactggaaag tcagaatcga ggagaagctg 240 gggaagaaag tgattgagtt gactggagat gtgacgcctg acatgaaatc tatagccaag 300 gcagacctca ttgtgacaac gccagagaaa tgggacggag tttccagatc ctggcaaaat 360 agaaactatg tgcagcaagt aactatattg attatcgacg aaattcacct gcttggtgaa 420 gagagaggac ctgtcttgga agtaatagtc agcaggacca attttatttc ttcccacact 480 gaaaagccag ttaggattgt cggactgagt accgctctcg caaacgcccg agaccttgct 540 gactggctta atattaagca gatgggtctg tttaatttta ggcctagcgt ccgccccgta 600 cctctggaag tacacataca aggattcccg 630

Claims

1. An ASCC3 polypeptide, characterized in that, The amino acid sequence of the expressed polypeptide is shown in SEQ ID NO:

1.

2. The ASCC3 polypeptide according to claim 1, characterized in that, Its encoding cDNA sequence is shown in SEQ ID NO:

2.

3. A method for cloning, constructing, and expressing the ASCC3 polypeptide as described in claim 1, characterized in that, The process includes synthesizing a nucleic acid sequence encoding an antagonistic polypeptide, which is then digested with restriction endonucleases, mixed with an expression vector, and ligase buffer and ligase are added. After incubation, a recombinant expression vector is obtained. The restriction endonucleases include HindIII and KpnI. The expression vector is pCMV-Flag. The expression vector is linearized with restriction endonucleases identical to the encoding nucleic acid sequence. The ligase buffer and ligase are T4 DNA ligase buffer and T4 DNA ligase, respectively.

Images