Use of biomarkers in predicting the risk of recurrence and / or metastasis in colorectal cancer

Abstract

This invention relates to the use of biomarkers in predicting the risk of recurrence and / or metastasis of colorectal cancer. The invention discloses the use of reagents in the preparation of kits or microarrays for predicting the risk of recurrence and / or metastasis of colorectal cancer in individuals. The invention also discloses a kit or microarray for predicting the risk of recurrence and / or metastasis of colorectal cancer in individuals.

Description

Technical Field

[0001] This application relates to the biomedical field. Specifically, this application relates to the use of biomarkers in predicting the risk of recurrence and / or metastasis in colorectal cancer. Background Technology

[0002] Colorectal cancer is one of the top five most common and deadliest cancers globally, ranking among the highest in both incidence and mortality. Research indicates that the recurrence and metastasis rate after colorectal cancer surgery is 20%–50%, with recurrence and metastasis concentrated in the first two years post-surgery. Patients require close follow-up after surgery, primarily including CEA and CA19-9 testing every three months, chest / abdomen / pelvic CT or MRI every six months, and colonoscopy within one year post-surgery. However, the detection of CEA and CA19-9 tumor serum markers has low sensitivity for recurrence and metastasis; CT / MRI is radiation-based and struggles to detect small lesions; and colonoscopy is invasive and cannot detect distant metastases. These factors make current methods insufficient as the primary means of long-term follow-up after colorectal cancer surgery.

[0003] Liquid biopsy technology allows cancer patients to assess their tumor molecular burden and risk of residual microfocals and recurrence / metastasis by detecting cell-free DNA in plasma after tumor resection. In recent years, DNA methylation has become increasingly popular in tumor molecular detection for early cancer screening and diagnosis; however, there are currently no particularly efficient biomarkers for assessing postoperative recurrence risk. Furthermore, because tumor molecules constitute a very small proportion of cell-free DNA in plasma, developing highly efficient biomarkers, especially for recurrence risk assessment, presents a significant challenge. Therefore, there is an urgent need to develop a method and / or kit that can efficiently read epigenetic information related to colorectal cancer from the extremely limited amount of cell-free extracellular DNA in biological samples, and that can be easily prepared and reliably applied in hospital laboratories. Summary of the Invention

[0004] To address the shortcomings of existing technologies, the inventors, through screening a large number of biomarkers, discovered that the biomarkers of this invention can predict the recurrence and / or metastasis (including in situ recurrence and metastasis) of colorectal cancer in individuals who have undergone colorectal cancer surgery with high sensitivity and specificity.

[0005] In one aspect, the present invention relates to the use of reagents in the preparation of kits or microarrays for predicting the risk of recurrence and / or metastasis of colorectal cancer in an individual, characterized in that the reagents are used to detect the methylation level of at least one target region of at least one biomarker selected from the group consisting of SALL1, POU4F2, SLC24A2, HS3ST2, KCTD8, intergenic spacer 3 (chr8:70945014-70949177) and any combination thereof in a sample isolated from the individual, wherein a methylation level of at least one target region of one or more biomarkers equal to or higher than the corresponding cutoff value indicates that the individual has a risk of recurrence and / or metastasis of colorectal cancer, and wherein the target region comprises at least one CpG dinucleotide sequence.

[0006] In some embodiments, the methylation is CpG methylation. In some embodiments, the individual is an individual who has undergone colorectal cancer surgery, such as a person who has undergone colorectal cancer surgery. In some embodiments, the reagent is selected from the following: i) a substance that hybridizes to or amplifies at least one target region of the marker, such as an oligonucleotide primer or probe; and ii) a bisulfite reagent or a methylation-sensitive restriction enzyme reagent that distinguishes methylated and unmethylated dinucleotides, such as methylated and unmethylated CpG dinucleotides, within at least one target region of the marker.

[0007] In some embodiments, the oligonucleotide primer or probe is complementary to or identical to a fragment of at least 9 bases in length to at least one target region of the marker, preferably selected from SEQ ID NO: 1-12 and 15-20. In some embodiments, the marker is a combination of two or more markers selected from: SALL1, POU4F2, SLC24A2, HS3ST2, KCTD8, and intergenic spacer 3 (chr8:70945014-70949177).

[0008] In some embodiments, the sample is selected from cell lines, histological sections, tissue biopsies, paraffin-embedded tissues, body fluids, feces, and combinations thereof; preferably, the sample is selected from colonic effluent, urine, plasma, serum, whole blood, isolated blood cells, and combinations thereof.

[0009] In some embodiments, the target region is selected from: regions chr16:51190041-51190146, chr4:147560088-147560191, chr16:22825783-22825873, chr4:44449597-44449687, chr9:19788670-19788750, chr8:70947014-70947177 or their complementary sequences or processed sequences (e.g., corresponding sequences after bisulfite conversion or MSRE treatment); or processed sequences of the complementary sequences (e.g., corresponding sequences after bisulfite conversion or MSRE treatment); or any combination of the foregoing sequences and / or regions.

[0010] In another aspect, the present invention relates to a kit or microarray for predicting the risk of recurrence and / or metastasis of colorectal cancer in an individual, characterized in that the kit or microarray comprises reagents for detecting the methylation level of at least one target region of at least one biomarker selected from the group consisting of: POU4F2, SALL1, SLC24A2, HS3ST2, KCTD8, intergenic spacer 3 (chr8:70945014-70949177) and any combination thereof in a sample isolated from the individual, wherein a methylation level of the target region of one or more biomarkers equal to or higher than the corresponding cutoff value indicates that the individual has a risk of recurrence and / or metastasis of colorectal cancer, and wherein the target region comprises at least one CpG dinucleotide sequence.

[0011] In some embodiments, the methylation is CpG methylation. In some embodiments, the individual is an individual who has undergone colorectal cancer surgery, such as a person who has undergone colorectal cancer surgery. In some embodiments, the sample is selected from cell lines, histological sections, tissue biopsies, paraffin-embedded tissues, body fluids, feces, and combinations thereof; more preferably, the sample is selected from colonic effluent, urine, plasma, serum, whole blood, isolated blood cells, and combinations thereof.

[0012] In some embodiments, the reagent is selected from the following: i) A substance that hybridizes with or amplifies at least one target region of the marker, such as an oligonucleotide primer or probe, preferably, the oligonucleotide primer or probe being complementary to or identical to at least a 9-base-length fragment of at least one target region of the marker; more preferably, the oligonucleotide primer or probe is selected from SEQ ID NO: 1-12 and 15-20; and ii) a bisulfite reagent or a methylation-sensitive restriction enzyme reagent that distinguishes methylated and unmethylated dinucleotides, such as methylated and unmethylated CpG dinucleotides, within at least one target region of the marker.

[0013] In some embodiments, the biomarker is a combination of biomarkers selected from the following: POU4F2, SALL1, SLC24A2, HS3ST2 and KCTD8; or POU4F2, SALL1, SLC24A2, HS3ST2, KCTD8 and intergenic spacer 3.

[0014] In some embodiments, the target region is selected from: regions chr16:51190041-51190146, chr4:147560088-147560191, chr16:22825783-22825873, chr4:44449597-44449687, chr9:19788670-19788750, chr8:70947014-70947177 or their complementary sequences or processed sequences (e.g., corresponding sequences after bisulfite conversion or MSRE treatment); or processed sequences of the complementary sequences (e.g., corresponding sequences after bisulfite conversion or MSRE treatment); or any combination of the foregoing sequences and / or regions.

[0015] In another aspect, the present invention relates to a method for assessing the risk of postoperative recurrence and / or metastasis in an individual with colorectal cancer, the method comprising the steps of: (a) Obtaining a biological sample containing DNA from said individual; and (b) Treat the DNA in the biological sample obtained in step (a) with a reagent that can distinguish between methylated and unmethylated sites, such as CpG sites, in the DNA to obtain treated DNA; (c) Optionally, at least one target region of at least one target marker in the processed DNA obtained in step (b) is pre-amplified using a pre-amplification primer pool, wherein at least one target region of each target marker is pre-amplified to obtain at least one pre-amplified product, and the at least one target marker comprises one or more markers selected from the group consisting of: SALL1, POU4F2, SLC24A2, HS3ST2, KCTD8, intergenic spacer 3 (chr8:70945014-70949177) and any combination thereof, and wherein the target region comprises at least one CpG dinucleotide sequence; (d) Detecting a methylated template of at least one target region of at least one target biomarker from step (b) or step (c), wherein the at least one target biomarker comprises one or more biomarkers selected from the group consisting of: SALL1, POU4F2, SLC24A2, HS3ST2, KCTD8, intergenic spacer 3 (chr8:70945014-70949177), and any combination thereof. (e) Compare the methylation level of at least one target region of each target biomarker in step (d) with the corresponding cutoff value, wherein a methylation level of at least one target region of one or more target biomarkers equal to or higher than the cutoff value relative to its corresponding cutoff value indicates that the individual has a risk of colorectal cancer recurrence and / or metastasis.

[0016] In some embodiments, the individual is an individual who has undergone colorectal cancer surgery, such as a person who has undergone colorectal cancer surgery. In some embodiments, the reagent is a bisulfite reagent or a methylation-sensitive restriction enzyme reagent that distinguishes methylated and unmethylated dinucleotides, such as methylated and unmethylated CpG dinucleotides, within at least one target region of the marker.

[0017] In some embodiments, in step (c), amplification is performed using a substance that amplifies at least one target region of the marker, such as an oligonucleotide primer. In some embodiments, the oligonucleotide primer is complementary to or identical to a fragment of at least 9 bases in length of at least one target region of the marker. In some embodiments, the oligonucleotide primer is selected from SEQ ID NO: 1-12. In some embodiments, in step (d), detection is performed using a substance that hybridizes to at least one target region of the marker, such as a probe. In some embodiments, the probe is complementary to or identical to a fragment of at least 9 bases in length of at least one target region of the marker. In some embodiments, the probe is selected from SEQ ID NO: 15-20.

[0018] In some embodiments, the biomarker is a combination of biomarkers selected from the following: POU4F2, SALL1, SLC24A2, HS3ST2 and KCTD8; or POU4F2, SALL1, SLC24A2, HS3ST2, KCTD8 and intergenic spacer 3.

[0019] In some embodiments, the sample is selected from cell lines, histological sections, tissue biopsies, paraffin-embedded tissues, body fluids, feces, and combinations thereof; preferably, the sample is selected from colonic effluent, urine, plasma, serum, whole blood, isolated blood cells, and combinations thereof.

[0020] In some implementations, the detection is performed using gene sequencing, PCR (e.g., fluorescent PCR), FISH, immunohistochemistry, ELISA, Western blotting, or flow cytometry.

[0021] In some embodiments, the target region is selected from: regions chr16:51190041-51190146, chr4:147560088-147560191, chr16:22825783-22825873, chr4:44449597-44449687, chr9:19788670-19788750, chr8:70947014-70947177 or their complementary sequences or processed sequences (e.g., corresponding sequences after bisulfite conversion or MSRE treatment); or processed sequences of the complementary sequences (e.g., corresponding sequences after bisulfite conversion or MSRE treatment); or any combination of the foregoing sequences and / or regions. Detailed Implementation

[0022] Several aspects of the invention are described below with reference to illustrative examples. It should be understood that numerous specific details, relationships, and methods are set forth to provide a full understanding of the invention. However, those skilled in the art will readily recognize that the invention may be practiced without one or more of these specific details or may be practiced in other ways.

[0023] This invention relates to the relationship between the methylation levels of newly discovered biomarkers and the risk of recurrence and / or metastasis (including in situ recurrence and metastasis) in colorectal cancer. The biomarkers described herein provide a method for assessing the risk of postoperative recurrence and / or metastasis (including in situ recurrence and metastasis) in an individual with colorectal cancer. Therefore, one embodiment of the invention represents an improvement in biomarkers suitable for assessing the risk of postoperative recurrence and / or metastasis (including in situ recurrence and metastasis) in an individual with colorectal cancer. In yet another embodiment, the newly discovered biomarkers of this invention can be used in conjunction with one or more other cancer biomarkers known in the art (e.g., CEA, CA 19-9, CA24-2, CA 125, CA 72-4, CF21-1, TSGF, P53-Ab) and / or routine diagnostic methods such as chest / abdomen / pelvic CT, chest / abdomen / pelvic MRI, and colonoscopy, for example, to assess the risk of postoperative recurrence and / or metastasis (including in situ recurrence and metastasis) in an individual with colorectal cancer or to prepare kits and / or microarrays for this purpose.

[0024] The term "sample" means material that is known or suspected to express or contain the markers described herein. Samples may be derived from biological sources ("biological samples"), such as tissues (e.g., biopsy samples), extracts, or cell cultures including cells (e.g., tumor cells), cell lysates, and biological or physiological fluids, such as whole blood, plasma, serum, saliva, cerebrospinal fluid, sweat, urine, breast milk, peritoneal fluid, etc. Samples obtained from sources or samples that have been pretreated to improve sample characteristics (e.g., plasma preparation from blood) may be used directly. In some aspects of the invention, the sample is a human physiological fluid, such as human plasma. In some aspects of the invention, the sample is a biopsy sample, such as tumor tissue or cells obtained through histological examination.

[0025] Samples that can be analyzed according to the present invention include clinically derived polynucleotides. As will be understood by those skilled in the art, target polynucleotides may include DNA or RNA, especially DNA, particularly free DNA such as extracellular free DNA.

[0026] Detectable labeling of a target polynucleotide or a substance that hybridizes with or amplifies a target polynucleotide (such as an oligonucleotide primer or probe) can be performed on one or more nucleotides using methods known in the art. Detectable labels can be, but are not limited to, luminescent labels, fluorescent labels, bioluminescent labels, chemiluminescent labels, radioactive labels, and colorimetric labels.

[0027] As used herein, the term "marker" refers to a target nucleic acid, gene region, or methylation site whose methylation level, or a score from a computational model based on methylation level, indicates the risk of recurrence and / or metastasis in colorectal cancer. A gene should be considered to include all its transcriptomic variants and all its promoters and regulatory elements. As understood by those skilled in the art, certain genes are known to exhibit allelic variations or single nucleotide polymorphisms ("SNPs") among individuals. SNPs include insertions and deletions of simple repetitive sequences of varying lengths (e.g., dinucleotide and trinucleotide repeats). Therefore, this application should be understood to extend to all forms of markers / genes arising from any other mutation, polymorphism, or allelic variation. Furthermore, it should be understood that the term "marker" should include both the sense and antisense strand sequences of the marker or gene.

[0028] As used herein, the term "marker" is broadly interpreted to include both 1) the original marker found in a biological sample or genomic DNA (in a specific methylation state) and 2) its processed sequence (e.g., the corresponding region after bisulfite conversion or the corresponding region after MSRE treatment). The bisulfite-converted corresponding region differs from the target marker in the genomic sequence in that one or more unmethylated cytosine residues are converted to uracil, thymine, or other bases that differ from cytosine in hybridization behavior. The MSRE-treated corresponding region differs from the target marker in the genomic sequence in that the sequence is cleaved at one or more MSRE cleavage sites.

[0029] In this invention, "methylation state" refers to the presence, absence, and / or amount of one or more methylated nucleotide bases in a nucleic acid molecule. For example, a nucleic acid molecule containing methylated cytosine is considered methylated, and its methylation state is methylated. A nucleic acid molecule containing no methylated cytosine is considered unmethylated, and its methylation state is unmethylated. In some embodiments, a nucleic acid may be characterized as "unmethylated" if it is not methylated at a specific locus (e.g., a locus containing a specific single CpG dinucleotide) or a specific combination of loci, even if it is methylated at other loci of the same gene or molecule.

[0030] Therefore, methylation status describes the state of methylation of nucleic acids (e.g., genomic sequences). Furthermore, methylation status refers to the methylation-related characteristics of a nucleic acid segment at a specific genomic locus. Such characteristics include, but are not limited to, whether any cytosine (C) residues within this DNA sequence are methylated, the location of one or more methylated C residues, the frequency or percentage of methylated C residues throughout any particular region of the nucleic acid, and methylation allele differences due to, for example, differences in allele origins. "Methylation status" refers to the relative, absolute, or pattern of methylated or unmethylated C residues throughout any particular region of a nucleic acid in a biological sample. For example, if one or more cytosine (C) residues within a nucleic acid sequence are methylated, it may be termed "hypermethylated" or has "increased methylation," while if one or more cytosine (C) residues within a DNA sequence are unmethylated, it may be termed "demethylated" or has "decreased methylation." Similarly, if one or more cytosine (C) residues within a nucleic acid sequence are methylated compared to another nucleic acid sequence (e.g., from a different region or from a different individual), the sequence is considered hypermethylated or has increased methylation compared to other nucleic acid sequences. Alternatively, if one or more cytosine (C) residues within a DNA sequence are unmethylated compared to another nucleic acid sequence (e.g., from a different region or from a different individual), the sequence is considered demethylated or has decreased methylation compared to other nucleic acid sequences.

[0031] In this invention, methylation level represents the proportion of one or more sites that are methylated. The methylation level of a region (or a group of sites) is the average of the methylation levels of all sites in that region (or all sites in the group). Therefore, an increase or decrease in the methylation level of a region does not indicate that the methylation levels of all methylated sites in that region have increased or decreased. The process of converting the results of methods for detecting DNA methylation (e.g., simplified methylation sequencing, quantitative real-time PCR) into methylation levels is known in the art.

[0032] The term "methylation level" as used herein refers to the relationship between the methylation status of any number and any position of CpGs in the sequence in question. This relationship can be the result of addition or subtraction of methylation status parameters (e.g., 0 or 1) or calculations using mathematical algorithms (e.g., mean, percentage, number, proportion, degree, or calculations using mathematical models), including but not limited to methylation level metrics, methylation haplotype ratios, or methylation haplotype loadings.

[0033] In this invention, the genes used as markers are expected to include naturally occurring variants of the gene, its complementary sequence, all its promoters and regulatory elements (e.g., nucleic acid sequences within 5 kb upstream of the gene annotation start site (e.g., 4 kb, 3 kb, 2 kb, or 1 kb) and within 5 kb downstream of its gene annotation termination site), and fragments of the gene or the variant, particularly molecularly detectable fragments. In this invention, the terms "molecularly detectable fragment," "target region," and "target gene region" are used interchangeably. The molecularly detectable fragment preferably comprises at least 16, 17, 18, 19, 20, 22, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, or more consecutive nucleotides of the marker. In some embodiments, the continuous nucleotides comprise at least one, two, three, four, five, six, seven, eight, nine, ten, twelve, fifteen, or more CpG dinucleotide sequences. In some embodiments, the target gene region is preferably rich in CpG dinucleotides.

[0034] In this invention, the term "target region" or "target gene region" refers to any molecularly detectable fragment, or its complementary sequence or a processed sequence (e.g., the corresponding sequence after bisulfite conversion or MSRE treatment), or a processed sequence of the complementary sequence (e.g., the corresponding sequence after bisulfite conversion or MSRE treatment) within the nucleic acid region consisting of the marker gene itself, 5 kb upstream (e.g., 4 kb, 3 kb, 2 kb, or 1 kb) of its gene annotation start site and 5 kb downstream (e.g., 4 kb, 3 kb, 2 kb, or 1 kb) of its gene annotation end site. For example, the target gene region of the target markers in Table 1 below includes its Hg19 coordinates and any molecularly detectable fragment within 5 kb (e.g., 4 kb, 3 kb, 2 kb, or 1 kb) upstream and downstream of those coordinates, its complementary sequence or a processed sequence (e.g., the corresponding sequence after bisulfite conversion or MSRE treatment), and the processed sequence of the complementary sequence (e.g., the corresponding sequence after bisulfite conversion or MSRE treatment). More preferably, the target gene region of the target markers in Table 1 below includes its Hg19 coordinates and any molecularly detectable fragment within 5 kb (e.g., 4 kb, 3 kb, 2 kb, or 1 kb) upstream of those coordinates, its complementary sequence or a processed sequence (e.g., the corresponding sequence after bisulfite conversion or MSRE treatment), and the processed sequence of the complementary sequence (e.g., the corresponding sequence after bisulfite conversion or MSRE treatment).

[0035] In some implementations, it is preferred to use and detect target biomarkers selected from Table 1 below, their target gene regions, or any combination thereof: Target markers Hg19 coordinates Examples of Hg19 target gene regions SALL1 chr16:51169886-51185278 chr16:51190041-51190146 POU4F2 chr4:147560045-147563626 chr4:147560088-147560191 HS3ST2 chr16:22825498-22927659 chr16:22825783-22825873 KCTD8 chr4:44175926-44450824 chr4:44449597-44449687 SLC24A2 chr9:19507450-19786926 chr9:19788670-19788750 Gene intergenic region 3 chr8:70945014-70949177 chr8:70947014-70947177 In some implementations, it is preferred to use and detect two or more (e.g., three, four, five or six) of the target markers in Table 1 and their target gene regions, such as a combination of POU4F2, SALL1, SLC24A2, HS3ST2 and KCTD8; or a combination of POU4F2, SALL1, SLC24A2, HS3ST2, KCTD8 and intergenic spacer 3.

[0036] In some embodiments, the target biomarker POU4F2 and its target gene region are preferably used and detected, and optionally additionally, a selection of target biomarkers and their target gene regions or any combination thereof are used and detected: SALL1, SLC24A2, HS3ST2, KCTD8, and intergenic spacer region 3. In some embodiments, the target biomarker SALL1 and its target gene region are preferably used and detected, and optionally additionally, a selection of target biomarkers and their target gene regions or any combination thereof are used and detected: POU4F2, SLC24A2, HS3ST2, KCTD8, and intergenic spacer region 3. In some embodiments, the target biomarker intergenic spacer region 3 and its target gene region are preferably used and detected, and optionally additionally, a selection of target biomarkers and their target gene regions or any combination thereof are used and detected: POU4F2, SALL1, SLC24A2, HS3ST2, and KCTD8.

[0037] In some embodiments, the use of the target markers of the present invention and their target gene regions or combinations thereof can achieve a sensitivity of at least 20%, such as at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 80%, with a specificity of at least 80%, for example, at least 85%, or at least 90%, or can achieve a sensitivity of at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 85%, with a specificity of at least 80%.

[0038] The terms “subject,” “patient,” and “individual” are used interchangeably herein and refer to warm-blooded animals, such as mammals. This term includes, but is not limited to, livestock, rodents (e.g., rats and mice), primates, and humans. Preferably, the term refers to humans.

[0039] The term "methylation assay" refers to any assay that determines the methylation status of one or more dinucleotide (e.g., CpG) sequences within a DNA sequence.

[0040] In this document, the terms "cutoff value" and "threshold" are used interchangeably and should be understood according to the general understanding of those skilled in the art, and represent any useful reference used to reflect DNA methylation levels. In some embodiments, the cutoff value is represented by a positive reference interval, wherein a positive reference interval indicates that the individual has a risk of colorectal cancer recurrence and / or metastasis; for example, the methylation level of one or more markers within a positive reference interval compared to a corresponding positive reference interval indicates that the individual has a risk of colorectal cancer recurrence and / or metastasis. Cutoff values ​​or positive reference intervals can be obtained from known databases or individual studies. In this invention, a cutoff value or positive reference interval refers to the level from a positive control (i.e., an individual with recurrence and / or metastasis of colorectal cancer). Cutoff values ​​or positive reference intervals can be obtained from a patient's own blood reference sample; the expression of a marker gene in an individual with recurrence and / or metastasis of colorectal cancer; or colorectal cancer cells from a pre-determined individual with recurrence and / or metastasis of colorectal cancer. In some implementations, when using fluorescent PCR detection, a positive reference interval is set using Ct values, for example, a Ct value with a specificity greater than 90% (the proportion of positive results in non-relapsed samples is less than 10%) for each biomarker. As is known to those skilled in the art, a larger Ct value indicates a lower methylation level, i.e., Ct value and methylation level are negatively correlated. Therefore, when using Ct values ​​to represent cutoff values ​​or positive reference intervals, a methylation level of one or more biomarkers equal to or higher than the cutoff value should be expressed as a Ct value of one or more biomarkers being less than or equal to a reference Ct value. In some implementations, the Ct values ​​corresponding to the positive reference intervals for each biomarker are shown in Table 4. For example, for SALL1, the positive reference interval is a Ct value less than or equal to 35.

[0041] The term "oligonucleotide" refers to a polymeric form of nucleotides of any length, which may be ribonucleotides or deoxyribonucleotides. This term includes double-stranded and single-stranded DNA and RNA, and modified and unmodified forms such as methylated or capped polynucleotides. The terms "polynucleotide" and "oligonucleotide" are used interchangeably herein. Oligonucleotides may, but are not required to, include other coding or non-coding sequences, or they may, but are not necessarily, linked to other molecules and / or vectors or supporting materials. Oligonucleotides used in the methods or kits of this invention may have any length suitable for the specific method. In some applications, the term refers to antisense nucleic acid molecules (e.g., mRNA or DNA strands in the opposite direction to the sense polynucleotide encoding the markers of this invention).

[0042] The oligonucleotides used in this invention comprise complementary nucleic acid sequences and nucleic acids substantially identical to these sequences, and also include sequences that differ from the nucleic acid sequences due to genetic code degeneracy. The oligonucleotides used in this invention also include nucleic acids that hybridize to oligonucleotide cancer biomarker nucleic acid sequences under stringent conditions, preferably highly stringent conditions.

[0043] Nucleotide hybridization assays are well known in the art. Hybridization procedures and conditions will vary depending on the application and will be selected based on known universal binding methods, see, for example, J. Sambrook et al., Molecular Cloning: A Laboratory Manual (3rd ed., Science Press, 2002); and Young and Davis, PNAS, 80: 1194 (1983). Methods and apparatus for performing repeatable and controlled hybridization reactions have been described in U.S. Patent Nos. 5,871,928, 5,874,219, 6,045,996, 6,386,749, and 6,391,623, each of which is incorporated herein by reference.

[0044] As used herein, "primer" generally refers to a linear oligonucleotide that is complementary to and annealed to the target sequence. The lower limit of primer length depends on hybridization ability, as very short primers (e.g., less than 5 nucleotides) do not form thermodynamically stable double strands under most hybridization conditions. Primer length typically varies between 8 and 50 nucleotides. In some embodiments, primers are between approximately 15 and 25 nucleotides. Naturally occurring nucleotides (especially guanine, adenine, cytosine, and thymine, hereinafter referred to as "G", "A", "C", and "T") and nucleotide analogs can be used as primers in this invention.

[0045] The term "amplification product" used in this article refers to the amplified nucleic acid generated from a nucleic acid template through nucleic acid amplification.

[0046] As used herein, the term "nucleotide analogue" refers to a compound that is structurally similar to a naturally occurring nucleotide. Nucleotide analogues may have altered phosphate backbones, sugar moieties, nucleobases, or combinations thereof. Nucleotide analogues with altered nucleobases typically impart different base pairing and base stacking properties. Nucleotide analogues with altered phosphate-sugar backbones (e.g., peptide nucleic acids (PNAs) and locked nucleic acids (LNAs)) typically exhibit altered chain properties, such as secondary structure formation.

[0047] Examples of primers and probes used in this invention are shown in Table 2, and their target gene regions are shown in Table 1.

[0048] The nucleotide sequences of the primers and probes of this invention also include their modified forms, as long as the amplification or detection effect of the primers is not significantly affected. The modifications may include, for example, adding one or more nucleotide residues to or at both ends of the nucleotide sequence, deleting one or more nucleotide residues from the nucleotide sequence, or replacing one or more nucleotide residues in the sequence with other nucleotide residues, such as replacing A with T, C with G, etc. Those skilled in the art will understand that primers with such modified forms are also covered within the scope of this invention, and particularly within the scope of the claims. In one embodiment, the modified form of the primer's nucleotide sequence is a chemically enhanced primer as disclosed in CN103270174A.

[0049] The individual nucleotides in the primers of this invention can be synthesized chemically using, for example, a universal DNA synthesizer (e.g., the Applied Biosystems Model 394). Oligonucleotides can also be synthesized using any other methods well known in the art.

[0050] DNA extracted from the sample was used as a template, and PCR primers were used to amplify the target marker to obtain the amplified product. Amplification reactions include, but are not limited to, polymerase chain reaction (PCR), ligase chain reaction (LCP), automated sequence replication (3SR), nucleic acid sequence-based amplification (NASBA), strand displacement amplification (SDA), multiple displacement amplification (MDA), and rolling circle amplification (RCA), disclosed in the following references (incorporated herein): Mullis et al., U.S. Patent Nos. 4,683,195; 4,965,188; 4,683,202; 4,800,159 (PCR); Gelfand et al., U.S. Patent No. 5,210,015 (Real-time PCR using “Taqman” or “Taq” [registered trademark] probes); Wittwer et al., U.S. Patent No. 6,174,670; Kacian et al., U.S. Patent No. 5,399,491 (“NASBA”); Lizardi, U.S. Patent No. 5,854,033; Aono et al., Japanese Patent Publication No. JP Number 4-262799 (rolling circle amplification); etc.

[0051] PCR is preferably used to amplify the target biomarker. PCR is well known in the art. The term "PCR" includes derivatives of this reaction, including but not limited to reverse transcription PCR, real-time PCR, nested PCR, multiplex PCR, and quantitative real-time PCR. Quantitative real-time PCR is preferably used to quantitatively amplify the target nucleotides.

[0052] PCR is performed in the presence of primers, template DNA, and a thermostable DNA polymerase, using primers that hybridize to the sense strand (reverse primers) and primers that hybridize to the antisense strand (forward primers), by repeating the denaturation, annealing, and extension steps approximately 30 to 60 times (e.g., 50 times). In one embodiment, the PCR is quantitative real-time PCR. In one embodiment, the primers shown in Table 2 were used for the PCR. Those skilled in the art will understand that other PCR methods and primers may also be used, as long as the target fragment can be amplified.

[0053] In the PCR of this invention, various conventional thermostable DNA polymerases can be used for amplification, including but not limited to FastStart Taq DNA polymerase (Roche), Ex Taq (registered trademark, Takara), Z-Taq, AccuPrime Taq DNA polymerase, and HotStarTaq Plus DNA polymerase.

[0054] The method of selecting appropriate PCR reaction conditions based on primer Tm values ​​is well known in the art. Those skilled in the art can select the optimal conditions based on primer length, GC content, target specificity and sensitivity, and the properties of the polymerase used. For example, the following conditions can be used for quantitative real-time PCR: 95°C for 5 minutes; 95°C for 15 seconds, 56°C for 40 seconds, for 50 cycles. The reaction volume is 25 μL.

[0055] Reagents that can be used to detect the methylation level of the target markers of this invention are well known in the art. Such reagents suitable for this invention, such as bisulfite reagents or methylation-sensitive restriction enzymes, are commercially available or routinely prepared by methods well known to those skilled in the art.

[0056] The term "bisulfite reagent" refers to a bisulfite used to distinguish between methylated and unmethylated CpG dinucleotide sequences.

[0057] The term "methylation-sensitive restriction enzyme" should be understood as an enzyme that selectively digests nucleic acids based on the methylation state of its recognition site. For restriction enzymes that specifically cleave when the recognition site is unmethylated or hemimethylated, cleavage does not occur or occurs with significantly reduced efficiency when the recognition site is methylated. Preferably, the following methylation-sensitive restriction enzymes have a recognition sequence containing a CG dinucleotide (e.g., cgcg or cccggg). In some embodiments, it is further preferred to be a restriction enzyme that does not cleave when the cytosine in the dinucleotide is methylated at the C5 carbon atom.

[0058] The kit of the present invention can be prepared using conventional methods in the art. The kit may contain materials or reagents (including reagents for detecting various target biomarkers) used in carrying out the methods of the present invention. The kit may include storage reagents (e.g., primers, dNTPs, enzymes, etc. in suitable containers) and / or supporting materials (e.g., buffer solutions, instructions for performing the assay, etc.). For example, the kit may include one or more containers (e.g., boxes) containing the corresponding reagents and / or supporting materials. Such contents may be delivered together or separately to the intended recipient. As an example, the kit may contain reagents for detecting various target biomarkers, buffer solutions, and instructions for use. The kit may also contain polymerases and dTNPs, etc. The kit may also contain internal standards, positive and negative controls, etc., for quality control. The kit may also contain reagents for preparing nucleic acids, such as DNA, from samples. The above examples should not be construed as limiting the kits and their contents applicable to the present invention.

[0059] A microarray is a solid support with a flat surface containing an array of nucleic acids. Each member of the array contains an identical copy of an oligonucleotide or polynucleotide immobilized at a spatially defined region or site that does not overlap with regions or sites of other members in the array; that is, the region or site is spatially discrete. Furthermore, the spatially defined hybridization site can be "addressable" because its location and the identity of the immobilized oligonucleotide are known or predetermined (e.g., known or predetermined before its use). Typically, the oligonucleotide or polynucleotide is single-stranded and usually covalently linked to the solid support by a 5' or 3' end. The density of nucleic acids containing non-overlapping regions in the microarray is typically greater than 100 / cm³. 2 More preferably greater than 1000 / cm 2 Microarray technology is disclosed in, for example, the following references: Microarrays: A Practical Approach (IRL Press, Oxford, 2000), edited by Schena; Southern, Current Opin. Chem. Biol., 2:404-410, 1998, the entire contents of which are incorporated herein by reference.

[0060] This invention discloses the use of biomarkers in assessing the risk of postoperative recurrence and / or metastasis in individuals with colorectal cancer. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired results. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The uses described herein have been described through preferred embodiments, and those skilled in the art will clearly be able to modify or appropriately alter and combine the uses described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention. Example

[0061] To better understand the content of this invention, detailed descriptions will be provided in conjunction with embodiments.

[0062] Example 1. Comparison of methylation signals at target sites before and after surgery in patients. Surgery remains the most effective treatment for resectable colorectal tumors, and a reduction in tumor molecular burden is observed in most patients after tumor resection. Therefore, for biomarkers suitable for monitoring postoperative tumor molecular burden, a statistically significant preoperative signal should be observed compared to a postoperative signal. This example examined preoperative and postoperative plasma cell-free DNA methylation signals in 50 patients. The specific experimental procedures are as follows.

[0063] 1. Cell-free extracellular DNA was extracted from the plasma samples described above using the commercial Qiagen QIAamp Circulating Nucleic Acid Kit.

[0064] 2. Using the commercially available bisulfite conversion reagent MethylCode TM The Bisulfite Conversion Kit converts extracted extracellular free DNA to sulfite to obtain converted DNA.

[0065] 3. The transformed DNA was used for pre-amplification. Using the primer pool shown in Table 2, containing methylation-specific primers for all target sites (POU4F2, SALL1, SLC24A2, HS3ST2, KCTD8, and intergenic spacer 3) and internal control (ACTB) primer pairs, PCR amplification was performed using the transformed DNA as a template. The final concentration of each primer was 100 nM. The PCR reaction system consisted of 10 μL of transformed DNA, 2.5 μL of premixed primers, and 12.5 μL of PCR reagent (Luna® Universal Probeq PCR Master Mix (NEB)). The PCR reaction conditions were as follows: 95℃ for 5 minutes; 95℃ for 30 seconds, 56℃ for 60 seconds, for 15 cycles.

[0066] 4. Fluorescent PCR Detection. The pre-amplified product from step 3 was diluted 10-fold for fluorescent PCR detection. Primers and detection probe sequences as shown in Table 2 were used, and the internal reference gene ACTB was simultaneously detected as a control. The final primer concentration was 500 nM, and the final probe concentration was 200 nM. The PCR reaction system contained: 10 μL of the pre-amplified diluted product; 2.5 μL of primer and probe premix containing the detection site; and 12.5 μL of PCR reagent (Luna® Universal Probe qPCR Master Mix (NEB)). The PCR reaction conditions were as follows: 95℃ for 5 minutes; 95℃ for 15 seconds, 56℃ for 40 seconds (fluorescence acquisition), 50 cycles. The corresponding detection fluorescence channel was selected based on the fluorescence modification of different gene probes. The Ct value for target sites where no amplification signal was detected was set to 50.

[0067] Table 2. Primer and probe sequences result The differences in the mean Ct values ​​of the above-mentioned biomarkers before and after surgery, along with statistical analysis, are summarized in the table below. The p-values ​​were obtained using the t-test. Except for the internal control, the p-values ​​for the other biomarkers before and after surgery were all less than 0.05.

[0068] markers Ct mean difference p-value POU4F2 -8.34 0.0002 SALL1 -5.68 0.0098 SLC24A2 -4.49 0.0334 HS3ST2 -8.36 0.0003 KCTD8 -4.98 0.0129 Gene intergenic region 3 -5.40 0.0022 Example 2. Risk assessment of recurrence and metastasis based on plasma cell-free DNA methylation signaling 2–6 weeks post-surgery. Blood samples were collected from 102 patients 2–6 weeks post-surgery, and plasma cell-free DNA methylation was detected according to the procedure described in Example 1. These 102 patients were subsequently followed up post-surgery, with a median follow-up of 10 months. Recurrence and metastasis (including in situ recurrence and metastasis) were observed in 14 patients. A positive reference interval was set using Ct values ​​greater than 90% specificity (the proportion of positive results in non-recurrence samples less than 10%) for each biomarker. The sensitivity of each biomarker for detecting recurrence and metastasis was statistically analyzed, and the results are shown in the table below. markers Sensitivity Positive reference interval (Ct) SALL1 50.0% ≤35 SLC24A2 42.9% ≤35 Gene intergenic region 3 35.7% ≤35 POU4F2 28.6% ≤35 HS3ST2 28.6% ≤35 KCTD8 28.6% ≤35 When using a combination of POU4F2, SALL1, SLC24A2, HS3ST2, and KCTD8 for evaluation, the sensitivity for recurrence and metastasis detection was 78.6%, and the specificity was 88.9%. When using a combination of POU4F2, SALL1, SLC24A2, HS3ST2, KCTD8, and intergenic spacer 3 for evaluation, the sensitivity for recurrence and metastasis detection was 85.7%, and the specificity was 83.3%.

[0069] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention. <110> Fudan University Cancer Hospital Shanghai Kunyuan Biotechnology Co., Ltd. <120> Use of biomarkers in predicting the risk of recurrence and / or metastasis in colorectal cancer <130> CPCH2161568N <160> twenty one <170> PatentIn version 3.3 <210> 1 <211> 17 <212> DNA <213> Artificial sequence <400> 1 gagggtgggt ttggtaa 17 <210> 2 <211> 20 <212> DNA <213> Artificial sequence <400> 2 gatataaaaa caaccctcca 20 <210> 3 <211> 20 <212> DNA <213> Artificial sequence <400> 3 aacatccgtt caaactaaca 20 <210> 4 <211> 17 <212> DNA <213> Artificial sequence <400> 4 ggttgtgcga agttgag 17 <210> 5 <211> 20 <212> DNA <213> Artificial sequence <400> 5 tagttttcgg agaagacggc 20 <210> 6 <211> 20 <212> DNA <213> Artificial sequence <400> 6 ctataaccct acgatcgcct 20 <210> 7 <211> 20 <212> DNA <213> Artificial sequence <400> 7 aggtcggttt ttatatggtg 20 <210> 8 <211> twenty one <212> DNA <213> Artificial sequence <400> 8 tcgatataac tactccaaat c 21 <210> 9 <211> 20 <212> DNA <213> Artificial sequence <400> 9 agttaaaagt aagggtagga 20 <210> 10 <211> 19 <212> DNA <213> Artificial sequence <400> 10 ccccgctaaa aattaacca 19 <210> 11 <211> 17 <212> DNA <213> Artificial sequence <400> 11 ggtcgggttg agattgg 17 <210> 12 <211> 17 <212> DNA <213> Artificial sequence <400> 12 ggtggggttg agattgg 17 <210> 13 <211> twenty four <212> DNA <213> Artificial sequence <400> 13 gtgatggagg aggtttagta agtt 24 <210> 14 <211> 25 <212> DNA <213> Artificial sequence <400> 14 ccaataaaac ctactcctcc cttaa 25 <210> 15 <211> twenty two <212> DNA <213> Artificial sequence <400> 15 cgcgttcgag ttaagagtcg cg 22 <210> 16 <211> 25 <212> DNA <213> Artificial sequence <400> 16 cgtcgtcgttttcggatttt gtacg 25 <210> 17 <211> 19 <212> DNA <213> Artificial sequence <400> 17 tcgtggtagc gttacgcga 19 <210> 18 <211> twenty two <212> DNA <213> Artificial sequence <400> 18 tcgttaatta gtatcgcgac ga 22 <210> 19 <211> twenty four <212> DNA <213> Artificial sequence <400> 19 cgggggtttt aaatttacgt ttcg 24 <210> 20 <211> 20 <212> DNA <213> Artificial sequence <400> 20 cggtttttgt cggggtgcgg 20 <210> twenty one <211> 30 <212> DNA <213> Artificial sequence <400> twenty one accacccaccc aacacacaat aacaaacaca 30

Claims

1. Use of an agent in the manufacture of a kit or microarray for predicting the risk of recurrence and metastasis of colorectal cancer in an individual, characterized in that The reagent is used to detect the methylation level of each of the following biomarkers selected from a combination of biomarkers isolated from the individual: i) POU4F2, SALL1, SLC24A2, HS3ST2 and KCTD8, or ii) POU4F2, SALL1, SLC24A2, HS3ST2, KCTD8 and intergenic spacer 3, wherein the sequence of intergenic spacer 3 is chr8:70945014-70949177, and the reference genome for the sequence is Hg19; The reagents described herein contain the following primer and probe sets: (i) the forward primer shown in SEQ ID NO: 1, the reverse primer shown in SEQ ID NO: 2, and the probe shown in SEQ ID NO: 15 for SALL1; the forward primer shown in SEQ ID NO: 3, the reverse primer shown in SEQ ID NO: 4, and the probe shown in SEQ ID NO: 16 for POU4F2; the forward primer shown in SEQ ID NO: 5, the reverse primer shown in SEQ ID NO: 6, and the probe shown in SEQ ID NO: 17 for HS3ST2; the forward primer shown in SEQ ID NO: 7, the reverse primer shown in SEQ ID NO: 8, and the probe shown in SEQ ID NO: 18 for KCTD8; and the forward primer shown in SEQ ID NO: 9, the reverse primer shown in SEQ ID NO: 10, and the probe shown in SEQ ID NO: 19 for SLC24A2; or (ii) For SALL1, the forward primer shown in SEQ ID NO: 1, the reverse primer shown in SEQ ID NO: 2, and the probe shown in SEQ ID NO: 15; for POU4F2, the forward primer shown in SEQ ID NO: 3, the reverse primer shown in SEQ ID NO: 4, and the probe shown in SEQ ID NO: 16; for HS3ST2, the forward primer shown in SEQ ID NO: 5, the reverse primer shown in SEQ ID NO: 6, and the probe shown in SEQ ID NO: 17; for KCTD8, the forward primer shown in SEQ ID NO: 7, the reverse primer shown in SEQ ID NO: 8, and the probe shown in SEQ ID NO: 18; for SLC24A2, the forward primer shown in SEQ ID NO: 9, the reverse primer shown in SEQ ID NO: 10, and the probe shown in SEQ ID NO: 19; and for intergenic spacer region 3, the forward primer shown in SEQ ID NO: 11, the reverse primer shown in SEQ ID NO: 15, the probe shown in SEQ ID NO: 16, the probe shown in SEQ ID NO: 17, the probe shown in SEQ ID NO: 18, the probe shown in SEQ ID NO: 19, the probe shown in SEQ ID NO: 19, the probe shown in SEQ ID NO: 10, the probe shown in SEQ ID NO: 19, the probe shown in SEQ ID NO: 19, the probe shown in SEQ ID NO: 11, the probe shown in SEQ ID NO: 19, the probe shown in SEQ ID NO: 10, the probe shown in SEQ ID NO: 19 ... The reverse primer shown in SEQ ID NO: 12 and the probe shown in SEQ ID NO: 20, and The sample in question was cell-free DNA from blood plasma.

2. Use according to claim 1, characterized in that The methylation is CpG methylation.

3. Use according to claim 1, characterized in that The individuals referred to are those who have undergone colorectal cancer surgery.

4. The use according to claim 1 or 2, characterized in that... The reagent also includes reagents selected from the following: A bisulfite reagent or a methylation-sensitive restriction enzyme reagent, wherein the bisulfite reagent or methylation-sensitive restriction enzyme reagent distinguishes between methylated and unmethylated CpG dinucleotides of the marker.

Images