Drug targets and applications for hair follicle stem cell loss

Abstract

Niche constriction mediated by mechanical changes sensed by the mechanically sensitive ion channel Piezo1, leads to loss of hair follicle stem cells through apoptosis. The reduced niche size leads to abnormal hair cycle-dependent apoptosis of stem cells, which can be completely rescued by simply re-expanding the three-dimensional niche space. In vivo pharmacological compound screening and live Ca 2+ Imaging shows that stem cells depend on mechanically sensitive calcium channels to sense niche size reduction. Guided by transcriptome screening, epithelial-specific knockout of mouse Piezo1 and compound activation experiments show that Piezo1 is both necessary and sufficient to mediate hair follicle stem cell survival for niche size regulation. Stretch-activated Piezo1 confers sensitivity to the regressive phase-specific death signal TNFα on other resistant stem cells. In a model of pure hair and nail ectodermal dysplasia disease, loss of epithelial Piezo1 rescues stem cell loss caused by pathological niche constriction.

Description

Background Technology

[0001] Tissue-resident stem cells occupy a three-dimensional niche space and maintain tissue homeostasis by integrating signals from the microenvironment to modulate their regenerative activity. In the context of histopathology and aging, niche physiology typically exhibits a substantial reduction in overall physical size, accompanied by the loss of stem cell populations, such as skeletal muscle atrophy in response to systemic disease, intestinal mucosal atrophy following prolonged starvation, gastric niche atrophy during infection-induced inflammation, and testicular niche atrophy during aging. Although a reduction in stem cell numbers is generally associated with overall physiological niche size, the causal relationship between niche atrophy and stem cell loss remains unclear. Hair follicle stem cells (HFSCs) reside in a niche environment called the ridge. The three-dimensional space of a telogen ridge in a resting phase is filled with the central hair shaft, the intermediate Krt6+ symbiotic layer cells, and the outermost layer of HFSCs. Reduced ridge size due to hair shaft miniaturization typically occurs during aging, androgenetic alopecia, and hereditary follicle-related diseases. Accompanying the overall reduction in ridge size is the loss of the HFSC population and regenerative activity. Similar to other tissues, it is unclear which change has a causal effect. Although mechanical force is a major physiological parameter sensed by many cell types in the body, it is unclear whether it is involved in mediating the crosstalk between niche shrinkage and stem cell loss. Summary of the Invention

[0002] In a first aspect, this disclosure provides a drug target for hair follicle stem cell loss. The drug target is a factor triggered or activated by niche atrophy.

[0003] Preferably, the loss of hair follicle stem cells is caused by abnormal stem cell death. Preferably, the abnormal stem cell death is hair cycle-dependent. Preferably, the abnormal stem cell death occurs during the regression phase or the regression-resting phase transition.

[0004] Preferably, the niche shrinkage refers to a reduction in the physical niche size or a reduction in the three-dimensional niche space. Typically, specific niche shrinkage mainly includes two aspects: a decrease in Krt6+ symbiotic layer cells and a reduction in the three-dimensional niche space. The inventors of this disclosure conducted a "removal + refilling" experiment and found that the loss of Krt6+ symbiotic layer cells is not the cause of hair cycle-dependent HFSC loss due to niche shrinkage; only restoring the physical niche size has a complete salvage effect. This experiment also ruled out many other potential hair removal-induced effects.

[0005] Preferably, the drug target is intracellular calcium. 2+ and / or intercellular Ca 2+The inventors of this disclosure discovered intracellular Ca... 2+ Chelating agents and intercellular Ca 2+ Chelating agents can significantly rescue abnormal HFSC cell apoptosis caused by niche shrinkage.

[0006] Preferably, the drug target is a mechanosensitive ion channel and / or a factor involved in the mechano-calcium signaling pathway. The inventors of this disclosure have found that mechanosensitive ion channel inhibitors significantly rescue HFSC loss induced by niche shrinkage and increase intracellular calcium in HFSCs with reduced niche size. 2+ Concentration, indicating intracellular Ca2+ mediated by mechanosensitive ion channels. 2+ It increased the involvement of stem cell loss triggered by niche shrinkage induced by apoptosis.

[0007] Preferably, the mechanosensitive ion channel is expressed in the epithelial layer. Preferably, the mechanosensitive ion channel, or the ion channel involved in the mechano-calcium signaling pathway, is the epithelial-expressed mechanosensitive ion channel Piezo1. The inventors of this disclosure have obtained genetic evidence indicating that the mechanosensitive ion channel Piezo1 expressed in HFSCs senses a reduction in niche space and mediates hair cycle-dependent apoptosis in abnormal HFSC cells. Furthermore, the inventors of this disclosure have conducted loss-of-function and gain-of-function experiments, ultimately demonstrating that epithelial-expressed Piezo1 is necessary and sufficient for HFSC survival mediating niche size regulation.

[0008] Preferably, the drug target is TNFα or a factor involved in the TNFα signaling pathway. The inventors of this disclosure have discovered that the absence of the TNF receptor almost completely blocks apoptosis in HFSCs, indicating that TNFα is essential for inducing apoptosis in HFSCs that are induced by niche shrinkage and are dependent on the hair cycle.

[0009] Preferably, TNFα or factors involved in the TNFα signaling pathway are hair cycle specific, particularly specific to the regression phase or the regression-resting phase transition. The inventors of this disclosure examined the expression patterns of TNFα at different hair cycle stages and found that TNFα mRNA was undetectable in the HF during the anagen or telogen phases, but detectable during the regression phase. This expression pattern is consistent with the hypothesized regression-specific signaling, which can interact with increased intracellular calcium. 2+ The combined effects of mechanical stretching and TNFα induce apoptosis in HFSC cells. Furthermore, the combined treatment with mechanical stretching induces cell death in a dose-dependent manner, and the effect of mechanical stretching is lost upon knockout of the mechanosensitive ion channel Piezo1 in keratinocytes.

[0010] Preferably, the drug targets for hair follicle stem cell loss include: (1) intracellular Ca2+. 2+ Intercellular Ca 2+ (1) Mechanosensitive ion channels and / or factors involved in the mechano-calcium signaling pathway, and (2) TNFα and / or factors involved in the TNFα signaling pathway. Preferably, the mechanosensitive ion channel or ion channel involved in the mechano-calcium signaling pathway is the epithelial mechanosensitive ion channel Piezo1. Preferably, the TNFα or factor involved in the TNFα signaling pathway is specific to the regression phase or the regression-resting phase transition phase.

[0011] Preferably, niche shrinkage is directly caused by or related to aging, androgenetic alopecia, and / or hereditary follicular dysplasia, wherein niche shrinkage triggers the aforementioned drug targets. Preferably, hereditary follicular dysplasia refers to ectodermal dysplasia of pure hair and nails.

[0012] Secondly, this disclosure provides a method for establishing an animal model of hair follicle stem cell loss, or a method for inducing hair follicle stem cell loss in animals, said method comprising inhibiting the function of at least one of the following substances or reducing the amount of at least one of the following substances: intracellular Ca 2+ Intercellular Ca 2+ Mechanosensitive ion channels, factors involved in the mechano-calcium signaling pathway, TNFα, and factors involved in the TNFα signaling pathway. Preferably, the model can be an animal (e.g., mouse, rat, dog, pig, or cat), tissue (e.g., skin), or cells isolated from a tissue.

[0013] Thirdly, this disclosure provides an animal model of hair follicle stem cell loss, which is induced by inhibiting the function of at least one of the following substances or reducing the amount of at least one of the following substances: intracellular Ca 2+ Intercellular Ca 2+ Mechanosensitive ion channels, factors involved in the mechano-calcium signaling pathway, TNFα, and factors involved in the TNFα signaling pathway. Preferably, the model can be an animal (e.g., mouse, rat, dog, pig, or cat), tissue (e.g., skin), or cells isolated from a tissue.

[0014] Fourthly, this disclosure provides a method for screening candidate drugs for the prevention or treatment of hair follicle stem cell loss, using the drug target or animal model.

[0015] Fifthly, this disclosure provides a method for preparing a drug for preventing or treating the loss of hair follicle stem cells, using the drug target or an animal model.

[0016] In a sixth aspect, this disclosure provides a method for diagnosing hair follicle stem cell loss, which uses the drug target or animal model.

[0017] In a seventh aspect, this disclosure provides a method for evaluating the therapeutic effect of hair follicle stem cell loss, which uses the drug target or animal model.

[0018] Eighthly, this disclosure provides a method for prognostic assessment of hair follicle stem cell loss, which uses the drug target or animal model.

[0019] Ninthly, this disclosure provides a drug for the loss of hair follicle stem cells, comprising at least one of the following: intracellular Ca 2+ Chelating agents, intercellular calcium 2+ Chelating agents, mechanosensitive ion channel inhibitors, mechano-calcium signaling inhibitors, TNFα inhibitors, TNFα receptor blockers, and TNFα signaling inhibitors. The inhibitors or blockers mentioned can be compounds or biomolecules (e.g., polynucleotides, peptides, antibodies, etc.).

[0020] In a tenth aspect, this disclosure provides a method for preventing or treating the loss of hair follicle stem cells, which uses the drug. Attached Figure Description

[0021] Figure 1 Shrinkage in physical niche size triggers hair cycle-dependent aberrant stem cell death. Scale bar, 30 μm. All data reflect mean ± SD of 3 mice in 3 independent experiments. *p<0.1, **p<0.01, ***p<0.001, ****p<0.0001.

[0022] Figure 2 Mechanosensitive ion channels mediate intracellular Ca2+ 2+ Increased involvement in inducing abnormal stem cell death caused by niche shrinkage. All data reflect mean ± SD of 3 mice in 3 independent experiments. Scale bar, 30 μm. *p<0.1, **p<0.01, ***p<0.001, ****p<0.0001.

[0023] Figure 3 The mechanosensitive ion channel Piezo1 expressed in epithelial cells mediates aberrant stem cell death triggered by niche atrophy. All data reflect mean ± SD of 3 mice in 3 independent experiments. SG, sebaceous gland; Bu, carina. Scale bar, 30 μm. ****p<0.0001.

[0024] Figure 4Hair cycle-dependent TNFα synergistically activates Piezo1 to induce aberrant stem cell death triggered by niche shrinkage. All data reflect mean ± SD of 3 mice in 3 independent experiments. SG, sebaceous gland; Bu, carina. Scale bar, 30 μm.

[0025] Figure 5 Pathological niche atrophy induces hair cycle-dependent aberrant stem cell death via the mechanosensitive ion channel Piezo1. All data reflect the mean ± SD of 3 mice in 3 independent experiments. SG, sebaceous gland; Bu, carina. Scale bar, 30 μm. Detailed Implementation

[0026] The embodiments described herein are provided by way of illustration only and not limitation. Those skilled in the art will readily recognize that various non-critical parameters can be changed or modified to produce substantially similar results.

[0027] It should be understood that the embodiments and implementations described herein are for illustrative purposes only, and various modifications or variations made by those skilled in the art based on these embodiments and implementations should be covered within the spirit and scope of this application, and are also covered within the scope of the appended claims. All publications, patents, and patent applications cited herein are incorporated herein by reference in their entirety for all purposes.

[0028] method

[0029] mice

[0030] Mouse experiments were conducted according to the recommendations in the Laboratory Animal Care and Use Guidelines of the Institute of Life Sciences. All animals were handled in accordance with the guidelines of the Chinese Laboratory Animal Use Law and the protocol (M0020) approved by the Animal Experimentation Ethics Committee of the Institute of Life Sciences. Nfatc1CreER mice were prepared and provided by Dr. Bin Zhou. Sox9CreER, ShhCreER, Hoxc13 KO, and Trpv4 KO have been previously described. K14Cre mice (strain: 004782), Rosa-stop-mTmG mice (strain: 007576), Ai14 mice (strain: 007914), Piezo1 fl / fl (strain: 029213), GCaMP6s (strain: 024106), and Tnfrsf1a1b (strain: 003243) were obtained from the Jackson Laboratory. Hoxc13 fl / fl mice were generated by inserting LoxP into exon 2 of Hoxc13. The LoxP1 insertion site is at position 7895, and the LoxP2 insertion site is at position 8601.

[0031] Hair shaft removal experiment

[0032] The hair follicles on the tail skin were arranged in triplets, and the middle follicle of the triplet was used. For the catagen hair shaft plucking experiment, the middle third of the length and width of the skin along the dorsal tail of P9 mice was used. For the telogen hair shaft plucking experiment, the middle third of the length and width of the skin along the dorsal tail of P14 mice was used. The morphology of the plucked hair shafts was examined by optical microscopy to verify the correct plucking of catagen or telogen hair shafts. Individual hair shafts were gently plucked using forceps. For the plucking and refilling experiment, after plucking, the hair shaft end with Krt6+ cells was cut off with a scalpel. The short hair shaft was reinserted into the plucked, hollow hair follicle channel using forceps. Four days later, the success of the plucking and refilling process was examined using global immunofluorescence and light field imaging.

[0033] Living Ca 2+ Imaging

[0034] Sox9CreER::GCaMP6s::Ai14 mice were used for in vivo Ca 2+ Imaging. Prior to imaging, tamoxifen was injected intraperitoneally daily from P11-13 to label HFSCs. In the tail skin, hair follicles were arranged in triplets. At P14, the right hair shaft of the rightmost hair in the triplet was plucked along the midline of the dorsal side of the tail skin. The left hair follicle of the same triplet served as an internal control without plucking. Mice were anesthetized with isoflurane, and their tails were secured to a custom stage with tape for imaging. Ca2+ imaging was performed using a Nikon two-photon microscope (Olympus, UIS2) equipped with a 25X water immersion objective (numerical aperture 1.02). 2+ Imaging. The laser was tuned to a wavelength of 910 nm and an intensity of 40% to image the GCaMP6s signal. The laser was tuned to a wavelength of 1040 nm and an intensity of 10% to image the tdTomato signal. Images were acquired for 10 minutes at a rate of 1 frame / 10 seconds using Nikon software. For each frame, the normalized GCaMP6s intensity was calculated by dividing the background-subtracted GCaMP6s fluorescence value by the background-subtracted tdTomato fluorescence value of the same target region. The relative GCaMP6s signal change F / F for each frame (t) was calculated. b (t). Baseline F b It is the average of the lowest 10th percentile fluorescence intensity during the same cell imaging period. Ca is defined based on an amplitude at least twice that of baseline noise. 2+ Flickering. Analysis of Ca using GraphPad Prism. 2+ Intensity trajectory, maximum F / F b and Ca 2+ Number of blinks.

[0035] Animal processing

[0036] Hair follicle stem cells were labeled using Nfatc1CreER::mTmG mice. Pregnant mice were given a single intraperitoneal injection of tamoxifen at E17.5. Sox9CreER::GCaMP6s::Ai14 mice were injected with tamoxifen once daily from P11 to P13 for calcium deficiency. 2+ Imaging. Nursing mothers of ShhCreER::Hoxc13 fl / fl::Ai14 mice were injected with tamoxifen once daily from P3 to P9 for Hoxc13 conditional knockout. For the inhibitor assay, C57BL / 6J mice had their hair shafts plucked at P9, and the inhibitor was injected intradermally into the middle third of the tail skin once daily from P9 to P12. The in vivo inhibitors used were: paclitaxel (Selleck, S1150, 10 μM), cytochalasin D (Abcam, ab143484, 50 μM), BAPTA-AM (Sigma, A1076, 200 μM), BAPTA (Sigma, A4926, 200 μM), and GsMTx4 (R&D, 4912, 1 μM). For Yoda1 injections across different hair growth cycles, administer 7.5 μM Yoda1 intradermally once daily at the middle third of the skin at the tail for three consecutive days. For the anagen (growth) to catagen (regression) phase, inject Yoda1 from P10 to P12, using the lateral (right or left) follicles of the triplet. For the catagen to telogen (resting) phase, inject Yoda1 from P10 to P12, using the central follicle of the triplet. For the telogen to early anagen phase, inject Yoda1 from P13 to P15. For the early anagen to late anagen phase, inject Yoda1 from P15 to P17. For in vivo Yoda1 + TNFα injection experiments, from P12 to P14, administer 7.5 μM Yoda1 and 0.1 μg / mL TNFα intradermally once daily at the middle third of the skin at the tail.

[0037] In vitro tensile test

[0038] The in vitro stretching apparatus for an isometric strain cell culture system has been previously described. A Matrigel-coated silicone membrane was secured to the bottom of a custom-made cylinder support using rubber O-rings, and then a pressure head ring was placed in the central space of the cylinder support (Item #1) to assemble the stretching apparatus. The assembled apparatus (Item #1) was placed between the top and bottom helical metal rings. Cells were seeded onto the silicone membrane and inside the pressure head ring. The top helical metal ring could be rotated downwards to apply pressure to the pressure head ring, thus stretching the silicone membrane. Calculations showed that 1.5 rotations of the top helical metal ring represented 10% membrane stretching, 3 rotations represented 20% stretching, and 5 rotations represented 30% stretching. The silicone membrane was coated with Matrigel at 37°C for 2 hours, and then keratinocytes were seeded onto the membrane on Day 1 (D1) for stretching experiments. On Day 2 (D2), the membrane was stretched every 30 minutes for 4 hours, with the degree of stretching varying with and without TNFα.

[0039] Cell culture experiment

[0040] To establish C57 and Piezo1 cKO cell lines, dorsal skin was removed from newborn mice, and the cells were placed derm-side down in dispersant (Dispase, Life Technologies, dissolved in PBS, 0.4 mg / mL) at 37°C for 1 hour. The epidermis was then separated from the dermis and digested in 0.25% trypsin solution (Gibco) at 37°C. When most keratinocytes had dissociated, the cells were collected by centrifugation and digested in 0.05 mM Ca2+. 2+Cells were cultured in E-medium. All cell lines were cultured in a cell culture incubator at 37°C and 5% CO2. For in vitro TNFα and stretching assays, keratinocytes were treated with 100 ng / mL TNFα for 4 hours with or without varying degrees of stretching (0%, 10%, 20%, 30%). Apoptotic events in live cells were detected using the DEVD assay (CellEvent Caspase-3 / 7 Green Detector, C10423). The DEVD assay reagent was diluted to a final concentration of 2 μM. The cell culture medium was removed, and the diluted reagent and Hoechst 33342 were added to the cells. Cells were incubated at 37°C for 30 minutes and then imaged. 20,000 keratinocytes were placed in the wells of a 6-well plate for Western blotting of cleaved caspase 3 protein. Twenty hours later, cells were treated with different concentrations (0, 0.01, 0.1 μg / mL) of TNFα and different concentrations (0, 2.5, 7.5 μM) of Yoda1. Twenty hours later, cells were collected for Western blotting. The following antibodies were used for Western blotting: anti-cleavage-caspase 3 antibody (Cellsignaling, D175, 1:1000) and anti-actin-HRP antibody (MBL, PM053-7).

[0041] Immunofluorescence staining, confocal microscopy and image processing

[0042] Tissue was embedded in an OCT compound (Tissue-Tek), frozen on dry ice, and sectioned (20-30 μm) for staining. Sections were fixed in PBS solution with 4% (vol / vol) paraformaldehyde for 10 min, permeated in 0.5% Triton (PBST) for 15 min, and blocked in blocking buffer (PBS solution containing 2% normal donkey serum, 1% BSA, and 0.5% Triton) for 1 h. Primary antibody was incubated overnight at 4°C, followed by washing with PBS for 15 min, three times. Secondary antibody was incubated at room temperature for 1 h, followed by washing with PBS for 15 min, three times. For H&E staining, skin samples were sectioned (10 μm) and fixed in PBS containing 4% paraformaldehyde for 10 min. Sections were stained in hematoxylin (Sigma) for 20 seconds, rinsed in water and 0.3% acidic alcohol, and then stained in eosin (Sigma) for 30 seconds. H&E staining was imaged using a VS120 microscope. Immunofluorescence staining was performed using a Nikon A1-R confocal microscope (Olympus Life Science). Microscopic data were analyzed using ImageJ and Bitplane Imaris. RGB images were assembled and labeled using Adobe Illustrator CS6. The following antibodies were used: anti-P-cad antibody (R&D, BAF761; 1:500), anti-active caspase 3 antibody (Cellsignaling, D175, 1:1000), anti-Krt6 antibody (Chen Ting Lab, 1:1000), anti-Hoxc13 antibody (Chen Ting Lab, 1:1000), anti-GFP antibody (Abcam, ab13970, 1:1000), anti-CD34 antibody (eBioscience, 50-0341, 1:500), and anti-Ki-67 antibody (eBioscience, 1:1000).

[0043] whole Tail skin staining

[0044] Full-thickness tail skin was harvested from the tail and cut into 1cm × 0.5cm pieces. The tail skin was then treated in 25mMETDA at 37°C on a shaker at 150 rpm for 2 hours. The epidermis and dermis containing hair follicles were separated using forceps. The epidermis was fixed in 4% paraformaldehyde for 7 minutes, then washed with PBS for 30 minutes, three times. If necessary, unwanted long anagen follicles that obstruct observation of shorter follicles were removed using forceps under a stereomicroscope. The epidermis was then processed for immunofluorescence staining and imaging.

[0045] In situ hybridization of fluorescent RNA

[0046] Tissues were fixed in freshly prepared 4% PFA at 4°C for 24 hours, dehydrated with 10%, 20%, and 30% sucrose, and then frozen in OCT embedding medium containing dry ice. Sections were prepared by cutting 10 μm thick sections. Sections were air-dried at room temperature, and in situ detection of fluorescent RNA was performed using the RNAscope Multiplex Fluorescence Kit v2. The RNAscope probes used were: TNFα (NM_013693, region 41-1587), Ppib (NM_011149.2, region 98-856).

[0047] RNA isolation and real-time PCR

[0048] The entire tail skin was treated in 25 mM ETDA at 37°C on a shaker at 150 rpm for 2 hours. The epidermis was separated from the dermis and then treated with 0.25% trypsin for 30 minutes. The separated keratinocytes were collected by centrifugation. Total RNA was isolated using Trizol (Life Technologies) and then extracted using the Direct-Zol RNA miniprep kit (Zymoresearch). An equal volume of RNA was added to the reverse transcriptase reaction mixture (Vazyme, R222-01) to obtain cDNA. Real-time PCR was performed using a CFX96™ real-time system (Bio-Rad) and Power SYBR Green PCR MasterMix (Life Technologies). Primers were designed for the following cycling conditions: 95°C for 10 min initial denaturation, 95°C for 10 s denaturation, 61°C for 30 s annealing, 65°C for 10 s extension, for 40 cycles. The primers used are as follows: PPIBF, GTGAGCGCTTCCCAGATGAGA; PPIB R, TGCCGGAGTCGACAATGATG; Peizo1 F, CGTCGGGAACCAGAGGG; Piezo1 R, ACCAGCGAGAGAGCATTGAA; Trpv4 F, CCACCCCAGTGACAACAAG; Trpv4 R, GGAGCTTTGGGGCTCTGT.

[0049] Statistical analysis

[0050] Data are expressed as mean ± standard deviation (SD). All statistical charts were prepared in GraphPad Prism. Significance analysis was performed using the unpaired two-tailed Student test in Prism. P-values ​​were calculated with 95% confidence intervals to indicate statistical significance between groups. A p-value < 0.05 was considered statistically significant. Statistically significant differences between groups are indicated by asterisks (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001).

[0051] Example 1: Reduction in physical niche size triggers hair cycle-dependent abnormal stem cell death.

[0052] During the regression phase of a normal hair cycle, the hair shaft shrinks and moves upward, followed by the epithelial tail chain undergoing apoptosis. The docking of the hair shaft and Krt6+ symbiotic cells at the bulge marks the end of the regression phase and the apoptotic events. To investigate whether the reduction in three-dimensional niche size leads to HFSC loss, we removed the hair shaft before docking with Krt6+ symbiotic cells at the bulge and attached Krt6+ symbiotic cells during morphological regression, tracking the fate of HFSCs during the subsequent regression-resting phase. Figure 1 a) In the control HF that was not removed, active caspase 3+ apoptotic cells were present only in the contracting epithelial strand of the vestigial HF. No apoptosis occurred in the outer root sheath cells (including the HFSCs surrounding the root sheath). All apoptotic events ceased once the contracting root sheath and Krt6+ associated layer cells stopped in the bulging region and came into contact with the HFSCs. One day after removal of the vestigial root sheath (D1), active caspase 3+ apoptotic cells were still present only in the contracting epithelial strand of the lower HF. On day 2 (D2) after removal of the root sheath, the HF diameter was significantly reduced due to the absence of the root sheath within the HF, and apoptotic events spread significantly from the lower HF to the upper HF (including some bulging cells). On day 3 (D3), as the HF shortened further, abnormal apoptosis was observed in both the lower and upper bulging cells, which persisted into day 4 (D4). However, not all lenticular cells disappear due to apoptosis. On day 5 (D5), the secondary lenticular embryo begins to expand and start the next growth cycle, similar to the control group of unremoved HF. Figure 1(b) To quantify the observed spatiotemporal variations, the bulge was divided into upper (Bu1) and lower (Bu2) portions. At D2, the diameter of Bu2 in the removed HF began to decrease, reaching its lowest level at D3, approximately 50% smaller than the control HF. Corresponding to the gradual decrease in bulge diameter, in the removed HF, Bu2 began to show aberrant apoptotic cells at D2, peaking at D3. Subsequently, in the removed HF, the diameter of Bu1 began to decrease slightly at D3, reaching its lowest level at D4. Correspondingly, in the removed HF, Bu1 began to show aberrant apoptosis at D3, peaking at D4. Figure 1 c~d).

[0053] The upward spread of apoptosis was not caused by damage from the plucking itself. Even though the hair shaft and Krt6+ symbiotic cells were removed from the resting bulge when the hair shaft was plucking during the resting phase, no active caspase 3+ apoptotic cells were subsequently detected in the bulge region. Figure 1 d). At D4, following the removal of the resting hair shaft, HF cells entered the anagen phase, similar to previous observations. This result indicates that hair shaft removal alone does not induce apoptosis in abnormal HFSC cells. Furthermore, removal of the catagen hair shaft does indeed lead to hair cycle-dependent apoptosis in abnormal HFSC cells. To determine whether this results in HFSC loss, we used lineage tracing to track HFSC numbers. Using Nfatc1CreER::mTmG mice, HFSCs were labeled as mGFP+ cells by injecting tamoxifen during morphogenesis. At D1, following the removal of the catagen hair shaft, the number of HFSCs remained unchanged between the hair shaft-removed and unremoved control HF cells, indicating that hair shaft removal does not directly remove HFSCs. However, at D4, the number of HFSCs in the removed HF cells was significantly reduced compared to the control HF cells. Figure 1 e). In summary, these results ultimately demonstrate that plucking the catarrhal hair shaft reduces ridge size and triggers aberrant HFSC cell apoptosis dependent on the hair cycle, leading to HFSC loss.

[0054] In particular, Figure 1 A shows a schematic diagram of the hair shaft plucking test during the regression phase. Figure 1 b shows in such Figure 1 Immunofluorescence images of hair follicles in the tail skin at different time points during the transition from the catagen to the telogen phase, with or without the removal of the catagen hair shaft, are shown in image a. Figure 1In diagram b, D1–D5 represent time points after the removal of the hair shaft during the regression phase, from the regression phase to the resting phase and then to the anagen phase. Active caspase 3 staining indicates apoptosis. Pcad staining marks epithelial cells. The ridge is divided into upper (Bu1) and lower (Bu2) sections to quantify changes in ridge diameter and the sequence of apoptotic events. Note that after hair shaft removal during the regression phase, apoptotic events spread from the lower to the upper part of the ridge. SG, sebaceous gland; Bu, ridge. Furthermore, Figure 1 c and Figure 1 d shows the quantification of bulge diameter at the indicated time points and under the indicated conditions, as well as the quantification of cell death in the bulge region at the indicated time points and under the indicated conditions. Figure 1 e shows the quantification of the number of stem cells at the indicated time points and under the given conditions.

[0055] Example 2: Restoring physical niche size can salvage hair cycle-dependent abnormal stem cell death.

[0056] The sequential association between decreased bulge diameter and increased apoptosis in Bu1 and Bu2 suggests that niche shrinkage may be the cause of hair cycle-dependent aberrant HFSC death. The specific niche shrinkage we refer to here includes two main aspects: a reduction in Krt6+ symbiotic cells and a shrinkage of the three-dimensional niche space. Krt6+ symbiotic cells are known to secrete factors regulating HFSC quiescence. To distinguish the contribution of Krt6+ symbiotic cells and changes in physical niche size to the observed phenomena, we performed a "plucking and refilling" experiment: after plucking the catagen hair shaft, hair shafts without attached Krt6+ symbiotic cells were reinserted to re-expand the reduced physical niche space. Figure 1 f). If the lack of Krt6+ symbiotic cells is the primary cause of cycle-dependent HFSC loss due to niche shrinkage, then this procedure will not have any salvage effect. However, if the reduction in physical niche size is the primary cause, this procedure should be able to salvage the phenomenon. As a control for the pluck + refill experimental procedure, we plucked the telogen hair shaft and then re-inserted the hair shaft without attached Krt6+ symbiotic cells above the sebaceous gland to avoid re-expanding the reduced physical niche space caused by plucking. This is called the “pluck + SG refill” experiment. Global immunofluorescence staining and bright-field imaging showed the successful execution of the above experiment. To help distinguish between the original hair shaft and the re-inserted hair shaft, we re-inserted the stained hair shaft into the hair follicle of the plucked hair shaft ( Figure 1g). In the control resting thoracic thoracic region, we could clearly detect hair shafts and Krt6+ associated cells within the thoracic region, and no apoptosis occurred in HFSCs. On day 4 after hair shaft removal in the vestigial phase, no hair shafts or Krt6+ associated cells were observed at the resting thoracic region, and a large number of abnormal HFSC apoptosis occurred. Remarkably, simply re-inserting hair shafts without Krt6+ associated cells into the thoracic region after removing the vestigial hair shafts completely prevented the spread of apoptosis from low HF to the thoracic region. A similar procedure, but re-inserting hair shafts without Krt6+ associated cells above the thoracic region, had no rescue effect. Quantification of apoptosis in the thoracic region showed that the removal + refill experiment completely rescued apoptosis, but the removal + SG refill experiment had no effect. Figure 1 h). Quantification of the ridge diameter indicates that the removal + refill procedure re-enlarged the reduced ridge size, while the removal + SG refill procedure did not. Figure 1 i) Since restoring physical niche size alone had a complete salvage effect in the absence of any Krt6+ symbiotic cells, we can conclude that the lack of Krt6+ symbiotic cells is not the cause of hair cycle-dependent HFSC loss due to niche atrophy. It has been demonstrated that hair removal can recruit immune cells to the skin. Since the removal-induced response remained in the removal + refill experiment, and the restoration of physical niche size alone had a complete salvage effect, this experiment also ruled out many other potential removal-induced effects.

[0057] In particular, Figure 1 f shows a schematic diagram of the hair shaft removal and refilling test during the regression phase. Figure 1 g shows immunofluorescence and bright-field global images of hair follicles in the tail skin under the conditions shown, with yellow arrows marking the hair shaft and Krt6 staining marking the symbiotic layer cells embracing the ends of the hair shaft. Figure 1 h shows the quantification of cell death in the thoracic tract under the conditions indicated. Figure 1 i shows the quantification of the bulge diameter under the conditions shown.

[0058] Example 3: Ca 2+ Chelating agents and mechanosensitive ion channel inhibitors rescue abnormalities induced by niche shrinkage. Apoptosis in HFSC cells.

[0059] Next, we wanted to understand how changes in physical niche size trigger hair cycle-dependent HFSC death. After plucking the telogen hair shaft, the remaining HF did not remain a hollow channel but rather gradually condensed inward from the bottom up, as if compressed into a solid cylinder. The HF is encased by an outer layer of elastic dermal sheath cells, which may contribute to this effect. There are many potential mechanisms by which HFSCs can sense changes in physical niche size and associated mechanical forces: polysaccharide-protein complexes, lipid rafts, cell adhesion structures, and mechanosensitive ion channels, among others. We noted that aberrant HFSC apoptosis induced by niche shrinkage was independent of basement membrane attachments, as aberrant apoptosis occurred in both basal and suprabasal bulge cells. Therefore, we decided to first examine intracellular mechanotransferring factors: actin microfilaments, microtubule networks, and Ca2+. 2+ The focus was on signals, but not on cell-cell or cell-basement membrane adhesion molecules. To determine their functional relevance, we administered multiple inhibitors intradermally after plucking the regressive hair shaft to see which could rescue HFSC cell apoptosis: paclitaxel (Taxol) stabilizes microtubules; cytochalasin D is an inhibitor of actin polymerization; and BAPTA-AM is an intracellular Ca2+ signal. 2+ BAPTA, a chelating agent, is an intercellular calcium chelating agent. 2+ Chelating agents. Of these four different treatment methods, two Ca... 2+ Chelating agents significantly rescued apoptosis in abnormal HFSC cells induced by niche shrinkage, while cytoskeleton regulators did not. Because these results identified the potential role of mechanosensitive ion channels, we tested the rescue effect of GsMTx4, a mechanosensitive ion channel inhibitor. It interacts with two Ca2+ ions... 2+ Chelating agents have similar rescue effects. Figure 2 a). To determine whether this also led to the rescue of HFSC numbers, we used lineage tracing to track HFSC numbers after treatment. Using Nfatc1CreER::mTmG mice, HFSCs were labeled as mGFP+ cells by injection of tamoxifen during morphogenesis, followed by intradermal injection of GsMTx4 after removal of the telogen effluvium, and HFSC numbers were quantified 4 days later. Compared to vector treatment, GsMTx4 significantly rescued niche shrinkage-induced HFSC loss ( Figure 2 b). This functional evidence suggests that mechanosensitive ion channels mediate intracellular Ca2+. 2+ The increase is associated with HFSC loss caused by niche shrinkage.

[0060] In particular, Figure 2Figure a shows the quantification of cell death in the peduncle after treatment with different inhibitors following removal of the telogen effluvium. Paclitaxel is a microtubule stabilizer. Cytochalasin D is an inhibitor of actin polymerization. BAPTA-AM is an intracellular calcium... 2+ Chelating agent, BAPTA is an intercellular calcium... 2+ Chelating agent. GsMTx4 is a mechanosensitive ion channel inhibitor. And... Figure 2 b shows the overall immunofluorescence image and quantification of the number of hair follicle stem cells in the tail skin under the conditions shown. Hair follicle stem cells were labeled as membrane GFP+ cells using Nfatc1CreER::mTmG mice.

[0061] Example 4: Intracellular Ca2+ mediated by mechanosensitive ion channels 2+ Increased participation leads to induced niche shrinkage Abnormal stem cell death.

[0062] If this is indeed correct, we should be able to see intracellular Ca in HFSCs after the niche size is reduced. 2+ The concentration increased. To test this, we used Sox9CreER::GCaMP6s::Ai14 mice to investigate the effect of Ca in in vivo HFSCs. 2+ The inflow was imaged in real time. GCaMP6s are a type of green fluorescent Ca... 2+ The indicator exhibits high sensitivity and slow decay kinetics. Following tamoxifen injection during the morphogenesis phase, HFSCs express GCaMP6s and stable RFPs from the Ai14 allele. Then, at different time points after removal of the catagen hair shaft, we used two-photon microscopy to perform in vivo imaging of HFSCs in intact skin from anesthetized live mice. Figure 2 c). In control HF without removal, HFSCs showed stable RFP and GCaMP6 fluorescence levels during real-time imaging. The RFP signal served as an internal control, and the GFP / RFP ratio was used to normalize GCaMP6 intensities. In control HF HFs, GCaMP6 intensities remained constant, indicating intracellular Ca2+. 2+ The levels remained unchanged. On the other hand, at D4 after the removal of the regressive hair shaft, HFSCs still showed stable RFP fluorescence levels during real-time imaging, but GCaMP6s exhibited highly dynamic signal spikes, with randomly occurring flashes of elevated GFP signal in individual HFSCs after HF removal. Normalized GCaMP6s signals showed significantly high-intensity sites, indicating intracellular Ca2+ in HFSCs after HF removal. 2+ The pulse intensity increased. To quantify these observed dynamic changes, the fluorescence intensity (F) of the normalized GCaMP6s signal from single cells was divided by F. b It represents the average fluorescence intensity of the lowest 10% of the cells during the imaging period. Figure 2d). Compare the F / F of HFSC with time in HF. b The response shows a flat trajectory, while the trajectory of the HFSC in the removed HF produces multiple signal peaks. We then use the maximum F / F ratio in the trajectory. b To compare Ca at different time points after plucking the hair shaft during the regression phase. 2+ Inflow ( Figure 2 e). The maximum F / F ratio compared to the unremoved HF. b The level remained close to 1 at all time points, indicating a deficiency of intracellular Ca in these HFSCs. 2+ Increase. For plucked HF, the maximum F / F ratio is observed at D2 and D3 after plucking the hair shaft during the regression period. b The level was the same as that in the control HF, but significantly increased on day 4. This indicates that dynamic intracellular Ca2+ levels were observed in HFSCs only on day 4 after hair shaft removal. 2+ Increase. When we quantize imaging, Ca 2+ The number of flashes (defined as F / F in the trajectory) b When considering the number of peaks, the difference over the same time period is also significant. Figure 2 f). Only in D4 after hair shaft removal, Ca in HFSC 2+ The number of flickering events increased significantly. The maximum imaging depth of two-photon microscopy limited our observation to the bulge area directly below the sebaceous gland, which corresponds to our... Figure 1 The Bu1 region is defined in c. According to our quantification, the diameter of Bu1 decreases significantly only at D4. The associated apoptosis in Bu1 peaks at D4 in the plucked HF. Therefore, Ca at Bu1... 2+ The temporal variation in inflow was associated with a decrease in bulge diameter and an increase in HFSC cell apoptosis.

[0063] In particular, Figure 2 c shows the living Ca 2+ Schematic diagram of imaging strategy, and report mouse response to Ca in hair follicle stem cells using Sox9CreER::GCaMP6s::Ai14. 2+ Representative images of in vivo time-delayed scintillation recordings. Intact tail skin of anesthetized mice was imaged directly using a 2-photon microscope. The imaging area corresponds to... Figure 1 The upper bulge (Bu1) region is depicted in b. RFP expressing the Ai14 allele labeled hair follicle stem cells with a stable fluorescent signal during real-time imaging. Dynamic green GCaMP6s signal flashing indicates intracellular Ca... 2+ Increase. The pseudo-color image represents the ratio of GCaMP6s fluorescence to RFP fluorescence. The yellow arrow highlights the dynamic Ca... 2+ A shimmering single cell. Scale bar, 30 μm. Figure 2d shows a representative trajectory of calcium intensity in hair follicle stem cells from the control and plucked hair follicles shown in (c). Figure 2 e shows the maximum F / F ratio in the upper bulge region under the conditions shown. b The quantification is as follows: C represents control hair follicles that have not been plucked, and P represents plucked hair follicles. Figure 2 f shows the 10-minute imaging time window Ca under the conditions shown. 2+ Quantization of the number of flashes.

[0064] Example 5: Piezo1, a mechanosensitive ion channel expressed in epithelium, mediates niche shrinkage-induced abnormal stem cell damage. Cell death.

[0065] Many proteins have been reported to function as mechanosensitive ion channels in mammalian systems. First, we examined the expression levels of these identified mechanosensitive ion channels in HFSCs. Of these eight, Trpv4 and Piezo1 showed high expression levels, while the others were not expressed at all or at very low levels. Figure 3 a). Therefore, we will next use gene experiments to test the functional correlation between Trpv4 and Piezo1. K14Cre::Piezo1 fl / fl mice were used for conditional ablation of Piezo1 in skin epithelial cells, including HFSCs; Trpv4 KO mice were used for ablation of Trpv4 in all cells. Figure 3 b). Neither Piezo1 cKO nor Trpv4 KO HF showed abnormal morphology or apoptosis in the carina. Figure 3 (c-d) When we removed the vestigial hair shafts and quantified apoptosis at D4, wild-type (Wt) HFSCs exhibited strong apoptosis induced by niche shrinkage. Loss of Piezo1 significantly reduced apoptosis in HFSCs, while loss of Trpv4 did not. Figure 3 (c-d). This genetic evidence suggests that the mechanosensitive ion channel Peizo1 expressed in HFSCs senses a reduction in niche space and mediates apoptosis in HFSCs that is dependent on the hair cycle. Piezo1 has been reported to play roles in mechanodynamically regulated vascular architecture, inflammatory responses in innate immunity, central nervous system aging, midgut stem cell differentiation, and cell compression in the epithelium. To investigate whether activation of Piezo1 is sufficient to induce apoptosis in HFSCs in the absence of changes in niche size, we intradermally injected the Piezo1-specific activator Yoda1 at different stages of the hair cycle and quantified apoptosis in HFSCs ( Figure 3e). Similar to mediator treatment, Yoda1 treatment did not induce apoptosis in HFSC cells during the growth-regression, rest-growth, and growth-growth phase transitions. However, Yoda1 treatment alone induced strong apoptosis in HFSC cells during the regression-rest phase transition. This effect was mediated by epithelial-expressed Piezo1, as Yoda1 treatment failed to induce aberrant apoptosis in Piezo1 cKO HFSCs during the regression-rest phase transition. These loss-of-function and gain-of-function experiments ultimately demonstrate that epithelial-expressed Piezo1 is both necessary and sufficient for mediating niche-size regulation and HFSC survival.

[0066] In particular, Figure 3 Figure a shows the expression levels of mechanosensitive ion channels from RNA-seq analysis of hair follicle stem cells. Note that both Piezo1 and Trpv4 are highly expressed. Figure 3 b shows the qPCR validation of Piezo1 knockout efficiency in K14Cre::Piezo1 mice and Trpv4 knockout efficiency in Trpv4 KO mice. Figure 3 c and Figure 3 Image d shows a quantitative and representative immunofluorescence image of cell death in the bulge under the conditions shown. On day 4 after removal of the vestigial hair shaft, niche-induced stem cell death could be significantly rescued by loss of Piezo1 expression in epithelial cells, but not by loss of Trpv4. Figure 3 Image e shows the overall immunofluorescence images and quantification of cell death in tail skin hair follicle stem cells treated with and without the Piezo1-specific activator Yoda1 at different hair cycle stages. Yoda1 was administered intradermally for 3 days prior to analysis. It was noted that Yoda1 treatment only induced aberrant cell death in the bulge region during the telogen effluvium transition phase. This Yoda1-induced hair cycle-dependent stem cell death was dependent on Piezo1 expression in epithelial cells, as this effect was completely absent in the skin of K14Cre::Piezo1 fl / fl mice.

[0067] To date, our data indicate that variations in the three-dimensional niche size activate the mechanosensitive ion channel Peizo1 on the HFSC, thereby generating Ca... 2+Influx, in synergistic with certain regression-specific "death signals," leads to aberrant apoptosis and loss of HFSCs. Since Yoda1 treatment does not induce aberrant apoptosis of HFSCs in the early regression phase, but rather in the transition phase from regression to resting phase, this result indicates that regression-specific signals are not present in the bulge region in the early regression phase, but gradually approach the bulge as the regression epithelial tail chains contract upwards. Next, we need to determine this signal in synergistic effect with intracellular Ca2+. 2+ Enhance synergistic effects to induce regression-specific signals in HFSC cells to induce apoptosis.

[0068] Example 6: The absence of TNF receptors blocked abnormal apoptosis in HFSCs.

[0069] Previous studies have identified TNFα as a major signal associated with regression-phase cell death. First, we performed in situ RNA analysis to examine the expression patterns of TNFα at different hair cycle stages. Figure 4 a) TNFα mRNA was undetectable in HF during the growth or resting phase. During regression, TNFα was expressed by lower levels of HF epithelial cells (including contracting epithelial tails). This expression pattern is consistent with a hypothesized regression-specific signaling pattern that can be associated with increased intracellular calcium. 2+ The synergistic effect induces apoptosis in HFSC cells. To test the functional relevance of TNFα, we used Tnfrsf1a1b double-KO mice to see if the lack of TNFα response produced a rescue effect. Figure 4 (b) When we removed the telogen-phase hair shaft and quantified apoptosis on D4, Wt HFSCs exhibited strong aberrant apoptosis induced by niche shrinkage. Loss of TNF receptors 1a and 1b almost completely blocked aberrant apoptosis in HFSCs. This genetic experiment suggests that telogen-specific TNFα is essential for inducing niche shrinkage-triggered, hair cycle-dependent aberrant apoptosis in HFSCs. To investigate whether TNFα is sufficient to interact with increased intracellular Ca2+... 2+ Synergistic effect, inducing HFSC cell apoptosis in a hair cycle-independent manner, we intradermally injected TNFα with or without the Piezo1-specific activator Yoda1 during the resting phase. Figure 4 c). During the resting phase, treatment with TNFα or Yoda1 alone did not induce HFSC apoptosis, but combined treatment with TNFα and Yoda1 during the resting phase led to strong HFSC apoptosis. To further test the synergistic effect of TNFα and Yoda1, we used cultured keratinocytes in vitro and Western blot to detect cell death ( Figure 4d). Neither TNFα nor Yoda1 treatment alone induced cleaved caspase-3 in keratinocytes in vitro, while combined treatment with TNFα and Yoda1 induced cleaved 19kd and 17kd forms of caspase-3 in a concentration-dependent manner. The effect of Yoda1 was Piezo1-dependent, as combined treatment with TNFα and Yoda1 in Piezo1-KO keratinocytes only induced the inactive 19kd form of cleaved caspase 3.

[0070] In particular, Figure 4 a shows an in situ analysis of TNFα expression patterns at different hair cycle stages. Note that TNFα exhibits regression-specific expression in the epithelial tail chain of contracting hair follicles. Figure 4 b shows the overall immunofluorescence image and quantification of cell death in the bulge under the conditions shown. Loss of Tnfrsf1a and 1b at D4 after removal of the telogen effluvium significantly rescued hair cycle-dependent stem cell death. Figure 4 c shows the overall immunofluorescence image and quantification of cell death of hair follicle stem cells in tail skin treated with and without the Piezo1 activator Yoda1 and / or TNFα. Treatment with Yoda1 or TNFα alone did not induce hair follicle stem cell death in the resting phase, but combined treatment with Yoda1 and TNFα was sufficient to induce hair follicle stem cell death independent of the hair cycle. Figure 4 Image d shows the proteomic blot of cleaved caspase 3 in keratinocytes cultured under the conditions shown. Treatment with Yoda1 or TNFα alone failed to induce cleaved caspase 3 in cultured keratinocytes, but combined treatment with Yoda1 and TNFα was sufficient to induce cleaved caspase 3 (19 kDa and 17 kDa) in a dose-dependent manner. In the Piezo1 KO cell line, combined treatment with Yoda1 and TNFα induced only the inactive 19 kDa form of cleaved caspase 3.

[0071] Example 7: The synergistic effect of hair cycle-dependent TNFα and Piezo1 activation to induce niche shrinkage triggering Abnormal stem cell death.

[0072] To further verify the function of TNFα in mechanically induced cell death, we designed an in vitro cell stretching assay. Figure 4e). Keratinocytes were cultured on an elastic silicone membrane attached to a stretching device. Different levels of mechanical force were applied to the keratinocytes by stretching the membrane to varying degrees. Keratinocyte apoptosis was quantified by detecting the activity of active caspase 3 using a fluorescent DEVD peptide. Mechanical stretching or TNFα treatment alone could not induce keratinocyte apoptosis in vitro. However, combined treatment with mechanical stretching and TNFα induced cell death in a dose-dependent manner. The effect of mechanical stretching disappeared upon knockout of the mechanosensitive ion channel Piezo1 in keratinocytes.

[0073] In particular, Figure 4 Figure e shows a schematic diagram and quantification of cell death in keratinocytes cultured under the conditions shown. Keratinocytes were cultured on an elastic silicone membrane attached to a stretching device. The applied mechanical stretching sensitized the keratinocytes to TNFα-induced cell death in a stretching dose-dependent manner. The effect of mechanical stretching disappeared upon knocking out the mechanosensitive ion channel Piezo1 in the keratinocytes.

[0074] These loss-of-function and gain-of-function experiments ultimately demonstrated that TNFα is a regression-specific factor and a necessary and sufficient factor to synergize with Piezo1 activation to induce HFSC apoptosis. During the normal hair cycle, HFSCs are insensitive to regression-specific TNFα, but Piezo1 activation by niche size reduction sensitizes HFSCs to TNFα, leading to cell death and reduced cell numbers.

[0075] Example 8: Blocking the function of Piezo1, a mechanosensitive calcium channel expressed in epithelium, or the loss of Piezo1, to restore... It saved the hair cycle-dependent abnormal HFSC loss.

[0076] To investigate the pathological relevance we discovered, we employed a pure trichome and nail ectodermal dysplasia (PHNED) disease model. PHNED is a congenital disorder characterized by hypotrichosis and nail dystrophy. It is caused by the loss of Hoxc13, a transcription factor specifically expressed in anagen stromal cells that regulates terminal hair shaft differentiation and formation. We examined the expression pattern of Hoxc13 using immunofluorescence staining and confirmed that it is expressed only in anagen stromal cells, not HFSCs. Figure 5 a). We used Shh-CreER::Hoxc13 fl / fl::Ai14 mice to conditionally ablate Hoxc13 in some stromal cells. Figure 5 b). Shh-CreER targets only half of the stromal cells, not the HFSCs. In this Hoxc13 cKO mouse, overall HF development is normal. However, during regression, the hair shaft appears smaller, and some Krt6+ cells separate from the contracted hair bulb. Figure 5c). When the hair shaft and Krt6+ accompanying cells reach the bulge, the resulting resting bulge is approximately 20% smaller in size than that of Wt HF. Figure 5 d). We then used CD34 staining to quantify the number of HFSCs, and Hoxc13cKO HF had approximately 25% fewer HFSCs than Wt HF. Figure 5 e). Since Hoxc13 cKO does not directly affect HFSCs, we examined whether aberrant apoptosis induced by niche shrinkage was the cause of the reduced HFSCs. Figure 5 f). In Wt and Hoxc13 cKO HF, active caspase 3+ apoptotic cells were present only in the contractile epithelial tail chain of the vestigial HF. During the transition from vestigial to resting phase, HFSCs in Wt skin did not undergo apoptosis. However, HFSCs in Hoxc13 cKO skin exhibited significant apoptosis. During the growth phase, apoptosis ceased in all cells of Hoxc13 cKO skin. We used K14Cre::Piezo1fl / fl::Hoxc13 KO mice to test whether this hair cycle-dependent HFSC apoptosis was also induced by niche-shrinkage-activated Piezo1. Figure 5 g). HFSCs in Hoxc13 KO skin exhibit hair cycle-dependent apoptosis. This phenotype was significantly rescued after loss of epithelial-expressed Piezo1 in Hoxc13 KO skin. To determine whether this also leads to HFSC number rescue, we quantified CD34+HFSCs (g) in mice of different genotypes. Figure 5 h). Since Hoxc13KO is a complete knockout of Hoxc13 in the skin, the number of HFSCs in this mutant is reduced by approximately 40% compared to WT. The absence of epithelially expressed Piezo1 in Hoxc13KO skin significantly rescued the reduction in HFSC numbers. In summary, our results indicate that pathological niche shrinkage leading to hair cycle-dependent abnormal HFSC loss is mediated by activated mechanosensitive calcium channels, Peizo1, on HFSCs. Blocking this process can effectively rescue HFSC loss.

[0077] In particular, Figure 5 Image a shows an immunofluorescence image of Hoxc13-stained hair follicles in the anagen phase. Figure 5 b shows a schematic diagram of the knockout strategy and an immunofluorescence image of Hoxc13 staining in ShhCreER::Hoxc13 fl / fl::Ai14 mice. Figure 5c shows an overall immunofluorescence image of Krt6 staining in vestigial hair follicles of ShhCreER::Hoxc13 fl / fl::Ai14 and Wt mice. Arrows indicate that Krt6+ cells separate from the shrunken vestigial hair bulb ends in Hoxc13 cKO mice, but not in Wt mice. Figure 5 Image d shows the overall immunofluorescence images and quantification of ridge diameter of resting hair follicles in ShhCreER::Hoxc13 fl / fl::Ai14 and Wt mice. Note that the ridge diameter is significantly reduced in Hoxc13 cKO, but not in Wt follicles. Figure 5 e shows the overall immunofluorescence image and quantification of stem cell number in resting hair follicles of ShhCreER::Hoxc13 fl / fl::Ai14 and Wt mice. CD34 labeled hair follicle stem cells. Figure 5 f shows the overall immunofluorescence image and quantification of tail skin hair follicles from the anagen to catagen phases in ShhCreER::Hoxc13fl / fl::Ai14 and Wt mice. Active caspase 3 staining indicates apoptosis. RFP represents the progeny of cKO cells, which are present only in the hair shaft and not in the synaptic layer cells or hair follicle stem cells. Pcad labels the epithelial cells. Figure 5 g shows the overall immunofluorescence images and quantifications of resting hair follicles in the tail skin of Hoxc13 KO, Piezo1 cKO, Hoxc13 KO::Piezo1 cKO, and Wt mice. It is noted that in Hoxc13 KO, the loss of Piezo1 significantly rescued apoptosis of abnormal hair follicle stem cells. Figure 5 h shows the overall immunofluorescence image and quantification of stem cell numbers in resting hair follicles of Hoxc13 KO, Piezo1 cKO, Hoxc13 KO::Piezo1 cKO and Wt mice tail skin.

[0078] While mechanodynamic forces are a major physiological parameter sensed by many cell types in vivo, their involvement in mediating the cross-effect between niche shrinkage and stem cell loss remains entirely unknown. Our findings reveal a mechanosensory axis that mediates niche shrinkage-triggered stem cell loss via apoptosis. Mechanodynamic forces associated with the reduction in three-dimensional niche size activate the mechanosensitive ion channel Piezo1, thereby increasing intracellular Ca2+. 2+ Increased HFSC sensitivity to regression-specific TNFα leads to apoptosis. Our mechanistic findings should be important for developing drug therapies targeting pathological and aging-related stem cell loss.

Claims

1. A method for establishing an animal model of hair follicle stem cell loss for non-therapeutic purposes, or a method for inducing hair follicle stem cell loss in animals, comprising administering intradermal dermal activator of the mechanosensitive ion channel Piezo1 and TNFα in combination during the regression-resting phase transition of hair follicles.

2. The method according to claim 1, characterized in that, The activator of Piezo1 is Yoda1.

3. The use of the animal model established by the method of claim 1 in screening candidate drugs for the prevention or treatment of hair follicle stem cell loss.

4. Intracellular Ca 2+ Chelating agents, intercellular calcium 2+ Use of at least one of a chelating agent and a mechanosensitive ion channel inhibitor in the preparation of a medicament for the prevention or treatment of hair follicle stem cell loss. in, The loss of hair follicle stem cells is caused by aging and / or ectodermal dysplasia of pure hair and nails. Among them, the intracellular Ca 2+ The chelating agent is BAPTA-AM, and the intercellular Ca 2+ The chelating agent is BAPTA, and the mechanosensitive ion channel inhibitor is GsMTx4.

Images