Methods for identifying Corynebacterium clarithropii

Abstract

This invention proposes the use of at least one of protein X, protein MraZ, and secretory protein, having the nucleotide sequence shown in SEQ ID NO: 1, in the identification of Corynebacterium klebsiella, a primer set, a kit, and their application in the identification of Corynebacterium klebsiella, a method for identifying Corynebacterium klebsiella, and the use of the primer set in the preparation of the kit. Protein X, protein MraZ, and secretory protein can serve as marker genes for the identification of Corynebacterium klebsiella. By detecting these three proteins, accurate identification of Corynebacterium klebsiella can be achieved. Furthermore, the detection results are highly accurate, reproducible, and have good application prospects, especially in the diagnosis of granulomatous mastitis caused by Corynebacterium klebsiella infection.

Description

Technical Field

[0001] This invention relates to the field of biology. Specifically, this invention relates to a method for identifying Corynebacterium kuribda. Background Technology

[0002] Corynebacterium kroppenstedtii was first isolated from clinical sputum specimens by Collins et al. in 1998. Classified as a Gram-positive, short, rod-shaped bacillus belonging to the family Corynebacteriaceae in the order Actinobacteriaceae of the phylum Actinobacteria, it exhibits lipophilic growth. This bacterium does not contain mycolic acid, is non-motile, non-spore-forming, does not produce diphtheria toxin, and is positive for catalase and aescin.

[0003] Corynebacterium krusei has difficulty growing on ordinary culture media (such as brain-heart agar), but grows well on brain-heart agar plates containing Tween 80. However, even so, the positive rate of detection of this bacterium using conventional culture methods is low.

[0004] In recent years, with the development of sequencing technology, the positive detection rate can be improved. However, sequencing technology is expensive and requires professional technicians to operate, and the process is relatively complicated, so it is not suitable for large-scale clinical promotion.

[0005] Quantitative real-time PCR (qPCR) is a nucleic acid analysis technique that is widely used due to its simplicity, speed, convenience, and low cost. Designing specific primers and probes allows for dual recognition of the target sequence, resulting in high specificity and low false positives. Furthermore, this technique integrates PCR amplification, fluorescent labeling, and signal acquisition techniques, exhibiting high sensitivity and the ability to detect multiple copies. Product quantification is achieved directly through fluorescence signal acquisition, demonstrating good linearity and a wide linear range. Since amplification and detection are performed within the same tube, there is no need to open the tube, eliminating contamination issues. Therefore, qPCR is an accurate and rapid method for detecting Corynebacterium kuribstemii.

[0006] Currently, researchers are using 16S ribosomal RNA (16S rRNA) from *Corynebacterium krusei* as a target for primer design in quantitative real-time PCR (qPCR). 16S rRNA is a component of the 30S subunit of the ribosome in prokaryotes, and its length is approximately 1.5 kb. Studies have found that 16S rRNA sequences between species contain both hypervariable regions (V regions, showing differences between species) and conserved regions (highly similar between species). Often, full-length amplification and sequencing of the entire 16S rRNA region (~1.5 kb) is necessary for species identification. Commonly used 16S rRNA sequencing selects the variable region (approximately 100-300 bp), which, while allowing for genus-level identification, is difficult to differentiate at the species level. Similarly, the target region for qPCR is generally within 100-200 bp, although using probe primers for hybridization can significantly improve specificity. However, due to the limited target area, the ability to differentiate species is limited, especially when distinguishing between different species within the same genus *Corynebacterium*, which may lead to false positives. Therefore, a more specific method is needed to identify *Corynebacterium kuribsi*. Summary of the Invention

[0007] This invention aims to at least partially solve at least one of the technical problems existing in the prior art. To this end, this invention proposes the use of at least one of the genes encoding protein X, protein MraZ, and secretory protein in the identification of *Corynebacterium kuristegia*, a primer set, a kit, and their application in the identification of *Corynebacterium kuristegia*, a method for identifying *Corynebacterium kuristegia*, and the use of the primer set in the preparation of the kit. Protein X, protein MraZ, and secretory protein can serve as marker genes for identifying *Corynebacterium kuristegia*. Accurate identification of *Corynebacterium kuristegia* can be achieved by detecting these three proteins. Furthermore, the detection results are highly accurate, reproducible, and have promising application prospects, especially in the diagnosis of granulomatous mastitis caused by *Corynebacterium kuristegia* infection.

[0008] In one aspect of the invention, the invention proposes the use of at least one of a gene encoding protein X, a gene encoding protein MraZ, and a gene encoding a secretory protein in the identification of *Corynebacterium kuristegia*, wherein the gene encoding protein X has a nucleotide sequence as shown in SEQ ID NO: 1 or a nucleotide sequence having at least 70% homology with the nucleotide sequence shown in SEQ ID NO: 1. The genes encoding protein X, protein MraZ, and the secretory protein can serve as marker genes for the identification of *Corynebacterium kuristegia*. Accurate identification of *Corynebacterium kuristegia* can be achieved by detecting these three genes, and the detection results are highly accurate, reproducible, and have promising application prospects, especially in the diagnosis of granulomatous mastitis caused by *Corynebacterium kuristegia* infection.

[0009] According to an embodiment of the present invention, the gene encoding the protein MraZ has a nucleotide sequence as shown in SEQ ID NO: 2 or a nucleotide sequence having at least 70% homology with the nucleotide sequence shown in SEQ ID NO: 2, and the gene encoding the secretory protein has a nucleotide sequence as shown in SEQ ID NO: 3 or a nucleotide sequence having at least 70% homology with the nucleotide sequence shown in SEQ ID NO: 3.

[0010] In another aspect of the invention, a primer set is provided. According to embodiments of the invention, the primer set comprises at least one of the following three primer sets: a first primer set suitable for amplifying at least a portion of a gene encoding protein X, wherein protein X is as defined in the preceding applications; a second primer set suitable for amplifying at least a portion of a gene encoding protein MraZ, wherein protein MraZ is as defined in the preceding applications; and a third primer set suitable for amplifying at least a portion of a gene encoding a secretory protein, wherein the secretory protein is as defined in the preceding applications. Using the primer set of the present invention, genes encoding protein X, protein MraZ, and the secretory protein can be amplified, thereby aiding in the identification of Corynebacterium kuristegiae.

[0011] According to an embodiment of the present invention, the first primer set includes a first primer having a nucleotide sequence as shown in SEQ ID NO: 4, a second primer having a nucleotide sequence as shown in SEQ ID NO: 5, and a first probe primer having a nucleotide sequence as shown in SEQ ID NO: 6; the second primer set includes a third primer having a nucleotide sequence as shown in SEQ ID NO: 7, a fourth primer having a nucleotide sequence as shown in SEQ ID NO: 8, and a second probe primer having a nucleotide sequence as shown in SEQ ID NO: 9; the third primer set includes a fifth primer having a nucleotide sequence as shown in SEQ ID NO: 10, a sixth primer having a nucleotide sequence as shown in SEQ ID NO: 11, and a third probe primer having a nucleotide sequence as shown in SEQ ID NO: 12, wherein the first probe primer, the second probe primer, and the third probe primer have a fluorescent gene.

[0012] In another aspect of the invention, a kit is provided. According to an embodiment of the invention, the kit includes the primer set described above. The primer set described above can be used to amplify genes encoding protein X, protein MraZ, and secreted proteins, thereby aiding in the identification of Corynebacterium kuristegia.

[0013] In another aspect, the present invention proposes the application of the aforementioned primer set or kit in the identification of Corynebacterium kuristegia. As previously stated, the primer set or kit of the present invention can amplify the genes encoding protein X, protein MraZ, and secretory protein, thereby enabling the identification of Corynebacterium kuristegia. This contributes to in-depth theoretical research and practical application of the characteristics of Corynebacterium kuristegia, such as in the diagnosis of granulomatous mastitis caused by Corynebacterium kuristegia infection.

[0014] In another aspect, the present invention provides a method for identifying *Corynebacterium clarithroptus*. According to embodiments of the invention, the method includes: determining whether a test strain contains at least one of protein X, protein MraZ, and a secretory protein; the presence of at least one of protein X, protein MraZ, and a secretory protein in the *Corynebacterium clarithroptus* is an indicator that the test strain is *Corynebacterium clarithroptus*, wherein protein X, protein MraZ, and the secretory protein are as defined in the foregoing uses. Genes encoding protein X, protein MraZ, and the secretory protein can serve as marker genes for *Corynebacterium clarithroptus*, and accurate identification of *Corynebacterium clarithroptus* can be achieved by detecting these three genes.

[0015] According to an embodiment of the present invention, the method includes: extracting DNA from the test strain; using the DNA as a template, amplifying it using the primer set or kit described above to obtain an amplification product; performing comparative analysis on the amplification product to determine whether it can encode protein X, protein MraZ, and / or secretory protein; when the amplification product can encode protein X, protein MraZ, and / or secretory protein, it is an indication that the test strain is Corynebacterium cristatum.

[0016] In another aspect of the invention, the use of the aforementioned primer set in the preparation of a kit is proposed. According to an embodiment of the invention, the kit is used for the diagnosis of granulomatous mastitis. Using the primer set of the present invention, genes encoding protein X, protein MraZ, and secretory proteins can be amplified, enabling the identification of Corynebacterium cristatum and aiding in the diagnosis of granulomatous mastitis caused by Corynebacterium cristatum infection.

[0017] According to an embodiment of the present invention, the granulomatous mastitis is caused by infection with Corynebacterium kuribda.

[0018] Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. Attached Figure Description

[0019] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the description of the embodiments taken in conjunction with the following drawings, in which:

[0020] Figures 1-3The diagrams showing the amplification results according to one embodiment of the present invention are shown respectively. Detailed Implementation

[0021] The embodiments of the present invention are described in detail below. These embodiments are exemplary and are only used to explain the present invention, and should not be construed as limiting the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments used, unless otherwise specified, are all commercially available conventional products.

[0022] In one aspect of the invention, the invention proposes the use of at least one of a gene encoding protein X, a gene encoding protein MraZ, and a gene encoding a secretory protein in the identification of *Corynebacterium kuristegia*, wherein the gene encoding protein X has a nucleotide sequence as shown in SEQ ID NO: 1 or a nucleotide sequence having at least 70% homology with the nucleotide sequence shown in SEQ ID NO: 1. Studies have found that the genes encoding protein X (unknown protein), protein MraZ, and the secretory protein can serve as marker genes for identifying *Corynebacterium kuristegia*. Accurate identification of *Corynebacterium kuristegia* can be achieved by detecting these three genes, and the detection results are highly accurate, reproducible, and have promising application prospects, especially in the diagnosis of granulomatous mastitis caused by *Corynebacterium kuristegia* infection.

[0023] The gene encoding protein X has the following nucleotide sequence or a nucleotide sequence that is at least 70% homologous to this sequence:

[0024] ATGCATATTCGGCCAACATTTGACCGGTATTCTCCTAGTGACCTGTCTTGGCTTGGTTCACGTCATGCTGTGGACAATGCGGAGACGGGAACATTGGGGGAAAAGACAACCCATATTCGACGGGCAGTTTTACCGTCGGGCACCGCTTTGCACCGTGACGGCGACTACTGGCTTCCGGTGACATCGAAAACGCAGTCTGTGGACGGTTTTTTGCTCACTGACCAGGACAATGTTCCTGGAGAGGTTGTACCCATTGTGTGGCATGGCCGTATCCGCGTTGATCGTCTTCCAGATTCAAACAACCGCGTGAAAATCGCAGAATGCGATCATCCTGAGTTCACTTTCGTTCACGAGCCGTCCGATTCTCTATGGAATGAGGATGGCTCGACGAATTTTGATCAGGTCGGATCACTGCGAGGTGATATTTAA(SEQ ID NO: 1)

[0025] The gene encoding the protein MraZ has the following nucleotide sequence, or a nucleotide sequence having at least 70% homology with the sequence:

[0026] ATGTTCTTCGGTACTTTCACCCCCAAGATGGACGACAAAGGACGCTTGACTCTTCCGGCCAAGTTTCGCGATGAGTTAGCAGAAGGCTTGATGGTGACGAAAGGCCAAGACCATTCATTAGCCATCTATCCGCGCAACGTGTTCCTCGAACGCGCTCGCAAAGCTGCTGCTGCATCTCGAACGAACCCGGAGGCTCGCGCATTTGTGCGTAACTTAGCGGCCAGCGCGGATGAACAATCTGTTGATGGTCATGGGCGAATAACGATTTCGCCTGATCATCGTCGCTACGCAGGGTTAAGCAAAGAATGCGTCGTGATTGGTTCTGTTGACTTCGTCGAAATCTGGAATGCGGAGTCGTGGAATCAGTACCAAGCCGAACATGAAGAAAGCTACGCCAACGGTGACGATGCTGCTTTCATGGACTTCCTCTAA(SEQ ID NO: 2)

[0027] Genes encoding secreted proteins have the following nucleotide sequence or a nucleotide sequence that is at least 70% homologous to this sequence:

[0028] (SEQ ID NO: 3)

[0029] In another aspect of the invention, a primer set is provided, which contains three sets of primers for amplifying at least a portion of a gene encoding protein X, at least a portion of a gene encoding protein MraZ, and at least a portion of a gene encoding a secretory protein, respectively.

[0030] Specifically, the first primer set includes a first primer having a nucleotide sequence as shown in SEQ ID NO: 4, a second primer having a nucleotide sequence as shown in SEQ ID NO: 5, and a first probe primer having a nucleotide sequence as shown in SEQ ID NO: 6. The first and second primers described above can be used to specifically amplify a portion of the sequence encoding protein X.

[0031] The second primer set includes a third primer having the nucleotide sequence shown in SEQ ID NO: 7, a fourth primer having the nucleotide sequence shown in SEQ ID NO: 8, and a second probe primer having the nucleotide sequence shown in SEQ ID NO: 9. Using the third and fourth primers, a portion of the sequence encoding the MraZ protein can be specifically amplified. The second probe primer has a fluorescent gene that can generate a fluorescent signal, thereby determining whether the MraZ protein is present based on the fluorescence signal.

[0032] The third primer set includes a fifth primer with the nucleotide sequence shown in SEQ ID NO: 10, a sixth primer with the nucleotide sequence shown in SEQ ID NO: 11, and a third probe primer with the nucleotide sequence shown in SEQ ID NO: 12. Using the fifth and sixth primers, a partial sequence encoding a secretory protein gene can be specifically amplified. The third probe primer has a fluorescent gene that can generate a fluorescent signal, thereby determining whether a secretory protein is present based on the fluorescence signal.

[0033] The first, second, and third probe primers contain fluorescent genes. This generates a detectable fluorescent signal, allowing for the determination of the presence of protein X, marZ, and secreted proteins based on the fluorescence signal. This invention does not strictly limit the type of fluorescent gene, as long as it can generate a detectable fluorescent signal and does not affect primer-DNA strand binding. Specific selection can be flexible and based on actual conditions. For example, it can be FAM, ROX, VIC, etc.

[0034] Table 1 Primer Sequences

[0035]

[0036] The present invention will be explained below with reference to embodiments. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0037] Example 1: Selecting a specific gene that can specifically represent Corynebacterium kuribsi.

[0038] MetaPhIAn can analyze sequence information from known databases to generate unique marker genes for each species. These marker genes are present only in that species and are absent or significantly different in other species. Therefore, these marker genes can serve as target regions for species identification. However, when designing primers, because this database is based on existing sequenced genomes, some species may only have 1-2 sequenced whole genomes. Therefore, marker genes may differ in actual strains due to random sequencing errors or their own base mutations. It is therefore best to collect different strains of the same species, verify sequence conservation, and select the most conserved regions of the marker genes to design primers suitable for broad-spectrum detection.

[0039] Based on this, whole-genome sequencing was performed on 5 strains of Corynebacterium kuribda. Then, MetaPhlAn was used to search for marker genes of Corynebacterium kuribda in the database. The sequences of the found marker genes were compared with the sequences of the same genes in the sequencing data of the 5 strains. Genes with a length greater than 300 bp and identity greater than 98% were selected as targets. The results are shown in Table 2. Three genes can be used as targets.

[0040] Table 2: Target regions of Corynebacterium kuribsiella pneumoniae

[0041]

[0042]

[0043] Example 2: Designing primers and verifying primer specificity

[0044] Primers for quantitative real-time PCR were designed targeting the sequences. Each designed primer sequence was compared with sequences in the database and those from the sequenced strains to confirm their compatibility with existing sequences. After screening, primers designed for protein X, MraZ, and secreted proteins are shown in Table 1. For protein X, the inventors designed amplification primers CK-F1 / CK-F2, and the probe primer CK-PT1. Amplification and hybridization of protein X were performed to generate a fluorescent signal, confirming the presence of protein X and thus the presence of *Corynebacterium kuristegi*. Similarly, amplification primers CK-F2 / CK-F2 and probe primer CK-PT2 were used to verify the MraZ gene, and amplification primers CK-F3 / CK-F3 and probe primer CK-PT3 were used to verify the secreted protein.

[0045] The species *C. amycolatum* and *C. tuberculostearicum* are very closely related to *C. koraiensis*, so these two species were used as control bacteria to verify the specificity of the designed primers. The experimental procedure used genomic DNA from five isolated strains of *Corynebacterium kuriformis*, one strain of *Corynebacterium adenophorum*, and one strain of *Corynebacterium tuberculosis* as templates. ROCHE's real-time quantitative PCR enzyme was used for detection. The transcriptional real-time PCR system and reverse transcription real-time PCR reaction were performed according to the enzyme's instructions. Because the probe primers for the three target genes carried different fluorescent labels, the designed amplification primers and probe primers were placed in the same tube for differentiation using fluorescent labels. The results are shown in Table 3. In the detection of the five *Corynebacterium kuriformis* strains, VIC, ROX, and FAM fluorescence were successfully detected. However, these three fluorescent signals were not detected in the detection of *Corynebacterium adenophorum* and *Corynebacterium tuberculosis*. Therefore, the designed primers have good specificity for *Corynebacterium kuriformis*, and all three primer sets can be used as primer sequences for detecting *Corynebacterium kuriformis*.

[0046] Table 3. Verification of the specificity of the three primer sets

[0047]

[0048] Note: A Ct value < 37 indicates a true detection.

[0049] Example 3: Detection of samples from patients with granulomatous mastitis using a validated primer set.

[0050] Selected samples were obtained using the previously reported nanopore sequencing method (Xin-Qian Li, Jing-Ping Yuan, Ai-Si Fu, Hong-Li Wu, Ran Liu, Tian-gang Liu, Sheng-Rong Sun & Chuang Chen (2021) New Insights of Corynebacterium kroppenstedtii in Granulomatous Lobular Mastitis based on Nanopore Sequencing, Journal of Investigative Surgery, DOI: 10.1080 / 08941939.2021.1921082The nucleic acid samples from three patients with granulomatous mastitis were used to verify the discriminative ability of the three primer sets in actual clinical samples. ROCHE's real-time quantitative PCR enzyme was used for detection. The transcriptional real-time PCR system and reverse transcription real-time PCR reaction were performed according to the enzyme's instructions. Because the probe primers for the three target genes carried different fluorescent labels, the designed amplification primers and probe primers were placed in the same tube for differentiation using fluorescent labels. The results are as follows: Figure 1-3 As shown, the three target genes were successfully amplified in all three samples, thus proving the detection of Corynebacterium kuribstemii in the three samples. This demonstrates that the three sets of primers of this invention have good clinical application value.

[0051] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0052] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention. SEQUENCE LISTING <110> Wuhan Zhenxi Medical Laboratory Co., Ltd. <120> Methods for identifying Corynebacterium clarithropii <130> BI3211066 <160> 12 <170> PatentIn version 3.3 <210> 1 <211> 429 <212> DNA <213> Artificial <220> <223> 1 <400> 1 atgcatattc ggccaacatt tgaccggtat tctcctagtg acctgtcttg gcttggttca 60 cgtcatgctg tggacaatgc ggagacggga acattggggg aaaagacaac ccatattcga 120 cgggcagttt taccgtcggg caccgctttg caccgtgacg gcgactactg gcttccggtg 180 acatcgaaaa cgcagtctgt ggacggtttt ttgctcactg accaggacaa tgttcctgga 240 gaggttgtac ccattgtgtg gcatggccgt atccgcgttg atcgtcttcc agattcaaac 300 aaccgcgtga aaatcgcaga atgcgatcat cctgagttca ctttcgttca cgagccgtcc 360 gattctctat ggaatgagga tggctcgacg aattttgatc aggtcggatc actgcgaggt 420 gatatttaa 429 <210> 2 <211> 432 <212> DNA <213> Artificial <220> <223> 2 <400> 2 atgttcttcg gtactttcac ccccaagatg gacgacaaag gacgcttgac tcttccggcc 60 aagtttcgcg atgagttagc agaaggcttg atggtgacga aaggccaaga ccattcatta 120 gccatctatc cgcgcaacgt gttcctcgaa cgcgctcgca aagctgctgc tgcatctcga 180 acgaacccgg aggctcgcgc atttgtgcgt aacttagcgg ccagcgcgga tgaacaatct 240 gttgatggtc atgggcgaat aacgatttcg cctgatcatc gtcgctacgc agggttaagc 300 aaagaatgcg tcgtgattgg ttctgttgac ttcgtcgaaa tctggaatgc ggagtcgtgg 360 aatcagtacc aagccgaaca tgaagaaagc tacgccaacg gtgacgatgc tgctttcatg 420 gacttcctct aa 432 <210> 3 <211> 555 <212> DNA <213> Artificial <220> <223> 3 <400> 3 atgagccacg gaaagtcaat attcctccgg atcattatga tcctggtcgc cgccatcctc 60 atcgcaggcg gtctatgggg catcggccta gccttgcacc tcacaccagc cgaaaagctc 120 ggtgagtacg cagacaccag cttctggggc acgttgaccg ataagtcctg gtacccgacg 180 gtcctcggtg tggcgtcggc aatcctgatt cttcttggcc tctggttctg gtggttaatc 240 atcgatcgcc gccgcgtcac caaggtggaa gcaaaagaat ctgccgacaa cggacgagtc 300 accgttcggc tggacgacat cgcgtccgct gtgtcgcagg atctcacccg gtatgacggt 360 attgcggact gcaaataccg ctctgaggtg gaccgtggcc agaaggtgct gacgatgacg 420 ttgcggtgcg acccgcatgc cgatctggat catgtgcggg gcgagtgccg ccaagcagcg 480 tcggatatcg tttctgcgct cccccaggaa gacgtggata cgcgattcct catccacctg 540 gataaagcga gctag 555 <210> 4 <211> 18 <212> DNA <213> Artificial <220> <223> 4 <400> 4 ccggtattct cctagtga 18 <210> 5 <211> 18 <212> DNA <213> Artificial <220> <223> 5 <400> 5 cgtcgaatat gggttgtc 18 <210> 6 <211> 20 <212> DNA <213> Artificial <220> <223> 6 <400> 6 cgtctccgca ttgtccacag 20 <210> 7 <211> 18 <212> DNA <213> Artificial <220> <223> 7 <400> 7 tcgtgattgg ttctgttg 18 <210> 8 <211> 19 <212> DNA <213> Artificial <220> <223> 8 <400> 8 cgtagctttc ttcatgttc 19 <210> 9 <211> 23 <212> DNA <213> Artificial <220> <223> 9 <400> 9 tactgattcc acgactccgc att 23 <210> 10 <211> 19 <212> DNA <213> Artificial <220> <223> 10 <400> 10 ccacggaaag tcaatattc 19 <210> 11 <211> 18 <212> DNA <213> Artificial <220> <223> 11 <400> 11 caggacttat cggtcaac 18 <210> 12 <211> 21 <212> DNA <213> Artificial <220> <223> 12 <400> 12 cattatgatc ctggtcgccg c 21

Claims

1. Use of primers for amplifying at least one of the genes encoding protein X, protein MraZ, and a secretion protein in the identification of Corynebacterium kuristegi for non-diagnostic purposes, wherein the nucleotide sequence of the gene encoding protein X is shown in SEQ ID NO: 1, the nucleotide sequence of the gene encoding protein MraZ is shown in SEQ ID NO: 2, and the nucleotide sequence of the gene encoding the secretion protein is shown in SEQ ID NO:

3.

2. Application of primer sets or kits containing said primer sets in the identification of Corynebacterium kuribstemii for non-diagnostic purposes; The primer set includes at least one of the following three sets of primers: A first primer set, the first primer set being adapted to amplify at least a portion of a gene encoding protein X, said gene encoding protein X being as defined in the use described in claim 1; A second primer set, the second primer set being adapted to amplify at least a portion of a gene encoding the protein MraZ, said gene encoding the protein MraZ being as defined in the use described in claim 1; A third primer set, said third primer set being adapted to amplify at least a portion of a gene encoding a secretory protein, said gene encoding a secretory protein being as defined in the use described in claim 1.

3. Use according to claim 2, characterized in that, The first primer set includes a first primer with a nucleotide sequence as shown in SEQ ID NO: 4, a second primer with a nucleotide sequence as shown in SEQ ID NO: 5, and a first probe primer with a nucleotide sequence as shown in SEQ ID NO: 6; The second primer set includes a third primer with a nucleotide sequence as shown in SEQ ID NO: 7, a fourth primer with a nucleotide sequence as shown in SEQ ID NO: 8, and a second probe primer with a nucleotide sequence as shown in SEQ ID NO: 9; The third primer set includes a fifth primer with a nucleotide sequence as shown in SEQ ID NO: 10, a sixth primer with a nucleotide sequence as shown in SEQ ID NO: 11, and a third probe primer with a nucleotide sequence as shown in SEQ ID NO: 12; The first, second, and third probe primers contain fluorescent genes.

4. A method for identifying Corynebacterium koilus for non-diagnostic purposes, characterized in that, include: Determine whether the test strain contains at least one of the following: a gene encoding protein X, a gene encoding protein MraZ, and a gene encoding a secreted protein. The presence of at least one of the following genes in the test strain—a gene encoding protein X, a gene encoding protein MraZ, and a gene encoding a secreted protein—is an indicator that the test strain is *Corynebacterium clarithroptus*. The genes encoding protein X, MraZ, and secretion proteins are as defined in the use described in claim 1.

5. The method according to claim 4, characterized in that, include: Extract DNA from the test strain; Using the DNA as a template, amplification is performed using the primer set or kit described in claim 2 or 3 to obtain the amplification product; The amplification products are compared and analyzed to determine whether they contain genes encoding protein X, protein MraZ, and / or secretory proteins. When the amplification product contains a gene encoding protein X, a gene encoding protein MraZ, and / or a gene encoding a secretory protein, it is an indication that the test strain is Corynebacterium cristatum.

6. The use of the primer set in the preparation of the reagent kit, characterized in that, The kit is used to diagnose Corynebacterium clarithroplasiae infection, and the primer set includes at least one of the following three sets of primers: A first primer set, the first primer set being adapted to amplify at least a portion of a gene encoding protein X, said gene encoding protein X being as defined in the use described in claim 1; A second primer set, the second primer set being adapted to amplify at least a portion of a gene encoding the protein MraZ, said gene encoding the protein MraZ being as defined in the use described in claim 1; A third primer set, said third primer set being adapted to amplify at least a portion of a gene encoding a secretory protein, said gene encoding a secretory protein being as defined in the use described in claim 1.

7. The use according to claim 6, characterized in that, The first primer set includes a first primer with a nucleotide sequence as shown in SEQ ID NO: 4, a second primer with a nucleotide sequence as shown in SEQ ID NO: 5, and a first probe primer with a nucleotide sequence as shown in SEQ ID NO: 6; The second primer set includes a third primer with a nucleotide sequence as shown in SEQ ID NO: 7, a fourth primer with a nucleotide sequence as shown in SEQ ID NO: 8, and a second probe primer with a nucleotide sequence as shown in SEQ ID NO: 9; The third primer set includes a fifth primer with a nucleotide sequence as shown in SEQ ID NO: 10, a sixth primer with a nucleotide sequence as shown in SEQ ID NO: 11, and a third probe primer with a nucleotide sequence as shown in SEQ ID NO: 12; The first, second, and third probe primers contain fluorescent genes.

Images