A method for pan-cancer ultra-early screening

Abstract

The present application relates to a kind of pan-cancer super-early screening method.The level of genetic defect telomere in human peripheral blood genomic DNA is detected to implement super-early evaluation and corresponding kit.The method has high sensitivity and high specificity, is suitable for the abnormal increase of telomerase of pan-cancer, about 90% of all cancers, and the screening time node is significantly earlier than the related technology of peripheral blood tumor residue (ctDNA, cfDNA or CTC);It needs small sample amount, has good repeatability, is easy to operate, time-consuming is short, and has low cost and the like characteristics, has wide market application prospect.

Description

[0001] Cross-reference of related applications

[0002] This application cites the invention entitled "A Mutated Human Telomerase RNA Gene and Its Application in the Prevention and Treatment of Pan-Cancer" filed by the applicant on the same filing date, the entire contents of which are incorporated herein by reference. Technical Field

[0003] This invention relates to a method for pan-cancer ultra-early screening of subjects. More specifically, this invention relates to a method for determining at an early stage whether a subject has cancer and / or is at high risk of cancer by measuring genetically defective telomeres in genomic DNA from peripheral blood or other biological samples. The invention also relates to a kit for such screening. Background Technology

[0004] Early detection of cancer, especially early screening, is one of the most important means to effectively improve cancer prevention and cure. The concept and technical requirements of early cancer screening differ from those of early clinical auxiliary diagnosis and treatment. First, early screening technology is applied to healthy individuals without any clinical symptoms of cancer. Therefore, early cancer screening technology must be effective against a wide range of cancers, with at least one screening effective against the top ten most common cancers. Furthermore, the technology must be simple, convenient, easy to perform, safe, and non-invasive. The effective screening time should be significantly earlier than clinical diagnosis, and the screening cost should be affordable for the general population. Currently, early cancer screening technologies both domestically and internationally are almost entirely based on the development of technologies that detect residues shed into peripheral blood by cancer cells at a certain stage of growth. Various ultra-micro detection technologies, including cfDNA, ctDNA, CTC, DNA methylation, and gene mutation profiling (panel), are gradually moving towards clinical application. However, these technologies all face similar serious bottlenecks: the screening time is not significantly earlier than existing clinical diagnostic techniques. Due to the short half-life and extremely low concentration of residual cancer cells, coupled with interference from genetic variations in hematopoietic stem cells, these early screening technologies are difficult to further improve. Strictly speaking, these technologies are not true early cancer screening technologies and can only be applied in clinical auxiliary diagnosis and treatment. According to relevant technology test data reported by leading global companies, these technologies showed excellent sensitivity and specificity in retrospective tests, but in prospective tests, the positive predictive value (PPV) and negative predictive value (NPV) were often unsatisfactory, especially the core indicator of early cancer screening, PPV, which fell far short of requirements. Therefore, these technologies are relatively effective for the early auxiliary diagnosis and treatment of specific single cancer types or a limited number of cancer types, but they are almost unusable for early cancer screening. The academic community is also questioning the feasibility of these ultra-micro liquid biopsy technologies based on residual cancer cells, believing that they have many uncertainties (Razavi, P., et al., 2019, Nat Med 25: 1928-1937). Another approach is in-depth NGS analysis of genomic DNA, including WES, WGS, DNA methylation, and cancer-related gene profiling, which seems to be more reliable and stable. However, they still face a significant hurdle in the short term. Although sequencing technology and costs are approaching market application requirements, finding the relationship between certain gene alterations and cancer symptoms remains extremely difficult. Extensive basic research in medicine and epigenetics is still needed. The interactions between genes, between genes and traits, and between traits within an organism are comparable to the internet, with a single gene being merely a node in a gene network. With the exception of a very few genes, almost all existing sequencing results are essentially a "hidden book," offering little help in early cancer screening.

[0005] Therefore, there is an urgent need in this field for technologies and methods that can achieve early screening of pan-cancer types. Summary of the Invention

[0006] To explore the common problem of abnormally elevated telomerase levels in most cancer cells, resulting in extremely short telomeres, even shorter than those in normal cells with no telomerase activity, the inventors examined the 3' terminal repeat sequences of telomeres in normal tissues, adjacent tissues, and cancerous tissues from six types of cancer. They found that all normal tissues were predominantly AGGGTT, but cancerous tissues showed very low levels, indicating a severe disorder.

[0007] The inventors further analyzed the characteristics of telomerase in cancer cells and found that it is no different from that in normal embryonic cells. It needs to pair with the two bases at the end of the 3' of the telomere to effectively catalyze, synthesize, and extend the telomere.

[0008] Based on the disordered 3' ends of telomeres in cancer cells and the catalytic properties of telomerase, combined with the gradual shortening of telomeres during cell division, the inventors conducted a detailed analysis of 27 telomere sequences located in the human genome database provided by NCBI. Unexpectedly, they discovered that 18 telomeres (5'AGGGTC3') exist in a telomere region approximately 100–1000 bp near the chromosome. n (5'GGGTTC3') n (5'AGGGTG3') n and (5'GGGTTG3') n The sequences are repeated n times. These repeating sequences are different from the normal 3' telomere terminal repeats (5'AGGGTT3')n and (5'GGGTTA3'). n Significant differences exist. Due to the semi-conservative replication of DNA during cell division, after dozens of cell divisions, telomeres shorten to these regions with significant differences, resulting in TC or TG endings at the 3' end of some telomeres. The inventors hypothesize that these TC or TG-terminated telomeres affect telomerase binding, potentially leading to abnormally high telomerase levels and limiting telomere elongation. Therefore, in this invention, the inventors refer to telomeres with such TC or TG-terminated telomere repetitive sequences as "genetically defective telomeres."

[0009] To enable telomerase to bind to genetically defective telomeres, the inventors performed single-base site-directed mutagenesis and recombination on telomerase RNA to repair severely defective telomeres. The results were encouraging: HELA cancer cell growth was significantly slowed, Bcap37 telomerase activity decreased dramatically, and programmed apoptosis was initiated in cancerous cells. These results indicate that genetically defective TC or TG telomeres are directly related to early-stage cancer development and are one of the key drivers of cancerous transformation. Their presence predicts whether cells are in a cancerous stage or at risk of developing cancer. Undoubtedly, measuring genetically defective telomeres at the 3' end of telomeres can assess whether cells have become cancerous or are at risk of developing cancer.

[0010] The inventors also determined the 3' terminal repeat sequences of telomeres in biological samples from subjects with different cancers and in the genomes of various cancer cell lines, and found that some of their telomeres had become TC or TG genetically defective telomeres, that is, the 3' terminal repeat sequences of telomeres were 5'AGGGTC3', 5'GGGTTC3', 5'AGGGTG3' and / or 5'GGGTTG3'.

[0011] The inventors further discovered that the total amount of genetically defective telomeres in the genome of biological samples from subjects is highly correlated with their cancer status or risk. They also found that these genetically defective telomeres appearing on different chromosomal arms are associated with cellular carcinogenesis or organs or tissues at risk of carcinogenesis. The biological sample is not necessarily a sample of cancerous tissue or tissue at risk of cancer; it can be a peripheral blood sample. The inventors' related evidence also indicates that peripheral blood is the optimal sample. Therefore, by measuring the content of telomere terminal repeat sequences 5'AGGGTC3', 5'GGGTTC3', 5'AGGGTG3', and / or 5'GGGTTG3' in cells from biological samples from subjects, or by further locating their corresponding chromosomal arms, it is possible to assess whether the subject has cancer and / or is at high risk of developing cancer, and the possible tissues involved.

[0012] Therefore, in one aspect, the present invention provides a method for identifying whether a subject has cancer and / or determining whether a subject is at risk of developing cancer, comprising: a) determining the presence and number of defective telomeres in genomic DNA from a biological sample of the subject, including the total amount of amplified products, the number of amplified DNA bands, the molecular weight and product amount of each amplified DNA band, and the location and distribution of defective telomeres on chromosome arms; and b) comparing reference values ​​formed by retrospective testing big data of known cancer patients and non-cancer patients. For subjects with unknown cancer status, a risk assessment of the likelihood of developing cancer within a certain time frame can be made. For subjects with cancer and / or a high risk of cancer, the most likely specific tissue can be provided to help subjects be vigilant and take preventative measures.

[0013] On the other hand, the present invention provides biomarkers as early drivers of cellular carcinogenesis, namely genetically defective telomeres whose 3' terminal repeat sequences are characterized by 5'AGGGTC3', 5'GGGTTC3', 5'AGGGTG3', or 5'GGGTTG3'. The present invention also relates to the use of such TC and / or TG genetically defective telomeres for the adjuvant diagnosis and treatment of pan-cancer diseases, including pre-treatment, during-treatment, and / or post-treatment, as well as recurrence monitoring. They can also be used to monitor and evaluate the efficacy of therapeutic drugs and treatment regimens.

[0014] In another aspect, the present invention relates to a kit for pan-cancer ultra-early screening, comprising the components required for determining the presence of 3' telomere repeat sequences 5'AGGGTC3', 5'GGGTTC3', 5'AGGGTG3' and / or 5'GGGTTG3' in genomic DNA from a subject's biological sample, and optionally instructions for use.

[0015] The present invention also relates to the use of the kit for pan-cancer ultra-early screening, including auxiliary diagnosis, adjuvant treatment, cancer recurrence monitoring, evaluation of anti-cancer drugs, and efficacy monitoring and evaluation of specific treatment plans in medical institutions. Invention Details

[0017] Most cancers are diseases of aging, caused by genetic mutations in a small number of senescent cells that allow them to escape programmed apoptosis and continue to divide, resulting in abnormal tissue proliferation. This is also an evolutionary adaptation of the human genome by cells to avoid aging or death. Research has also found that senescent cells have a greater capacity for this abnormal proliferation (Nishiguchi, MA et al., 2018, Cell Reports, 24, 3383-3392). Studies have shown that as people age, the body gradually ages, which is reflected in the genome not only by significant changes in DNA methylation, but more importantly by the continuous shortening of telomeres at the ends of chromosomes. Numerous studies have shown that the rate of this shortening is influenced not only by genetic factors but also by a combination of external environmental factors, including living and working environments, dietary habits, and personality traits. Therefore, telomere shortening plays a role in the "biological clock" and is more closely associated with cancer. Further research has shown that some telomeres gradually shorten in length, while others remain relatively constant (Muezzinler, A. et al., 2013, Ageing Res Rev 12:509-519). Only normal embryonic cells in vivo, including germ cells and stem cells, can extend telomeres through the catalytic action of telomerase, maintaining the normal length of all telomeres and enabling continuous cell division. However, more than 90% of cancer cells exhibit abnormally high telomerase activity, yet their telomeres are shorter than those of somatic cells without telomerase activity. Telomerase can also maintain the constant length of these shortened telomeres, allowing them to evade programmed apoptosis and thus achieving "immortality" for cancer cells. Telomere shortening and abnormal activation of telomerase are directly associated with cell division, aging, and carcinogenesis (Greider, CW et al., 1996, Annu Rev Biochem 65, 337-365; Blasco, MA, 2005, Nat. Rev. Genet. 6: 611–622; Turner, KJ, et al., 2019, Cells, 8: 73-92). The 2009 Nobel Prize in Physiology or Medicine was awarded to the three discoverers of telomeres and telomerase.

[0018] Telomeres, located at the ends of chromosomes, are specialized structures formed by the binding of various proteins to the ends of genomic DNA. Besides the associated proteins, human telomere DNA consists of simple repeat sequences (TTAGGG)n, with the 3' end protruding to form a single-stranded structure approximately 24-96 bp in length. In vivo, the 3' end single strand inserts back into the double-stranded region, forming "T-loop" and "D-loop" structures. This provides a binding basis for telomere proteins such as TIN2, TPP1, TRF1, TRF2, Pot1, and Pot1a, forming a terminal "cap" structure to effectively prevent exonuclease damage to the genome (Tian, ​​X. et al., 2010, Appl Biochem Biotechnol, 160: 1460-1472). This loop structure is crucial for the self-protection and stability of telomeres and chromosomes. Loss of the loop structure triggers programmed apoptosis. Theoretically, there are six possible telomere 3' end repeat sequences in humans: 1) 5'TTAGGG3'; 2) 5'GTTAGG3'; 3) 5'GGTTAG3'; 4) 5'GGGTTA3'; 5) 5'AGGGTT3'; and 6) 5'TAGGGT3'. The inventors used a telomere 3' end repeat sequence detection method to examine 15 telomeres in the whole blood genomes of 17 normal individuals of different ages. The results showed a significant preference for 3' end repeat sequences, with 5'AGGGTT3' endings accounting for 26±7.7%, and gradually decreasing with age. Nucleic acid kinetic analysis also showed that the 5'AGGGTT3' end repeat sequence was significantly more stable than the other five ending sequences, further supporting the existence of a preference for telomere 3' end repeat sequences in vivo.

[0019] The inventors further conducted a simultaneous detection study on cancerous tissue, adjacent normal tissue, and normal tissue from patients with six different types of cancer—breast cancer, rectal cancer, colon cancer, liver cancer, lung cancer, and stomach cancer—under the same genetic background. More importantly, they discovered that the proportion of 5'AGGGTT3' in cancerous tissue was significantly lower than in adjacent normal tissue, less than 19.0% in early pathological stages and less than 15.4% in late stages, falling below the theoretical average of 16.7% for the six telomere endings. This degree of decrease in cancerous tissue showed a clear linear relationship with pathological progression and was independent of cancer type, indicating that the decrease in the 3' telomere 3' terminal repeat sequence 5'AGGGTT3' is a common phenomenon in cancer. This suggests that the 3' telomere 3' terminal repeat sequence may be directly related to cellular carcinogenesis.

[0020] The non-random ending of the 3' telomere repeat sequence is mainly due to the selective preference of the telomerase RNA template for the 3' end base of the telomere. This end base is both the binding site of telomerase, i.e., the "substrate," and the "product" catalyzed by telomerase synthesis. The inventors combined the Trap method (Imam, SA, et al., 1997, Anticancer Res 17:4435-4441) with a 3' telomere repeat sequence detection method, using six oligonucleotides with two base differences at the end of the 3' end as leader sequences to conduct an in-depth study on the efficiency and characteristics of telomerase in HELA cells catalyzing telomere synthesis in vitro. They found that telomerase pairs with the two bases at the end of the 3' telomere to form an effective binding site, synthesizing 6 bases per translocation. Different binding sites directly determine the translocation efficiency and synthesis efficiency of telomerase, thus affecting telomere elongation. The efficiency, from highest to lowest, is TT>GT>GG, reaching 177, 110, and 89.7 relative units, respectively.

[0021] Combining the disordered 3' terminal repeat sequences of telomeres in cancer cell genomes with the catalytic properties of telomerase, the inventors conducted a detailed analysis of 27 located telomere sequences based on information from the NCBI human genome database. Surprisingly, they discovered that within a telomere region approximately 100–1000 bp from the chromosome, 18 telomeres exhibited n abnormal repeat sequences, including (5'AGGGTC3')n, (5'GGGTTC3')n, (5'AGGGTG3')n, and (5'GGGTTG3')n. The inventors hypothesize that defects in semi-conservative DNA replication during cell division lead to the shortening of telomere DNA repeat sequences, decreasing by approximately 60–180 bp with each division. After dozens of cell divisions, telomeres shorten to genetically defective telomere regions (i.e., telomere regions containing 5'AGGGTC3', 5'GGGTTC3', 5'AGGGTG3', or 5'GGGTTG3'), and the two bases at the 3' end of some telomeres will exhibit a TC or TG ending. Since these endings are inherited along with the human genome, in this invention, the inventors define telomeres with such endings as TC or TG genetically defective telomeres, respectively.

[0022] Beyond specific theories, the inventors hypothesize that the presence of TC or TG genetically defective telomeres completely alters the optimal binding site for telomerase in telomere synthesis, severely impacting its normal catalytic activity and efficiency. On one hand, it disrupts translocation control, primarily via the 5'AGGGTT3' pathway, leading to disordered 3' ends of elongated telomeres and interfering with loop formation. On the other hand, due to low catalytic efficiency and limited telomere length, the binding protein at the telomere ends transmits an erroneous "telomerase deficiency" signal, causing the cell to restart telomerase expression. Ultimately, instead of initiating programmed apoptosis, the cell misdirects the telomerase gene, circumventing programmed apoptosis, restoring its ability to divide, and achieving "immortality."

[0023] To further demonstrate the direct relationship between TC and TG genetically defective telomeres and cellular carcinogenesis, the inventors employed a site-directed mutagenesis method using the recombinant human telomerase RNA gene. This method utilized the effective pairing of a single-base mutant of the telomerase RNA gene with TC or TG in genetically defective telomeres to repair genetically defective telomeres in HELA cells. The results showed that the vast majority of HELA cells underwent programmed apoptosis. Using an adenovirus AD5 gene vector, the adenovirus particles of this mutant were injected into xenografts of the Bcap37 cell line. The results also showed a one-third reduction in tumor growth rate, and paraffin sections of the tumors revealed significant apoptosis. Genomic DNA analysis of the tumors showed very typical characteristics of programmed apoptosis, and the inventors were also surprised to find a 75.1% decrease in telomerase activity. These findings clarify that the presence of TC and TG genetically defective telomeres is an important characteristic of human cellular aging or carcinogenesis, and confirms their direct correlation with cellular carcinogenesis. They are among the most important drivers of early-stage carcinogenesis and can serve as novel targets for innovative drug development. TC and TG genetically defective telomeres are also extremely important biomarkers for early-stage carcinogenesis and can be used for ultra-early screening of various cancer types. Therefore, quantitative detection of telomeres with genetic defects in TC and TG in cells can achieve the goal of ultra-early screening for pan-cancer types. Simultaneously, related drugs for accompanying interventions, prevention, and treatment of pan-cancer ultra-early screening have been developed according to this invention.

[0024] The inventors also discovered that detecting the telomere status of human peripheral blood genomes not only reflects the telomere status of other human tissues but is also the optimal tissue for detecting genetically defective telomeres. It is a "liquid-phase" tissue, where a small number of cells with genetically defective telomeres coexist in a relatively homogeneous environment with other normal cells, making even very small samples highly representative—something impossible with other "solid-phase" tissues. Furthermore, peripheral blood is also the tissue where genetically defective telomeres occur earlier, a conclusion supported by large-scale data in a paper published in *Science* (Demanelis et al., 2020, *Science* 369:1333, https: / / doi.org / 10.1126 / science.aaz6876). In addition, basic cytogenetics shows that mitosis in eukaryotic cells is completely different from meiosis. Mitosis does not involve complete dedifferentiation of cells or the pairing of sister chromosomes; the cells produced after division are identical to those before division. Through research on telomere behavior in the model organism rice, the inventors discovered that only meiosis can alter the difference in telomere length between sister chromosomes, while mitosis cannot. There are two subspecies of rice: indica and japonica. The average telomere length of indica rice is more than three times longer than that of japonica rice (Ohmido, N., et al., 2000, Mol Gen Genet 263:388-394). Utilizing this characteristic, indica rice (Guanglu Dwarf 4) was used as the male parent, and japonica rice (Nipponbare) as the female parent. Through artificial pollination, hybridization was performed to obtain the F1 hybrid. The telomere length (Chr.04q) of the long arm of the fourth chromosome in both the F1 and paternal / maternal parents was analyzed. The results showed that the telomere length of chromosomes from the paternal parent in the F1 was similar to that of the paternal parent, and the telomere length of chromosomes from the maternal parent in the F1 was similar to that of the maternal parent. This indicates that the telomere length difference between sister chromosomes in the F1 is significant, demonstrating that mitosis cannot alter the telomere length between sister chromosomes. In mammals, Dolly the sheep, a world-famous somatic cell clone, had a lifespan approximately 6.7 years shorter than that of a normal sheep of the same breed. This is closely related to the fact that its cell nucleus originated from mammary gland cells of a 6-year-old sheep. This premature aging and death may also corroborate that although the entire dedifferentiation and redifferentiation process of animal cells is completely altered through nuclear-cytoplasmic fusion of different somatic cells, the result cannot change or restore the length of telomeres, thus reversing the "telomere clock" (Kishigami, S., et al., 2008, Exp Cell Res 314:1945-1950). Clearly, mitosis cannot alter the genetic behavior of telomere length in mammalian cells.The human body originates from a single fertilized egg cell and is formed through several mitotic divisions. Therefore, the consistency of telomere behavior in various human tissues, including the peripheral blood genome, shows that with age, only their absolute lengths shorten synchronously. In other words, the state of telomeres in the peripheral blood genome directly reflects the telomere state of the human body and its various tissues. This conclusion is fully demonstrated and supported by a big data paper published in the world-renowned journal *Science*. This paper conducted an in-depth and detailed study on telomere length changes using nearly 1,000 deceased donors, 25 different human tissues, and 6,391 samples (Demanelis et al., 2020, *Science* 369: 1333, https: / / doi.org / 10.1126 / science.aaz6876). The results showed that only testicular tissue had the longest telomeres, significantly longer than other tissues, indicating that only meiosis can restore telomere length, while mitosis cannot. A more significant finding from this report is that peripheral blood telomeres were the shortest among 25 tissues, strongly suggesting that peripheral blood can serve as a substitute for telomere length in other tissues. Furthermore, the inventors believe that the shortest telomeres in peripheral blood indicate that it is also the tissue most likely to have TC and TG genetically defective telomeres. Therefore, using peripheral blood for telomere screening is undoubtedly the optimal choice in terms of timing; quantitative detection of TC and TG genetically defective telomeres in the peripheral blood genome can achieve the goal of ultra-early screening for pan-cancer diseases.

[0025] Therefore, this invention discloses a pan-cancer ultra-early screening method based on peripheral blood DNA. It involves the quantitative detection of TC and TG genetically defective telomeres, which can advance cancer screening to before or after cell carcinogenesis, achieving pan-cancer ultra-early screening.

[0026] As used in this article, the term "pan-cancer" refers to cancers with abnormally elevated telomerase levels in cells. These cancers account for more than 90% of all human cancers and most originate from cancerous changes in cells within epithelial tissues. They also include sarcomas, blastomas, and other similar tumors.

[0027] As used in this article, the term "ultra-early screening" refers to effective screening shortly before or after tissue or cell carcinogenesis, before cancer cells or cancerous tissue detach, die, undergo apoptosis, or are secreted into the peripheral circulation system. Its effective screening timeframe is significantly earlier than existing early screening technologies based on ctDNA, cfDNA, CTC, DNA methylation, and / or oncogene mutation profiles (panels).

[0028] As used herein, the term "subject" refers to the test subjects and screening subjects involved in the technology of this invention. For the sake of accurate description, subjects can be divided into three types: Category A subjects are cancer patients diagnosed by existing clinical diagnostic techniques, which may be known or unknown advanced tumors, and may be cancer patients who have received medical intervention or have not received intervention; Category B subjects are normal subjects without any cancer symptoms, and who have not developed any cancer symptoms during a follow-up period of 2 to 5 years; Category C subjects are normal subjects without any cancer symptoms, who may or may not be cancer patients in the future.

[0029] As used herein, the terms "nucleic acid," "nucleic acid sequence," "oligonucleotide," and "primer" refer to any molecule based on ribonucleotides or deoxyribonucleotides, including DNA, ctDNA, cfDNA, or any combination thereof. Therefore, nucleic acid molecules, oligonucleotides, or primers may include naturally occurring nucleotides, non-natural nucleotides, or combinations thereof.

[0030] As used herein, the term "oligonucleotide" refers to a single-stranded sequence of deoxyribonucleotide or ribonucleotide bases, a known analogue of a natural nucleotide, or a mixture thereof. Oligonucleotides are typically short in length (e.g., less than 100 nucleotides) and can be prepared by any suitable method, including, for example, direct chemical synthesis or cloning and restriction enzyme digestion of a suitable sequence. Typically, in the context of this invention, oligonucleotides are designed to recognize and bind to a specific complementary nucleotide sequence located within another nucleic acid molecule. Oligonucleotides may also include bases other than those required for hybridization with said complementary sequence. Oligonucleotides may or may not act on polymerase-mediated extension primers. It is not required that all bases in an oligonucleotide be complementary to the sequence to which the oligonucleotide is designed to bind; the oligonucleotide only needs to contain enough complementary bases for the oligonucleotide to recognize and bind to that sequence. The oligonucleotide sequence can be an unmodified nucleotide sequence or can be chemically modified or conjugated using a variety of methods known to those skilled in the art.

[0031] As used herein, the term "primer" refers to an oligonucleotide that binds to a specific region of a single-stranded template nucleic acid molecule and initiates nucleic acid synthesis via an enzymatic reaction (extending from the 3' end of the primer and being complementary to the sequence of the template molecule). Typically, primers are referred to as 'forward' and 'reverse' primers, one of which is complementary to the nucleic acid strand, and the other of which is complementary to the complementary strand of that strand.

[0032] As used herein, the term "DNA adapter" refers to a short, double-stranded oligodeoxyribonucleotide, a sticky end-connector consisting of a linker strand and a selector strand. It can be attached to the end of telomeric DNA with genomic defects via DNA ligase, with the bases complementary to the 3' end of the selector strand.

[0033] As used herein, the term "biological sample" refers to any biological sample containing human genomic DNA. A biological sample can be human tissue, cells, secretions, or a pre-processed sample thereof.

[0034] As used herein, the term "detection value" refers to a numerical value obtained by analyzing genomic DNA from a biological sample from a subject to be screened using the methods of this invention. It can be described as the total amount (ng) and fraction (ng) of amplified DNA bands of TC and / or TG genetically defective telomeres present in the genomic DNA, along with the corresponding DNA molecular weight (bp), and the chromosomal arm location of the genetically defective telomeres.

[0035] As used in this article, the term "reference value" refers to test values ​​obtained by testing a large number of Category A and Category B subjects. These values ​​may include parameters relating the distribution of genetically defective telomeres on different chromosome arms to cancer types. Processed through mathematical modeling and artificial intelligence techniques, these values ​​represent a set of pan-cancer risk thresholds, which may or may not include age, gender, and external environmental factors. They can be used as a comparative standard or parameter for assessing a subject's cancer risk and the risk of developing a specific type of cancer.

[0036] As used herein, the term "telomere genetic defect" refers to the presence of multiple tandem abnormalities in certain near-chromosomal telomere repeat sequences within the DNA repeat sequences of human chromosome telomeres. This abnormality is inherited genomically and is defective compared to normal telomere repeat sequences, including (AGGGTC). n (GGGTTC) n (AGGGTG) n And / or (GGGTTG) n .

[0037] As used herein, the term "genetically defective telomere" refers to a telomere that gradually shortens with each cell division in the human body. When the telomere shortens to the genetically defective region, the two bases at the end of the 3' end of the telomere exhibit a TC or TG defective structure. Examples include 5'…AGGGTC 3', 5'…GGGTTC 3', 5'…AGGGTG 3', and / or 5'…GGGTTG 3'.

[0038] As used in this article, the term "internal control" refers to a single-copy conserved genomic DNA fragment or housekeeping gene DNA fragment with the same blunt-end restriction enzyme cleavage at both ends and a size of 0.5–2.0 kb selected from the human genome in order to minimize various uncertainties and errors in the testing process of different subject samples. Specific amplification primers for this fragment are designed and synchronously PCR amplified with the test sample from the same subject. The amount of amplification product obtained can be used to correct the amount of amplification product in that sample.

[0039] In one aspect, the present invention provides a method for ultra-early pan-cancer screening of subjects, comprising the steps of quantitatively detecting genetically defective telomeres in genomic DNA from biological samples of the subjects, namely one or more of the 3' end sequences of telomeres 5'AGGGTC3', 5'GGGTTC3', 5'AGGGTG3', and 5'GGGTTG3', and / or locating genetically defective telomeres on different chromosome arms, and optionally comparing the obtained detection levels with reference values.

[0040] The genomic DNA used in this invention can be prepared using conventional methods, referring to *Molecular Cloning: A Laboratory Manual*, ensuring that the prepared genomic DNA is intact and undegraded, and that its 3' telomere sequence can be determined by PCR. In one embodiment, the prepared genomic DNA is first digested with restriction endonucleases, then ligated with suitable DNA adapters, the telomeres to be detected are amplified by PCR, and the products are quantitatively analyzed.

[0041] The method of the present invention may include: preparing a genomic DNA sample; treating the genomic DNA with restriction endonucleases; purifying the enzyme-digested sample; ligating the purified enzyme-digested DNA fragments with DNA adapters specific to the telomeres to be detected; purifying the ligated sample; PCR amplifying the telomere sequence to be detected, and performing quantitative analysis on the product and / or sequencing the product with DNA, and comparing it with human whole genome information to identify its corresponding chromosome arm.

[0042] In one embodiment, the method of the present invention includes the following steps:

[0043] 1) Genomic DNA isolated from the biological samples of the subjects was treated with restriction enzymes and then purified;

[0044] 2) The purified enzyme-digested genomic DNA from step 1) is ligated to an adapter, which specifically targets the 3' terminal repeat sequence of the genetic defect telomere described in this invention and consists of two oligonucleotide chains. One of the oligonucleotide chains is an 18-base linker strand (LL) with 5' phosphorylation modification and 3' C3 spacer modification, and its sequence can be, for example... (SEQ ID NO.5), the other oligonucleotide chain is a 17-base sequence selected from the 3' C3 spacer modified. (SEQ ID NO.1) (SEQ ID NO.2) (SEQ ID NO.3) or The selected strands (SL, namely SL1, SL2, SL3 and SL4) of (SEQ ID NO.4) are adapted to different genetic defect telomere sequences;

[0045] 3) Purify the ligation sample obtained in step 2);

[0046] 4) Perform PCR amplification and quantitative analysis on the purified sample obtained in step 3).

[0047] In this invention, the subject can be a mammal, such as a primate, particularly a human. The subject can be a normal individual without any cancerous symptoms, an individual at risk of developing cancer, a suspected cancer patient, an individual with unhealthy habits or a family history of cancer-related genetic disorders, or an individual in a specific living or working environment, etc. The biological sample is a sample containing genomic DNA and may include, for example, blood, urine, stool, sputum, pleural fluid, peritoneal fluid, bronchial and bronchoalveolar lavage fluid, tissue sections, epidermis, mucous membranes, etc. Samples can be obtained, for example, by aspiration biopsy using puncture techniques. Samples can be processed, such as paraffin-embedded tissue, tissue fixed in fixative, tissue treated with preservatives, frozen tissue, etc. Blood can be whole blood or white blood cells; preferably, the biological sample is peripheral blood.

[0048] The malignant tumors mentioned can be tumors or cancers with abnormally elevated telomerase levels, accounting for more than 90% of malignant tumor types, such as lung adenocarcinoma, liver cancer, breast cancer, stomach cancer, adrenocortical carcinoma, cervical cancer, ovarian cancer, and other cancers originating from epithelial tissue, as well as sarcomas and blastomas.

[0049] In some implementations, genomic DNA can be extracted from cells or tissues prior to analysis. Those skilled in the art will understand how to extract genomic DNA from biological samples from a subject, or how to prepare genomic DNA using an automated genomic DNA extractor, ensuring the integrity and non-degradation of the genomic ends, referring to teachings such as *The Handbook of Molecular Cloning* (edited by Sambrook and Manitis et al.). Alternatively, cells may be further treated to make the DNA usable for analysis; for example, cell lysates may be used with or without denaturation or degradation of cellular proteins, and protective agents, DNA cleaners, etc., may or may not be used to prevent DNA degradation. Preferably, an EDTA anticoagulant is used in the blood collection tube, and the genomic DNA is further purified to ensure genomic integrity and purity for use in step 1).

[0050] In the method of this invention, any suitable endonuclease can be used to fragment the genomic DNA isolated from the subject sample, provided that there is no restriction site of the endonuclease between the designed forward primer and the 3' terminal repeat sequence of the telomere. Preferably, the endonuclease is a blunt-ended endonuclease, such as EcoRV, AluI, HaeIII, SmaI, SnaBI, etc., but it is not limited thereto. Those skilled in the art can determine a suitable endonuclease through conventional experiments combined with the above conditions.

[0051] In the method of this invention, the subject's genomic DNA digested with endonucleases is purified and the target fragment is enriched. Such DNA purification and enrichment methods are known in the prior art, including, for example, phenol / chloroform purification, magnetic bead purification and enrichment methods, etc. Appropriately long digested fragments can be selectively recovered, such as target fragments less than 2.5 kb, 2.0 kb, 1.5 kb, 1.0 kb, or 0.9 kb, 0.8 kb, 0.7 kb, 0.6 kb, 0.5 kb. Fragments less than 1.5 kb are preferably recovered. The purified subject's genomic DNA can be used in subsequent ligation reactions.

[0052] The DNA adapter used in this invention can be provided in oligonucleotide form and then fabricated into an adapter upon use. Alternatively, the DNA adapter used in this invention can be provided after a DNA adapter made from a synthetic oligonucleotide chain. The adapter consists of two synthetically produced oligonucleotide chains: a linker strand (LL) with 5' phosphorylation modification and 3' C3 or C6 spacer modification, designed with a 5'-X'-Y'-3' sequence; and a selector strand (SL) with 3' C3 or C6 spacer modification, designed with sequences of SL1, 5'-X-gaccct-3'; SL2, 5'-X-gaaccc-3'; SL3, 5'-X-caccct-3'; and SL4, 5'-X-caaccc-3' for different genetic defect telomere sequences. X' and X are anticomplementary, and their lengths can be 8-25, 10-20, or 10-15 nucleotides; Y' and Y are anticomplementary, and their lengths can be 2-20, 4-15, or 6-12 nucleotides (Y is part of the reverse primer; see reverse primer design for details). Preferably, the linker strand is 18 nucleotides, where X' is 11 nucleotides and Y' is 7 nucleotides. (SEQ ID NO. 5); preferably, the chain is selected to be 17 nucleotides, where X is 11 nucleotides, i.e., SL1. (SEQ ID NO.1); SL2, (SEQ ID NO.2); SL3, (SEQ ID NO.3); and SL4, (SEQ ID NO.4). The LL linker strand can be used with the SL1, SL2, SL3 and SL4 selector strands to form LK1, LK2, LK3 and LK4 adhesive linkers, respectively, suitable for different genetic defect telomeres.

[0053] Methods for preparing DNA adapters from oligonucleotides are known in the prior art and can be readily performed by those skilled in the art. For example, equimolar amounts of 1-100 mM linker (LL) solution and 1-100 mM of the corresponding selector solution can be mixed in a buffer, centrifuged, and then subjected to PCR cooling cycles. In one embodiment, the corresponding DNA adapter solution can be obtained by cycling at 98°C / 1 min, 97°C / 1 min, and then decreasing by 1°C per cycle until stopping at 12°C.

[0054] The DNA adapter solution can be directly ligated with the purified, endonuclease-digested subject genomic DNA fragments prepared in the previous steps using a DNA ligase. The conditions for the DNA ligation reaction are known to those skilled in the art and can be performed using routine experiments. Preferably, the ligase is a highly specific sticky-end ligase, such as T7 DNA ligase, but it is not limited thereto; those skilled in the art can determine a suitable ligase through routine experiments.

[0055] The product obtained from the ligation reaction can be used directly for PCR amplification, or it can be purified using DNA purification methods before being used for PCR amplification. Suitable DNA purification methods are known in the art, including, for example, phenol / chloroform extraction, magnetic bead extraction, etc. In one embodiment, the primers used in PCR amplification include: a forward primer (FPrim), which can be designed specifically for a single telomere or a group of telomeres. Specifically, a specific forward primer can be designed for the proximal telomere region of a chromosome, or a forward primer that specifically represents multiple telomeres can be designed from homologous conserved sequences of multiple located proximal telomere regions of chromosomes. This forward primer may also cover other unknown or unlocated telomeres with the same homologous conserved sequences. Preferably, a homologous forward primer capable of amplifying 15 pre-localized telomeres (Chr01q, Chr2q, Chr04q, Chr7q, Chr8p, Chr9p, Chr10q, Ch12q, Chr13q, Chr15q, Chr16p, Chr21q, Chr22q, ChrYq, and ChrXq) is used. The homologous forward primer is 5'-gaatcctgcgcaccgagattctc-3' (SEQ ID NO.6; FPrim). The reverse primer is designed with a sequence of 5'-YXZ-3', where X can be 8-25, 10-20, or 10-15 nucleotides in length, and Y can be 2-20, 4-15, or 6-12 nucleotides in length. X and Y are respectively anticomplementary to X' and Y' in the linker strand (see adapter design for details of X' and Y'). Z can be 1 to 6 nucleotides in length and is inversely complementary to the 3' terminal repeat sequence of the defective telomere. Preferably, Y is 6 nucleotides, X is 11 nucleotides, and Z is 3 nucleotides, i.e., a reverse primer. (SEQ ID NO.7; RPrim1, applicable to LK1); (SEQ ID NO.8; RPrim2, applicable to LK2); (SEQ ID NO.9; RPrim3, applicable to LK3); and (SEQ ID NO.10; RPrim4, applicable to LK4).

[0056] Optimization of PCR amplification conditions is well known to those skilled in the art. This includes, for example, altering the temperature cycling conditions for PCR amplification; adding enhancers to the reaction solution to improve the specificity and / or efficiency of PCR amplification, such as PEG, glycerol, dimethyl sulfoxide, etc.; and using or not using hot-start DNA polymerase. Glycerol and hot-start polymerase are preferably used, employing touchdown PCR technology.

[0057] Then, the PCR amplification products are quantitatively measured. Quantitative measurement of PCR amplification products can be performed using conventional methods, such as electrophoresis and chromatography, quantifying the PCR amplification results by measuring electrophoretic bands or elution peaks. Alternatively, quantitative real-time PCR (qPCR) or digital PCR can be used, achieving PCR quantification through primer fluorescent labeling or a series of PCRs with different template concentration gradients. PCR amplification products can be separated by electrophoresis, stained, and imaged. Furthermore, the DNA sequence of specific target DNA bands can be determined and compared with the human whole genome sequence to identify the chromosome (arm) corresponding to the target DNA band. This allows for obtaining a distribution map of genetically defective telomeres on chromosomes and their correlation with cellular carcinogenesis in different tissues, establishing an important database for cancer tracing.

[0058] Simultaneous quantitative determination of PCR amplification amount and molecular weight of each amplified DNA band in the image is performed using suitable software, such as Syngene Tools, Quantityone, and ImageJ. In one implementation, using a standardized quantified DNA marker as a scalar, the PCR products are separated by agarose gel electrophoresis, stained, and imaged using a quality control system. Syngene Tools software is used to quantitatively analyze the DNA bands in the image, including the total amount of PCR amplified product (ng), the molecular weight of each band (bp), and the corresponding amount of amplified product (ng), obtaining PCR amplified product band spectrum detection data. Based on this data, a comprehensive comparison of longitudinal detection parameters before and after the amplification of category A subjects can monitor and evaluate the progression of cancer, treatment effectiveness, or cancer recurrence; a horizontal comparison with patients with similar cancer types can assist in optimizing treatment plans; further analysis of the DNA sequence information of the amplified band spectrum of category A subjects can locate genetically defective telomeres, obtain the correlation between corresponding chromosomal genetically defective telomeres and cancer types, providing important references for subsequent treatment plans and drug selection. By accumulating large amounts of data from Category A and Category B subjects, a mathematical model is established. This model, combined with artificial intelligence algorithms, analyzes and identifies the tissues and organs most likely to develop cancerous cells, obtaining a comprehensive reference threshold for detection. For each Category C subject, the test results are compared with the reference values ​​using artificial intelligence learning technology to assess the risk of developing cancer within a certain timeframe. For example, if a clear PCR amplification band indicates the presence of genetically defective telomeres in a Category C subject's blood, further information and evaluation can be obtained by comparing the total PCR amplification amount, the molecular weight of the specific band, and the amplification quantity with the reference value. This allows for further DNA sequencing analysis of the amplified DNA bands to obtain information about the chromosome (arm) where the target DNA band is located, achieving the goal of ultra-early cancer screening and early warning.

[0059] This invention's pan-cancer ultra-early screening method is based on screening for telomeres with TC and TG genetic defects in cells. It is a novel and original screening technology that can advance the screening time to before or after cell carcinogenesis, truly achieving ultra-early cancer screening, significantly superior to existing screening technologies. It utilizes the consistency between telomeres in the genomes of various human tissues and cells. In particular, it leverages the high consistency of telomere changes in peripheral blood with those in other tissues and organs (except for meiotic tissues in the testes). A small amount of whole blood, such as 0.2 ml, is used as the screening sample, making sampling convenient and non-invasive.

[0060] On the other hand, the present invention provides a kit for pan-cancer ultra-early screening, which includes oligonucleotide chains for testing TC and TG genetic defect telomeres in subjects and PCR detection primers and related reagents.

[0061] In one embodiment, the kit contains at least five oligonucleotides, namely 5'X-gaccct3', 5'X-gaaccc3', 5'X-caccct3', and 5'X-caaccc3', which are the selection strands of genetically defective telomeres of 5'AGGGTC3', GGGTTC3', 5'AGGGTG3', and 5'GGGTTG3', respectively, and are referred to as selection strands (SL) SL1, SL2, SL3, and SL4, wherein each X independently has 8–25, 10–20, or 10–15 nucleotides, and a corresponding linker strand with the sequence 5'-X'-Y'3', wherein X and X' are inversely complementary; Y' and Y are inversely complementary (Y is part of the PCR reverse primer). The at least five oligonucleotides may be present as linkers (LK) LK1, LK2, LK3, and LK4 formed between the linker strand and the selection strand. Preferably, the sequence of the connecting chain is 5'tcgtagactgcgtaccga 3' (SEQ ID NO.5), and the sequences of the selected chains are 5'gcagtctacgagaccct3' (SEQ ID NO.1), 5'gcagtctacgagaaccc3' (SEQ ID NO.2), 5'gcagtctacgacaccct3' (SEQ ID NO.3), and 5'gcagtctacgacaaccc3' (SEQ ID NO.4).

[0062] In another embodiment, the 5' end of one or more of the linking chains is phosphorylated, and the 3' end of the linking and selecting chains is modified with a C3 spacer or a C6 spacer.

[0063] In a further embodiment, the kit further comprises amplification primers, including, for example, the forward primer 5'gaatcctgcgcaccgagattctc3' (SEQ ID NO. 6); and one or more reverse primers selected from the following: 5'cggtacgcagtctacgagac3' (PRim1, SEQ ID NO. 7), 5'cggtacgcagtctacgagaa3' (Prim2, SEQ ID NO. 8), 5'cggtacgcagtctacgacac3' (Prim3, SEQ ID NO. 9) and 5'cggtacgcagtctacgacaa3' (Prim4, SEQ ID NO. 10), which can be used for the detection of the adapter forms LK1, LK2, LK3 and LK4 formed by the linker strand LL and the selector strands SL1, SL2, SL3 and SL4, respectively.

[0064] Optionally, the kit of the present invention may further include one or more of the following: positive control, negative control, internal control, DNA marker standard, buffer, restriction endonuclease, ligase, PCR amplification enzyme, or any combination thereof. The kit of the present invention may also optionally include instructions for use.

[0065] Test results of the screening method and kit of this invention showed that in retrospective testing of blood samples from various cancer patients, the sensitivity reached 100% (16 / 16), and the specificity reached 97.6% (41 / 42). One subject, although showing a low molecular weight band, had a very low total PCR amplification; after a 56-month follow-up, the subject was healthy, indicating an actual specificity of 100%. This method can cover cancers with abnormally elevated telomerase levels, accounting for approximately 90% of cancer types, meeting the requirements for pan-cancer detection. Furthermore, the detection of TC-deficient telomeres can also be used for companion diagnosis and monitoring during various cancer treatments. This technology, based on genomic DNA from subject tissues and secretions, especially peripheral blood, is convenient, requires minimal sample volume, is non-invasive, requires few equipment, is easy to operate, offers better data stability and repeatability, and is cost-effective, possessing broader market application potential and significantly superior to existing technologies.

[0066] On the other hand, specific fluorescent probes can be used to directly label the terminal single base of TC and / or TG genetically defective telomeres, or gene chip detection methods can be used to achieve quantitative detection of TC and / or TG genetically defective telomeres, thus achieving the goal of ultra-early screening of pan-cancer types as described above. Attached Figure Description

[0067] The specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.

[0068] Figure 1 and Figure 2a , Figure 2b , Figure 2c DNA adapters were prepared using the LL and SL1 chains of this invention, and the results of whole blood genomic DNA testing were performed on different types of cancer and non-cancer samples. DNA markers, with molecular weights decreasing from 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp, were used, with the 750 bp standard amount being 60.0 ng. Quantitative analysis of the PCR amplification products was performed using Syngene Genetool software, including the molecular weight (bp) of the DNA bands and the product amount (ng). In the figure, the dashed line represents the DNA marker standard sample, and the solid line represents the subject sample. Figure 1-1 The four cancer cell lines shown in ~1-4 are lung cancer, colon cancer, liver cancer, and cervical cancer. Figure 1-5 The normal hepatocyte line shown is LO2. Figure 2a In the middle: Lung cancer cases shown in Figures 2-1 to 2-7; colon cancer cases shown in Figures 2-8 to 2-9; Figure 2b Figure 2-10 shows colon cancer; Figure 2-11 shows rectal cancer; Figures 2-12 and 2-13 show cervical cancer; Figure 2-14 shows ovarian cancer.

[0069] Figure 2-15 shows gastric cardia cancer; Figure 2-16 shows gingival cancer; Figures 2-17 and 2-18 show normal subjects (Class B subjects); Figure 2c In the middle: Normal subjects (Category B subjects) are shown in Figures 2-19 to 2-21. Among all the cancer patients shown in the figures, they may have received or are currently receiving various treatments. Except for patient 3 with colon cancer whose cancer cells have metastasized, the other patients have not metastasized.

[0070] Table 1, will Figure 1 The table summarizes the molecular weight of the amplified DNA bands and the amount of PCR products for the tested cases, including the calculated number of telomeres in each case. In 7 lung cancer cases, the "bold + underlined" DNA fragments originated from the same TC-deficient telomere; in 3 colon cancer cases, the "bold + italic" DNA fragments originated from another TC-deficient telomere.

[0071] Figure 3 The results of statistical analysis of the total PCR product count for each test case in Table 1 are as follows: 16 cancer patients (◆), 4 cancer cell lines (●), and 5 normal subjects (○).

[0072] Figure 4 A schematic diagram of the construction of the hTERC eukaryotic expression vector is shown.

[0073] Figure 5 A schematic diagram of the construction of the hTERC adenovirus shuttle vector carrying the hTERT promoter is shown.

[0074] Figure 6 The expression of the recombinant hTERC wild-type eukaryotic expression was shown in HeLa cells.

[0075] Figure 7 The study demonstrated the effect of the mutated hTERC gene on the growth of the cancer cell line HeLa.

[0076] Figure 8 The apoptotic characteristics of HeLa cells were observed using Hoechst 33342 staining.

[0077] Figure 9 The study demonstrated the inhibitory effect of the mutated hTERC gene on the growth of solid tumors in human breast cancer.

[0078] Figure 10 The study demonstrated the inhibitory effect of the mutated hTERC gene on telomerase in human breast cancer cells.

[0079] Figure 11 The study showed the effect of a single-base mutation in the hTERC gene on apoptosis in human breast cancer solid tumor cells by observing tissue sections. Figure 12 The study demonstrated the effect of the mutated hTERC gene on programmed apoptosis in human breast cancer cells. Detailed Implementation

[0080] This invention relates to the following sequences:

[0081] SL1 artificially synthesized sequence, 3' end C3 spacer modified

[0082] 5'GCAGTCTACGAGACCCT 3'(SEQ ID NO.1)

[0083] SL2 artificially synthesized sequence, 3' end C3 spacer modified

[0084] 5'GCAGTCTACGAGAACCC 3'(SEQ ID NO.2)

[0085] SL3 artificially synthesized sequence, 3' end C3 spacer modified

[0086] 5'GCAGTCTACGACACCCT 3'(SEQ ID NO.3)

[0087] SL4 artificially synthesized sequence, 3' end C3 spacer modified

[0088] 5'GCAGTCTACGACAACCC 3'(SEQ ID NO.4)

[0089] LL artificially synthesized sequence, 5' phosphorylation, 3' C3 spacer modification

[0090] 5'TCGTAGACTGCGTACCGA 3'(SEQ ID NO.5)

[0091] Primer FPrim artificially synthesized sequence,

[0092] 5'GAATCCTGCGCACCGAGATTCTC 3'(SEQ ID NO.6)

[0093] The primer RPrim1 is a synthetically produced sequence.

[0094] 5'CGGTACGCAGTCTACGAGAC 3'(SEQ ID NO.7)

[0095] The primer RPrim2 is a synthetically produced sequence.

[0096] 5'CGGTACGCAGTCTACGAGAA 3'(SEQ ID NO.8)

[0097] The primer RPrim3 is a synthetically produced sequence.

[0098] 5'CGGTACGCAGTCTACGACAC 3'(SEQ ID NO.9)

[0099] The primer RPrim4 is a synthetically produced sequence.

[0100] 5'CGGTACGCAGTCTACGACAA 3'(SEQ ID NO.10)

[0101] Implementation Plan

[0102] The following provides one embodiment of the pan-cancer ultra-early screening method of the present invention:

[0103] 1) Genomic DNA sample preparation:

[0104] Using the MiniBEST Whole Blood Genomic DNA Extraction Kit provided by Takara Bio Engineering (Dalian) Co., Ltd. (TAKARA), human blood genomic DNA samples were extracted and prepared according to the kit instructions. Finally, 1xTE, pH 7.6 buffer was used instead of the "Elution" elution buffer provided in the kit.

[0105] 2) Oligonucleotide synthesis and adapter fabrication:

[0106] a) The oligonucleotides listed in the sequence listing were synthesized by Shanghai Bioengineering Co., Ltd., and chemically modified as required.

[0107] b) Dissolve the synthesized oligonucleotides in double-distilled water (ddH2O) to prepare 20 mM solutions and set aside. Add 20 μL of sterile double-distilled water (ddH2O) and 5.0 μL of adapter buffer [200 mM Tris-HCl pH 7.6, 600 mM Kac, 20 mM Mg(Ac)2] to a PCR thin-walled tube. Add 12.5 μL of 20 mM linker strand (LL) solution and 12.5 μL of 20 mM selector strand (SL1) solution, mix well, and centrifuge. Place the tube in a PCR instrument and run the following program: 98 °C / 1 min, 97 °C / 1 min (-1 °C / Cycle, 83 Cycles), stop at 12 °C. Label the tube as: LK1.

[0108] DNA adapters LK2, LK3, and LK4 were prepared using the same method.

[0109] 3) Endonuclease treatment of genomic DNA:

[0110] Dilute the prepared genomic DNA to 20 ng / ul with 1xTE pH7.6 buffer. Take 25ul (500 ng DNA) and mix it with 25ul of enzyme digestion mixture [5ul 10x EcoRV buffer, 17ul ddH2O and 3.0ul 15U / ul EcoRV (Takara)]. Incubate at 37°C for 2 hours and label it as: M1.

[0111] 4) Sample purification via enzyme digestion:

[0112] Add 50 μL of ddH2O to each digested sample, then add 40 μL of magnetic bead mixture (Hieff NGS™ Smarter DNA Clean Beads kit), and purify the sample according to the kit instructions. Elute with 28.0 μL of 0.1xTE at pH 7.6, and aspirate 26.5 μL of purified DNA sample, labeling it as: MC1.

[0113] 5) Ligation of purified enzyme-digested DNA fragments with adapters:

[0114] Take 12.0 μL of MC1 DNA fragment, add 15 μL of 2x T7 DNA Ligase Buffer, 1.5 μL of 5.0 μL MILK1, and 1.5 μL of T7 DNA Ligase (Biolab NEB), mix, centrifuge, incubate at 25°C for 2 hours, and label as: MCL1.

[0115] 6) Sample purification:

[0116] Add 70 μL ddH2O to each MCL sample, then purify the sample according to step 4, and elute with 34 μL 0.1xTEpH7.6. Take 32.5 μL of purified DNA sample and label it as: MCLC1.

[0117] 7) Samples purified by PCR amplification:

[0118] Take 8 μL of MCLC1, add 2 μL of ddH2O, then add 10 μL of PCR mixture [4.5 μL ddH2O, 2.0 μL 10x PCR Buffer, 1.6 μL 2.5 mM dNTP, 0.5 μL 25 μM FPrim, 0.5 μL 25 μM RPrim1, 0.6 μL 100% glycerol, and 0.3 μL HS Taq (Takara). Mix well and centrifuge. Execute the Touchdown PCR reaction program (Bio-Rad S1000™ Thermal Cycler): 94℃ / 4 min; {94℃ / 45 sec, 67℃ (-1.0℃ / cycle) / 60 sec, 72℃ / 60 sec} for a total of 6 cycles, (94℃ / 35 sec, 60℃ / 60 sec, 72℃ / 60 sec) for a total of 28 cycles, 72℃ / 15 min, 4℃ / Forever.

[0119] 8) Electrophoretic separation, staining, and imaging of PCR products:

[0120] The PCR product sample and 60 ng (4 μL) of DNA standard (DL2000 DNA Marker, TAKARA) were separated on a 1.5% agarose gel; then, they were normalized with 0.1% ethidium bromide staining and imaged using a GeneGenius Bio-imaging System (SYNGENE, Synoptics Ltd, Cambridge, UK).

[0121] 9) Quantitative analysis, obtaining results:

[0122] The Genetool (SYNGENE, Synoptics Ltd, Cambridge, UK) image quantification tool was used. According to the DNA standard instructions, the molecular weights of the DNA bands in lane M were defined as 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp, with the 750 bp band representing 60 ng of dsDNA. Then, the molecular weight and amplification amount of each target band in the PCR product were determined. Specific Implementation

[0124] Example 1: Determination of 5'AGGGTC3' genetically defective telomeres in various cancer cell lines

[0125] Example 1.1

[0126] Lung cancer cell lines were selected, cultured using standard methods, and a sufficient number of cells were collected to extract genomic DNA. All other steps were identical to the previously described testing protocol, and the quantitative results were recorded as follows: Figure 1-1 .

[0127] Example 1.2

[0128] Colorectal cancer cell lines were selected, cultured routinely, and a sufficient number of cells were collected to extract genomic DNA. All remaining steps were identical to the previously described test protocol, and the quantitative results were recorded as follows: Figure 1 -2.

[0129] Example 1.3

[0130] Liver cancer cell lines were selected, cultured routinely, and a sufficient number of cells were collected to extract genomic DNA. All remaining steps were identical to the previously described testing protocol, and the quantitative results were recorded as follows: Figure 1-3 .

[0131] Example 1.4

[0132] Cervical cancer cell lines were selected, cultured routinely, and a sufficient number of cells were collected to extract genomic DNA. All other steps were identical to the previously described testing protocol, and the quantitative results were recorded as follows: Figure 1-4 .

[0133] Example 1.5

[0134] A normal hepatocyte cell line (LO2) was selected, cultured using standard methods, and a sufficient number of cells were collected to extract genomic DNA. All other steps were identical to the previously described test protocol, and the quantitative results were recorded as follows: Figure 1-5 .

[0135] The quantitative test results of the cancer cell lines and normal hepatocyte lines are summarized in Table 1. It can be seen that, compared with the results measured in normal hepatocyte lines, the amount of 5'AGGGTC3' genetically defective telomeres was significantly higher in each cancer cell line, indicating that a higher content of 5'AGGGTC3' genetically defective telomeres predicts the carcinogenic nature and / or trend of the cells.

[0136] Example 2: Determination of 5'AGGGTC3' genetically defective telomeres in some cancer subjects

[0137] Example 2.1

[0138] EDTA-anticoagulated venous blood samples were selected from lung cancer subject 1 (adenocarcinoma with stromal invasion, without metastasis) and tested using the aforementioned test protocol. The quantitative measurement results are recorded in Figure 2-1.

[0139] Example 2.2

[0140] EDTA-anticoagulated venous blood samples were selected from lung cancer subject 2 (nodular adenocarcinoma of the lung, 22 lymph nodes with chronic inflammation and carbon deposits, no metastasis) and tested according to the aforementioned test protocol. The quantitative measurement results are recorded as shown in Figure 2-2.

[0141] Example 2.3

[0142] EDTA-anticoagulated venous blood samples were selected from lung cancer subject 3 (nodular type, with chronic inflammation of 4 lymph nodes with carbon deposits, and no metastasis) and tested according to the aforementioned test protocol. The quantitative measurement results are recorded as shown in Figures 2-3.

[0143] Example 2.4

[0144] EDTA-anticoagulated venous blood samples were selected from lung cancer subject 4 (nodular type, non-metastatic) and tested using the aforementioned test protocol. The quantitative measurement results are recorded as shown in Figures 2-4.

[0145] Example 2.5

[0146] EDTA-anticoagulated venous blood samples were selected from lung cancer subjects (without metastasis) and tested using the aforementioned test protocol. The quantitative measurement results are recorded as shown in Figure 2-5.

[0147] Example 2.6

[0148] EDTA-anticoagulated venous blood samples were selected from subject 1 (squamous lung cancer, non-metastatic) and tested using the aforementioned test protocol. The quantitative measurement results are recorded in Figures 2-6.

[0149] Example 2.7

[0150] EDTA-anticoagulated venous blood samples were selected from subject 2 (squamous lung cancer, non-metastatic) and tested using the aforementioned test protocol. The quantitative measurement results are recorded in Figures 2-7.

[0151] Example 2.8

[0152] EDTA-anticoagulated venous blood samples were selected from subject 1 (moderately differentiated adenocarcinoma, 35 lymph nodes with chronic inflammation, no metastasis) and tested using the aforementioned test protocol. The quantitative measurement results are recorded in Figures 2-8.

[0153] Example 2.9

[0154] EDTA-anticoagulated venous blood samples were selected from subject 2 (advanced, metastatic colon cancer) and tested using the aforementioned test protocol. The quantitative measurement results are recorded in Figure 2-9.

[0155] Example 2.10

[0156] EDTA-anticoagulated venous blood samples were selected from subject 3 (moderately differentiated adenocarcinoma, 31 lymph nodes with chronic inflammation, no metastasis) and tested using the aforementioned test protocol. The quantitative measurement results are recorded in Figure 2-10.

[0157] Example 2.11

[0158] EDTA-anticoagulated venous blood samples were selected from subjects with rectal cancer (ulcerative type, 14 chronic lymphadenitis, no metastasis) and tested according to the aforementioned test protocol. The quantitative measurement results are recorded as shown in Figure 2-11.

[0159] Example 2.12

[0160] EDTA-anticoagulated venous blood samples were selected from cervical cancer subject 1 (non-metastatic) and tested using the aforementioned test protocol. The quantitative measurement results are recorded in Figure 2-12.

[0161] Example 2.13

[0162] EDTA-anticoagulated venous blood samples were selected from cervical cancer subject 2 (non-metastatic) and tested using the aforementioned test protocol. The quantitative measurement results are recorded in Figure 2-13.

[0163] Example 2.14

[0164] EDTA-anticoagulated venous blood samples were selected from ovarian cancer subjects (without metastasis) and tested using the aforementioned test protocol. The quantitative measurement results are recorded in Figure 2-14.

[0165] Example 2.15

[0166] EDTA-anticoagulated venous blood samples were selected from subjects with gastric cardia cancer (medium-to-poorly differentiated adenocarcinoma of the gastric cardia type, chronic inflammation of one lymph node, and no metastasis). The tests were performed using the aforementioned test protocol, and the quantitative results are recorded in Figure 2-15.

[0167] Example 2.16

[0168] EDTA-anticoagulated venous blood samples were selected from subjects with gingival cancer (non-metastatic) and tested using the aforementioned test protocol. The quantitative measurement results are recorded as shown in Figure 2-16.

[0169] Example 2.17

[0170] EDTA anticoagulated venous blood samples were selected from normal subject 1 (without any clinical symptoms of cancer, and a 4.5-year follow-up study to confirm their health status), and the tests were performed using the aforementioned test protocol. The quantitative measurement results are recorded in Figure 2-17.

[0171] Example 2.18

[0172] EDTA-anticoagulated venous blood samples were selected from normal subject 2 (without any clinical symptoms of cancer) and tested using the aforementioned test protocol. The quantitative measurement results are recorded in Figure 2-18.

[0173] Example 2.19

[0174] EDTA anticoagulated venous blood samples were selected from normal subject 3 (without any clinical symptoms of cancer, and were considered healthy subjects after a 4.5-year follow-up visit) and tested using the aforementioned test protocol. The quantitative measurement results are recorded in Figure 2-19.

[0175] Example 2.20

[0176] EDTA-anticoagulated venous blood samples were selected from normal subject 4 (without any clinical symptoms of cancer) and tested using the aforementioned test protocol. The quantitative measurement results are recorded as shown in Figure 2-20.

[0177] Example 2.21

[0178] EDTA-anticoagulated venous blood samples were selected from normal subject 2 (without any clinical symptoms of cancer) and tested using the aforementioned test protocol. The quantitative measurement results are recorded as shown in Figure 2-21.

[0179] Results Analysis

[0180] Table 1 summarizes all data from Examples 2.1 to 2.21.

[0181] Table 1. Results of 5'AGGGTC3' telomere detection in different cancer types.

[0182]

[0183] The results clearly showed that, regardless of whether the cancer was lung cancer, colon cancer, rectal cancer, ovarian cancer, cervical cancer, or the less common gingival cancer, clear DNA target bands were amplified in the whole blood genomic DNA of the subjects (Category A subjects), with an average total PCR product of 123.8 ng, while the average for control subjects (Category B subjects) was only 6.0 ng. Furthermore, the presence of the 5'AGGGTC3' genetically defective telomeres was not detected in most non-cancer subjects. Similar results were obtained when testing cancer cell lines, with an average of 96.1 ng for cancer cell lines and only 5.6 ng for controls. The content of DNA bands was significantly increased in both cancer subjects and cancer cell lines.

[0184] Based on the DNA bands amplified by PCR in each example, the number of different aneuploidies, i.e., the number of TC telomeres, is obtained by dividing the molecular weight of each band by the number of bases in a complete repeat sequence (6 bp). For example, in colon cancer 2, five bands were amplified: 981 bp, 576 bp, 443 bp, 375 bp, and 275 bp. The calculated aneuploidies are 0.500, 0.000, 0.8333, 0.500, and 0.8333, respectively. The 981 bp and 375 bp, and 443 bp and 275 bp bands with the same aneuploidy originate from the same telomere, differing only in the 5'AGGGTC3' site. Therefore, the number of telomeres containing the 5'AGGGTC3' genetic defect is 3. Of course, this is only a simple, preliminary assessment; more accurate information can be obtained through DNA sequencing analysis and comparison with the human genome. Preliminary analysis revealed 2–5 genetically defective 5'AGGGTC3' telomeres originating from different chromosomal arms in the genomes of the same cancer cases. In 7 lung cancer cases, 2–4 genetically defective telomeres were found, but at least one of them originated from the same chromosomal arm. In 3 colon cancer cases, at least one genetically defective telomere also originated from the same chromosomal arm. However, the chromosomal arm of this genetically defective telomere in colon cancer differed from that in lung cancer. This indicates a close correlation between different cancer types and progression stages and the number and chromosomal arm of 5'AGGGTC3' genetically defective telomeres. This provides further information on cancer risk types for positive subjects in ultra-early screening and may enable cancer tissue tracing through DNA sequencing or combined with other methods, including family history and multiple external environmental factors, leading to more precise prevention.

[0185] A statistical analysis graph was created showing the PCR amplification product quantities of cancer patients, cancer cell lines, and normal subjects. Figure 3The results clearly showed that there were extremely significant differences between cancer subjects and cancer cell lines and normal subjects, demonstrating 100% sensitivity and 100% specificity, indicating the effectiveness and reliability of pan-cancer ultra-early screening technology.

[0186] Alternatively or additionally, by replacing SL1 in Example 1 with SL2, SL3, or SL4 respectively, and replacing PRim1 with the corresponding Prim2, Prim3, or Prim4, while keeping the other steps unchanged, it is possible to process 5'GGGT respectively. TC 3', 5' AGGG TG 3' and 5' GGGT TG Testing of telomeres with genetic defects such as 3' can yield more parameters for pan-cancer ultra-early screening.

[0187] Example 3: Apoptosis of cancer cells by a single-base mutant of the hTERC gene targeting genetically defective telomeres with the last two bases of 3' telomeres being TC and / or TG.

[0188] Not limited to specific theories, this study hypothesizes that human telomerase RNA genes targeting mutations in the TC or TG terminal sequences of genetically defective telomeres, upon introduction into cancer cells, will transcribe a mutated hTERC component. This component can bind to the intracellular hTERT protein to form catalytically active telomerase, thereby repairing genetically defective telomeres with the corresponding 3' ends of human chromosome telomeres containing TC and / or TG, transforming them into TT ends. Subsequently, under the action of endogenous telomerase, telomeres are effectively extended. Abnormal telomerase expression is reduced via the Pot1 and Tin2 signaling pathways, guiding certain senescent cells, potentially cancerous cells, or already cancerous cells with telomeres shortened to the genetically defective region into PCD apoptosis, further confirming the role of TC and / or TG genetically defective telomeres in cell carcinogenesis.

[0189] Example 3.1 Creation of a single-base mutant of the hTERC gene

[0190] Based on the NCBI database, the full-length hTERC gene is 451 bp and has no introns. The human hTERC sequence was directly obtained from genomic DNA and used as the wild-type gene (WT), as shown in SEQ ID NO. 11. The deoxyadenine nucleotide (A) at position -54 of the hTERC sequence was mutated to deoxyguanine nucleotide (G) using overlap PCR, defined as hTERC gene mutant I (TI, SEQ ID NO. 12). The deoxyadenine nucleotide (A) at position -54 was mutated to deoxycytosine nucleotide (C), defined as hTERC gene mutant II (TII, SEQ ID NO. 13). These mutants were then cloned into a T-vector. The specific implementation is as follows:

[0191] A: Preparation of human whole-genome DNA. Whole-genome DNA was prepared using the TaKaRa MiniBEST Whole Blood Genomic DNA Extraction Kit and stored at 4°C for later use.

[0192] B: For the overlap extension PCR method, the primers used for site-directed mutagenesis are:

[0193] 1)TF:5'-TTCCATTTTTAAGGTAGTCGAGG-3' (SEQ ID NO.NO. 14);

[0194] 2) TR: 5'-TAAAAGGCAACAAAAAGCGGAAG-3' (SEQ ID NO. 15);

[0195] 3) MF-I:5'-GTCTAACCCTGACTGAGAAGG-3' (SEQ ID NO. 16);

[0196] 4) MR-I: 5'-CCTTTCCAGTCAGGGTTAGAC-3' (SEQ ID NO. 17).

[0197] First round of PCR: The reaction system consisted of 20 μL (2.0 μL 10x PCR Buffer with Mg2+, 1.6 μL 10 mM dNTP, 2.0 μL 2.0 μM Primer TF, 2.0 μL 2.0 μM Primer MR-I, 5.0 μL 10 ng / μL Genomic DNA, 0.2 μL 5 U / μL Pfu polymerase, and 7.2 μL ddH2O). The reaction program was: 95℃ / 5 min, (95℃ / 30 sec, 58℃ / 30 sec, 72℃ / 60 sec) x 30 cycles, 72℃ / 10 min, and a stop at 8℃. PCR products were electrophoresed on a 1% agarose gel. Then, the 376 bp target fragment was recovered using the Takara MiniBEST Agarose Gel DNA Extraction Kit, labeled as PD1, and diluted to 10 ng / μL. Simultaneously, Primer TR replaced Primer TF, and Primer MF-I replaced Primer MR-I, with all other components remaining identical. The 639bp target fragment was recovered, labeled as PD2, and diluted to 10 ng / ul. Second round PCR: The reaction system consisted of 20ul (2.0ul 10x Pfu Buffer with Mg2+, 1.6ul 10mM dNTP, 2.0ul 2.0uM Primer TF, 2.0ul 2.0uM Primer TR, 0.5ul 10ng / ul PD1, 0.5ul 10ng / ul PD2, 0.2ul 5U / ul Pfu polymerase, and 11.2ul ddH2O). The reaction program was: (95℃ / 30sec, 62℃ / 30sec, 72℃ / 60sec) x 30 cycles, 72℃ / 10min, stop at 8℃. PCR products were electrophoresed on a 1% agarose gel. Then, the 967bp target fragment was recovered using the Takara MiniBEST Agarose Gel DNA Extraction Kit and labeled as TD-I. Simultaneously, 0.5µl of 10ng / µl PD1 and 0.5µl of 10ng / µl PD2 were replaced with 1.0µl of 50ng / µl Genomic DNA to obtain the wild-type target gene fragment, labeled as WD. TD-I and WD were cloned using pMD18-T. The target fragment was then...

[0198] TD-I or WD was used for 3' end A addition reaction, with a reaction volume of 10 μL (2.0 μL 10x PCR Buffer with Mg2+, 1.0 μL 1mM dATP, 7.8 μL TD-I or WD target fragment, 0.2 μL 5U / μL rTaq), and incubated at 72°C for 15 minutes. Then, ligation and cloning were performed according to the instructions of the Takara pMDTM18-T Vector Cloning Kit. DNA samples were extracted using the Takara MiniBEST Plasmid Purification Kit, and after sequencing confirmation, they were labeled as pMD18 / +TD-I and pMD18 / +WD, respectively.

[0199] C: Construct the pMD18 / +hTERC(MT-I) transfer vector. The primers used are:

[0200] 1) EcoRTER:

[0201] 5'-GCGTGAATTCTCCCTTTATAAGCCGAC-3' (SEQ ID NO. 18);

[0202] 2) BamHNoSP:

[0203] 5'-CAGGATCCAAAAAAAAATGGGGGCTCACAAGCC-3' (SEQ ID NO. 19).

[0204] The PCR reaction system consisted of 20 μL (10 μL 2x GC Buffer, 3.2 μL 10 mM dNTP, 2.0 μL 2.0 μM MEcoRTER, 2.0 μL 2.0 μM BamHNoSP, 1 μL DNA from pMD18 / TD-I, 0.2 μL 5 U / μL Pfupolymerase, 1.6 μL ddH2O); the PCR program was: 95℃ / 2 min, (95℃ / 30 sec, 60℃ / 30 sec, 72℃ / 60 sec) x 30 cycles, 72℃ / 10 min, and a stop at 8℃. The PCR products were electrophoresed on a 1% agarose gel, and the amplified fragments were recovered using the Takara MiniBEST Agarose Gel DNA Extraction Kit. The recovered amplified fragments and pMDTM18-T Vector DNA were then double-digested with BamHI and EcoRI, respectively. The enzyme digestion reaction system consisted of 25 μL (2.5 μL 10x Buffer T, 10 μL 60 ng / μL DNA, 0.6 μL 5 U / μL BamHI, 1.2 μL 5 U / μL EcoRI, 3.25 ddH2O). The reaction conditions were: 37°C for 2 hours. The DNA was purified using the Takara MiniBEST DNA Fragment Purification Kit. Then, ligation and cloning were performed according to the instructions of the Takara pMDTM18-T Vector Cloning Kit. DNA samples were then extracted using the Takara MiniBEST Plasmid Purification Kit and sequenced to confirm the DNA, yielding a transfer vector containing the single-base mutation I of the hTERC gene, labeled as: pMD18 / +hTERC(MT-I).

[0205] D: Replace MF-I: 5'-GTCTAACCCTCACTGAGAAGG-3' (SEQ ID NO.20) with primer MF-II: 5'-GTCTAACCCTGACTGAGAAGG-3' (SEQ ID NO.16); replace primer MR-I, 5'-CCTTCTCAGTCAGGGTTAGAC-3' (SEQ ID NO.21) with primer MR-II: 5'-CCTTCTCAGTGAGGGTTAGAC-3' (SEQ ID NO.17). Repeat steps B and C for the remainder to obtain the transfer vector of the hTERC gene single base mutation II, and label it as: pMD18 / +hTERC(MT-II).

[0206] E: Replace pMD18 / +TD-I with pMD18 / +WD constructed in step B, and repeat step C for the rest to obtain the wild-type transfer vector of the hTERC gene, and label it as: pMD18 / + hTERC(WT).

[0207] Example 3.2 Construction of a recombinant eukaryotic expression vector for the hTERC gene mutant

[0208] Using the eukaryotic expression vector pcDNA3.1(-) and the MT-I, MT-II, and WT transfer vectors obtained in Example 3.1, the hTERC target gene was inserted into the pcDNA3.1(-) eukaryotic expression vector by double digestion with BamHI and EcoRI. The specific implementation is as follows:

[0209] Plasmid DNAs of pcDNA3.1(-)(Invitrogen, Life Technology) and pMD18 / +hTERC(MT-I) were prepared using the Takara MiniBEST Plasmid Purification Kit. The pMD18 / +hTERC(MT-I) DNA double digestion reaction system consisted of: (5 μL 10x Buffer K, 12 μL 180 ng / μL pMD18 / +hTERC(MT-I) DNA, 2.5 μL 5 U / μL BamHI, 2.5 μL 5 U / μL EcoRI, 28 μL ddH2O). After incubating the reaction solution at 37°C for 2 hours, the products were digested by 1% agarose gel electrophoresis. Then, the hTERC(MT-I) target fragment (577 bp) was recovered using the Takara MiniBEST Agarose Gel DNA Extraction Kit. Simultaneously, the double enzyme digestion reaction system for pcDNA3.1(-) DNA was as follows: (5 μL 10x BufferK, 40 μL 50 ng / μL pcDNA3.1(-) DNA, 2.5 μL 5 U / μL BamHI, 2.5 μL 5 U / μL EcoRI). After incubating the reaction solution at 37°C for 2 hours, the digested sample was directly purified using the Takara MiniBEST DNA Fragment Purification Kit to obtain linear pcDNA3.1(-) DNA. Then, the hTERC(MT-I) target fragment was ligated to the linear pcDNA3.1(-) DNA sample using T4 ligase. The ligation system consisted of 10 μL (1 μL 10x T4 Ligase buffer, 5 μL 30 ng / μL recovered linear pcDNA3.1(-) DNA fragment, 1 μL 40 ng / μL recovered hTERC(MT-I) target fragment, and 1 μL 5 U / μL T4 DNALigase). After incubation at 16°C for 12 hours, the ligation fragments were transformed, screened, identified by enzyme digestion, and sequenced according to standard methods to obtain eukaryotic expression vectors carrying the target gene: pcDNA3.1(-) / +hTERC(MT-I).

[0210] Replace pMD18 / +hTERC(MT-I) with pMD18 / +hTERC(MT-II) or pMD18 / +hTERC(WT), respectively, keeping everything else identical, and repeat the above method. Eukaryotic expression vectors carrying the target gene were obtained: pcDNA3.1(-) / +hTERC(MT-II) and pcDNA3.1(-) / +hTERC(WT), respectively. Figure 4 )

[0211] Example 3.3 Construction of a human telomerase promoter transfer vector

[0212] Primers used for cloning hTERTpro: 1) hTERTpro-F: 5'-ACATACGTACACGCACCTGTTCCCAG-3' (SEQ ID NO.22); 2) hTERTpro–R: 5'-TCCTGAATTCGCGGGGGTGGCCGGGGCCA-3' (SEQ ID NO.23); PCR reaction system: 20 μL (10 μL 2x GC Buffer, 3.2 μL 10 mM dNTP, 2.0 μL 2.0 μM hTERTpro-F, 2.0 μL 2.0 μM hTERTpro-R, 0.5 μL 50 ng / μL genomic DNA, 0.2 μL 5 U / μL rTaqPolymerase, 5.7 μL ddH2O); Reaction conditions: 95℃ / 2 min, (95℃ / 30 sec, 61℃ / 30 sec, 72℃ / 60 sec) x 30 cycles, 72℃ Stop at 8℃ after 10 min. Electrophoresis of the PCR product on a 1% agarose gel followed by recovery of the 505 bp amplified fragment using the Takara MiniBESTAgarose Gel DNA Extraction Kit. Following the instructions of the Takara pMDTM18-T VectorCloning Kit, ligation and cloning were performed. After sequencing confirmation, the human telomerase promoter (hTERTpro) transfer vector was labeled as: pMD18 / +hTERTpro.

[0213] Example 3.4 Construction of an AD5 replication-defective adenovirus shuttle vector containing the hTERC gene mutant

[0214] A: DNA samples containing the HCMV adenovirus vector pCA13 / -HCMV and plasmid pMD18 / +hTERTpro deleted were prepared using the Takara MiniBEST Plasmid Purification Kit. The hTERTpro fragment was transformed into the pCA13 / -HCMV plasmid using a double digestion method with HindIII and EcoRI. The double digestion reaction system 1 consisted of (2.5 μL 10x Buffer R, 8 μL pMD18 / +hTERTpro DNA, 0.8 μL 5 U / μL HindIII, 1.25 μL 5 U / μL EcoRI, 12.45 μL ddH2O). After incubating the reaction solution at 37°C for 2 hours, the products were digested by 1% agarose gel electrophoresis. Then, the 519 bp target fragment was recovered using the Takara MiniBEST Garose Gel DNA Extraction Kit. Simultaneously, the double enzyme digestion reaction system 2 consisted of (2.5 μL 10x Buffer R, 8 μL pCA13 / -HCMV DNA, 0.8 μL 5 U / μL HindIII, 1.25 μL 5 U / μL EcoRI, and 12.45 μL ddH2O). After incubating the reaction solution at 37°C for 2 hours, the digested sample was directly purified using the Takara MiniBEST DNA Fragment Purification Kit. Finally, the 519 bp fragment was ligated with the double-digested and purified pCA13 / -HCMV DNA sample using T4 ligase. The ligation system consisted of 10 μL (1 μL 10x T4 Ligase buffer, 1.5 μL recovered pCA13 / -HCMV fragment, 6.5 μL recovered hTERTpro target fragment, and 1 μL 5 U / μL T4 DNA ligase). After incubation at 16°C for 2 hours, the ligated fragment was transformed, screened, digested, and sequenced according to standard methods to obtain the target recombinant plasmid: pCA13 / +hTERTpro.

[0215] B: DNA from pCA13 / +hTERTpro and pMD18 / +hTERC(MT-I) plasmids was prepared using the Takara MiniBEST Plasmid Purification Kit. The hTERC(MT-I) fragment was transformed into the pCA13 / +hTERTpro vector using a double digestion method with BamHI and EcoRI. The double digestion reaction system for pMD18 / +hTERC(MT-I) DNA was as follows: (5 μL 10x Buffer K, 12 μL 180 ng / μL pMD18 / +hTERC(MT-I) DNA, 2.5 μL 5 U / μL BamHI, 2.5 μL 5 U / μL EcoRI, 28 μL ddH2O). After incubating the reaction solution at 37°C for 2 hours, the products were digested by 1% agarose gel electrophoresis. Then, the hTERC(MT-I) target fragment (577 bp) was recovered using the Takara MiniBEST Agarose Gel DNA Extraction Kit. Simultaneously, the pCA13 / +hTERTpro DNA double digestion reaction system consisted of: (5 μL 10x Buffer K, 40 μL 50 ng / μL pCA13 / +hTERTpro DNA, 2.5 μL 5 U / μL BamHI, 2.5 μL 5 U / μL EcoRI). After incubating the reaction solution at 37°C for 2 hours, the digested sample was directly purified using the Takara MiniBEST DNA Fragment Purification Kit to obtain linear pCA13 / +hTERTpro DNA. Finally, the hTERC(MT-I) target fragment and the digested linear pCA13 / +hTERTpro DNA sample were ligated using T4 ligase. The ligation system consisted of 10 μL (1 μL 10x T4 Ligase buffer, 5 μL 30 ng / μL recovered linear pCA13 / +hTERTpro DNA fragment, 1 μL 40 ng / μL recovered hTERC(MT-I) target fragment, and 1 μL 5 U / μL T4 DNA ligase). After incubation at 16°C for 2 hours, the ligated fragments were transformed, screened, digested, and sequenced according to standard methods to obtain the target gene shuttle vector: pCA13 / +hTERTpro+hTERC(MT-I).

[0216] Replace pMD18 / +hTERC(MT-I) with pMD18 / +hTERC(MT-II) or pMD18 / +hTERC(WT), and repeat the above method, keeping everything else identical. This will yield the target gene shuttle vectors: pCA13 / +hTERTpro+hTERC(MT-II) and pCA13 / +hTERTpro+hTERC(WT). Figure 5 )

[0217] Example 3.5 Packaging AD5 replication-defective recombinant adenovirus using the AdMAX system

[0218] A: The target gene transfer vector pCA13 / +hTERTpro+hTERC(MT-I) and the human adenovirus serotype 5 (E1 / E3 deletion) backbone vector pBHG11 were co-transfected into HEK293 cells via liposome-mediated transfection to obtain the target recombinant adenovirus. Specific method: One day before transfection, 7.5 × 10⁵ human embryonic kidney 293 cells were seeded in 60 mm Petri dishes with 5% DMEM and cultured in a 37°C, 5% CO₂ incubator. 3-4 hours before transfection (with a cell turnaround rate preferably less than 70%), the medium was replaced with fresh medium, and 5 ml of serum-free medium was added to ensure rapid cell growth. Then, the target gene transfer vector pCA13 / +hTERTpro+hTERC(MT-I), the viral backbone vector pBHG11, and liposome Lipofectamine 2000 (purchased from Invitrogen) were added to 293 cells (details omitted). After co-culturing for 7-14 days, viral plaques appeared. After three purification cycles of viral plaques, the cells were collected and subjected to three freeze-thaw cycles between -80℃ and 37℃. Then, the cells were centrifuged at 4℃ and 5000 rpm for 10 minutes to remove cell debris. The packaged recombinant adenovirus particles were aliquoted and stored at -80℃ for later use.

[0219] B: Identification of recombinant adenovirus

[0220] Recombinant adenovirus DNA was extracted using the QIAGEN DNA Blood Mini Kit, following the product instructions.

[0221] The target gene expression cassette (hTERTpro+hTERC, 1002bp) was then amplified by PCR. The upstream primer Target-F was 5'-ATTACATACGTACACGCACCT-3' (SEQ ID NO. 24); the downstream primer Target-R was 5'-AACGGGAAAGCGAACTGCAT-3' (SEQ ID NO. 25). Reaction conditions: 95℃ / 3min, (95℃ / 30sec, 60℃ / 30sec, 72℃ / 60sec) x 30 cycles, 72℃ / 10min, stop at 8℃. The amplified product was subjected to 1% agarose gel electrophoresis. The 1002bp target fragment was recovered using the Takara MiniBEST Agarose Gel DNA Extraction Kit, and after routine T-cloning, it was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequence confirmed that the -54th site of the hTERC gene was guanine deoxyribonucleotide "G". The recombinant adenovirus was named AD5+hTERC(MT-I).

[0222] Replace pCA13 / +hTERTpro+hTERC(MT-I) with pCA13 / +hTERTpro+hTERC(MT-II), and repeat steps A and B above completely. Confirm that the -54th site of the hTERC gene in the sequencing sequence is cytosine deoxyribonucleotide "C", and name the recombinant adenovirus: AD5+hTERC(MT-II).

[0223] Replace pCA13 / +hTERTpro+hTERC(MT-I) with pCA13 / +hTERTpro+hTERC(WT), and repeat steps A and B above completely. Confirm that the -54th site of the hTERC gene in the sequencing sequence is adenine deoxyribonucleotide "A", and name the recombinant adenovirus: AD5+hTERC(WT).

[0224] C: Amplification, purification, and titer determination of recombinant adenovirus

[0225] Based on commonly used recombinant adenovirus amplification methods, HEK293 cells were seeded in 75cm² culture flasks, and 20ml of 10% FBS DMEM was added. When the cells reached 80-90% confluence, the solution was replaced with 15ml of 2% FBS DMEM. 0.5ul of virus preservation solution, purified and correctly identified via viral plaque removal, was carefully added to the culture flask and gently agitated three times in a horizontal cross-shaped motion. After culturing at 37℃ in a 5% CO₂ incubator for 48 hours, the cell pellet was collected, and 5ml of 5% DMEM was added to resuspend the pellet. The mixture was then subjected to three freeze-thaw cycles from -20℃ to 37℃, centrifuged at 600g for 20 minutes, and the supernatant was collected after removing the pellet. This process was repeated to amplify the desired viral load. The viral particles were purified using an HPLC ion-exchange column, and the physical titer (vp / ml) and infectivity titer (TCID50 / ml) of the purified sample were determined. Results: AD5+hTERC(MT-I) was 5.3×10⁻⁶. 11 vp / ml and 1.58×10 10 TCID50 / mL; AD5+hTERC(MT-II) was 2.69×10⁻⁶. 11 vp / ml and 7.94×10 9 TCID50 / mL; and AD5+hTERC(WT) was 2.3×10⁻⁶. 11 vp / ml and 6.3×10 9 TCID50 / mL;

[0226] Example 3.6 Using the recombinant expressed in hTERC wild-type eukaryotic cells, the gene expression cassette of the recombinant was tested.

[0227] Based on the presence of genetically defective telomeres at the 3' end of HeLa cell genomic DNA and their high telomerase activity, mutant recombinant vectors severely interfere with cell growth (see Example 7). Therefore, wild-type recombinant eukaryotic expression vectors were selected for testing the gene expression cassettes of the recombinants. The specific implementation is as follows:

[0228] A: Determine the optimal selection concentration of G418. Take HeLa cells in good growth condition, digest them with 0.25% trypsin to prepare a cell suspension, and seed them at 1000 cells / ml in 24-well plates. Incubate for 6 hours, aspirate the culture medium, wash once with PBS, and add different concentrations of selection medium to each well (G418 was diluted with culture medium at gradient concentrations of 100ug / ml, 200ug / ml, 300ug / ml, 400ug / ml, 500ug / ml, 600ug / ml, 700ug / ml, 800ug / ml, 900ug / ml, and 1000ug / ml to prepare selection medium). Change the selection medium every 3 days. The optimal selection concentration, 400ug / ml G418, was determined when all cells were killed within 10-14 days.

[0229] B: HeLa cells were transfected with the recombinant vector pcDNA3.1(-) / +hTERC(WT) to obtain a stably transfected single-cell line. HeLa cells in good growth condition were selected and seeded in 6-well plates one day before transfection. Transfection was performed when cell confluence reached 90%-95% (Effectene cell transfection was performed according to the kit instructions). 24 hours after transfection, cells were trypsinized and passaged at a 1:10 ratio. After 24 hours of adherence, G418 selection was initiated at a concentration of 400 μg / ml. After 14 days, most cells died, and a very small number formed clones. In a clean bench, the culture medium in the culture dish was discarded, and cells were trypsinized. Single clones were picked using a 200 μl pipette and added to 24-well plates pre-filled with culture medium. After cell adherence, G418 selection medium was added, and the cells were cultured for another 2-5 days. Once the cells reached confluence, they were trypsinized with 0.25% and transferred to 6-well plates for further culture to obtain a stably transfected HeLa cell line.

[0230] C: Total RNA was extracted from stably transfected HeLa cell lines using the Trizol method, and the expression of the target gene was detected by RT-PCR to confirm the correct expression of the recombinant gene. Figure 4 )

[0231] Example 3.7 Testing the effect of recombinant hTERC gene mutant on the growth of HeLa cell line

[0232] A: MTT assay for HeLa cell growth.

[0233] HeLa cells were transfected using the constructed recombinant eukaryotic expression vectors pcDNA3.1(-) / +hTERC(MT-I), pcDNA3.1(-) / +hTERC(MT-II), and pcDNA3.1(-) / +hTERC(WT), with an additional empty vector pcDNA3.1(-) / (empty) as a negative control. (The procedure was performed according to the Effectene kit instructions). First, HeLa cells in good growth condition were selected and plated in six-well plates one day before transfection. Transfection was performed when the cell confluence reached 90%-95% (Effectene cell transfection was performed according to the kit instructions). Twenty-four hours after transfection, cells were collected by trypsin digestion, and the single-cell suspension density was adjusted to 10T. 4 -10 5 Cells / mL. 200 μl / well (1 × 10⁻⁶) 4 Cells were seeded in 96-well plates, with 5 wells per group. The plates were incubated at 37°C in a 5% CO2 incubator. Starting from the 24th hour, one 96-well plate was randomly removed every 24 hours, and 20 μL of 5 mg / mL MTT solution was added to each well. After 4 hours of incubation, the culture medium was aspirated, and 150 μL of DMSO was added to each well. The plates were then shaken on a microplate shaker for 10 minutes, and the OD value at 570 nm was measured using an ELISA reader. Results: The growth rate of HeLa cells with pcDNA3.1(-) / +hTERC(MT-I) and pcDNA3.1(-) / +hTERC(TII) plasmids was significantly slowed, while the positive control pcDNA3.1(-) / +hTERC(WT) and the negative control pcDNA3.1(-) grew faster. Figure 7 )

[0234] B: Hoechst 33342 staining to observe apoptosis characteristics

[0235] Hoechst 33342 staining was used to observe cell morphology. Cells transfected with the mutant pcDNA3.1(-) / +hTERC(MT-I) and pcDNA3.1(-) / +hTERC(TII) showed some nuclear swelling, and some cells exhibited chromatin condensation. The high fluorescence state indicated apoptosis. However, the unmutated positive control pcDNA3.1(-) / +hTERC(WT) and the negative control pcDNA3.1(-) both showed normal cell states. Figure 8 ).

[0236] Example 3.8 Testing the inhibitory effect of recombinant hTERC gene mutant on the growth of human breast cancer solid tumors

[0237] Human breast cancer Bcap-37 cells were cultured, passaged, centrifuged at 3000 rpm for 3 min, and resuspended in PBS to a final volume of 3 x 10⁻⁶ cells / mL. 6 / 0.1ml / mouse, Ih, is injected into the axilla of nude mice, 20 mice at a time. After 10 days, when the tumor has grown to 3-4mm, 15 mice with well-developed and relatively uniform tumors are selected and randomly divided into 3 groups, each receiving 10ul of 1x10 6 AD5+hTERC (MT-I), AD5+hTERC (MT-II), and AD5+hTERC (WT) were administered via single-point injection at a TCID50 / mL dose, once weekly for three consecutive weeks. Nude mice were sacrificed on day 32 of administration, and tumor tissue was dissected and weighed. Results: The hTERC gene single-base mutation sample significantly inhibited the growth of human breast cancer Bcap-37 solid tumors, with tumor inhibition rates of 38% and 30.12%, respectively. Figure 9 The weighed tumor tissue was placed in liquid nitrogen for quick freezing and stored at -80°C.

[0238] Example 3.9 Testing the inhibitory effect of recombinant hTERC gene mutant on human breast cancer telomerase

[0239] A: The solid tumor sample obtained in Example 8 was tested using the TRAP method. 100 mg of solid tumor was placed in a pre-cooled mortar, crushed with liquid nitrogen, and 200 μL of lysis buffer (10 mM Tris-HCl pH 7.5, 1 mM EGTA, 0.1 mM AEBSF, 5 mM β-mercaptoethanol, 1% NP-40, 0.25 mM NaDOC, 150 mM NaCl, 1 mM MgCl2, 10% glycerol) was added, and the mixture was homogenized thoroughly. The homogenate was transferred to a 1.5 mL Eppendorf tube and incubated on ice for 25 min. Then, it was centrifuged at 12,000 g, 4 °C for 20 min. The supernatant was transferred to a 1.5 mL Eppendorf tube, mixed thoroughly, and 5 μL was used for protein concentration determination using the Bradford method. The remainder was aliquoted into eight 100 μL Eppendorf tubes and stored at -80 °C for later use.

[0240] B: Telomerase reaction and PCR amplification. TS primer: 5'-GGATCCAATCCGTCGAGCAGAGTT-3' (SEQ ID NO.26); CX primer: 5'-CCCTTA CCCTTACCCTTACCCTTA-3' (SEQ ID NO.27). The reaction system consisted of 50 μL (20 mM Tris-HCl pH 8.5, 2.0 mM MgCl2, 50 mM KCl, 0.01% Triton X-100, 1 mM EGTA, 1 mM MDT, 5 ng BSA, 50 μM dNTPs, 2 μM TS primer, 2.5 μL of 100 ng total protein / μL telomerase extract, DEPC H2O to 50 μL), incubated at 20°C for 20 min, and then inactivated at 80°C for 10 min. Add 0.5 μL of 20 mM CX primer and 0.5 μL of 5 U / μL Taq DNA polymerase, and perform PCR reaction: 95℃ / 3 min, (95℃ / 30 sec, 68℃ / 45 sec) x 30 cycles, 72℃ / 10 min, stop at 8℃.

[0241] C: Separate PCR products by 10% polyacrylamide gel electrophoresis.

[0242] Prepare 20 ml of 10% non-denaturing polyacrylamide gel (5.46 ml, 37% Acr-Bis 36:1, 12.4 ml ddH2O, 2 ml 10×TBE, 125 μl 10% APS, 15 μl TEMED). Pre-run vertical electrophoresis for 1 hour using 0.5xTBE electrophoresis buffer at 17.5 V / cm. Then, load 15 μl of PCR product with 1.5 μl of 10x loading buffer and continue electrophoresis for 1 hour. Silver staining: Fix the gel in 10% acetic acid for 30 min, rinse three times with distilled water for 5 min each time; soak in 0.2 g / L sodium thiosulfate for 1 min, rinse three times with distilled water for 30 s each time; soak the gel in 0.2% silver nitrate solution for 30 min, rinse with distilled water for 15 s; then develop in chromogenic solution for about 10 min, and fix in 10% acetic acid for 10 min. Perform relative quantification analysis using Genetool software. Results: The relative telomerase activity in hTERC gene single-base mutant solid tumor samples was significantly decreased, accounting for only 21.6% (MT-I) and 28.3% (MT-II) of wild-type samples. Figure 10 )

[0243] Example 3.10 Observation of Structural Changes in Human Breast Cancer Cells by Recombinant hTERC Gene Mutant Using common paraffin sectioning and Schiff staining methods, the changes in solid tumor tissue samples obtained in Example 8, especially the changes in cell nuclei, were observed. Solid tumor tissue was cut into 4x4mm sections and fixed in FAA fixative. After a series of dehydration, paraffin embedding, embedding, and cutting into 2-3µm thin sections, the sections were fixed on glass slides, dewaxed, stained with Schiff stain, and mounted. The sections were observed and photographed under a 10x100x ordinary microscope, and the results were recorded: A: AD5+hTERC (MT-I); B: AD5+hTERC (MT-II) Compared with C: control AD5+hTERC (WT) samples, the cell nuclei were condensed and smaller, uneven in size, and showed dense staining due to nuclear condensation. The intercellular contact became loose, exhibiting obvious apoptosis. Figure 11 )

[0244] Example 3.11 Detection of the effect of recombinant hTERC gene mutant on programmed apoptosis in human breast cancer cells

[0245] The genomic DNA fragments involved in programmed apoptosis consist of approximately 180 bp multimers, exhibiting a typical "ladder-like" pattern on agarose gel electrophoresis, which clearly distinguishes them from the DNA degradation characteristics of other dead cells. The specific implementation is as follows:

[0246] Genomic DNA from solid tumor samples was prepared using the Takara MiniBEST Universal Genomic DNA Extraction Kit and quantified using Nanodrop 2000. Total DNA from human breast cancer Bcap-37 solid tumor cells was analyzed by 1% agarose gel electrophoresis for a specific single-base mutation in the hTERC gene; the results showed almost identical characteristics. This indicates that the single-base mutation in the hTERC gene induces programmed apoptosis in cancer cells. Figure 12 )

[0247] This embodiment demonstrates that by using the recombinant telomerase RNA gene mutant of the present invention, the repair of TC and / or TG genetically defective telomeres can significantly reduce their high-migrase activity, significantly inhibit the growth of cancer cells, and reverse them into normal programmed apoptosis. This embodiment further confirms the existence of TC or TG genetically defective telomeres in cancer cells, and more importantly, verifies the direct relationship between the existence of TC and / or TG genetically defective telomeres and driving cell carcinogenesis. This demonstrates the reliability of TC and / or TG genetically defective telomeres as biomarkers for early cell carcinogenesis, their potential for use in pan-cancer ultra-early screening, and their status as a driving factor for early cell carcinogenesis. They can serve as novel targets for innovative drug development and can also be used to develop related drugs for pan-cancer ultra-early screening, prevention, and treatment.

[0248] Those skilled in the art will understand that many variations and / or modifications can be made to this invention without departing from the spirit or scope of the invention as broadly described. The examples listed above are merely a few specific embodiments of the invention. Besides this method, chemical fluorescent labeling can be applied specifically to the last base at the 3' end of the telomere, or DNA microarray detection technology can be used to detect similar genetically defective telomeres, thereby achieving the same purpose. Obviously, this invention is not limited to the above embodiments, but also relates to any other methods, modifications, techniques, or pathways for achieving the same purpose using genetically defective telomeres with TC or TG repetitive sequences at the 3' end of human genomic DNA telomeres. All such methods and pathways fall within the scope of this invention and are subject to this patent. sequence list <110> Liu Xiaochuan <120> A pan-cancer ultra-early screening method <130> IDC206044 <160> 27 <170> PatentIn version 3.5 <210> 1 <211> 17 <212> DNA <213> Artificial sequence <400> 1 gcagtctacg agaccct 17 <210> 2 <211> 17 <212> DNA <213> Artificial sequence <400> 2 gcagtctacg agaaccc 17 <210> 3 <211> 17 <212> DNA <213> Artificial sequence <400> 3 gcagtctacg acaccct 17 <210> 4 <211> 17 <212> DNA <213> Artificial sequence <400> 4 gcagtctacg acaaccc 17 <210> 5 <211> 18 <212> DNA <213> Artificial sequence <400> 5 tcgtagactg cgtaccga 18 <210> 6 <211> twenty three <212> DNA <213> Artificial sequence <400> 6 gaatcctgcg caccgagatt ctc 23 <210> 7 <211> 20 <212> DNA <213> Artificial sequence <400> 7 cggtacgcag tctacgagac 20 <210> 8 <211> 20 <212> DNA <213> Artificial sequence <400> 8 cggtacgcag tctacgagaa 20 <210> 9 <211> 20 <212> DNA <213> Artificial sequence <400> 9 cggtacgcag tctacgacac 20 <210> 10 <211> 20 <212> DNA <213> Artificial sequence <400> 10 cggtacgcag tctacgacaa 20 <210> 11 <211> 451 <212> DNA <213> Homo sapiens <400> 11 gggttgcgga gggtgggcct gggaggggtg gtggccattt tttgtctaac cctaactgag 60 aagggcgtag gcgccgtgct tttgctcccc gcgcgctgtt tttctcgctg actttcagcg 120 ggcggaaaag cctcggcctg ccgccttcca ccgttcattc tagagcaaac aaaaaatgtc 180 agctgctggc ccgttcgccc ctcccgggga cctgcggcgg gtcgcctgcc cagcccccga 240 accccgcctg gaggccgcgg tcggcccggg gcttctccgg aggcacccac tgccaccgcg 300 aagagttggg ctctgtcagc cgcgggtctc tcgggggcga gggcgaggtt caggcctttc 360 aggccgcagg aagaggaacg gagcgagtcc ccgcgcgcgg cgcgattccc tgagctgtgg 420 gacgtgcacc caggactcgg ctcacacatg c 451 <210> 12 <211> 451 <212> DNA <213> Homo sapiens <400> 12 gggttgcgga gggtgggcct gggaggggtg gtggccattt tttgtctaac cctgactgag 60 aagggcgtag gcgccgtgct tttgctcccc gcgcgctgtt tttctcgctg actttcagcg 120 ggcggaaaag cctcggcctg ccgccttcca ccgttcattc tagagcaaac aaaaaatgtc 180 agctgctggc ccgttcgccc ctcccgggga cctgcggcgg gtcgcctgcc cagcccccga 240 accccgcctg gaggccgcgg tcggcccggg gcttctccgg aggcacccac tgccaccgcg 300 aagagttggg ctctgtcagc cgcgggtctc tcgggggcga gggcgaggtt caggcctttc 360 aggccgcagg aagaggaacg gagcgagtcc ccgcgcgcgg cgcgattccc tgagctgtgg 420 gacgtgcacc caggactcgg ctcacacatg c 451 <210> 13 <211> 451 <212> DNA <213> Human <400> 13 gggttgcgga gggtgggcct gggaggggtg gtggccattt tttgtctaac cctcactgag 60 aagggcgtag gcgccgtgct tttgctcccc gcgcgctgtt tttctcgctg actttcagcg 120 ggcggaaaag cctcggcctg ccgccttcca ccgttcattc tagagcaaac aaaaaatgtc 180 agctgctggc ccgttcgccc ctcccgggga cctgcggcgg gtcgcctgcc cagcccccga 240 accccgcctg gaggccgcgg tcggcccggg gcttctccgg aggcacccac tgccaccgcg 300 aagagttggg ctctgtcagc cgcgggtctc tcgggggcga gggcgaggtt caggcctttc 360 aggccgcagg aagaggaacg gagcgagtcc ccgcgcgcgg cgcgattccc tgagctgtgg 420 gacgtgcacc caggactcgg ctcacacatg c 451 <210> 14 <211> 23 <212> DNA <213> Artificial sequence <400> 14 ttccattttt aaggtagtcg agg 23 <210> 15 <211> 23 <212> DNA <213> Artificial sequence <400> 15 taaaaggcaa caaaaagcgg aag 23 <210> 16 <211> 21 <212> DNA <213> Artificial sequence <400> 16 gtctaaccct gactgagaag g 21 <210> 17 <211> 21 <212> DNA <213> Artificial sequence <400> 17 ccttctcagt cagggttaga c 21 <210> 18 <211> 27 <212> DNA <213> Artificial sequence <400> 18 gcgtgaattc tccctttata agccgac 27 <210> 19 <211> 33 <212> DNA <213> Artificial sequence <400> 19 caggatccaa aaaaaaatgg gggctcacaa gcc 33 <210> 20 <211> twenty one <212> DNA <213> Artificial sequence <400> 20 gtctaaccct cactgagaag g 21 <210> twenty one <211> twenty one <212> DNA <213> Artificial sequence <400> twenty one ccttctcagt gagggttaga c 21 <210> twenty two <211> 26 <212> DNA <213> Artificial sequence <400> twenty two acatacgtac acgcacctgt tcccag 26 <210> twenty three <211> 29 <212> DNA <213> Artificial sequence <400> twenty three tcctgaattc gcgggggtgg ccggggcca 29 <210> twenty four <211> twenty one <212> DNA <213> Artificial sequence <400> twenty four attacatacg tacacgcacc t 21 <210> 25 <211> 20 <212> DNA <213> Artificial sequence <400> 25 aacgggaaag cgaactgcat 20 <210> 26 <211> twenty four <212> DNA <213> Artificial sequence <400> 26 ggatccaatc cgtcgagcag agtt 24 <210> 27 <211> twenty four <212> DNA <213> Artificial sequence <400> 27 cccttaccct tacccttacc ctta 24

Claims

1. A kit comprising a selected oligonucleotide, a linker oligonucleotide, a forward primer for PCR amplification and one or more reverse primers, and optionally, instructions for use. (1) The selected oligonucleotide corresponds to the 3' end sequence of the telomere selected from the corresponding complementary sequences of 5'AGGGTC3', 5'GGGTTC3', 5'AGGGTG3' and 5'GGGTTG3', whose nucleotide sequence is selected from 5'-X-gaccct-3', 5'-X-gaaccc-3', 5'-X-caccct-3' and / or 5'-X-caaccc-3', and the selected oligonucleotide has a 3' end C3 spacer modification, C6 spacer modification and / or other modifications that can effectively prevent the action of exonucleases; (2) The nucleotide sequence of the linker oligonucleotide is 5'-X'-Y'-3', and the X' in the linker oligonucleotide and the X in the selector oligonucleotide are anticomplementary, and its length is 8-25 nucleotides. The length of Y' in the linker oligonucleotide is 2-20 nucleotides. The linker oligonucleotide has a 5' phosphorylation modification and a 3' C3 spacer modification, a C6 spacer modification, and / or other modifications that can effectively prevent the action of exonucleases; (3) The forward primer is specific to the telomere region of the chromosome, and (4) The one or more reverse primers have nucleotide sequences selected from 5'-YX-gac-3', 5'-YX-gaa-3', 5'-YX-cac-3' and 5'-YX-caa-3', wherein X is inversely complementary to X' in the linker strand; and Y is a sequence inversely complementary to Y' in the linker strand.

2. The kit according to claim 1, wherein the nucleotide sequence of the linker oligonucleotide is as shown in 5'tcgtagactgcgtaccga 3' (SEQ ID NO. 5).

3. The kit according to claim 1, wherein the nucleotide sequence of the selected oligonucleotide is selected from the following nucleotide sequences: 5'gcagtctacgagaccct3' (SEQ ID NO. 1); 5'gcagtctacgagaaccc3' (SEQ ID NO. 2); 5'gcagtctacgacaccct3' (SEQ ID NO. 3); and / or 5'gcagtctacgacaaccc3' (SEQ ID NO. 4).

4. The kit according to claim 1, wherein: The nucleotide sequence of the forward primer is shown as 5'gaatcctgcgcaccgagattctc3' (SEQ ID NO. 6).

5. The kit according to claim 1, wherein the nucleotide sequence of said one or more reverse primers is selected from the nucleotide sequences shown below: 5' cggtacgcagtctacgagac3' (SEQ ID NO. 7); 5' cggtacgcagtctacgagaa 3' (SEQ ID NO. 8); 5' cggtacgcagtctacgacac3' (SEQ ID NO. 9); and / or 5' cggtacgcagtctacgacaa 3' (SEQ ID NO. 10).

6. The kit according to claim 1, further comprising one or more of the following: internal control, buffer, restriction endonuclease, DNA ligase, PCR amplification enzyme, or any combination thereof.

7. The kit according to claim 6, wherein the restriction endonuclease is a blunt-terminated endonuclease.

8. The kit according to claim 7, wherein the restriction endonuclease is selected from EcoRV, AluI, HaeIII, SmaI and / or SnaB I.

9. The kit according to claim 6, wherein the DNA ligase is a highly specific sticky-end ligase.

10. The kit according to claim 9, wherein the DNA ligase is T7 DNA ligase.

11. The kit according to any one of claims 1-10, wherein the kit is used for the detection of lung cancer, colon cancer, liver cancer, rectal cancer, gastric cardia cancer, gingival cancer, ovarian cancer, breast cancer or cervical cancer.

12. The kit according to claim 11, wherein the kit is used for ultra-early screening of lung cancer, colon cancer, liver cancer, rectal cancer, gastric cardia cancer, gingival cancer, ovarian cancer, breast cancer, or cervical cancer.

13. The kit according to any one of claims 1-10, wherein the selected oligonucleotide and the linker oligonucleotide form a linker.

14. The kit according to claim 1, used for detecting biological samples from a subject.

15. The kit according to claim 14, wherein the biological sample is a sample containing the nucleus of a subject's cell from an organ or tissue of the subject.

16. The kit according to claim 15, wherein the biological sample is blood, tissue section and / or biopsy sample.

17. The kit according to claim 15, wherein the biological sample is peripheral blood.

18. The kit according to any one of claims 14-17, wherein the biological sample is treated with EDTA.

19. The kit according to claim 1, wherein the lengths of X' in the linking oligonucleotide and X in the selected oligonucleotide are 10-20 nucleotides.

20. The kit according to claim 1, wherein the lengths of X' in the linking oligonucleotide and X in the selected oligonucleotide are 10-15 nucleotides.

21. The kit according to claim 1, wherein Y has 2-20 nucleotides.

22. The kit according to claim 1, wherein the length of Y' in the linker oligonucleotide is 4-15 nucleotides.

23. The kit according to claim 1, wherein the length of Y' in the linker oligonucleotide is 6-12 nucleotides.

24. A PCR amplification method, comprising the following steps: 1) Genomic DNA isolated from subject biological samples was treated with blunt-terminated endonuclease and then purified; 2) The purified digested genomic DNA from step 1) is ligated to a specific adapter targeting the 3' telomere end sequence using a ligase, wherein the 3' telomere end sequence is selected from one or more of 5'AGGGTC3', 5'GGGTTC3', 5'AGGGTG3', and 5'GGGTTG3', and the adapter consists of a linker strand and a selector strand. The linker strand has a 5' end phosphorylation modification, a 3' end C3 spacer modification, a C6 spacer modification, and / or other modifications that effectively prevent exonuclease activity, and its nucleotide sequence is shown as 5'-X'-Y'-3'. The selected strand corresponds to the complementary sequence of the corresponding 3' end sequence of the telomere, has a 3' end C3 spacer or C6 spacer modification and / or other modifications that can effectively prevent the action of exonucleases, and its nucleotide sequence is selected from 5'-X-gaccct-3', 5'-X-gaaccc-3', 5'-X-caccct-3' and / or 5'-X-caaccc-3', wherein X and X' in the linker oligonucleotide are inversely complementary; 3) Purify the ligation sample obtained in step 2); 4) Perform PCR amplification on the purified sample obtained in step 3) using forward primers and one or more reverse primers, wherein: The forward primer is specific to the telomere region of the chromosome. The nucleotide sequences of the one or more reverse primers are selected from nucleotide sequences such as 5'-YX-gac-3', 5'-YX-gaa-3', 5'-YX-cac-3' and 5'-YX-caa-3', wherein X is anticomplementary to X' in the linker strand; and Y is a sequence anticomplementary to Y' in the linker strand.

25. The method of claim 24, wherein Y has 2-20 nucleotides.

26. The method of claim 24, wherein there is no restriction site of the nuclease between the forward primer and the 3' end sequence of the telomere.

27. The method of claim 24, wherein the nucleotide sequence of the linker strand is as shown in Figure 5. ’ tcgtagactgc gtaccga 3' (SEQ ID NO. 5).

28. The method of claim 24, wherein the nucleotide sequence of the selected strand is selected from 5' strands having a 3' end C3spacer modification. gcagtctacga gaccct3' (SEQ ID NO. 1), 5' gcagtctacga gaaccc3' (SEQ ID NO. 2), 5' gcagtctacga caccct3' (SEQ ID NO. 3) or 5' gcagtctacga The nucleotide sequence of caaccc3' (SEQ ID NO. 4).

29. The method according to claim 24, wherein: The nucleotide sequence of the forward primer is shown as 5'gaatcctgcgcaccgagattctc3' (SEQ ID NO. 6).

30. The method according to claim 24, wherein the PCR amplification reaction in step 4) uses the forward primer: 5'gaatcctgcgcaccgagattctc3' (SEQ ID NO. 6); and the reverse primer selected from the following: 5'cggtacgcagtctacgagac3' (SEQ ID NO. 7); 5'cggtacgcagtctacgagaa 3' (SEQ ID NO. 8); 5'cggtacgcagtctacgacac3' (SEQ ID NO. 9) and 5'cggtacgcagtctacgacaa 3' (SEQ ID NO. 10).

31. The method of claim 24, wherein the blunt-terminal endonuclease is selected from EcoRV, AluI, HaeIII, SmaI and / or SnaBI.

32. The method of claim 24, wherein the ligase is a highly specific sticky-terminal ligase.

33. The method according to claim 32, wherein the ligase is a T7 DNA ligase.

34. The method of claim 24, wherein the biological sample is a sample containing the nucleus of a subject's cell from an organ or tissue of the subject.

35. The method of claim 34, wherein the biological sample is blood, tissue section, and / or biopsy sample.

36. The method of claim 34, wherein the biological sample is peripheral blood.

37. The method according to any one of claims 34-36, wherein the biological sample is treated with EDTA.

38. Use of the kit according to any one of claims 1-23 in the preparation of a formulation for identifying the 3' end sequence of a biological sample from a subject, wherein the 3' end sequence of the telomere is 5'AGGGTC3', 5'GGGTTC3', 5'AGGGTG3' and / or 5'GGGTTG3'.

39. The use according to claim 38, wherein the formulation is used to identify whether a subject has lung cancer, colon cancer, liver cancer, rectal cancer, gastric cardia cancer, gingival cancer, ovarian cancer, breast cancer, or cervical cancer and / or to determine whether a subject is at risk of having lung cancer, colon cancer, liver cancer, rectal cancer, gastric cardia cancer, gingival cancer, ovarian cancer, breast cancer, or cervical cancer.

40. The use according to claim 39, wherein the identification is performed by a method comprising the steps of: a) Determine the presence, number, and chromosomal location and distribution of defective telomeres in genomic DNA from biological samples from test subjects, including the number of amplified DNA bands, the molecular weight of each band, the amount of amplified product, and the total amplification amount; and (b) By comparing the test data with reference values ​​formed by known subjects with lung cancer, colon cancer, liver cancer, rectal cancer, gastric cardia cancer, gingival cancer, ovarian cancer, breast cancer, or cervical cancer and non-cancer subjects, the risk assessment for subjects can be made regarding whether they may or may not develop lung cancer, colon cancer, liver cancer, rectal cancer, gastric cardia cancer, gingival cancer, ovarian cancer, breast cancer, or cervical cancer within a certain time range.

41. The use according to claim 40, wherein step a) comprises treating the isolated genomic DNA with an endonuclease, ligating DNA adapters, and then amplifying the DNA by PCR to qualitatively and quantitatively determine the genetically defective telomeres of the genome.

42. The use according to claim 41, wherein the endonuclease is a blunt-terminated DNA endonuclease.

43. The use according to claim 39, wherein the identification is performed by the following steps: 1) Perform PCR amplification according to the method described in claim 24, and perform quantitative analysis; and 2) Compare the quantitative analysis results obtained in step 1) with reference values ​​from a large dataset of test data from known subjects with lung cancer, colon cancer, liver cancer, rectal cancer, gastric cardia cancer, gingival cancer, ovarian cancer, breast cancer, or cervical cancer and non-cancer subjects, including the number of amplified DNA bands, the molecular weight of each band and the amount of amplified product, the total amount of amplification, and the distribution of amplified bands on chromosomes, optionally. The fact that the quantitative analysis results obtained in step 1) are significantly higher than the reference values ​​from non-cancer subjects indicates that the subjects have a higher risk of lung cancer, colon cancer, liver cancer, rectal cancer, gastric cardia cancer, gingival cancer, ovarian cancer, breast cancer, or cervical cancer; and Optionally, the specific tissue or organ associated with the risk of lung cancer, colon cancer, liver cancer, rectal cancer, gastric cardia cancer, gingival cancer, ovarian cancer, breast cancer, or cervical cancer can be determined by chromosomal localization of genetically defective telomeres in subjects at risk of lung cancer, colon cancer, liver cancer, rectal cancer, gastric cardia cancer, gingival cancer, ovarian cancer, breast cancer, or cervical cancer and comparison with reference values.

44. The use according to claim 43, wherein the PCR amplification procedure is: (1) 94℃ for 4 min; (2) 94℃ for 45 seconds, 67℃ for 60 seconds, 72℃ for 60 seconds, for a total of 6 cycles, wherein the annealing step at 67℃ is reduced by 1.0℃ in each cycle; (3) 94℃ for 35 seconds, 60℃ for 60 seconds, 72℃ for 60 seconds, for a total of 28 cycles; and (4) 72℃ for 15 minutes.

45. The use according to claim 43, wherein the electrophoresis results of the PCR products are quantitatively analyzed, the molecular weight and product amount of each amplified band of the PCR are obtained simultaneously, and the quantitative analysis results are comprehensively compared with reference values ​​from test data of known subjects with lung cancer, colon cancer, liver cancer, rectal cancer, gastric cardia cancer, gingival cancer, ovarian cancer, breast cancer or cervical cancer and non-cancer subjects, and / or the chromosomal localization of genetically defective telomeres is performed on subjects at risk of lung cancer, colon cancer, liver cancer, rectal cancer, gastric cardia cancer, gingival cancer, ovarian cancer, breast cancer or cervical cancer, and the specific tissue or organ at risk of cancer can be determined by combining the reference values, thus completing the assessment.

46. ​​The use according to claim 38, wherein the biological sample is a sample containing the nucleus of a subject's cell from an organ, tissue, or secretion.

47. The use according to claim 46, wherein the biological sample is blood, urine, sputum, pleural fluid, peritoneal fluid, bronchoalveolar lavage fluid or bronchoalveolar lavage fluid, or tissue section and / or biopsy sample.

48. The use according to claim 46, wherein the biological sample is peripheral blood.

49. The use according to claim 38, wherein the formulation is used to identify the presence of a biomarker in a biological sample of a subject, wherein the biomarker is a telomere 3' terminal sequence 5'AGGGTC3', 5'GGGTTC3', 5'AGGGTG3', or 5'GGGTTG3'.

50. The use according to claim 49, wherein the presence of the biomarker indicates cell carcinogenesis.

51. The use according to claim 50, wherein the formulation is used for ultra-early screening of lung cancer, colon cancer, liver cancer, rectal cancer, gastric cardia cancer, gingival cancer, ovarian cancer, breast cancer, or cervical cancer.

52. The use according to any one of claims 46-48, wherein the biological sample is treated with EDTA.

Images