Use of attenuated guanylate kinase to improve the ability of a strain to produce a nucleoside or derivative thereof
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-07-28
- Publication Date
- 2026-08-11
AI Technical Summary
鲜有文献报道其他基因位点对核苷生产菌性能提升的作用效果
Smart Images

Figure BDA0003185501940000041 
Figure BDA0003185501940000051
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and in particular to the application of a weakened guanylate kinase in improving the ability of bacterial strains to produce nucleosides or their derivatives. Background Technology
[0002] Nucleosides are a general term for a class of glycosides, which are components of nucleic acids and nucleotides. Nucleosides are formed by the condensation of D-ribose or D2-deoxyribose with pyrimidine or purine bases. Nucleosides are generally colorless crystals, insoluble in common organic solvents, readily soluble in hot water, and have a melting point of 160–240℃. Nucleosides formed from D-ribose are called ribonucleosides, which participate in the composition of RNA; nucleosides formed from D-α-deoxyribose are called deoxyribonucleosides, which participate in the composition of DNA. D-ribose condenses with adenine, guanine, cytosine, thymine, or uracil to form the corresponding adenine ribonucleosides, guanine ribonucleosides, cytosine ribonucleosides, thymine ribonucleosides, and uracil ribonucleosides, which are abbreviated as adenosine (A), guanosine (G), cytosine (C), thymine (T), and uridine (U), respectively.
[0003] Adenosine, or adenosine nucleoside, chemically named 6-amino-9-β-D-furanoribosyl-9-hydropurine, is a product of adenosine nucleotide dephosphorylation and an important nucleotide derivative. Adenosine is an endogenous nucleoside found throughout human cells. It can directly enter the myocardium, where it is phosphorylated to adenosine monophosphate, participating in myocardial energy metabolism and also contributing to coronary artery dilation and increased blood flow. Adenosine has physiological effects on the cardiovascular system and many other systems and tissues in the body. Besides being used as a specific drug for treating heart disease, adenosine is also an important intermediate in the synthesis of adenosine triphosphate (ATP), adenine, adenosine monophosphate, and vidarabine, and is widely used in the pharmaceutical and other industries.
[0004] Guanine nucleoside, also known as 9-β-D-furanoriboguanine, or simply guanosine, has a variety of uses and plays a wide role in the food and pharmaceutical industries. In the food sector, guanosine is an important precursor to disodium guanylate, which, when used in combination with disodium inosinate, serves as a flavor enhancer widely used in condiments such as chicken bouillon and soy sauce. In the pharmaceutical field, guanosine can serve as a pharmaceutical intermediate for various antiviral drugs, such as acyclic guanosine, triazole nucleoside, and guanosine triphosphate sodium, all of which require guanosine as a raw material for synthesis.
[0005] Inosine, chemical name: 9-β-D-ribosinopurine, is a cellular metabolism modifier. It participates in nucleic acid metabolism, converting into inosinic acid and adenosine triphosphate (ATP) in the body. It participates in cellular energy metabolism and protein synthesis, increasing the activity of various enzymes, especially coenzyme A and pyruvate oxidase, thus enabling cells to continue metabolism under hypoxic conditions. It also activates liver function, promotes the recovery of damaged liver, stimulates antibody production, and promotes intestinal iron absorption. It is suitable for various chronic liver diseases, heart diseases, leukopenia or thrombocytopenia, central retinitis, etc., and can prevent the liver and heart side effects caused by antimony exposure.
[0006] Purine nucleosides can be synthesized through both chemical and microbial fermentation methods, with microbial fermentation becoming the mainstream method due to its numerous advantages (mild conditions and low environmental pollution). However, fermentation methods are characterized by high cost and low conversion rates. Therefore, it is urgent to improve the performance of microbial strains through metabolic engineering.
[0007] Currently, the main methods for improving the performance of nucleoside-producing bacteria are the optimization of purine operons and the modification of the nucleoside export protein gene pbuE. This includes overexpression of purine operon genes such as purF, optimization of purine operon riboswitches, and optimization through point mutations in the pbuE gene. Few studies report the effects of other gene loci on improving the performance of nucleoside-producing bacteria. Summary of the Invention
[0008] To address the problems existing in the prior art, the present invention provides the application of weakened guanylate kinase in improving the ability of strains to produce nucleosides or their derivatives.
[0009] In a first aspect, the present invention provides the application of weakened guanylate kinase in improving the ability of strains to produce nucleosides or their derivatives.
[0010] Furthermore, the weakened guanylate kinase is obtained by inhibiting the expression of guanylate kinase in the strain; preferably, the guanylate kinase comprises the amino acid sequence shown in SEQ ID NO.1.
[0011] Furthermore, the inhibition of guanylate kinase expression in the strain includes any one or more of the following:
[0012] I) The guanylate kinase described in the text undergoes a point mutation leading to attenuation;
[0013] II) The gene encoding the guanylate kinase is weakened due to gene segment deletion or premature termination.
[0014] III) The gene encoding the guanylate kinase undergoes start codon weakening, leading to attenuation.
[0015] IV) The weakening is caused by the weakening of the regulatory region of the gene encoding guanylate kinase.
[0016] Furthermore, the point mutation is any one or more of the following mutation modes of guanylate kinase:
[0017] The isoleucine at position 66 was mutated to methionine, the valine at position 105 was mutated to leucine, and the asparagine at position 133 was mutated to lysine.
[0018] And / or, the start codon is weakened such that the start codon of the gene encoding the guanylate kinase is changed from ATG to GTG or TTG;
[0019] And / or, the weakening of the regulatory region includes: replacing the promoter of the gene encoding the guanylate kinase, or mutations occurring in the -10 region and / or the -35 region.
[0020] Further, by method II), the amino acid sequence of the weakened guanylate kinase is shown in SEQ ID No. 5, and the nucleotide sequence is shown in SEQ ID No. 6;
[0021] The amino acid sequence of the attenuated guanylate kinase obtained by method III is shown in SEQ ID No. 7, and the nucleotide sequence is shown in SEQ ID No. 8.
[0022] The amino acid sequence of the attenuated guanylate kinase obtained by method IV is shown in SEQ ID No. 9, and the sequence is shown in SEQ ID No. 10.
[0023] Furthermore, the strain is:
[0024] Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus pumilus, or Corynebacterium ammonia-producing.
[0025] Furthermore, the nucleoside is one or more of the following: glycoside, inosine, guanosine, or flavin.
[0026] Secondly, the present invention provides an ylzA protein mutant, wherein the ylzA protein mutant is obtained by any one or more of the following mutations to the ylzA protein with the amino acid sequence shown in SEQ ID NO.2:
[0027] The 77th leucine was mutated to arginine, the 81st glutamic acid to glycine, and the 85th aspartic acid to glutamic acid.
[0028] Thirdly, the present invention provides a recombinant microorganism comprising the attenuated guanylate kinase and / or the ylzA protein mutant mentioned in the aforementioned applications.
[0029] Furthermore, the starting strain of the recombinant microorganism is Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus pumilus, or Corynebacterium ammonia-producing.
[0030] The present invention further provides the application of the recombinant microorganism in the production of nucleosides or their derivatives.
[0031] The present invention has the following beneficial effects:
[0032] This invention discovers that inhibiting guanylate kinase expression or mutating the ylzA protein in strains can enhance their nucleoside production capacity. Furthermore, it provides mutants of guanylate kinase and ylzA protein, along with their corresponding mutation sites. Experimental verification shows that inhibiting guanylate kinase expression or mutating the ylzA protein significantly increases nucleoside production in the strains, indicating that weakened guanylate kinase or mutated ylzA protein plays a significant role in nucleoside synthesis. Detailed Implementation
[0033] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention.
[0034] Unless otherwise specified, all reagents used in the embodiments of this invention are commercially available products and can be purchased through commercial channels. The original strains *B. amyloliquefaciens* 13952 (NCBI reference gene sequence CP009748.1) and *B. subtilis* A5 used in this invention were preserved in our laboratory. The adenosine, guanosine, and inosine standards used in this invention were purchased from Sigma-Aldrich (http: / / www.sigmaaldrich.com / sigma-aldrich). The molecular biology reagents used, such as DNA polymerase, DNA purification kit, restriction endonucleases, dephosphorylases, and DNA ligases, were purchased from Thermo Fisher Scientific (http: / / www.thermoscientificbio.com / fermentas). Other biochemical reagents were purchased from Sangon Biotech (Shanghai) Co., Ltd. (http: / / www.sangon.com / ).
[0035] The primer sequences involved in each embodiment are shown in Table 1.
[0036] Table 1 Primer sequences
[0037]
[0038]
[0039] Example 1: Mutagenesis screening to obtain high-yielding guanosine-producing strains
[0040] In this embodiment, after multiple rounds of mutagenesis screening, B. amyloliquefaciens ATCC13952 was obtained as a B. amyloliquefaciens MHA mutant strain. This strain produced guanosine at a level of 18 g / L in shake flasks with a conversion rate of 15%, making it a high-yielding guanosine bacterium.
[0041] Comparative genomics analysis revealed that B. amyloliquefaciens MHA possesses gmk I66M gmk V105L gmk N133K ylzA L77R ylzA E81G ylzA D85E Point mutations in six key genes, as detected by enzyme activity assays, revealed a significant decrease in guanylate kinase activity in the mutant bacteria. Therefore, it is possible that mutations in guanylate kinase lead to reduced guanylate kinase activity, promoting high guanosine production. This invention therefore introduces these six site mutations, along with inactivation and weakening modifications of the gmk gene, into the starting strains *B. amyloliquefaciens* ATCC13952 (Δupp) and *B. subtilis* A5 for verification.
[0042] Example 2: Engineered strain B. amyloliquefaciens G11 (gmk) I66M ), G12(gmk V105L ), G13(gmk N133K Construction of )
[0043] Using primers gmk66-A-1f / 1r and gmk66-A-2f / 2r, gmk105-A-1f / 1r and gmk105-A-2f / 2r, and gmk133-A-1f / 1r and gmk133-A-2f / 2r, with the genome of *B. amyloliquefaciens* 13952 as a template, and using Pfu high-fidelity DNA polymerase, gmk66-A-1f / 1r and gmk66-A-2f / 2r were amplified to obtain gmk66-A-1f / 1r and gmk66-A-2f / 2r, respectively, and the genome of *B. amyloliquefaciens* 13952 was used as a template. * Upstream and downstream homologous arms.
[0044] The upstream and downstream fragments were fused using primers gmk66-A-1f / 2r, gmk105-A-1f / 2r, gmk133-A-1f / 2r, and ylzA-A-1f / 2r to obtain A-gmk. I66M A-gmk V105L A-gmk N133KHomologous fragments (containing I66M mutation, V105L mutation, and N133K mutation, respectively; the amino acid sequence of gmk is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.3. All three mutations are performed on the amino acids shown in SEQ ID NO.1, and the corresponding nucleotide mutations are: t to g at position 158, g to t at position 313, and c to g at position 399, based on SEQ ID NO.3). Each fragment was then ligated to the pKSU (tool vector) plasmid via SalI / PstI double digestion, followed by transformation to obtain the plasmid pKSU-A-gmk. I66M pKSU-A-gmk V105L pKSU-A-gmk N133K .
[0045] The transformants were electrochemically converted into B. amyloliquefaciens 13952(Δupp). Transformants were screened on LB plates containing 2.5 μg / mL chloramphenicol at 30 °C. The obtained transformants were inoculated into 5 mL LB liquid, cultured at 42 °C and 200 rpm for 12 h, and passaged for one generation. The transformed transformants were then diluted and plated on LB plates containing 5 μg / mL chloramphenicol to obtain the first recombinant.
[0046] The primary recombinant was inoculated into 5 ml of LB broth, incubated at 42 °C and 200 rpm for 12 h, and passaged. The recombinants were then diluted and plated onto LB plates containing 0.8 μM 5-FU to screen for secondary recombinants. The resulting recombinants were obtained by introducing gmk into *B. amyloliquefaciens* 13952Δupp. I66M、 gmk V105L gmk N133K Mutant B. amyloliquefaciens G11(gmk) I66M ), G12(gmk V105L ), G13(gmk N133K ) strain.
[0047] Example 3: Construction of engineered strain B. amyloliquefaciens G14 (introducing the Δgmk mutation)
[0048] To compare enzyme activity experiments, this invention also modifies guanylate kinase to inactivate it. The specific procedure is as follows:
[0049] Using primers Δgmk-A-1f / 1r, with the B. amyloliquefaciens 13952 genome as a template, pfu high-fidelity DNA polymerase was used to amplify the upstream and downstream homologous arms of Δgmk, respectively.
[0050] The upstream and downstream fragments were fused using primers Δgmk-A-1f / 2r to obtain homologous fragments of Δgmk (containing a 402bp knockout modification; the complete A-Δgmk* gene nucleotide sequence is shown in SEQ ID No. 6, totaling 213bp, and the amino acid sequence is shown in SEQ ID No. 5, totaling 70 amino acids). Each fragment was then ligated to the pKSU (tool vector) plasmid via SalI / PstI double digestion, followed by transformation to obtain the plasmid pKSU-A-Δgmk. The screening method was the same as in Example 2.
[0051] Example 4: Comparison of guanylate kinase activity of engineered strains B. amyloliquefaciens G11, G12, G13, G14 and B. amyloliquefaciens 13952
[0052] Using primers gmk-Sf / r, wild-type and mutant gmk fragments were amplified from the genomes of *B. amyloliquefaciens* strains G11, G12, G13, G14, and B. amyloliquefaciens 13952, respectively. The five obtained gmk gene fragments were simultaneously digested with the vector pET28a using BamHI / XbaI, purified, and ligated into *E. coli* BL21 using T4 ligase to prepare HIS-tagged gmk overexpression vectors pET28a-gmk(wt) and pET28a-gmk. I66M pET28a-gmk V105L pET28a-gmk N133K Five bacterial strains were induced to express pET28a-Δgmk using IPTG, and the centrifuged bacterial cells were then resuspended and lysed in 1×PBS.
[0053] Protein guanylate kinase was purified using a Bio-Scale Mini Profinity IMAC filter and a Profinia protein purification system (Bio-Rad) for enzyme activity assay.
[0054] Reaction conditions: 50 μM M MP, 1.5 mM phosphoenolpyruvate, 150 μM NADH, 4 mM ATP, 10 mM MgCl4, 0.1 M KCl, and enzyme solutions (2 U pyruvate kinase and 2.64 U lactate dehydrogenase) were dissolved in 100 μL of Tris-HCl buffer (pH 7.5). The reaction was carried out at 25°C for 10 min, and then the temperature was adjusted to 99°C for 2 min to terminate the reaction. Finally, NADH analysis buffer was added, and the reaction was carried out at 27°C for 30 min. The concentration of NADH was determined using a microplate spectrophotometer at a wavelength of 340 nm. Concentration standard curves of NADH at 0, 10, 20, 50, 100, and 200 μM were established.
[0055] The enzyme activity assay results are shown in Table 2. The results show that, compared with the starting strain B. amyloliquefaciens 13952, the guanylate kinase activities of the engineered strains B. amyloliquefaciens G11, G12, G13, and G14 were significantly reduced, decreasing to 36.3%, 44.9%, 53.7%, and 4.2% of the control strain, respectively.
[0056] Table 2 Enzyme Activity Assay of Engineered Strains
[0057] strain Ba 13952 G11 G12 G13 G14 Enzyme activity (μM ADP) 283 103 127 152 12
[0058] Example 5: Comparison of nucleoside synthesis capabilities of engineered strains B. amyloliquefaciens G11, G12, G13, G14 and B. amyloliquefaciens 13952
[0059] 1. Culture medium:
[0060] (1) Seed culture medium formula (g / L): glucose 20, yeast powder 5, corn steep liquor powder 5, potassium dihydrogen phosphate 3, magnesium sulfate 0.5, ferrous sulfate 0.02, manganese sulfate 0.01, pH 7.0~7.2, sterilized at 121℃ for 20min.
[0061] (2) Fermentation medium formula (g / L): glucose 60, yeast powder 3.5, potassium dihydrogen phosphate 3, ammonium sulfate 25, manganese sulfate 0.01, magnesium sulfate 5, sodium glutamate 10, corn steep liquor powder 15, calcium carbonate 25, pH 7.0~7.2, sterilized at 121℃ for 20min.
[0062] (3) LB liquid culture medium formula (g / L): peptone 10, yeast extract 5, NaCl 10, adjust pH to 7.2, sterilize at 0.15 MPa pressure for 20 min.
[0063] (4) The LB solid medium formula is: add agar powder (final concentration 18g / L) to the LB liquid medium and sterilize at 121℃ for 20min.
[0064] 2. Cultivation Methods
[0065] (1) Streak the strain in three zones on LB plates and incubate overnight at 37°C;
[0066] (2) Pick a single colony and inoculate it into 30 mL of seed culture medium. Incubate at 110 rpm and 36 °C for 7–8 h.
[0067] (3) Transfer 10% of the inoculum to 30 mL of fermentation medium, shake at 130 rpm, and incubate at 35.5 °C for 70 h;
[0068] The fermentation results are shown in Table 3 (average of three parallel biological experiments). The results show that, compared with the starting strain *B. amyloliquefaciens* 13952, the guanosine accumulation in the engineered strain was increased to varying degrees. G11(gmk) I66M ), G12(gmk V105L ), G13(gmk N133K The yields of guanosine from G14(Δgmk) were 4.14 g / L, 4.37 g / L, 4.81 g / L, and 4.06 g / L, respectively, indicating that weakening of the gmk gene can significantly increase the accumulation of guanosine in Bacillus.
[0069] Table 3 Nucleoside production detection of engineered strains
[0070] strain Ba 13952 G11 G12 G13 G14 Guanosin (g / L) 3.05 4.14 4.37 4.81 4.06
[0071] This may be due to the weakening or inactivation of the gmk gene, resulting in less GMP being broken down into GDP, which can further generate GTP to enter the riboflavin biosynthesis pathway. Ribulucose 5-phosphate (Ru-5P) is a shared precursor in both purine and riboflavin biosynthesis pathways. Therefore, weakening the gmk gene reduces the amount of GTP, a precursor in the riboflavin biosynthesis pathway, thus reducing competition for Ru-5P and promoting de novo purine synthesis. Experimental results indicate that mutations at these sites favor the accumulation of nucleosides in Bacillus.
[0072] Based on this principle, this invention applies not only to Bacillus amyloliquefaciens but also to its close relative, Bacillus subtilis. Therefore, the inventors modified a laboratory-preserved adenosine-producing strain derived from Bacillus subtilis 168 by weakening guanylate kinase, thus achieving the same goal of increasing guanylate yield.
[0073] Example 6: Engineered strain B. subtilis E11 (gmk) ttg Construction of )
[0074] Use primer gmk ttg -S-1f / 1r and gmk ttg -S-2f / 2r, using the B. subtilis A5 genome as a template, and amplified with Pfu high-fidelity DNA polymerase to obtain gmk ttg Upstream and downstream homologous arms;
[0075] Use primer gmk ttg -S-1f / 2r fused upstream and downstream fragments to obtain S-gmk ttg Homologous fragments (containing complete S-gmk) ttgThe gene's nucleotide sequence (615 bp, as shown in SEQ ID No. 8) and amino acid sequence (203 amino acids, as shown in SEQ ID No. 7) were then combined with the pKSU (tool vector) plasmid and subjected to SalI / PstI double digestion, ligation, and transformation to obtain the plasmid pKSU-S-gmk. ttg .
[0076] Plasmid pKSU-S-gmk ttg The transformants were electrochemically converted into B. subtilis A5, and the transformants were screened on LB plates containing 2.5 μg / mL chloramphenicol at 30 °C. The obtained transformants were inoculated into 5 mL LB liquid, cultured at 42 °C and 200 rpm for 12 h and passaged for one generation. The transformed transformants were then diluted and plated on LB plates containing 5 μg / mL chloramphenicol to obtain the first recombinant.
[0077] The primary recombinant was inoculated into 5 ml of LB broth, incubated at 42 °C and 200 rpm for 12 h, and passaged. The recombinant was then diluted and plated onto LB plates containing 0.8 μM 5-FU to screen for secondary recombinants, yielding the recombinant *B. subtilis* A5 with *gmk* introduced. ttg Mutant B. subtilisE11(gmk) ttg ) strain.
[0078] Example 7: Construction of engineered strain B. subtilis E12 (introduction of gmk) -10* mutation)
[0079] Use primer gmk -10* -S-1f / 1r and gmk -10* Using the B. subtilis A5 genome as a template, gmk was obtained by amplification with Pfu high-fidelity DNA polymerase. -10* Upstream and downstream homologous arms;
[0080] Use primer gmk -10* -S-1f / 2r merges upstream and downstream fragments to obtain gmk -10* Homologous fragments (containing complete S-gmk) -10* The gene's nucleotide sequence (213 bp, as shown in SEQ ID No. 10) and amino acid sequence (204 amino acids, as shown in SEQ ID No. 9) were then combined with the pKSU (tool vector) plasmid and subjected to SalI / PstI double digestion, ligation, and transformation to obtain the plasmid pKSU-S-gmk. -10* The screening method is the same as in Example 6.
[0081] Example 8: Comparison of guanylate kinase activity of engineered strains B. subtilis E11, E12 and B. subtilis A5
[0082] Using primers gmk-Af / r, wild-type and mutant gmk fragments were amplified using the genomes of B. subtilis A5, E11, and E12 strains as templates. The three gmk gene fragments were then digested with BamHI / XbaI and the vector pET28a, purified, and ligated into E. coli BL21 using T4 ligase to prepare HIS-tagged gmk overexpression vectors pET28a-gmk(wt) and pET28a-gmk. ttg pET28a-gmk -10* The enzyme activity assay method is the same as in Example 4.
[0083] The enzyme activity assay results are shown in Table 4. The results show that, compared with the starting strain B. subtilis A5, the guanylate kinase activities of the engineered strains B. subtilis E11 and E12 were significantly reduced, decreasing to 68.2% and 62.8% of the control strain, respectively.
[0084] Table 4 Enzyme Activity Assay of Engineered Strains
[0085] strain Bs A5 E11 E12 Enzyme activity (μM ADP) 309 211 194
[0086] Example 9: Comparison of nucleoside synthesis capabilities among engineered strains B. subtilis E11, E12 and B. subtilis A5
[0087] The culture medium and fermentation method are the same as in Example 5.
[0088] The fermentation results are shown in Table 5 (average of three parallel biological experiments). The results show that, compared with the starting strain *B. subtilis* A5, the adenosine accumulation of the engineered strain was increased to varying degrees. E11(gmk) ttg E12(gmk) -10* The guanosine yields of *Gmk* and *Bacillus* were 9.01 g / L and 9.05 g / L, respectively. This indicates that attenuation of the *Gmk* gene can significantly increase the accumulation of guanosine in *Bacillus*.
[0089] Table 5. Adenosine production detection of engineered strains
[0090] strain Bs A5 E11 E12 Guanosin (g / L) 8.39 9.01 9.65
[0091] Example 10: Engineered strain B. amyloliquefaciens G15 (ylzA) L77R ), G16(ylzA E81G ), G17(ylzA D85E Construction of )
[0092] ylzA encodes a putative protein whose function is currently unidentified, and no literature reports its role in nucleoside production. In this invention, three mutant modifications obtained from comparative genomics analysis were reintroduced into B. amyloliquefaciens13952(Δupp) for verification, yielding unexpected results.
[0093] The specific build process is as follows:
[0094] Using primers ylzA-A-1f / ylzA77-A-1r and ylzA77-A-2f / 2r, ylzA-A-1f / ylzA81-A-1r and ylzA81-A-2f / 2r, ylzA-A-1f / ylzA85-A-1r and ylzA85-A-2f / 2r, with the B. amyloliquefaciens13952 genome as a template, pfu high-fidelity DNA polymerase was used to amplify the upstream and downstream homologous arms of ylzA to obtain the results.
[0095] The upstream and downstream fragments were fused using primers ylzA-A-1f / 2r to obtain A-ylzA. L77R A-ylzA E81G A-ylzA D85E Homologous fragments (containing L77R mutation, E81G mutation, and D85E mutation respectively; the amino acid sequence of the ylzA protein is shown in SEQ ID NO.2, and the nucleotide sequence is shown in SEQ ID NO.4; all the above mutations are based on SEQ ID NO.2, and the corresponding nucleotide sequences are t to g at position 230, a to g at position 242, and t to g at position 255, respectively, based on SEQ ID NO.4). These fragments were then combined with the pKSU (tool vector) plasmid through SalI / PstI double digestion, ligation, and transformation to obtain the plasmid pKSU-A-ylzA. L77R pKSU-A-ylzA E81G pKSU-A-ylzA D85E The screening method is the same as in Example 2.
[0096] Example 11: Comparison of nucleoside accumulation capacity of engineered strains B. amyloliquefaciens G15, G16, G17 and B. amyloliquefaciens 13952
[0097] The culture medium and culture method are the same as in Example 5.
[0098] The fermentation results are shown in Table 6 (average values of three parallel biological experiments). The results show that, compared with the starting strain *B. amyloliquefaciens* 13952, the inosine accumulation of the engineered strains was increased to varying degrees, especially in G15(ylzA). L77R ), G16(ylzA E81G ), G17(ylzA D85E The guanosine yields of the three strains were 4.01 g / L, 4.38 g / L, and 4.09 g / L, respectively, all higher than those of the original strain. The ylzA gene is located upstream of the gmk gene, suggesting that the two may not be expressed independently.
[0099] This may be due to the ylzA gene mutation, which weakens the expression of the gmk gene, thereby reducing the consumption of GMP, an intermediate in the purine pathway, and promoting the accumulation of guanosine. The accumulation of adenosine and inosine in each engineered strain was also increased. This is because the riboflavin biosynthesis pathway is weakened after the gmk gene expression is affected, increasing the ribulose-5-phosphate (Ru-5P) precursor in the de novo purine synthesis pathway, thus promoting the accumulation of purines and nucleosides. The experimental results indicate that mutations at these sites are beneficial to the accumulation of nucleosides in Bacillus.
[0100] Table 6. Glycoside production detection of engineered strains
[0101] strain Ba 13952 G15 G16 G17 Guanosin (g / L) 3.17 4.01 4.38 4.09
[0102] The construction of the strain of the present invention is not limited in terms of the order of steps. Any person skilled in the art who achieves the purpose of the present invention by following the disclosure of the present invention shall fall within the protection scope of the present invention.
[0103] The strain designations used in this invention, such as B. subtilis E11 and B. subtilis E12, are for ease of description and should not be construed as limiting the invention. The above method constructs a strain containing the Bacillus guanylate kinase mutant gene gmk. I66M gmk V105L gmk N133K ,Δgmk,gmk ttg gmk -10* ylzA L77R ylzA E81G ylzA D85E The uses of engineered bacteria include, but are not limited to, nucleosides.
[0104] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention. sequence list <110> Meihua (Shanghai) Biotechnology Co., Ltd. <120> Application of weakened guanylate kinase in enhancing the ability of strains to produce nucleosides or their derivatives <130> KHP211117889.8 <160> 46 <170> SIPOSequenceListing 1.0 <210> 1 <211> 212 <212> PRT <213> Artificial Sequence <400> 1 Met Lys Gly Arg Gly Asn Cys Arg Met Lys Glu Arg Gly Leu Leu Ile 1 5 10 15 Val Leu Ser Gly Pro Ser Gly Val Gly Lys Gly Thr Val Arg Gln Ala 20 25 30 Ile Phe Ser Gln Glu Asp Thr Lys Phe Glu Tyr Ser Ile Ser Val Thr 35 40 45 Thr Arg Asn Pro Arg Glu Gly Glu Val Asp Gly Val Asp Tyr Phe Phe 50 55 60 Lys Ser Arg Asp Glu Phe Glu Arg Met Ile Glu Asn Asn Lys Leu Leu 65 70 75 80 Glu Trp Ala Glu Tyr Val Gly Asn Tyr Tyr Gly Thr Pro Val Asp Tyr 85 90 95 Val Glu Gln Thr Leu Gln Glu Gly Lys Asp Val Phe Leu Glu Ile Glu 100 105 110 Leu Gln Gly Ala Leu Gln Val Arg Asn Ala Phe Pro Glu Gly Leu Phe 115 120 125 Ile Phe Leu Ala Pro Pro Ser Leu Ser Glu Leu Lys Asn Arg Ile Val 130 135 140 Thr Arg Gly Thr Glu Thr Asp Asp Leu Ile Glu Asn Arg Met Lys Ala 145 150 155 160 Ala Lys Ala Glu Ile Glu Met Asp Ala Tyr Asp Tyr Val Val Glu 165 170 175 Asn Asp Asp Ile Gln Thr Ala Cys Asp Lys Ile Asn Ala Ile Val Leu 180 185 190 Ala Glu His Leu Lys Arg Glu Arg Val Ala Pro Arg Tyr Lys Lys Met 195 200 205 Leo Glu Val Glu 210 <210> 2 <211> 89 <212> PRT <213> Artificial Sequence <400> 2 Met Thr Ile Lys Leu Ile Asn Ile Gly Phe Gly Asn Ile Ile Ser Ala 1 5 10 15 Asn Arg Met Ile Ser Ile Val Ser Pro Glu Ser Ala Pro Ile Lys Arg 20 25 30 Met Ile Gln Asp Ala Arg Asp Arg Gly Met Leu Ile Asp Ala Thr Tyr 35 40 45 Gly Arg Arg Thr Arg Ala Val Val Val Met Asp Ser Asp His Ile Ile 50 55 60 Leu Ser Ala Val Gln Pro Glu Thr Val Ala His Arg Leu Ser Val Lys 65 70 75 80 Glu Glu Ile Met Asp Glu Gly Gln Gly 85 <210> 3 <211> 615 <212> DNA <213> Artificial Sequence <400> 3 atgaaagaaa gagggttatt aatcgttctc tcaggtccct caggagttgg aaaaggaacg 60 gttcggcaag caatattttc acaagaagac acgaaatttg aatactcaat ttcagtcacg 120 [[ID=?]] acgagaaacc cgagagaggg cgaggtcgac ggcgtcgatt atttctttaa atcaagagat 180 gaattcgaac gcatgattga aaacaacaaa ctgcttgagt gggcggaata tgtcggcaac 240 tattacggaa cgcccgtcga ttatgtcgaa cagacgcttc aagaaggaaa agacgtcttc 300 ttagagattg aagtgcaggg cgcgctccaa gtgcggaatg catttccgga aggcctgttt 360 atcttcttag cgccgccgag tctttctgag ctgaaaaaca gaatcgtgac aagaggaact 420 gaaaccgacg atttaattga aaacagaatg aaggccgcaa aagctgaaat cgaaatgatg 480 gacgcgtatg attatgtcgt ggaaaacgat gatatccaaa cggcttgtga taagattaac 540 gcaattgttc tcgccgagca cttaaagcgt gaacgcgttg ctccgagata taagaaaatg 600 ctggaggtag aataa 615 <210> 4 <211> 297 <212> DNA <213> Artificial Sequence <400> 4 atgacgatta aactgattaa tatcggattt ggcaatatca tctccgccaa tcggatgatt 60 tcgattgtca gcccggagtc tgcgccaata aagcgaatga ttcaggatgc aagagaccgc 120 ggaatgctaa tagacgctac atacggacga agaacccgtg cagttgtcgt catggatagt 180 gatcacatta tcttatctgc cgtccagcct gagacagttg cacacagact ttctgtgaaa 240 gaagaaatta tggatgaagg gcaggggtaa ttgccgcatg aaagaaagag ggttatt 297 <210> 5 <211> 70 <212> PRT <213> Artificial Sequence <400> 5 Ile Val Thr Arg Gly Thr Glu Thr Asp Asp Leu Ile Glu Asn Arg Met 1 5 10 15 Lys Ala Ala Lys Ala Glu Ile Glu Met Met Asp Ala Tyr Asp Tyr Val 20 25 30 Val Glu Asn Asp Asp Ile Gln Thr Ala Cys Asp Lys Ile Asn Ala Ile 35 40 45 Val Leu Ala Glu His Leu Lys Arg Glu Arg Val Ala Pro Arg Tyr Lys 50 55 60 Lys Met Leu Glu Val Glu 65 70 <210> 6 <211> 213 <212> DNA <213> Artificial Sequence <400> 6 atcgtgacaa gaggaactga aaccgacgat ttaattgaaa acagaatgaa ggccgcaaaa 60 gctgaaatcg aaatgatgga cgcgtatgat tatgtcgtgg aaaacgatga tatccaaacg 120 gcttgtgata agattaacgc aattgttctc gccgagcact taaagcgtga acgcgttgct 180 ccgagatata agaaaatgct ggaggtagaa taa 213 <210> 7 <211> 203 <212> PRT <213> Artificial Sequence <400> 7 Lys Glu Arg Gly Leu Leu Ile Val Leu Ser Gly Pro Ser Gly Val Gly 1 5 10 15 Lys Gly Thr Val Arg Gln Ala Ile Phe Ser Gln Glu Asp Thr Lys Phe 20 25 30 Glu Tyr Ser Ile Ser Val Thr Thr Arg Ser Pro Arg Glu Gly Glu Val 35 40 45 Asn Gly Val Asp Tyr Phe Phe Lys Thr Arg Asp Glu Phe Glu Gln Met 50 55 60 Ile Ala Asp Asn Lys Leu Leu Glu Trp Ala Glu Tyr Val Gly Asn Tyr 65 70 75 80 Tyr Gly Thr Pro Val Asp Tyr Val Glu Gln Thr Leu Gln Asp Gly Lys 85 90 95 Asp Val Phe Leu Glu Ile Glu Val Gln Gly Ala Leu Gln Val Arg Asn 100 105 110 Ala Phe Pro Glu Gly Leu Phe Ile Phe Leu Ala Pro Pro Ser Leu Ser 115 120 125 Glu Leu Lys Asn Arg Ile Val Thr Arg Gly Thr Glu Thr Asp Ala Leu 130 135 140 Ile Glu Asn Arg Met Lys Ala Ala Lys Ala Glu Ile Glu Met Met Asp 145 150 155 160 Ala Tyr Asp Tyr Val Val Glu Asn Asp Asn Val Glu Thr Ala Cys Asp 165 170 175 Lys Ile Lys Ala Ile Val Leu Ala Glu His Leu Lys Arg Glu Arg Val 180 185 190 Ala Pro Arg Tyr Lys Lys Met Leu Glu Val Glu 195 200 <210> 8 <211> 615 <212> DNA <213> Artificial Sequence <400> 8 ttgaaagaaa gagggttatt aatcgttctc tcaggtccct caggagttgg taaaggaacg 60 gttcgacaag cgatcttttc gcaggaagac acaaaatttg aatattcgat ttcagtaacc 120 acaagaagtc caagagaggg cgaagtgaac ggagtcgatt attttttcaa aacaagagac 180[[ID=**28**]] [[ID=**29**]]gaattcgagc aaatgattgc ggacaacaag ctgcttgaat gggcagagta tgtcggcaat 240[[ID=**30**]] [[ID=**31**]]tattacggca cgccagtcga ttatgttgaa cagacgcttc aagatggaaa agacgtcttt 300[[ID=**32**]] [[ID=**33**]]ttagaaattg aagttcaagg ggctcttcaa gtgagaaatg ctttcccgga aggcctgttt 360[[ID=**34**]] [[ID=**35**]]attttccttg cgcctccaag cctttctgaa ctgaaaaaca gaatcgtgac acgaggaaca 420[[ID=**36**]] gaaacagacg ctctgattga aaatcgaatg aaagccgcaa aagctgagat cgaaatgatg 480 gatgcttatg actatgtcgt tgaaaacgat aatgtcgaaa cggcttgcga taaaatcaaa 540 gcaatcgttc ttgctgaaca tttgaagcgt gaacgcgttg caccaagata taagaaaatg 6Lys Asp Val Phe Leu Glu Ile Glu Val Gln Gly Ala Leu Gln Val Arg 100 105 110 Asn Ala Phe Pro Glu Gly Leu Phe Ile Phe Leu Ala Pro Pro Ser Leu 115 120 125 Ser Glu Leu Lys Asn Arg Ile Val Thr Arg Gly Thr Glu Thr Asp Ala 130 135 140 Leu Ile Glu Asn Arg Met Lys Ala Ala Lys Ala Glu Ile Glu Met Met 145 150 155 160 Asp Ala Tyr Asp Tyr Val Val Glu Asn Asp Asn Val Glu Thr Ala Cys 165 170 175 Asp Lys Ile Lys Ala Ile Val Leu Ala Glu His Leu Lys Arg Glu Arg 180 185 190 Val Ala Pro Arg Tyr Lys Lys Met Leu Glu Val Glu 195 200 <210> 10 <211> 618 <212> DNA <213> Artificial Sequence <400> 10 atgaaagaaa gagggttatc aatcgttctc tcaggtccct caggagttgg taaaggaacg 60 gttcgacaag cgatcttttc gcaggaagac acaaaatttg aatattcgat ttcagtaacc 120 acaagaagtc caagagaggg cgaagtgaac ggagtcgatt attttttcaa aacaagagac 180 gaattcgagc aaatgattgc ggacaacaag ctgcttgaat gggcagagta tgtcggcaat 240 tattacggca cgccagtcga ttatgttgaa cagacgcttc aagatggaaa agacgtcttt 300 ttagaaattg aagttcaagg ggctcttcaa gtgagaaatg ctttcccgga aggcctgttt 360 attttccttg cgcctccaag cctttctgaa ctgaaaaaca gaatcgtgac acgaggaaca 420 gaaacagacg ctctgattga aaatcgaatg aaagccgcaa aagctgagat cgaaatgatg 480 gatgcttatg actatgtcgt tgaaaacgat aatgtcgaaa cggcttgcga taaaatcaaa 540 gcaatcgttc ttgctgaaca tttgaagcgt gaacgcgttg caccaagata taagaaaatg 600 ctggaggttg aataagmk 618 <210> 11 <211> 48 <212> DNA <213> Artificial Sequence <400> 11 caaaataagg atcctctaga gtcgacagtc ggacgcaaac ttgatttc 48 <210> 12 <211> 33 <212> DNA <213> Artificial Sequence <400> 12 tgttttccat catgcgatcg aattcatctc ttg 33 <210> 13 <211> 32 <212> DNA <213> Artificial Sequence <400> 13 tgatggaaaa caacaaactg cttgagtggg cg 32 <210> 14 <211> 46 <212> DNA <213> Artificial Sequence <400> 14 ccagtgccaa gcttgcatgc ctgcagagat aggttgctac gtgtgc 46 <210> 15 <211> 46 <212> DNA <213> Artificial Sequence <400> 15 caaaataagg atcctctaga gtcgactata gaatagcgac tgtgcg 46 <210> 16 <211> 37 <212> DNA <213> Artificial Sequence <400> 16 cgccctgcaa ttcaatctct aagaagacgt cttttcc 37 <210> 17 <211> 33 <212> DNA <213> Artificial Sequence <400> 17 ttgaattgca gggcgcgctc caagtgcgga atg 33 <210> 18 <211> 46 <212> DNA <213> Artificial Sequence <400> 18 ccagtgccaa gcttgcatgc ctgcagaacc agtttgctgg taagcg 46 <210> 19 <211> 47 <212> DNA <213> Artificial Sequence <400> 19 caaaataagg atcctctaga gtcgacaata tcatctccgc caatcgg 47 <210> 20 <211> 35 <212> DNA <213> Artificial Sequence <400> 20 gattctctttttcagctcag aaagactcgg cggcg 35 <210> twenty one <211> 38 <212> DNA <213> Artificial Sequence <400> twenty one gctgaaaaag agaatcgtga caagaggaac tgaaaccg 38 <210> twenty two <211> 46 <212> DNA <213> Artificial Sequence <400> twenty two ccagtgccaa gcttgcatgc ctgcagacac ttcattccgg ctcagc 46 <210> twenty three <211> 46 <212> DNA <213> Artificial Sequence <400> twenty three caaaataagg atcctctaga gtcgactgaa ggaatggacg gaggac 46 <210> twenty four <211> 38 <212> DNA <213> Artificial Sequence <400> twenty four tcagttcctc ttgtcacgat gcggcaatta cccctgcc 38 <210> 25 <211> 38 <212> DNA <213> Artificial Sequence <400> 25 ggcaggggta attgccgcat cgtgacaaga ggaactga 38 <210> 26 <211> 46 <212> DNA <213> Artificial Sequence <400> 26 ccagtgccaa gcttgcatgc ctgcagacac ttcattccgg ctcagc 46 <210> 27 <211> 46 <212> DNA <213> Artificial Sequence <400> 27 caaaataagg atcctctaga gtcgactgct ggctgcagat gtcgta 46 <210> 28 <211> 55 <212> DNA <213> Artificial Sequence <400> 28 gagaacgatt aataaccctc tttctttcaa gcggcaatta cccctgccct tcatc 55 <210> 29 <211> 55 <212> DNA <213> Artificial Sequence <400> 29 gatgaagggc aggggtaatt gccgcttgaa agaaagaggg ttattaatcg ttctc 55 <210> 30 <211> 46 <212> DNA <213> Artificial Sequence <400> 30 ccagtgccaa gcttgcatgc ctgcagtgca tttcacgggc acgtct 46 <210> 31 <211> 46 <212> DNA <213> Artificial Sequence <400> 31 caaaataagg atcctctaga gtcgactgct ggctgcagat gtcgta 46 <210> 32 <211> 47 <212> DNA <213> Artificial Sequence <400> 32 ctgagggacc tgagagaacg attgataacc ctctttcttt catgcgg 47 <210> 33 <211> 47 <212> DNA <213> Artificial Sequence <400> 33 ccgcatgaaa gaaagagggt tatcaatcgt tctctcaggt ccctcag 47 <210> 34 <211> 46 <212> DNA <213> Artificial Sequence <400> 34 ccagtgccaa gcttgcatgc ctgcagtgca tttcacgggc acgtct 46 <210> 35 <211> 27 <212> DNA <213> Artificial Sequence <400> 35 tctagactga gacagttgca cacagac 27 <210> 36 <211> 28 <212> DNA <213> Artificial Sequence <400> 36 ggttccacag tgaccagcgt atatttag 28 <210> 37 <211> 26 <212> DNA <213> Artificial Sequence <400> 37 tctagatgag acagttgcac acagac 26 <210> 38 <211> 27 <212> DNA <213> Artificial Sequence <400> 38 ggatccacgt ctcgcagaaa cagtcac 27 <210> 39 <211> 46 <212> DNA <213> Artificial Sequence <400> 39 caaaataagg atcctctaga gtcgacttga gacgctgtcc gaacag 46 <210> 40 <211> 34 <212> DNA <213> Artificial Sequence <400> 40 cacagaacgt ctgtgtgcaa ctgtctcagg ctgg 34 <210> 41 <211> 37 <212> DNA <213> Artificial Sequence <400> 41 gttgcacaca gacgttctgt gaaagaagaa attatgg 37 <210> 42 <211> 48 <212> DNA <213> Artificial Sequence <400> 42 ccagtgccaa gcttgcatgc ctgcagagag tcaattgacg gatctaac 48 <210> 43 <211> 35 <212> DNA <213> Artificial Sequence <400> 43 aatttctcctttcacagaaa gtctgtgtgc aactg 35 <210> 44 <211> 36 <212> DNA <213> Artificial Sequence <400> 44 gtgaaaggag aaattatgga tgaagggcag gggtaa 36 <210> 45 <211> 37 <212> DNA <213> Artificial Sequence <400> 45 cccttcctcc ataatttctt ctttcacaga aagtctg 37 <210> 46 <211> 35 <212> DNA <213> Artificial Sequence <400> 46 aattatggag gaagggcagg ggtaattgcc gcatg 35
Claims
1. Application of weakened guanylate kinase in enhancing the ability of bacterial strains to produce guanosine; The amino acid sequence of the guanylate kinase is shown in SEQ ID NO.1, and the strain is Bacillus subtilis or Bacillus amyloliquefaciens; The weakened guanylate kinase was obtained by inhibiting the expression of guanylate kinase in the strain.
2. The application according to claim 1, characterized in that, The inhibition of guanylate kinase expression in the strain includes any one or more of the following: I) The guanylate kinase described herein undergoes a point mutation leading to attenuation; II) The gene encoding the guanylate kinase is weakened due to gene segment deletion or premature termination. III) The gene encoding the guanylate kinase undergoes start codon weakening, leading to attenuation. IV) The weakening is caused by the weakening of the regulatory region of the gene encoding guanylate kinase.
3. The application according to claim 2, characterized in that, The inhibition of guanylate kinase expression in the strain is achieved by a point mutation in guanylate kinase leading to attenuation. The mutation mode is as follows: The isoleucine at position 66 was mutated to methionine, the valine at position 105 was mutated to leucine, and the asparagine at position 133 was mutated to lysine.
4. The application according to claim 2, characterized in that, The start codon is weakened so that the start codon of the gene encoding the guanylate kinase is changed from ATG to GTG or TTG. And / or, the weakening of the regulatory region includes: replacing the promoter of the gene encoding the guanylate kinase, or mutations occurring in the -10 and -35 regions.
5. A recombinant microorganism, characterized in that, The recombinant microorganism contains the weakened guanylate kinase described in the application of claim 3, and / or, the ylzA protein mutant; The ylzA protein mutant is obtained by any one of the following mutations of the ylzA protein with the amino acid sequence shown in SEQ ID NO.2: The 77th leucine was mutated to arginine, the 81st glutamic acid to glycine, and the 85th aspartic acid to glutamic acid. The starting strain of the recombinant microorganism is Bacillus subtilis or Bacillus amyloliquefaciens.
6. The use of the recombinant microorganism of claim 5 in the production of guanosine.