Recombinant full-length human type iii collagen yeast engineering strain and construction method

Abstract

The application discloses a kind of secretory expression recombinant collagen Pichia pastoris engineering strain and construction method.CLA4_signal signal peptide gene and full-length Ⅲ type human collagen mature peptide gene are connected in series, recombinant plasmid is constructed and is introduced into Pichia pastoris GS115 after linearization treatment, and high expression Pichia pastoris engineering strain pPICZA-CLA4_signal-COL Ⅲ / GS11 is screened, and the yield of fermentation target product reaches 15g / L, and the engineering strain has industrial production potential.The obtained Ⅲ type human collagen mature peptide full-length amino acid sequence has no redundant amino acid or purification tag at N-terminal and C-terminal, can effectively reduce potential risks such as infection and immunogenicity, has good safety, and the product can be applied to cosmetic medicine / cosmetics, medical devices, biomedical materials and nutrition and health care and other wide fields.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and more specifically, to a recombinant full-length type III humanized collagen Pichia pastoris engineered strain and its construction method. Background Technology

[0002] Collagen is a family of proteins widely distributed in animal connective tissues, primarily found in the skin, bones, cartilage, tendons, ligaments, and blood vessels. It exhibits rich diversity and tissue-specific distribution. The structural characteristic of collagen is that three left-handed helical α-polypeptide chains are intertwined to form a right-handed triple helix, resulting in a highly stable molecular structure. It possesses low immunogenicity and good biocompatibility, and is widely used in beauty and health care, biomedical materials, and food.

[0003] Based on differences in amino acid sequence and function, collagen is divided into 29 subtypes. Type I, Type II, and Type III collagen are the most prevalent and thoroughly studied. Human skin contains Type I and Type III collagen, while Type III collagen is mainly found in infant skin, the lining of blood vessels, and the intestines. Type III collagen accounts for 80% of normal infant skin, and the scarless healing mechanism in infants is due to their strong ability to synthesize Type III collagen. In adults, the amount of Type III collagen in skin decreases with age, and the adult dermis no longer has the ability to synthesize Type III collagen, only Type I collagen. As a result, wound healing often leaves scars.

[0004] Multiple studies have shown that the correct amino acid sequence is crucial for collagen to perform its biological functions. For example, mutations in type I collagen affect bone mineralization and limit bone growth, potentially leading to osteogenesis imperfecta (fragile bone disease); mutations in type II collagen cause spongy tracheal dysplasia; type III collagen is a major structural component of hollow organs (blood vessels, uterus, and intestines), and mutations in its gene can lead to vascular Ehlers-Danlos syndrome, in which patients typically die suddenly from the rupture of a large artery or other hollow organs. The molecular basis of the pathological mechanism of Alport syndrome is the mutation of the gene encoding type IV collagen, leading to damage to the structure and function of type IV collagen in the glomeruli, intraocular region, and inner ear basement membrane; mutations in type VII collagen are closely related to epidermolysis bullosa. Human collagen also has cell signal transduction functions. Collagen-specific cell receptors include integrin, discoid protein domain receptor (DDR), glycoprotein VI (GPVI), and leukocyte-associated immunoglobulin-like receptor 1 (LAIR-1). These receptors can provide unique binding sites for biomacromolecules such as proteoglycans, glycosaminoglycans, and growth factors, triggering the interaction between collagen molecules and cells and causing tissue-specific cell responses.

[0005] Collagen is mainly obtained through two pathways. Traditional methods of collagen production involve treating animal-derived tissues such as pigs, cattle, and fish with acids, alkalis, and enzymatic hydrolysis to extract mixed collagen peptides of varying lengths. This results in products with poor purity, often exhibiting off-odors and poor bioactivity, and carries potential risks such as viral infection and immune rejection. These products are generally used in food and health supplements, with a small portion used in cosmetics, and are unsuitable for medical devices or sophisticated tissue engineering products. Recombinant collagen expressed in host cells using genetic engineering technology offers advantages such as consistent composition, stable quality, and good safety, making it widely applicable in the medical industry and possessing broad application prospects. A comprehensive comparison of major systems for recombinant expression of type III collagen reveals that large-scale production using transgenic animals, transgenic plants, mammalian cells, and insect cells is costly and challenging. Microbial fermentation, primarily including E. coli and Pichia pastoris expression systems, offers advantages such as mature technology, high yield, short production cycle, simple cultivation, and low cost.

[0006] Type III human collagen mature peptides contain 1068 amino acids, with a molecular weight much larger than that of typical bioactive proteins. The *E. coli* system cannot express mature peptides with normal biological functions. Domestic research generally expresses smaller molecular weight type III humanized collagen fragments or recombinant human collagen-like proteins in *E. coli*. CN103122027A achieved high expression in *E. coli* by fusing tandem repeats of type III collagen peptides with type II collagen peptides. The basic repeating unit is GERGAPGFRGPAGPNGIPGEKGPAGERGAP, representing a type III human collagen peptide, with the terminal sequence GPPGPCCGGG, representing a type II human collagen peptide. The final product has two redundant amino acids (GP) at the N-terminus and a connecting amino acid (SR) in the middle. Through improved design, CN109593126A achieves efficient expression of only the type III collagen peptide repeating unit GERGAPGFRGPAGPNGIPGEKGPAGERGAP in *E. coli*, without redundant amino acids. CN1371919A utilizes high-density fermentation of *E. coli* to obtain highly expressed human-like collagen, but some of its designed amino acid sequences are not human collagen sequences. The main problems in the production process are: the target protein expressed by *E. coli* is often expressed in inclusion body form, making product purification difficult; the post-translational modification processing system of the prokaryotic expression system is imperfect, resulting in low biological activity of the expressed product; and residual endotoxins in the product can generate pyrogens.

[0007] Pichia pastoris combines the advantages of both prokaryotes and higher eukaryotes, possessing characteristics such as simple culture medium, suitability for high-density culture, relatively low cost, ability to perform post-translational protein processing, and easy acquisition of soluble active recombinant proteins. It is an ideal expression system for producing recombinant collagen with high purity, high safety, strong hydrophilicity, and good biocompatibility. International research mainly focuses on the recombinant expression of humanized type I human collagen in Pichia pastoris, while domestic research primarily utilizes recombinant secretory expression of type III human collagen fragments in Pichia pastoris. CN101200718A discloses a method for preparing recombinant plasmids of human-like collagen tandem genes with repeat numbers of 2, 3, and 6. CN102443057A discloses the efficient secretory expression of a 6-repeated tandem type III collagen fragment in Pichia pastoris, containing 599 amino acids and a molecular weight of 55.0 kDa. Its length is significantly shorter than the natural human collagen gene, and its homology with the template human type III collagen α1 chain is only 47%. CN111363029A discloses a 498-amino acid fragment of human type III collagen recombinantly expressed in Pichia pastoris, yielding a recombinant protein with a molecular weight of 54.5 kDa. CN103102407A discloses a 474-amino acid full-length recombinant humanized type III collagen expressed in secreted Pichia pastoris SMD1168, composed of tandem segments 1-229 and 233-461, with six histidine residues linked to the C-terminus as a specific affinity purification marker. CN102020716A discloses an 839-amino acid collagen fragment expressed in Pichia pastoris SMD1168, composed of a 230-amino acid peptide of human type III collagen linked to a 608-amino acid peptide of human type I collagen via a glutamic acid-phenylalanine linkage. These studies involve either partial amino acid sequence fragments of human collagen, combinations of functional fragments, or designed modifications of functional fragments, all of which differ from the full-length amino acid sequence of type III human collagen.

[0008] Full-length collagen with multiple specific cell receptor binding sites is a novel medical biomaterial. It degrades slowly in vivo and is suitable for preparing medical dressings, skin and bone tissue repair, injectable fillers, and other medical products. However, there are currently no reports of industrial-scale recombinant expression of full-length humanized collagen using the Pichia pastoris system; only two domestic patents involve recombinant full-length type III humanized collagen. CN103725623A discloses the secretion and expression of a mature peptide of the full-length type III collagen α chain in Pichia pastoris SMD1168, with an N-terminal STE13 cleavage site Glu-Ala-Glu-Ala*, which may result in redundant amino acids at the N-terminus of the collagen. CN109988243A discloses the recombinant full-length type III humanized collagen α1 chain and its application, which expresses full-length type III collagen in the secretion of Pichia pastoris SMD1168. The collagen chain, from the amino terminus, includes an amino-terminal affinity purification tag, a mature human type III collagen peptide chain, and a carboxyl-terminal affinity purification tag. The specific affinity purification tags designed at both ends may pose potential safety risks. Neither of these patents provides expression level data nor data related to fermenter experiments.

[0009] The aforementioned domestic and international R&D and marketed products are mostly type III recombinant humanized collagen fragments and recombinant collagen-like proteins. They are characterized by small molecular weight and easy skin penetration and absorption, but lack the crucial and holistic characteristics of collagen, and are generally suitable for skincare and cosmetic applications. The two patents mentioned above for preparing recombinant full-length type III humanized collagen either have redundant amino acids at the N-terminus due to insufficient protease cleavage, or have added purification affinity tags at the N- and C-termini for easier subsequent purification, both of which may pose potential safety risks.

[0010] Furthermore, high-density fermentation of Pichia pastoris typically uses BMGY, BMMY, or BSM inorganic salt media provided by Invitrogen. However, because BMGY / BMMY media contain organic components such as peptone and yeast extract, the cost per unit volume of organic nitrogen sources is too high for scale-up cultivation, and there is a possibility of contamination from organic and animal-derived components. Summary of the Invention

[0011] The technical problem to be solved by this invention is to address the shortcomings of existing recombinant collagen preparation technologies by providing a recombinant full-length type III humanized collagen Pichia pastoris engineered strain, achieving efficient secretory expression of the type III human collagen mature peptide gene in Pichia pastoris. The invention also provides methods for constructing, fermenting, culturing, and purifying this recombinant human type III collagen Pichia pastoris engineered strain.

[0012] To solve the above-mentioned technical problems, the present invention provides the following technical solution:

[0013] A recombinant full-length type III humanized collagen Pichia pastoris engineered strain: guided by CLA4_signal or its mutant sequence, the full-length amino acid sequence of the mature type III human collagen peptide is secreted into the extracellular space of the host bacteria.

[0014] The serine / threonine protein kinase CLA4 of *Saccharomyces cerevisiae* has a molecular weight of approximately 93 kJ and a C-terminal amino acid of KR. It can be recognized and effectively cleaved by the Kex2 protease of *Pichia pastoris*, and the secreted exogenous protein does not contain any redundant amino acids. This invention uses CLA4_signal tandem with the target protein gene to achieve efficient secretory expression of the complete mature peptide sequence of type III human collagen in the *Pichia pastoris* host.

[0015] Furthermore, the recombinant full-length type III humanized collagen Pichia pastoris engineered strain was obtained by the following method: the CLA4_signal gene and the type III human collagen mature peptide gene were tandemly constructed into the vector plasmid pPICZA, introduced into Pichia pastoris GS115, and screened to obtain a transgenic engineered strain with high-efficiency secretory expression. Electroporation transformation is preferred for introduction.

[0016] Furthermore, a Pichia pastoris engineered strain that secretes and expresses full-length type III humanized collagen is provided: the recombinant engineered strain is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 21547.

[0017] In the above-mentioned engineered bacteria, after the recombinant full-length type III humanized collagen was cleaved by the Kex2 protease of Pichia pastoris, the amino and carboxyl terms of the secreted recombinant collagen did not contain purified tag proteins, and neither of these terms contained any other extra amino acids.

[0018] The amino acid sequence of the recombinant type III human collagen mature peptide is SEQ ID NO.1.

[0019] The nucleotide sequence of the recombinant type III human collagen mature peptide was optimized according to the codon usage frequency of the Pichia pastoris host strain, and the nucleotide sequence is shown in SEQ ID NO.2.

[0020] The amino acid sequence of the Pichia pastoris engineered strain CLA4_signal, which secretes and expresses full-length type III humanized collagen, is shown in SEQ ID NO.3.

[0021] The nucleotide sequence of the Pichia pastoris engineered strain CLA4_signal, which secretes and expresses full-length type III humanized collagen, was optimized according to the host strain's codon usage preference, and the nucleotide sequence is shown in SEQ ID NO.4.

[0022] This invention provides a method for constructing a Pichia pastoris engineered strain that secretes and expresses full-length type III humanized collagen. The recombinant plasmid pPICZA-CLA4_signal-COLⅢ is constructed using molecular biology techniques such as gene synthesis, PCR amplification, directional ligation or seamless ligation. The target product is then secreted into the extracellular space of the Pichia pastoris host strain by CLA4_signal or its mutant sequence.

[0023] The PCR amplification primers F1, R1, F2, and R2 for the CLA4_signal gene and the type III human collagen mature peptide gene are shown below:

[0024] Upstream primer F1: aaaacaactaattattcgaaactatgagtttgtcagcagcag, restriction site is BstBI;

[0025] Downstream primer R1: catcataagaatcgtattgtctcttctgccaaataaaactc;

[0026] Upstream primer F2: ttttatttggcagaagagacaatacgattcttatgatg;

[0027] Downstream primer R2: ttgttctagaaagctggcggccgcttaaccatagtatggagc, with NotI as the restriction site.

[0028] This invention also provides a fermentation culture method for Pichia pastoris engineered strains that secrete and express full-length type III humanized collagen. The fermentation culture is carried out using BSM inorganic medium, which does not contain animal-derived components and has a clearly defined composition. This method can obtain a high level of recombinant protein expression, which is beneficial to improving product safety and ensuring product quality, while significantly reducing the production cost of fermentation.

[0029] This invention also provides a purification method for recombinant full-length type III humanized collagen, wherein the target protein is concentrated by adding saturated ammonium sulfate to the supernatant of the fermentation broth, the precipitate is collected by centrifugation and dissolved in citrate buffer, and recombinant full-length type III humanized collagen with a purity of over 98% is obtained by low-salt elution, high-salt elution and ultrafiltration desalting.

[0030] This invention provides a method for preparing full-length type III humanized collagen using recombinant full-length type III humanized collagen yeast genetically engineered strains, characterized by comprising the following steps:

[0031] 1) Construction of recombinant plasmids: Using the CLA4_signal gene and the type III human collagen mature peptide gene as templates, the target gene was amplified by PCR reaction. The PCR products were digested with BstBI / NotI enzymes and then ligated with the vector plasmid pPICZA. The fragments were recovered by gel extraction, ligated in a directional manner, and transformed into Escherichia coli DH10b by heat shock. The plasmids were plated on LB plates containing Zeocin, and a small amount of plasmids were extracted from single colonies. The positive recombinant plasmids were identified by enzyme digestion.

[0032] 2) Electroporation transformation: Recombinant plasmids linearized with restriction endonuclease PmeI were electroporated into Pichia pastoris GS115 competent cells, and the transformed colonies were plated on YPDS plates containing Zeocin.

[0033] 3) Screening for high expression strains: Two-stage culture and fermentation were carried out using YPD seed medium and BSM inorganic medium. Methanol was used to induce the expression of the target product. Dozens of transformed colonies were screened in shake flasks to obtain the high expression strain pPICZA-CLA4_signal-COLⅢ / GS115. The expression stability was verified by shake flask screening.

[0034] 4) High-density fermentation: Inoculate the fermenter to begin the glycerol culture stage, maintain a pH of 4.75-5.25, a temperature of 28-30℃, and a pressure of 0.2-1.0 bar, ensuring dissolved oxygen > 20%. When the carbon source is depleted and dissolved oxygen rises, enter the glycerol feeding stage, maintaining dissolved oxygen in the range of 20%-30% until the cell wet weight reaches 200-240 g / L, then stop adding glycerol. After the glycerol is depleted, proceed to the methanol induction stage, ensuring dissolved oxygen > 20%, and end fermentation after 80-100 hours of induction.

[0035] Preferably, during the glycerol feeding stage, 50% glycerol containing 12 mL / L of trace element PTM1 is fed in; methanol containing 12 mL / L of trace element PTM1 is fed in for methanol induction; and dissolved oxygen is maintained at >20% by adjusting the rotation speed, tank pressure, air flow rate, or methanol flow rate.

[0036] 5) Purification: The supernatant of the fermentation broth was added to saturated ammonium sulfate to concentrate the target protein. The precipitate was collected by centrifugation and dissolved in citrate buffer. After low-salt elution, high-salt elution and ultrafiltration desalting, the target product was collected to obtain recombinant full-length type III humanized collagen with a purity of over 98%.

[0037] The nucleotide sequence of the recombinant type III humanized collagen in this invention is shown in SEQ ID NO.2. This invention can obtain a complete mature type III collagen peptide that is 100% identical to the amino acid sequence of full-length type III human collagen, making it suitable for high-end medical fields such as medical devices and tissue engineering where product uniformity is required. The recombinant full-length type III humanized collagen prepared by this invention can be widely used in cosmetics, medical devices, medical materials, tissue engineering, nutritional supplements, and cell culture, especially in topical or endothelial skincare products, dressings, medical dressings, artificial skin, artificial blood vessels, artificial bones, and mucosal protectants.

[0038] Compared with the prior art, the present invention has the following advantages:

[0039] (1) Existing commercial Pichia pastoris expression vectors use α-Factor signal peptides to guide the secretory expression of large heterologous proteins, which is not ideal. This invention uses the CLA4_signal gene of Saccharomyces cerevisiae in tandem with the full-length type III human collagen optimized codon gene, which can efficiently secrete and express mature type III human collagen peptides in Pichia pastoris host cells. The high-yield strain obtained achieved a recombinant humanized collagen yield of 15 g / L in the high-density fermentation broth, realizing efficient secretory expression of full-length type III humanized collagen in Pichia pastoris host cells.

[0040] (2) This invention enables the efficient secretory expression of recombinant collagen in Pichia pastoris without modifying the original protein gene. The resulting recombinant full-length type III humanized collagen has a complete protein sequence and possesses the necessary biological activities for physiological function, such as stability, hydrophilicity, mechanical strength, cell adhesion activity, and tissue compatibility. Collagen gene mutations are closely related to the occurrence of various diseases, and the correct amino acid sequence is crucial for collagen to exert its biological function. The recombinant protein obtained by this invention is 100% identical to the mature peptide sequence of type III human collagen, has no redundant amino acids, is homologous to the human body, will not cause immune rejection, and has a higher safety profile than existing similar products in China.

[0041] (3) Human collagen contains a variety of specific cell receptors, which induce tissue-specific cellular responses through interactions with cells. Compared with the smaller molecular weight recombinant collagen fragments that have been extensively studied in China, the recombinant full-length type III humanized collagen of this invention retains its specific cell receptor characteristics and has a relative advantage in applications such as biomedicine and medical devices.

[0042] (4) This invention uses BSM inorganic culture medium, which is low in cost and has a clear composition. It can achieve efficient secretory expression of full-length type III humanized collagen and is easy to purify, yielding a target protein with a purity of over 98%. This recombinant protein is prepared by a green and environmentally friendly bio-fermentation method, with consistent components, stable quality, good biocompatibility and biodegradability, overcoming the risks of viral infection, rejection reaction, and uncertainty in structure and function associated with traditional animal collagen. Attached Figure Description

[0043] Figure 1 This invention describes a technical route for constructing a full-length type III humanized collagen recombinant vector, pPICZA-CLA4_signal-COLⅢ.

[0044] Figure 2 This is an electrophoresis image of the fusion gene CLA4_signal-COLⅢ constructed using overlap extension PCR technology. Lane M represents the DL5000 DNA Marker, and lane 1 represents the PCR amplification product of CLA4_signal-COLⅢ.

[0045] Figure 3 This is an electrophoresis image of the recombinant plasmid pPICZA-CLA4_signal-COLⅢ after enzyme digestion. Lane M1 is the DL5000 DNA Marker, lanes 1 and 2 are the results of double digestion with BstBI and NotI, and single digestion with PmeI, respectively, and lane M2 is the 1 kb DNA Ladder (Dye Plus).

[0046] Figure 4 This is an electrophoresis image of the recombinant engineered bacterium pPICZA-CLA4_signal-COLⅢ / GS115 for PCR identification. Lane M represents the DL5000 DNA Marker, and lane 1 represents the PCR amplification product of the engineered bacterium.

[0047] Figure 5 The recombinant engineered strain pPICZA-CLA4_signal-COLⅢ / GS115 was cultured in a fermenter. After methanol induction, fermentation broth was collected according to the production process, and protein samples were prepared for SDS-PAGE electrophoresis. Lane M is the PageRuler™ Prestained Protein Ladder, and lanes 1-7 are fermentation broth samples at different induction times.

[0048] Figure 6SDS-PAGE electrophoresis was performed on purified recombinant type III collagen and samples treated with collagen hydrolase. Lane M is the PageRuler™ Prestained Protein Ladder, lane 1 is the purified sample, and lane 2 is the sample treated with collagen hydrolase (Sigma, C5138-25MG). Detailed Implementation

[0049] The present invention will be explained below with reference to specific embodiments. The embodiments described with reference to the accompanying drawings are exemplary and should not be construed as limiting the present invention. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods.

[0050] Example: Construction of Pichia pastoris genetically engineered strain

[0051] The recombinant Pichia pastoris engineered strain pPICZA-CLA4_signal-COLⅢ / GS115 obtained in this invention is produced by directionally ligating the fusion gene CLA4_signal-COLⅢ obtained using overlap extension PCR technology with the expression vector pPICZA. The constructed recombinant plasmid is then electroporated into Pichia pastoris cells GS115, and a highly efficient transgenic engineered strain for secretory expression is obtained through screening. The strain was deposited on December 24, 2020, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, and is classified as *Pichia pastoris*, with strain number CGMCC No. 21547. The nucleotide sequence of the recombinant type III human collagen is shown in SEQ ID NO. 2, enabling the production of recombinant full-length type III humanized collagen. The amino acid sequence is shown in SEQ ID NO. 1, making it suitable for the medical device field where product uniformity is required.

[0052] The following is the specific construction process of the Pichia pastoris genetically engineered strain: The Pichia pastoris GS115 strain and expression vector pPICZA used in this invention were both purchased from Invitrogen, USA. The culture medium formulation used in this invention is as follows:

[0053] LB medium (1L): 5g yeast extract, 10g peptone, 10g sodium chloride (solid medium contains 2% agar powder).

[0054] YPD medium (1L): 10g yeast extract, 20g peptone, 20g glucose.

[0055] YPDS medium (1L): 10g yeast extract, 20g peptone, 20g glucose, 1M sorbitol (solid medium containing 2% agar powder).

[0056] BSM inorganic culture medium formula (1L): 85% H3PO4 26.7 ml, CaSO4•2H2O 0.93 g, K2SO4 18.2 g, MgSO4•7H2O 14.9 g, KOH 4.13 g, Glycerol 40 g, PMT1 4.35 ml.

[0057] PMT1 culture medium formula (1L): CuSO4•5H2O 6.0g, KI 0.088g, MnSO4•H2O 3.0g, Na2MoO4•2H2O 0.2g, H3BO3 0.02g, CoCl2•6H2O 0.5g, ZnCl2 20.0g, FeSO4•7H2O 65.0g, Biotin 0.2g, concentrated H2SO4 5.0ml.

[0058] 1. Obtaining the target gene

[0059] 1.1 Optimization of codon synthesis genes

[0060] Based on the full-length amino acid sequence of the mature peptide of type III human collagen registered in Genebank (NCBI Reference Sequence: NP_000081.2), this invention optimizes the corresponding gene sequence of collagen without altering the original amino acid sequence, thereby facilitating its secretory expression in Pichia pastoris. The gene sequence is shown in SEQ ID NO.2, and the optimized type III collagen gene sequence was synthesized by Nanjing GenScript Biotech Co., Ltd.

[0061] Based on the amino acid sequence of Saccharomyces cerevisiae CLA4 registered in Genebank (NCBI Reference Sequence: NP_014101.1), codon optimization was performed on CLA4_signal to eliminate codons with low usage in Pichia pastoris. Its gene sequence is shown in SEQ ID NO.4. The optimized sequence was synthesized by Nanjing Genscript Biotech Co., Ltd.

[0062] 1.2 Primer Design and Synthesis

[0063] PCR oligonucleotide amplification primers were designed based on the optimized CLA4_signal gene and the type III human collagen mature peptide gene.

[0064] Upstream primer F1: aaaacaactaattattcgaaactatgagtttgtcagcagcag, the underlined part is the restriction site BstBI;

[0065] Downstream primer R1: catcataagaatcgtattgtctcttctgccaaataaaactc;

[0066] Upstream primer F2: ttttatttggcagaagagacaatacgattcttatgatg;

[0067] Downstream primer R2: ttgttctagaaagctggcggccgcttaaccatagtatggagc, the underlined part is the restriction site NotI.

[0068] 1.3 PCR reaction to amplify the target gene

[0069] The synthesized CLA4_signal gene sequence and the type III human collagen mature peptide gene were used as templates for PCR amplification. The reaction system is as follows:

[0070]

[0071] The PCR amplification procedure is as follows:

[0072]

[0073] PCR amplification products were detected by 0.8% agarose gel electrophoresis, such as... Figure 2 As shown, the size is consistent with the expected product CLA4_signal-COLⅢ, which is 3503bp in length.

[0074] 2. Construction of recombinant expression plasmids

[0075] 2.1 Double enzyme digestion reaction and recovery of the target fragment

[0076] The PCR amplification product CLA4_signal-COLⅢ and the vector plasmid pPICZA were double-digested with BstBI and NotI (37℃, 2h), respectively. The digestion system is as follows:

[0077]

[0078] The enzyme digestion products were subjected to agarose gel electrophoresis. A gel block containing the target fragment was excised, and 3 volumes of GM elution buffer were added. After complete dissolution, the gel block was transferred to a spin column and centrifuged at 12,000 rpm for 1 min. The filtrate was discarded. Washing buffer (WB) was added twice, followed by centrifugation at 12,000 rpm for 1 min to remove residual liquid. 30 μL of sterile water was added to the center of the spin column membrane, and the mixture was incubated at room temperature for 1 min. The eluted DNA was collected by centrifugation at 12,000 rpm for 1 min.

[0079] 2.2 Directed Connections and Conversion

[0080] The PCR amplification product and the fragments of the vector plasmid pPICZA were recovered by double enzyme digestion gel, and incubated at 16℃ for 2 hours using the T4 DNA ligase system. The specific operation is as follows:

[0081]

[0082] The ligation product was added to competent DH10b cells, incubated on ice for 30 min, heat-shocked at 42°C for 90 s, incubated on ice for 2 min, then added to LLB medium and shaken at 37°C for 1 h. Finally, it was spread on Zeocin-resistant plates and incubated upside down at 37°C overnight.

[0083] 2.3 Identification of Recombinant Plasmids

[0084] Single colonies were picked, and plasmids were extracted in small quantities and digested with BstBI and NotI double enzymes, and PmeI single enzyme digestion. The mixture was incubated at 37℃ for 2 hours, and the digestion products were identified by agarose gel electrophoresis. Figure 3 The results showed that the double enzyme digestion product fragments were 3267bp+3466bp and the single enzyme digestion product fragment was 6734bp, indicating that the positive expression plasmid pPICZA-CLA4_signal-COLⅢ was successfully constructed.

[0085] 3. Construction of recombinant engineered strains

[0086] 3.1 Electroconversion of Pichia pastoris GS115

[0087] The recombinant plasmid was linearized with the restriction enzyme PmeI. 1-10 μg of the linearized plasmid was added to 80 μL of Pichia pastoris GS115 competent cells, mixed thoroughly, and transferred to a 2 mm electroporation cuvette. The cuvette was incubated on ice for 5 min. The electroporation parameters were set to 1.5 kV, 200 Ω, and 25 μF. Immediately after electroporation, 1 mL of pre-chilled 1 M sorbitol solution was added to the cuvette and mixed well. The mixture was then transferred to a sterile centrifuge tube and incubated at 30°C for 1 h. 200 μL of the bacterial culture was plated on a Zeocin-resistant (100 μg / ml) YPDS plate and incubated at 30°C for 2-5 days until single colonies appeared.

[0088] 3.2 PCR identification of recombinants

[0089] Genomic DNA was extracted from YPDS plate transformants using a yeast genomics kit. The PCR reaction system is as follows:

[0090]

[0091] The PCR reaction parameters are as follows:

[0092]

[0093] The amplification products were detected by 0.8% agarose gel electrophoresis as follows: Figure 4 As shown, the target gene band is approximately 3729 bp and the AOX1 gene band is approximately 2200 bp, proving that the target gene has been integrated into the chromosome of this recombinant engineered strain.

[0094] 3.3 Shake flask screening of recombinant expression strains

[0095] The preserved glycerol bacterial culture was transferred to 5 mL YPD medium Erlenmeyer flasks at a 1% inoculum and cultured at 30°C and 200 rpm until OD = 2–6. The cells were collected by centrifugation at 1500g for 5 min and then resuspended in 200 mL BSM inorganic medium (with a final concentration of 0.004% histidine) in Erlenmeyer flasks. The cells were cultured at 30°C and 200 rpm for 20 h to enter the induction phase. The induction temperature was 25°C, and every 24 h, 1.0% methanol (500 mL methanol plus 6 mL PMT1) was added to induce expression. After multiple rounds of initial screening, secondary screening, and validation screening, the high-yielding strain pPICZA-CLA4_signal-COLⅢ / GS115 was obtained.

[0096] 4. High-density fermentation of recombinant genetically engineered strains

[0097] The preserved engineered bacterial glycerol culture was inoculated into 1000 mL of YPD medium and cultured at 30℃ and 200 rpm until OD=2-6 to prepare primary seed culture. The primary seed culture was transferred at a 10% inoculation rate to a 30 L fermenter containing 20 L of BSM inorganic medium, with 0.004% histidine added to the final concentration. The fermentation was started at an initial temperature of 30℃, a rotation speed of 500 rpm, and an aeration rate of 20 L / min (1 V / V•min). The pH was adjusted to 5.0 with ammonia, and the fermentation pressure was 0.2-1.0 bar. Dissolved oxygen was maintained above 20%. When dissolved oxygen rose sharply, 50% glycerol containing 12 mL / L of trace element PTM1 was added to initiate the glycerol feeding stage, maintaining dissolved oxygen in the 20%-30% range. When the wet bacterial weight of the fermentation broth reaches 200-240 g / L, stop feeding and wait for the glycerol to be exhausted before starting the methanol induction stage. Add methanol containing 12 mL / L PTM1 trace element and induction temperature of 25℃. Adjust the rotation speed, tank pressure and aeration rate to make the dissolved oxygen greater than 20%.

[0098] Bacterial culture samples were collected at time points of 28h, 40h, 52h, 64h, 76h, 88h, and 100h for SDS-PAGE electrophoresis detection. Figure 5 As shown, the expression level of the target protein gradually increased with time from 28 to 76 hours, and showed a degradation trend after 88 hours. The yield of recombinant type III humanized collagen in the high-density fermentation broth reached 15 g / L, as determined by Coomassie brilliant blue staining.

[0099] 5. Isolation and purification of recombinant type III humanized collagen

[0100] The fermentation broth was centrifuged to remove bacterial cells, and the supernatant was collected. Saturated ammonium sulfate solution was added to a saturation level of 25%, and the mixture was stirred thoroughly. The mixture was allowed to stand at room temperature for 1 hour, and then centrifuged to collect the precipitate. The precipitate was dissolved in ultrapure water, and the solution was replaced with a 30kD ultrafiltration membrane to a citrate buffer (25mM citrate, 50mM sodium chloride, pH 6.2) to obtain the chromatography loading buffer. Low-salt elution was performed using a Capto SP ImpRes (Cytiva) column with the citrate buffer (25mM citrate, 50mM sodium chloride, pH 6.2), followed by high-salt elution with a citrate buffer (25mM citrate, 250mM sodium chloride, pH 6.2). The collected eluent was replaced with a 30kD ultrafiltration membrane to a 20mM PBS (pH 7.0) buffer to obtain recombinant full-length type III humanized collagen with a purity of over 98%. Figure 6 The collagen hydrolase shown (Sigma, C5138-25MG) can specifically hydrolyze purified recombinant type III humanized collagen.

[0101] The content of this invention is not limited to the embodiments listed. Any equivalent modifications made by those skilled in the art to the technical solutions of this invention by reading this specification are covered by the claims of this invention. sequence list <110> North China Pharmaceutical Group New Drug Research and Development Co., Ltd. <120> Recombinant full-length type III humanized collagen yeast engineered strain and construction method <130> 2021 <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1068 <212> PRT <213> Genus Homo (Homo sapiens) <400> 1 Gln Tyr Asp Ser Tyr Asp Val Lys Ser Gly Val Ala Val Gly Gly Leu 1 5 10 15 Ala Gly Tyr Pro Gly Pro Ala Gly Pro Pro Gly Pro Pro Gly Pro Pro 20 25 30 Gly Thr Ser Gly His Pro Gly Ser Pro Gly Ser Pro Gly Tyr Gln Gly 35 40 45 Pro Pro Gly Glu Pro Gly Gln Ala Gly Pro Ser Gly Pro Pro Gly Pro 50 55 60 Pro Gly Ala Ile Gly Pro Ser Gly Pro Ala Gly Lys Asp Gly Glu Ser 65 70 75 80 Gly Arg Pro Gly Arg Pro Gly Glu Arg Gly Leu Pro Gly Pro Pro Gly 85 90 95 Ile Lys Gly Pro Ala Gly Ile Pro Gly Phe Pro Gly Met Lys Gly His 100 105 110 Arg Gly Phe Asp Gly Arg Asn Gly Glu Lys Gly Glu Thr Gly Ala Pro 115 120 125 Gly Leu Lys Gly Glu Asn Gly Leu Pro Gly Glu Asn Gly Ala Pro Gly 130 135 140 Pro Met Gly Pro Arg Gly Ala Pro Gly Glu Arg Gly Arg Pro Gly Leu 145 150 155 160 Pro Gly Ala Ala Gly Ala Arg Gly Asn Asp Gly Ala Arg Gly Ser Asp 165 170 175 Gly Gln Pro Gly Pro Pro Gly Pro Pro Gly Thr Ala Gly Phe Pro Gly 180 185 190 Ser Pro Gly Ala Lys Gly Glu Val Gly Pro Ala Gly Ser Pro Gly Ser 195 200 205 Asn Gly Ala Pro Gly Gln Arg Gly Glu Pro Gly Pro Gln Gly His Ala 210 215 220 Gly Ala Gln Gly Pro Pro Gly Pro Pro Gly Ile Asn Gly Ser Pro Gly 225 230 235 240 Gly Lys Gly Glu Met Gly Pro Ala Gly Ile Pro Gly Ala Pro Gly Leu 245 250 255 Met Gly Ala Arg Gly Pro Pro Gly Pro Ala Gly Ala Asn Gly Ala Pro 260 265 270 Gly Leu Arg Gly Gly Ala Gly Glu Pro Gly Lys Asn Gly Ala Lys Gly 275 280 285 Glu Pro Gly Pro Arg Gly Glu Arg Gly Glu Ala Gly Ile Pro Gly Val 290 295 300 Pro Gly Ala Lys Gly Glu Asp Gly Lys Asp Gly Ser Pro Gly Glu Pro 305 310 315 320 Gly Ala Asn Gly Leu Pro Gly Ala Ala Gly Glu Arg Gly Ala Pro Gly 325 330 335 Phe Arg Gly Pro Ala Gly Pro Asn Gly Ile Pro Gly Glu Lys Gly Pro 340 345 350 Ala Gly Glu Arg Gly Ala Pro Gly Pro Ala Gly Pro Arg Gly Ala Ala 355 360 365 Gly Glu Pro Gly Arg Asp Gly Val Pro Gly Gly Pro Gly Met Arg Gly 370 375 380 Met Pro Gly Ser Pro Gly Gly Pro Gly Ser Asp Gly Lys Pro Gly Pro 385 390 395 400 Pro Gly Ser Gln Gly Glu Ser Gly Arg Pro Gly Pro Pro Gly Pro Ser 405 410 415 Gly Pro Arg Gly Gln Pro Gly Val Met Gly Phe Pro Gly Pro Lys Gly 420 425 430 Asn Asp Gly Ala Pro Gly Lys Asn Gly Glu Arg Gly Gly Pro Gly Gly 435 440 445 Pro Gly Pro Gln Gly Pro Pro Gly Lys Asn Gly Glu Thr Gly Pro Gln 450 455 460 Gly Pro Pro Gly Pro Thr Gly Pro Gly Gly Asp Lys Gly Asp Thr Gly 465 470 475 480 Pro Pro Gly Pro Gln Gly Leu Gln Gly Leu Pro Gly Thr Gly Gly Pro 485 490 495 Pro Gly Glu Asn Gly Lys Pro Gly Glu Pro Gly Pro Lys Gly Asp Ala 500 505 510 Gly Ala Pro Gly Ala Pro Gly Gly Lys Gly Asp Ala Gly Ala Pro Gly 515 520 525 Glu Arg Gly Pro Pro Gly Leu Ala Gly Ala Pro Gly Leu Arg Gly Gly 530 535 540 Ala Gly Pro Pro Gly Pro Glu Gly Gly Lys Gly Ala Ala Gly Pro Pro 545 550 555 560 Gly Pro Pro Gly Ala Ala Gly Thr Pro Gly Leu Gln Gly Met Pro Gly 565 570 575 Glu Arg Gly Gly Leu Gly Ser Pro Gly Pro Lys Gly Asp Lys Gly Glu 580 585 590 Pro Gly Gly Pro Gly Ala Asp Gly Val Pro Gly Lys Asp Gly Pro Arg 595 600 605 Gly Pro Thr Gly Pro Ile Gly Pro Pro Gly Pro Ala Gly Gln Pro Gly 610 615 620 Asp Lys Gly Glu Gly Gly Ala Pro Gly Leu Pro Gly Ile Ala Gly Pro 625 630 635 640 Arg Gly Ser Pro Gly Glu Arg Gly Glu Thr Gly Pro Pro Gly Pro Ala 645 650 655 Gly Phe Pro Gly Ala Pro Gly Gln Asn Gly Glu Pro Gly Gly Lys Gly 660 665 670 Glu Arg Gly Ala Pro Gly Glu Lys Gly Glu Gly Gly Pro Pro Gly Val 675 680 685 Ala Gly Pro Pro Gly Gly Ser Gly Pro Ala Gly Pro Pro Gly Pro Gln 690 695 700 Gly Val Lys Gly Glu Arg Gly Ser Pro Gly Gly Pro Gly Ala Ala Gly 705 710 715 720 Phe Pro Gly Ala Arg Gly Leu Pro Gly Pro Pro Gly Ser Asn Gly Asn 725 730 735 Pro Gly Pro Pro Gly Pro Ser Gly Ser Pro Gly Lys Asp Gly Pro Pro 740 745 750 Gly Pro Ala Gly Asn Thr Gly Ala Pro Gly Ser Pro Gly Val Ser Gly 755 760 765 Pro Lys Gly Asp Ala Gly Gln Pro Gly Glu Lys Gly Ser Pro Gly Ala 770 775 780 Gln Gly Pro Pro Gly Ala Pro Gly Pro Leu Gly Ile Ala Gly Ile Thr 785 790 795 800 Gly Ala Arg Gly Leu Ala Gly Pro Pro Gly Met Pro Gly Pro Arg Gly 805 810 815 Ser Pro Gly Pro Gln Gly Val Lys Gly Glu Ser Gly Lys Pro Gly Ala 820 825 830 Asn Gly Leu Ser Gly Glu Arg Gly Pro Pro Gly Pro Gln Gly Leu Pro 835 840 845 Gly Leu Ala Gly Thr Ala Gly Glu Pro Gly Arg Asp Gly Asn Pro Gly 850 855 860 Ser Asp Gly Leu Pro Gly Arg Asp Gly Ser Pro Gly Gly Lys Gly Asp 865 870 875 880 Arg Gly Glu Asn Gly Ser Pro Gly Ala Pro Gly Ala Pro Gly His Pro 885 890 895 Gly Pro Pro Gly Pro Val Gly Pro Ala Gly Lys Ser Gly Asp Arg Gly 900 905 910 Glu Ser Gly Pro Ala Gly Pro Ala Gly Ala Pro Gly Pro Ala Gly Ser 915 920 925 Arg Gly Ala Pro Gly Pro Gln Gly Pro Arg Gly Asp Lys Gly Glu Thr 930 935 940 Gly Glu Arg Gly Ala Ala Gly Ile Lys Gly His Arg Gly Phe Pro Gly 945 950 955 960 Asn Pro Gly Ala Pro Gly Ser Pro Gly Pro Ala Gly Gln Gln Gly Ala 965 970 975 Ile Gly Ser Pro Gly Pro Ala Gly Pro Arg Gly Pro Val Gly Pro Ser 980 985 990 Gly Pro Pro Gly Lys Asp Gly Thr Ser Gly His Pro Gly Pro Ile Gly 995 1000 1005 Pro Pro Gly Pro Arg Gly Asn Arg Gly Glu Arg Gly Ser Glu Gly Ser 1010 1015 1020 Pro Gly His Pro Gly Gln Pro Gly Pro Pro Gly Pro Pro Gly Ala Pro 1025 1030 1035 1040 Gly Pro Cys Cys Gly Gly Val Gly Ala Ala Ala Ile Ala Gly Ile Gly 1045 1050 1055 Gly Glu Lys Ala Gly Gly Phe Ala Pro Tyr Tyr Gly 1060 1065 <210> 2 <211> 3207 <212> DNA <213> Pichia pastoris <400> 2 caatacgatt cttatgatgt taagtctggt gttgctgttg gtggtttggc tggttaccca 60 ggtcctgcag gtccacctgg tccacctggt ccacctggga cttctggtca tccaggttct 120 cctggttctc caggttatca aggtccacct ggtgaaccag gtcaagctgg tccttccggt 180 ccacctggtc cacctggagc cattggtcct tctggtccag ctggtaaaga tggtgaatct ggtagacctg gtagaccagg agagagaggt ttgccaggtc cacctggtat tagggtcct 300 gctggtattc ctggttttcc tggtatgaaa ggtcacagag gttcgatgg tagaaacggt 360 gaaaagggag agactggtgc tccaggtttg aaaggtgaaa acggtttgcc tggagagaat 420 480. ggtgctccag gtcctatggg tccaagaggt gctcctggtg aaagaggtag acctggtttg ccaggtgctg ctggtgctag aggtaacgat ggtgctagag gttctgacgg acaaccaggt 540 ccacctggtc cacctggcac tgctggtttt cctggttctc caggtgctaa gggtgaagtt 600 ggtccagctg gttctcctgg ttctaacggt gctccaggtc aaagaggtga gccaggtcct 660 caaggtcatg ctggtgctca aggtccacct ggtccacctg gtattaatgg ttctccaggt 720 ggtaaaggtg aaatgggacc agctggtatt cctggtgctc caggtttgat gggtgctaga 780 ggtccacctg gtccagctgg tgctaacggt gctcctggtt tgagaggtgg tgctggtgaa 840 ccaggtaaaa acggtgctaa aggagagcca ggtcctagg gtgaaagagg tgaggctggt attcctggtg tccctggtgc taagggtgaa gatggtaaag atggttctcc tggagagcca 960 ggtgctaacg gacttccagg tgctgcagga gagagaggtg ctcctggtttt tagaggtcct 1020 gctggtccaa atggtattcc aggtgaaaag ggtccagccg gagagagagg tgctccagga 1080 ccagctggtc caagaggtgc tgctggtgag ccaggtagag atggtgttcc tggtggtcct 1140 ggtatgcgtg gtatgcctgg ttctccaggt ggtcctggtt ctgatggtaa accaggtcca 1200 cctggttctc aaggagagtc tggtagacca ggtccacctg gaccttctgg tcctagaggt 1260 caaccaggtg ttatgggttt cccaggtcct aagggtaacg atggtgctcc aggtaaaaat 1320 ggtgaaagag gtggtcctgg tggtcctggt cctcaaggtc cacctggtaa aaacggagag 1380 actggtccac agggtccacc tggacctacc ggaccaggtg gagataaagg agatacaggt 1440 ccacctggac ctcaaggttt gcaaggtttg cctggtactg gtggtccacc tggagaaaat 1500 ggtaaaccag gagagccagg tcctaaagga gatgctggtg ctccaggtgc tccaggtggt 1560 aaaggagatg ccggtgctcc aggtgaaaga ggtccacctg gtttggccgg tgctccaggt 1620 ttgagaggtg gtgctggtcc acctggacct gagggtggta aaggtgccgc cggtccacct 1680 ggtccacctg gggctgctgg tactccaggt ttgcagggta tgcctggtga aagaggtggt 1740 ttgggttctc caggtcctaa gggagataaa ggagagccag gtggtcctgg tgctgatggt 1800 gttcctggta aagatggtcc aagaggtcct actggtccaa tcggtccacc tggacctgct 1860 ggtcaacctg gagataaagg tgaaggtggt gctcctggtt tgccaggtat tgctggtcca 1920 agaggttctc ctggtgaaag aggtgagacc ggtccacctg gaccagccgg ttttcctggt 1980 gctccaggtc aaaacggtga accaggtggt aaagggaaa gaggtgctcc tggagaagaa 2040 ggagagggtg gtccacctgg tgttgccggt ccacctggtg gttctggtcc agctggtcca 2100 cctggtcctc aaggtgttaa gggtgaaaga ggttctcctg gtggtccagg tgctgctggt 2160 ttcccaggtg ctagaggttt gcctggtcca cctggttcta acggtaaccc tggtccacct 2220 ggaccttccg gttctccagg taagacggt ccacctggac ctgccggtaa cactggtgct 2280 cctggttctc caggtgtttc tggtccaaag ggagatgctg gtcaaccagg agaaaggt 2340 tctccaggtg ctcaaggtcc acctggtgct ccaggtccat tgggtattgc tggtattact 2400 ggtgctagag gtttggctgg tccacctggt atgccaggtc ctagaggttc tccaggacca 2460 cagggagtta agggtgaatc tggtaaacca ggtgctaatg gtttgtctgg agagcgtggt 2520 ccacctggac ctcaaggttt gcctggtttg gctggtactg ctggtgaacc aggtagagat 2580 ggtaaccctg gttctgatgg tttgccaggt agagacggtt ctccaggtgg taaggagat 2640 agaggtgaga atggttctcc cggtgctcca ggtgctcctg gtcatcctgg tccacctggt 2700 cctgttggtc cagctggtaa atccggagat agaggtgaat ctggtcctgc tggtccagct 2760 ggtgctccag gtcctgctgg ttctagaggt gctccaggac ctcagggtcc aagaggagat 2820 aagggtgaaa ctggagagag aggtgctgct ggtattaaag gtcacagagg ttttcctggt 2880 aacccaggtg ctcctggttc tcctggtcct gctggtcaac aaggtgctat tggttctcca 2940 ggacctgccg gtccaagagg tcctgttggt ccatctggtc cacctggtaa agatggtacc 3000 tccggtcatc caggtcctat tggtccacct ggtccaagag gtaatagagg tgaaagaggt 3060 tctgaggtt ctcctgtca cccaggtcag ccaggtccac ctgtccacc tggtgctcca 3120 gggccttgtt gtggtggtgt tggtgctgct gctattgctg gtattggtgg tgaaaaagct 3180 ggtggtttcg ctccatacta tggttaa 3207 <210> 3 <211> 83 <212> PRT <213> Homo sapiens <400> 3 Met Ser Leu Ser Ala Ala Ala Asn Lys Ile Ser Asp Asn Asp Phe Gln 1 5 10 15 Asn Ile Gly Pro Ala Pro Arg Pro Ser Ser Ser Asn Ser Gln Gly Arg 20 25 30 Thr Cys Tyr Asn Gln Thr Gln Pro and Thr Lys Leu Met Ser Gln Leu 35 40 45 Asp Leu Thr Ser Ser Ala Ser His Leu Gly Thr Ser Ser Thr Ser Lys Lys Lys 50 55 60 Gly Trp Val Ser Tyr Lys Asp Asp Gly Ile Leu Ser Phe Ile Trp 65 70 75 80 Gln Lys Arg <210> 4 <211> 249 <212> DNA <213> Pichia pastoris (Pichia pastoris) <400> 4 atgagtttgt cagcagcagc caataagatt tcagataacg acttccagaa catcggacca 60 gcaccaagac ctccttcctc taattctcaa ggtagaactt gttacaacca aactcaacca 120 atcactaagt tgatgtctca attggatttg acttctgctt ctcatttggg tacttctact 180 tctaagaaaa agagtggatg ggtttcctac aaggatgatg gtattttgag ttttatttgg 240 cagaagaga 249

Claims

1. A recombinant full-length type III humanized collagen yeast genetically engineered strain, characterized in that: The engineered strain was obtained by the following method: the CLA4_signal gene and the type III humanized collagen mature peptide gene were tandemly constructed into the vector plasmid pPICZA, introduced into Pichia pastoris GS115, and screened to obtain the transgenic engineered strain; the amino acid sequence of the CLA4_signal is shown in SEQ ID NO.

3.

2. The recombinant full-length type III humanized collagen yeast genetically engineered strain according to claim 1, characterized in that: The engineered strain is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 21547.

3. The recombinant full-length type III humanized collagen yeast genetically engineered strain according to claim 1, characterized in that: The amino acid sequence of the type III humanized collagen mature peptide is shown in SEQ ID NO.1; the nucleotide sequence of the type III humanized collagen mature peptide is optimized according to the codon usage frequency of Pichia pastoris host strain, and the nucleotide sequence is shown in SEQ ID NO.

2.

4. The recombinant full-length type III humanized collagen yeast genetically engineered strain according to claim 3, characterized in that: The amino acid sequence of the recombinant full-length type III humanized collagen does not contain purified tag protein at the amino and carboxyl ends, nor does it contain any other extra amino acids at either end.

5. The recombinant full-length type III humanized collagen yeast genetically engineered strain according to claim 1, characterized in that: The nucleotide sequence of the CLA4_signal is optimized according to the codon usage preference of the host bacteria, and the nucleotide sequence is shown in SEQ ID NO.

4.

6. A recombinant full-length type III humanized collagen yeast genetically engineered strain according to any one of claims 1-5, characterized in that: The PCR amplification primers F1, R1, F2, and R2 for the CLA4_signal gene and the type III humanized collagen mature peptide gene are shown below: F1: aaaacaactaattattcgaaactatgagtttgtcagcagcag, with the restriction site being BstBI; R1: catcataagaatcgtattgtctcttctgccaaataaaactc; F2:ttttatttggcagaagagacaatacgattcttatgatg; R2: ttgttctagaaagctggcggccgcttaaccatagtatggagc, with NotI as the restriction site.

7. A method for constructing a recombinant full-length type III humanized collagen yeast genetically engineered strain, characterized in that: The CLA4_signal gene and the type III humanized collagen mature peptide gene were tandemly constructed into the vector plasmid pPICZA, introduced into Pichia pastoris GS115, and the transgenic engineered strain was obtained by screening. The amino acid sequence of the CLA4_signal is shown in SEQ ID NO.

3.

8. A method for preparing full-length type III humanized collagen using recombinant full-length type III humanized collagen yeast genetically engineered strains, characterized in that... Includes the following steps: 1) Construction of recombinant plasmids: Using the CLA4_signal gene and the type III humanized collagen mature peptide gene as templates, the target genes were amplified by PCR reaction. The PCR products were digested with BstBI / NotI enzymes and then ligated with the vector plasmid pPICZA. The fragments were recovered by gel extraction, ligated in a directional manner, and transformed into Escherichia coli DH10b by heat shock. The plasmids were plated on LB plates containing Zeocin. A small amount of plasmid was extracted from a single colony and identified by enzyme digestion to obtain positive recombinant plasmids. The amino acid sequence of the CLA4_signal is shown in SEQ ID NO.

3. 2) Electroporation transformation: Recombinant plasmids linearized with restriction endonuclease PmeI were electroporated into Pichia pastoris GS115 competent cells, and the transformed colonies were plated on YPDS plates containing Zeocin. 3) Screening for high expression strains: Two-stage culture and fermentation were carried out using YPD seed medium and BSM inorganic medium. Methanol was used to induce the expression of the target product. Dozens of transformed colonies were screened in shake flasks to obtain the high expression strain pPICZA-CLA4_signal-COLⅢ / GS115. The expression stability was verified by shake flask screening. 4) High-density fermentation: Inoculate the fermenter to begin the glycerol culture stage, maintain pH 4.75-5.25, temperature 28-30℃, and tank pressure 0.2-1.0 bar, ensuring dissolved oxygen > 20%; when the carbon source is depleted and dissolved oxygen rises, enter the glycerol feeding stage, maintaining dissolved oxygen in the 20%-30% range until the cell wet weight reaches 200-240 g / L, then stop adding glycerol; after the glycerol is depleted, proceed to the methanol induction stage, ensuring dissolved oxygen > 20%, and end fermentation after 80-100 hours of induction; 5) Purification: The supernatant of the fermentation broth was added to saturated ammonium sulfate to concentrate the target protein. The precipitate was collected by centrifugation and dissolved in citrate buffer. After low-salt elution, high-salt elution and ultrafiltration desalting, the target product was collected to obtain recombinant full-length type III humanized collagen with a purity of over 98%.

9. The application of the recombinant full-length type III humanized collagen yeast genetically engineered strain according to claim 1 in the preparation of topical or invasive skin care products, medical dressings, artificial skin, artificial blood vessels, artificial bones and mucosal protectants.

Images