Single variable domains binding to bcma and antigen binding molecules

Abstract

An immunoglobulin monovariable domain and antigen-binding molecule that binds to BCMA are provided, specifically including an immunoglobulin monovariable domain and antigen-binding molecule, a nucleic acid encoding them, a carrier containing the nucleic acid, a cell containing the carrier, a pharmaceutical composition containing them, and therapeutic use thereof are also provided.

Description

Technical Field

[0001] This invention relates to antigen-binding molecules, and more particularly to single variable domains that bind BCMA and antigen-binding molecules. Background Technology

[0002] B-cell maturation antigen (BCMA), also known as tumor necrosis factor receptor superfamily member 17 (TNFRS17), is a protein encoded by the TNFRSF17 gene in the human body.

[0003] BAFF and APRIL are ligands of BCMA. BAFF (also known as BLYS, TALL-1, THANK, zTNF4, TNFSF20, D8Ertd387e) is a high-affinity ligand of BCMA, while APRIL (a proliferation-inducing ligand, also known as TNFSF13, TALL-2, TRDL-1) is a low-affinity ligand of BCMA. Furthermore, BAFF and APRIL are also ligands of B-cell activation factor receptor (BAFF-R), a member of the tumor necrosis factor receptor (TNFR) superfamily, as well as transmembrane activator and calcium modulator and cyclophilin ligand interactor (TACI). BCMA, along with BAFF-R and TACI, regulates B-cell proliferation, survival, maturation, and differentiation.

[0004] Multiple myeloma is a malignant plasma cell disease, and the expression level of BCMA is significantly increased in multiple myeloma cells. BCMA can be a suitable tumor antigen target for immunotherapeutic agents targeting multiple myeloma. Immunotherapy agents, such as antibodies that bind to BCMA, can block the binding between BCMA and its natural ligands BAFF and / or APRIL. As potential therapeutic targets, several antibodies targeting BCMA have been developed, but the pool remains limited, and more options are needed.

[0005] In camels, IgG antibodies, besides the traditional four-chain antibody IgG1 containing both light and heavy chains, also naturally exist as heavy-chain-only antibodies (HcAbs) IgG2 and IgG3, which do not contain a light chain. Heavy-chain-only antibodies contain a single variable domain (V... H A single domain antibody (sdAb) possesses the ability to specifically bind to antigens and exhibits high affinity for them. Based on its uniqueness, V... HThe H domain—either alone or as part of a larger antigen-binding molecule—offers several significant advantages over conventional scFvs and antibody fragments such as Fab, including the ability to bind antigens with high affinity using only a single domain, and the ease with which it can be modified into multivalent and multispecific forms. H The H domain is highly soluble and has no tendency to aggregate; the molecules are small, thus exhibiting high tissue permeability; single-domain antibodies do not need to pair with light chains; and there is no light-heavy chain mismatch problem when forming bispecific or multispecific antibodies, etc. Summary of the Invention

[0006] This invention provides a single variable domain binding BCMA and an antigen-binding molecule. This invention also provides related nucleotides, vectors, cells, compositions, construction methods, and uses capable of encoding the provided single variable domain and antigen-binding molecule.

[0007] In one aspect, the present invention provides a separate single variable structural domain that incorporates BCMA, wherein the single variable structural domain comprises CDR1, CDR2, and CDR3 selected from the following:

[0008] (a) CDR1 having at least 70% sequence identity with the amino acid sequences selected from SEQ ID NO:7, 10, 13 and 16;

[0009] (b) CDR2 having at least 85% sequence identity with the amino acid sequences selected from SEQ ID NO: 8, 11, 14 and 17; and

[0010] (c) CDR3 having at least 85% sequence identity with the amino acid sequences selected from SEQ ID NO:9, 12, 15 and 18.

[0011] In some implementations, the single variable structural domain comprises CDR1, CDR2, and CDR3 selected from any of the following groups:

[0012] (i) CDR1 containing the amino acid sequence of SEQ ID NO:7; CDR2 containing the amino acid sequence of SEQ ID NO:8; and CDR3 containing the amino acid sequence of SEQ ID NO:9;

[0013] (ii) CDR1 containing the amino acid sequence of SEQ ID NO:10; CDR2 containing the amino acid sequence of SEQ ID NO:11; and CDR3 containing the amino acid sequence of SEQ ID NO:12;

[0014] (iii) CDR1 containing the amino acid sequence of SEQ ID NO:13; CDR2 containing the amino acid sequence of SEQ ID NO:14; and CDR3 containing the amino acid sequence of SEQ ID NO:15; or

[0015] (iv) CDR1 containing the amino acid sequence of SEQ ID NO:16; CDR2 containing the amino acid sequence of SEQ ID NO:17; and CDR3 containing the amino acid sequence of SEQ ID NO:18.

[0016] In some embodiments, the single variable domain comprises an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the sequence of SEQ ID NO: 19, 21, 23, or 25.

[0017] In one aspect, the present invention provides a separate single variable domain, wherein the single variable domain comprises CDR1, CDR2 and CDR3 of the amino acid sequence of SEQ ID NO: 19, 21, 23 or 25.

[0018] In one aspect, the present invention provides a discrete single variable domain, wherein the single variable domain comprises an amino acid sequence of SEQ ID NO: 19, 21, 23 or 25.

[0019] In one aspect, the present invention provides a separate single variable domain that binds to the extracellular region of BCMA, with the binding site located at one or more amino acids in the Gln7-His19, Pro23-Ser30, and Asn31-Ser44 positions of the BCMA extracellular region, the amino acid sequence of which is shown in SEQ ID NO:35 or SEQ ID NO:36. These positions are numbered sequentially starting from the first amino acid (position 1) of the human BCMA extracellular region.

[0020] In one aspect, the present invention provides a separate single variable structural domain, wherein the single variable structural domain is associated with the same epitope as the single variable structural domain described in any embodiment herein.

[0021] In one aspect, the present invention provides a separate single variable structural domain, wherein the single variable structural domain competes with the single variable structural domain described in any embodiment herein for binding BCMA.

[0022] In some embodiments, the single variable domain described above is of camel-like or human origin. In some embodiments, the single variable domain described above is V HH, preferably from cameloid animals or humanized V H H.

[0023] In one aspect, the present invention provides the use of the single variable domain described herein, including for constructing antigen-binding molecules, preferably antibodies, monospecific antibodies, multispecific antibodies, or immunoconjugates.

[0024] In one aspect, the present invention provides a separate antigen-binding molecule that binds to BCMA and contains at least one single variable domain as described herein.

[0025] In one aspect, the present invention provides compositions comprising an active ingredient and a pharmaceutically acceptable carrier, wherein the active ingredient is a single variable domain as described herein or an antigen-binding molecule as described herein. In some embodiments, the antigen-binding molecule comprises an amino acid sequence as shown in SEQ ID NO: 27, 29, 31 or 33.

[0026] In one aspect, the present invention provides isolated nucleic acids that encode a single variable domain or an antigen-binding molecule as described herein.

[0027] In one aspect, the present invention provides a carrier comprising the isolated nucleic acid described herein.

[0028] In one aspect, the present invention provides a host cell comprising the vector described herein.

[0029] In one aspect, the present invention provides a method for detecting or measuring BCMA in a sample, comprising contacting the sample with a single variable domain or an antigen-binding molecule as described herein and detecting or measuring the binding complex.

[0030] In one aspect, the present invention provides a method for preparing the single variable domain described herein, comprising: culturing the host cell and isolating the expressed single variable domain, wherein the vector is an expression vector and the host cell contains nucleic acid encoding the single variable domain.

[0031] In one aspect, the present invention provides a method for preparing the antigen-binding molecule, comprising: culturing the host cell, isolating the expressed antigen-binding molecule, wherein the vector is an expression vector, and the host cell contains nucleic acid encoding the antigen-binding molecule.

[0032] In another aspect, the present invention provides a method for treating a subject with a tumor expressing BCMA, comprising administering to the subject a therapeutically effective amount of the single variable domain, the antigen-binding molecule, or the composition thereof.

[0033] In another aspect, the present invention provides a method for inhibiting, reducing, or blocking BCMA signaling in cells, comprising administering an effective amount of the single variable domain, the antigen-binding molecule, or the composition thereof to the cells.

[0034] In another aspect, the present invention provides a method for killing tumor cells expressing BCMA or inhibiting the growth of tumor cells expressing BCMA, comprising contacting the tumor cells with the single variable domain, the antigen-binding molecule, or the composition.

[0035] In another aspect, the present invention provides a method for treating a subject suffering from an autoimmune disease, comprising administering to the subject a therapeutically effective amount of the single variable domain, the antigen-binding molecule, or the composition described herein. Attached Figure Description

[0036] Figure 1 For ELISA detection of anti-human BCMA V H The curve of H-Fc chimeric antibody binding to antigen;

[0037] Figure 2A For flow cytometry detection of anti-human BCMA V H Binding curve of H-Fc chimeric antibody to CHO-hBCMA cells;

[0038] Figure 2B For flow cytometry detection of anti-human BCMA V H Binding curve of H-Fc chimeric antibody with U266 cells;

[0039] Figure 2C For flow cytometry detection of anti-human BCMA V H Binding curve of H-Fc chimeric antibody to RPMI8226 cells;

[0040] Figure 2D For flow cytometry detection of anti-human BCMA V H Binding curve of H-Fc chimeric antibody to HUVEC cells;

[0041] Figure 3A The binding curves of 1A10-Fc and 1A11-Fc chimeric antibodies to HEK293T-CynoBCMA were detected by flow cytometry.

[0042] Figure 3B To detect the binding curves of 1A10-Fc and 1A11-Fc chimeric antibodies to HEK293T by flow cytometry;

[0043] Figure 4 Showing human BCMA V HELISA results of competition between H-Fc chimeric antibody and ligand APRIL;

[0044] Figure 5A Comparative diagram of the extracellular amino acid sequences of BCMA in humans and cynomolgus monkeys;

[0045] Figure 5B The extracellular crystal structure of human BCMA;

[0046] Figure 5C The epitope relationships of 1A1, 1A10, 1A11 and 1B10. Detailed Implementation

[0047] the term

[0048] The term "antigen-binding molecule," in its broadest sense, refers to a molecule that specifically binds to an antigenic determinant. Some examples of antigen-binding molecules are antibodies, fusion proteins, and antibody-drug conjugates.

[0049] The term "immunoglobulin" refers to a protein with the structure of naturally occurring antibodies. For example, human IgG immunoglobulins are heterotetrameric glycoproteins of approximately 150,000 Daltons, composed of two light chains and two heavy chains linked by disulfide bonds. From the N-terminus to the C-terminus, each heavy chain has a heavy chain variable region (VH), followed by a hinge region (HR) and three constant domains (CH1, CH2, and CH3), also known as the heavy chain constant region. In the case of IgE immunoglobulins, the heavy chain also has a CH4 domain. Therefore, an immunoglobulin heavy chain is a polypeptide composed of the following domains in the N-terminus to C-terminus direction: VH-CH1-HR-CH2-CH3-(CH4). Similarly, from the N-terminus to the C-terminus, each light chain has a light chain variable region (VL), followed by a constant light chain domain, also known as the light chain constant region (CL). Therefore, an immunoglobulin light chain is a polypeptide composed of the following domains in the N-terminus to C-terminus direction: VL-CL. Human immunoglobulins are basically composed of two Fab and Fc domains connected by the immunoglobulin hinge region.

[0050] The term "antibody" is used in its broadest sense to encompass, but is not limited to, various antibody structures including, but not limited to, monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies, trispecific antibodies), and antibody fragments, as long as they exhibit the desired antigen-binding activity.

[0051] The term "variable domain" or "variable region" refers to a domain of an antibody involved in the binding of the antibody to an antigen. Each variable domain of a natural antibody essentially consists of four "frame regions" and three complementarity-determining regions (CDRs). The four "frame regions" are referred to in the art and hereinafter as "frame region 1" or "FR1", "frame region 2" or "FR2", "frame region 3" or "FR3", and "frame region 4" or "FR4", respectively; said frame regions are separated by three CDRs, referred to in the art and hereinafter as "complementarity-determining region 1" or "CDR1", "complementarity-determining region 2" or "CDR2", and "complementarity-determining region 3" or "CDR3", respectively. Therefore, the general structure or sequence of the variable domain can be represented as: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. The variable domain endows the antibody with antigen specificity due to the presence of an antigen-binding site.

[0052] The term "single variable domain" refers to a variable domain capable of specifically binding to an antigenic epitope without pairing with other variable domains. The antigen-binding site of a single variable domain is typically formed by three CDRs (CDR1, CDR2, and CDR3) and exists on a single domain. In some cases, the single variable domain can be a heavy-chain variable domain (e.g., VH) or a suitable fragment thereof; as long as it can form a single antigen-binding unit (i.e., a functional antigen-binding unit essentially composed of a single variable domain, so that the single antigen-binding domain does not need to interact with another variable domain to form a functional antigen-binding unit). Another example of a single variable domain is the "VHH domain" (or simply "VHH" or "V") of the camelid family. H H”).

[0053] "VHH domain", also known as VHH or V H H, V H The VHH domain, or single-domain antibody, was initially described as a variable domain for binding antigens of “heavy-chain-only antibodies” (i.e., “antibodies lacking light chains”). The term “VHH domain” is used to distinguish these variable domains from the heavy-chain variable domains present in conventional 4-chain antibodies (referred to herein as the “VH domain” or “VH”) and the light-chain variable domains present in conventional 4-chain antibodies (referred herein as the “VL domain” or “VL”). The VHH domain specifically binds to epitopes without the need for other antigen-binding domains (unlike the VH or VL domains in conventional 4-chain antibodies, where the epitope is recognized by both the VL and VH domains). The VHH domain is a small, stable, and highly efficient antigen-recognizing unit formed by a single domain.

[0054] "CDR" (complementarity-determining region), also known as "hypervariant region (HVR)," generally refers to each region of an antibody variable region that is highly variable in sequence and / or forms a structurally defined loop. Naturally occurring four-chain antibodies typically contain six CDRs: three in the heavy chain variable region (heavy chain CDR1, heavy chain CDR2, and heavy chain CDR3) and three in the light chain variable region (light chain CDR1, light chain CDR2, and light chain CDR3). Heavy chain-only antibodies or single variable domain antibodies typically have three CDRs (CDR1 (or HVR1), CDR2 (or HVR2), and CDR3 (or HVR3)). CDR3 exhibits the greatest diversity among the three CDRs and is believed to play a unique role in conferring fine specificity to antibodies.

[0055] Currently, there are many methods for defining CDRs. The Kabat definition, based on sequence variability, is the most commonly used (Elvin A. Kabat, et al., Sequences of Proteins of Immunological Interest, 5th ed., Public Health Service, National Institutes of Health, Bethesda, Md. (1991)); while the Chothia definition is based on the location of structural loops (Cyrus Chothia, et al., Canonical Structures for the Hypervariable Regions of Immunoglobulins, J. Mol. Biol. 196:901-917 (1987)). The AbM definition is a compromise between the Kabat and Chothia definitions and is used by the AbM antibody modeling software from Oxford Molecular. The "contact" definition of a CDR is based on the analysis of available complex crystal structures. The residues of each of these CDRs are recorded in Table S1 below.

[0056] Table S1 CDR Division

[0057]

[0058] In certain specific contexts herein, "complementarity-determining region," "CDR," or "HVR" refers to the CDR as defined by Kabat (Elvin A. Kabat, et al., Sequences of Proteins of Immunological Interest, 5th ed., Public Health Service, National Institutes of Health, Bethesda, Md. (1991)). Based on the amino acid sequence of the variable region of an antibody, those skilled in the art can routinely determine which amino acid residues are contained in any arbitrarily defined CDR, and other arbitrarily defined CDRs (e.g., Chothia, AbM definitions, etc.) are also covered within the scope of this invention.

[0059] Single variable structural domain (such as V) H The amino acid residue numbering of VH is based on the general VH numbering system given by Kabat et al. (Elvin A. Kabat, et al., Sequences of Proteins of Immunological Interest, 5th edition, Public Health Service, National Institutes of Health, Bethesda, Md. (1991)), as applied to the VH domains of camels in Riechmann et al.'s article (L Riechmann, et al., Single domain antibodies: comparison of camel VH and camelised human VH domains, J. Immunol. Methods. (1999)). H H is a structural domain. Based on this number, V... H H's FR1 contains amino acid residues at positions 1-30, V H H's CDR1 contains amino acid residues at positions 31-35, V H H's FR2 contains amino acids at positions 36-49, V H H's CDR2 contains amino acid residues at positions 50-65, V H H's FR3 contains amino acid residues at positions 66-94, V H H's CDR3 contains amino acid residues at positions 95-102, V H FR4 of H contains amino acid residues at positions 103-113. In this regard, it should be noted that, as is well known in the art, VH and V... HH. The total number of amino acid residues in each CDR can vary and may not correspond to the total number of amino acid residues indicated by the Kabat number (i.e., one or more positions in the actual sequence may not be occupied according to the Kabat number, or the actual sequence may contain more amino acid residues than the number allowed by the Kabat number).

[0060] "Variable domain residue numbering as in Kabat" or "amino acid position numbering as in Kabat" and its variations refer to the numbering system used by Kabat et al. (Elvin A. Kabat, et al., Sequences of Proteins of Immunological Interest, 5th edition, Public Health Service, National Institutes of Health, Bethesda, Md. (1991)) for encoding heavy chain or light chain variable domains of antibodies. Using this numbering system, the actual linear amino acid sequence can contain fewer or additional amino acids corresponding to shortened or inserted FR or CDRs of the variable domain. For example, a heavy chain variable domain may include a single amino acid insertion after amino acid residue 52 of CDR2 (according to Kabat's amino acid residue 52a) and inserted amino acid residues after amino acid residue 82 of the heavy chain FR (e.g., amino acid residues 82a, 82b, and 82c, etc., according to Kabat). For a given antibody, the Kabat number of the amino acid residues of a given antibody can be determined by comparing the antibody sequence with the homologous sequence of the "standard" Kabat number.

[0061] The term “frame region” or “FR” residues are amino acid residues with variable domains other than the CDR residues defined herein.

[0062] The term "human shared frame region" or "receptor human frame" refers to the frame of amino acid residues that most frequently appear in the selection of the human immunoglobulin VL or VH frame region sequence. Generally, the selection of the human immunoglobulin VL or VH sequence is derived from a subgroup of the variable domain sequence. Typically, the subgroups are those described in Kabat et al., Sequences of Proteins of Immunological Interest, 5th Edition, Public Health Service, National Institutes of Health, Bethesda, Md. (1991). Examples include: for VL, subgroups could be subgroups κI, κII, κIII, or κIV as described by Kabat et al. (ibid.). Similarly, for VH, subgroups could be subgroups I, II, or III as described by Kabat et al. Alternatively, the human common frame region (CFR) can be derived from specific residues mentioned above. For example, when human frame region residues are selected based on homology between human frame region residues and donor frame regions by comparing the donor frame region sequence with a set of various human frame region sequences, the recipient human frame region "derived" from the human common frame region can contain the same amino acid sequence, or it can contain pre-existing amino acid sequence variations. In some embodiments, the number of pre-existing amino acid variations is 10 or less, 9 or less, 8 or less, 7 or less, 6 or less, 5 or less, 4 or less, 3 or less, or 2 or less.

[0063] The term "Fc domain" or "Fc" is used to define the C-terminal region of the immunoglobulin heavy chain, which contains at least a portion of the constant region. This term includes the native sequence Fc and variant Fc. The C-terminal lysine residue (Lys447 according to the EU numbering system) of the Fc may or may not be present.

[0064] The term "EC50" refers to the effective concentration, the 50% maximal response of the antigen-binding molecule. The term "IC50" refers to the inhibitory concentration, the 50% maximal response of the antigen-binding molecule. Both EC50 and IC50 can be measured by ELISA or FACS analysis or any other method known in the art.

[0065] The term "KD" as used herein refers to the equilibrium dissociation constant, expressed as molar concentration (M). The KD value of an antigen-binding molecule can be determined using methods known in the art. One method for determining the KD of an antigen-binding molecule is to use surface plasmon resonance, such as with a biosensor system like the Biacore system.

[0066] The term “treatment” refers to measures used to treat, cure, reduce, alleviate, alter, remedy, improve, enhance, or influence a disease (e.g., illness), its symptoms, or to prevent or delay the onset of symptoms, complications, biochemical indicators, or otherwise inhibit or suppress the further development of a disease, ailment, or condition in a statistically significant manner.

[0067] The term “therapeutic effective amount” refers to the amount of antigen-binding molecule or composition or other administration necessary to provide a subject with therapeutic and / or preventive benefit.

[0068] The term "subject" includes any human or non-human animal. The term "non-human animal" includes all vertebrates, such as mammals and non-mammals, including non-human primates, sheep, dogs, horses, cattle, chickens, amphibians, reptiles, etc. Preferably, the subject according to the invention is a human. Unless otherwise stated, the terms "patient" or "subject" may be used interchangeably.

[0069] The term "specific binding" or "specific binding" means that the binding is selective with respect to the antigen and can be distinguished from unwanted or nonspecific interactions. The ability of an antigen-binding molecule or a single variable domain to bind to a specific antigenic determinant can be measured by enzyme-linked immunosorbent assay (ELISA) or other techniques familiar to those skilled in the art, such as surface plasmon resonance (SPR) technology (analyzed on Biacore instruments).

[0070] The term "isolated" refers to a target compound (e.g., VHH, antigen-binding molecule, antibody, or nucleic acid) that has been isolated from its natural environment.

[0071] The term "epitope," or the interchangeable term "antigenic determinant," refers to any antigenic determinant on an antigen to which the complementary site of an antibody binds. Antigenic determinants typically contain chemically active surface groups of a molecule, such as amino acid or sugar side chains, and generally possess specific three-dimensional structural features and specific charge characteristics. For example, an epitope typically comprises at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive or discontinuous amino acids in a unique spatial conformation; it can be a "linear" epitope or a "conformal" epitope. In a linear epitope, all points of interaction between the protein and the interacting molecule (e.g., an antibody) are linear along the primary amino acid sequence of the protein. In a conformal epitope, the points of interaction are separated by protein amino acid residues.

[0072] The term "identity" is also known as consistency. The percentage identity between two sequences is a function of the number of common positions shared by the sequences (i.e., % identity = number of common positions / total number of positions × 100), taking into account the number of gaps introduced to generate the optimal alignment of the two sequences and the length of each gap. As shown in the following non-limiting examples, mathematical algorithms can be used to compare sequences and determine the percentage identity between them. The percentage identity between two amino acid sequences can be determined using the algorithm of E. Meyers and W. Miller (Comput. Appl. Biosci., 4:11-17 (1988)), which is included in the ALIGN program (version 2.0) and uses the PAM120 residue weighting table with a gap length penalty of 12 and a gap penalty of 4. In addition, the percentage identity of two amino acid sequences can be determined using the Needleman and Wunsch algorithm (J.Mol.Biol.484-453(1970)), which has been incorporated into the GAP program in the GCG software package (available at www.gcg.com), using a Blossum 62 matrix or a PAM250 matrix with gap weights of 16, 14, 12, 10, 8, 6 or 4 and length weights of 1, 2, 3, 4, 5 or 6.

[0073] As used herein, “about” means within the range of acceptable error for a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, “about” in practice in the art may mean within one or more standard deviations. Alternatively, “about” may mean a range of up to 5% (i.e., ±5%), such as fluctuations within ±2%, ±1%, or ±0.5% of a given specific numerical range. Furthermore, particularly for biological systems or methods, the term may mean up to an order of magnitude or up to five times a certain value. When a specific value is given in this application or claim, unless otherwise stated, “about” should be understood as meaning within the acceptable range of error for that specific value.

[0074] In this document, unless otherwise stated, the term “comprising” or its equivalents (e.g., containing, including, etc.) are open-ended terms, meaning including but not limited to the specified elements, steps, or components, but open to any unspecified elements, steps, or components.

[0075] In this document, unless otherwise stated, singular terms cover the plural referents, and vice versa.

[0076] For purposes of description and disclosure, all patents, patent applications, and other identified publications are expressly incorporated herein by reference. These publications are provided solely because their publication predates the filing date of this application. All statements regarding the dates of these documents or descriptions of their contents are based on information available to the applicant and do not constitute any acknowledgment of the accuracy of the dates or contents of these documents. Furthermore, in any country, any reference to these publications herein does not constitute an endorsement that such publication is part of the general knowledge in the art. Various aspects of the invention will be described in further detail in the following sections.

[0077] Single variable structure domain

[0078] One aspect of the invention provides a segregated single variable domain that binds to BCMA (such as human BCMA). The single variable domain provides more available options for the development or construction of drugs targeting BCMA. The single variable domain possesses numerous desired therapeutic properties, such as good affinity for human BCMA and the ability to block the binding of the proliferation-inducing ligand APRIL to BCMA. In particular, in some embodiments, the single variable domain does not bind to human TACI and BAFFR proteins, exhibiting specificity; in some embodiments, it cross-reacts with monkey BCMA, and since monkeys are ideal experimental animals for drug toxicology studies, cross-reactivity with monkeys will facilitate the conduct of drug toxicology experiments.

[0079] In some embodiments, a single variable structural domain combined with BCMA is provided, comprising one, two, or all three CDRs of the single variable structural domain shown in SEQ ID NO:19. In one specific embodiment, a single variable structural domain combined with BCMA is provided, comprising CDR1, CDR2, and CDR3 of the single variable structural domain shown in SEQ ID NO:19. In some embodiments, a single variable structural domain combined with BCMA is provided, comprising one, two, or all three CDRs of the single variable structural domain shown in SEQ ID NO:21. In one specific embodiment, a single variable structural domain combined with BCMA is provided, comprising CDR1, CDR2, and CDR3 of the single variable structural domain shown in SEQ ID NO:21. In some embodiments, a single variable structural domain combined with BCMA is provided, comprising one, two, or all three CDRs of the single variable structural domain shown in SEQ ID NO:23. In one specific embodiment, a single variable structural domain combined with BCMA is provided, comprising CDR1, CDR2, and CDR3 of the single variable structural domain shown in SEQ ID NO:23. In some embodiments, a BCMA-binding single variable domain is provided, comprising one, two, or all three CDRs of the single variable domain shown in SEQ ID NO:25. In one specific embodiment, a BCMA-binding single variable domain is provided, comprising CDR1, CDR2, and CDR3 of the single variable domain shown in SEQ ID NO:25. In some embodiments, the single variable domain is of camel origin. In some embodiments, the single variable domain is humanized. In some embodiments, the single variable domain comprises a recipient human frame.

[0080] In some embodiments, a single variable domain for binding BCMA is provided, comprising at least one, at least two, or all three CDRs selected from: (a) CDR1 comprising an amino acid sequence selected from SEQ ID NO:7, 10, 13, and 16; (b) CDR2 comprising an amino acid sequence selected from SEQ ID NO:8, 11, 14, and 17; and (c) CDR3 comprising an amino acid sequence selected from SEQ ID NO:9, 12, 15, and 18. In some embodiments, the single variable domain is of camel origin. In some embodiments, the single variable domain is humanized. In some embodiments, the single variable domain comprises a recipient human frame.

[0081] In some embodiments, a single variable domain for binding BCMA is provided comprising three CDRs (CDR1, CDR2, and CDR3), said CDRs including: (a) CDR1 having sequence identity with an amino acid sequence selected from SEQ ID NO:7, 10, 13, and 16 of at least about 70%, about 75%, about 80%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%; (b) CDR1 having sequence identity with an amino acid sequence selected from SEQ ID NO:7, 10, 13, and 16 of at least 70%, about 75%, about 80%, about 85%, about 86%, about 97%, about 98%, about 99%, or about 100%; CDR2 having at least about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% sequence identity with the amino acid sequences selected from SEQ ID NO: 9, 12, 15, and 18; and (c) CDR3 having at least about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% sequence identity with the amino acid sequences selected from SEQ ID NO: 9, 12, 15, and 18. In some specific embodiments, a single variable domain for binding BCMA is provided comprising three CDRs (CDR1, CDR2, and CDR3), wherein the CDRs include: (a) CDR1 having sequence identity with the amino acid sequence of SEQ ID NO:7 of at least about 70%, about 75%, about 80%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%; (b) CDR1 having sequence identity with the amino acid sequence of SEQ ID NO:7 ... CDR2 having at least about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% sequence identity with the amino acid sequence of SEQ ID NO:9; and (c) CDR3 having at least about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% sequence identity with the amino acid sequence of SEQ ID NO:9.In some specific embodiments, a single variable domain for binding BCMA is provided comprising three CDRs (CDR1, CDR2, and CDR3), wherein the CDRs include: (a) CDR1 having sequence identity with the amino acid sequence of SEQ ID NO:10 of at least about 70%, about 75%, about 80%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%; (b) CDR1 having sequence identity with the amino acid sequence of SEQ ID NO:10 ... CDR2 having at least about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% sequence identity with the amino acid sequence of SEQ ID NO:11; and (c) CDR3 having at least about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% sequence identity with the amino acid sequence of SEQ ID NO:12. In some specific embodiments, a single variable domain for binding BCMA is provided comprising three CDRs (CDR1, CDR2, and CDR3), wherein the CDRs include: (a) CDR1 having sequence identity with the amino acid sequence of SEQ ID NO:13 of at least about 70%, about 75%, about 80%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%; (b) CDR1 having sequence identity with the amino acid sequence of SEQ ID NO:13 ... CDR2 having at least about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% sequence identity with the amino acid sequence of SEQ ID NO:14; and (c) CDR3 having at least about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% sequence identity with the amino acid sequence of SEQ ID NO:15.In some specific embodiments, a single variable domain for binding BCMA is provided comprising three CDRs (CDR1, CDR2, and CDR3), said CDRs including: (a) CDR1 having sequence identity with the amino acid sequence of SEQ ID NO:16 of at least about 70%, about 75%, about 80%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%; (b) CDR1 having sequence identity with the amino acid sequence of SEQ ID NO:16 ... CDR2 having at least about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% sequence identity with the amino acid sequence of SEQ ID NO:18; and (c) CDR3 having at least about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% sequence identity with the amino acid sequence of SEQ ID NO:18. In some embodiments, a CDR having at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the reference sequence contains substitutions (e.g., conservative substitutions), insertions, or deletions, but the single variable domain containing the sequence retains the ability to bind to the BCMA. In some embodiments, a single variable domain comprising three CDRs (CDR1, CDR2, and CDR3) is provided, wherein the CDRs include: (a) CDR1 having about one or about two amino acid substitutions (e.g., conserved substitutions), insertions, or deletions compared to amino acid sequences selected from SEQ ID NO:7, 10, 13, and 16; (b) CDR2 having about one, about two, or about three amino acid substitutions (e.g., conserved substitutions), insertions, or deletions compared to amino acid sequences selected from SEQ ID NO:8, 11, 14, and 17; and (c) CDR3 having about one, about two, or about three amino acid substitutions (e.g., conserved substitutions), insertions, or deletions compared to amino acid sequences selected from SEQ ID NO:9, 12, 15, and 18. In some embodiments, the single variable domain is affinity-matured. In some embodiments, the single variable domain is from camelids. In some embodiments, the single variable domain is humanized. In some implementations, a single variable domain contains the recipient human framework.

[0082] In some embodiments, a single variable domain for binding BCMA is provided, comprising three CDRs (CDR1, CDR2, and CDR3), wherein the CDRs include: CDR1 comprising the amino acid sequence of SEQ ID NO:7; CDR2 comprising the amino acid sequence of SEQ ID NO:8; and CDR3 comprising the amino acid sequence of SEQ ID NO:9. In some embodiments, a single variable domain for binding BCMA is provided, comprising three CDRs (CDR1, CDR2, and CDR3), wherein the CDRs include: CDR1 comprising the amino acid sequence of SEQ ID NO:10; CDR2 comprising the amino acid sequence of SEQ ID NO:11; and CDR3 comprising the amino acid sequence of SEQ ID NO:12. In some embodiments, a single variable domain for binding BCMA is provided, comprising three CDRs (CDR1, CDR2, and CDR3), wherein the CDRs include: CDR1 comprising the amino acid sequence of SEQ ID NO:13; CDR2 comprising the amino acid sequence of SEQ ID NO:14; and CDR3 comprising the amino acid sequence of SEQ ID NO:15. In some embodiments, a single variable domain for binding BCMA is provided, comprising three CDRs (CDR1, CDR2, and CDR3), wherein the CDRs include: CDR1 comprising the amino acid sequence of SEQ ID NO: 16; CDR2 comprising the amino acid sequence of SEQ ID NO: 17; and CDR3 comprising the amino acid sequence of SEQ ID NO: 18. In some embodiments, the single variable domain is of camel origin. In some embodiments, the single variable domain is humanized. In some embodiments, the single variable domain comprises a recipient human frame.

[0083] In some embodiments, the single variable domain (including any of the embodiments described above, such as the single variable domain containing a specific CDR1, CDR2, and / or CDR3) contains a V sequence identity with an amino acid sequence selected from SEQ ID NO: 19, 21, 23, and 25 having at least about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% of that sequence. HH. In some specific embodiments, the single variable domain (including any of the embodiments described above, such as the single variable domain containing a specific CDR1, CDR2, and / or CDR3) contains a sequence identity with an amino acid sequence selected from SEQ ID NO:19 having at least about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% of that sequence. H H. In some specific embodiments, the single variable domain (including any of the embodiments described above, such as the single variable domain containing a specific CDR1, CDR2, and / or CDR3) contains a sequence identity with the amino acid sequence of SEQ ID NO:21 having at least about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% of that sequence. H H. In some specific embodiments, the single variable domain (including any of the embodiments described above, such as the single variable domain containing a specific CDR1, CDR2, and / or CDR3) contains a sequence identity with the amino acid sequence of SEQ ID NO:23 having at least about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% of that sequence. H H domain. In some specific embodiments, the single variable domain (including any of the embodiments described above, such as the single variable domain containing a specific CDR1, CDR2, and / or CDR3) comprises a V domain having sequence identity with the amino acid sequence of SEQ ID NO:25 of at least about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% of that sequence. H H. In some more specific embodiments, the single variable domain comprises a V having sequence identity with the amino acid sequence of SEQ ID NO:19 having at least 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%. H H, and V HH includes: CDR1 containing the amino acid sequence of SEQ ID NO: 7, CDR2 containing the amino acid sequence of SEQ ID NO: 8, and CDR3 containing the amino acid sequence of SEQ ID NO: 9. In some more specific embodiments, the single variable domain includes V having sequence identity with the amino acid sequence of SEQ ID NO: 21 of at least 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%. H H, and V H H includes: CDR1 comprising the amino acid sequence of SEQ ID NO: 10, CDR2 comprising the amino acid sequence of SEQ ID NO: 11, and CDR3 comprising the amino acid sequence of SEQ ID NO: 12. In some more specific embodiments, the single variable domain comprises V having sequence identity with the amino acid sequence of SEQ ID NO: 23 having at least 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%. H H, and V H H includes: CDR1 comprising the amino acid sequence of SEQ ID NO: 13, CDR2 comprising the amino acid sequence of SEQ ID NO: 14, and CDR3 comprising the amino acid sequence of SEQ ID NO: 15. In some more specific embodiments, the single variable domain comprises V having sequence identity with the amino acid sequence of SEQ ID NO: 25 having at least 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%. H H, and V H H includes: CDR1 containing the amino acid sequence of SEQ ID NO: 16, CDR2 containing the amino acid sequence of SEQ ID NO: 17, and CDR3 containing the amino acid sequence of SEQ ID NO: 18. In some embodiments, V has an identity of at least 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99%. HThe H sequence contains substitutions (e.g., conserved substitutions), insertions, or deletions relative to the reference sequence, but the single variable domain containing this sequence retains the ability to bind to BCMA. In some embodiments, a total of 1-18, 1-16, 1-14, 1-12, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, or 1-2 amino acids are substituted, inserted, and / or deleted in the amino acid sequences selected from SEQ ID NO: 19, 21, 23, and 25. In some embodiments, the substitution, insertion, or deletion occurs in regions outside the CDR (i.e., in the FR). In some embodiments, the substitution, insertion, or deletion occurs in the CDR region, for example, one, two, or three of CDR1, CDR2, and CDR3. In some embodiments, the substitution, insertion, or deletion occurs in both CDR and non-CDR regions. Optionally, the single variable domain contains an amino acid sequence selected from SEQ ID NO: 19, 21, 23, and 25, including post-translational modifications of that sequence.

[0084] In some embodiments, a V sequence comprising the amino acid sequence of SEQ ID NO: 19, 21, 23, or 25 is provided. H H is a separated single variable structural domain.

[0085] In some embodiments, the single variable structural domain (including any of the embodiments described above, such as the single variable structural domain containing specific CDR1, CDR2, and / or CDR3) is V H H. Basic V H H has the following structure from the N-terminus to the C-terminus: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4, where FR1 to FR4 refer to frame regions 1 to 4 respectively, and CDR1 to CDR3 refer to complementarity-determining regions 1 to 3.

[0086] In some implementations, the single variable structural domain (including any of the above implementations, such as the single variable structural domain containing specific CDR1, CDR2, and / or CDR3) is an artificial V H H. A non-human single variable domain can be "humanized" by replacing one or more amino acid residues in the original single variable domain sequence with one or more amino acid residues present at the corresponding position in the VH domain of a conventional human 4-chain antibody. Humanization can be expected to reduce immunogenicity.

[0087] In some implementations, the single variable structural domain according to any of the above implementations may individually or in combination include one or more of the following properties:

[0088] (i) Combined with human BCMA;

[0089] (ii) Combined with monkey BCMA;

[0090] (iii) Block the binding of APRIL to BCMA; or

[0091] (iv) It does not bind to human TACI or / and BAFFR proteins.

[0092] In some embodiments, the single variable domain is combined with human BCMA. In some embodiments, the single variable domain is combined with human BCMA and monkey BCMA, such as cynomolgus monkey BCMA.

[0093] In some implementations, the single variable domain blocks the binding of APRIL and BCMA.

[0094] In some implementations, the single variable domain does not bind to human TACI and / or BAFFR proteins, exhibiting good specificity.

[0095] In some embodiments, the single variable structural domain combines the aforementioned properties (i)-(ii). In some embodiments, the single variable structural domain combines the aforementioned properties (i) and (iii); in some embodiments, the single variable structural domain combines the aforementioned properties (i), (iii), and (iv); in some embodiments, the single variable structural domain combines the aforementioned properties (i)-(iv).

[0096] In some embodiments, the present invention provides a single variable domain that binds to the same epitope as any of the single variable domains described herein. In some specific embodiments, a single variable domain that binds to the same epitope as a single variable domain comprising the amino acid sequence of SEQ ID NO: 19, 21, 23, or 25 is provided. In some embodiments, the single variable domain binding the same epitope is of camel origin or humanized.

[0097] Conventional techniques known to those skilled in the art can be used to competitively screen for binding to the same epitope. For example, competitive and cross-competitive studies can be performed to obtain single variable domains that compete or cross-competitively bind to the antigen. Therefore, in some embodiments, the present invention provides a single variable domain that competes with any of the single variable domains described herein for binding to BCMA. In some specific embodiments, a single variable domain that competes with a single variable domain containing the amino acid sequence of SEQ ID NO: 19, 21, 23, or 25 for binding to BCMA is provided. Binding to BCMA can be measured by ELISA, flow cytometry, surface plasmon resonance (SPR) assay, or any other method known in the art. In some embodiments, the single variable domain that competes for binding to BCMA is of camel origin or humanized.

[0098] This invention provides several exemplary single variable domains that bind BCMA. The amino acid sequences of the exemplary single variable domain CDRs (CDR1, CDR2, and CDR3) provided herein are given in Table S2 below. The full-length amino acid sequences of the exemplary single variable domains are given in Table S3 below.

[0099] Table S2: CDR sequence of a single variable domain

[0100]

[0101] Table S3: Full-length sequence of single variable domains

[0102]

[0103] antigen-binding molecules

[0104] The single variable domain of the present invention can be used to construct any desired antigen-binding molecule, thereby endowing the antigen-binding molecule with the property of targeting BCMA or other properties of the single variable domain. Therefore, the present invention provides isolated antigen-binding molecules comprising at least one (or more) of the single variable domain of the present invention.

[0105] In some embodiments, the antigen-binding molecule comprises at least one single variable domain, wherein the single variable domain comprises CDR1, CDR2, and CDR3 selected from any one of the following:

[0106] (i) CDR1 shown in SEQ ID NO: 7, CDR2 shown in SEQ ID NO: 8, and CDR3 shown in SEQ ID NO: 9;

[0107] (ii) CDR1 shown in SEQ ID NO: 10, CDR2 shown in SEQ ID NO: 11, and CDR3 shown in SEQ ID NO: 12;

[0108] (iii) CDR1 shown in SEQ ID NO: 13, CDR2 shown in SEQ ID NO: 14, and CDR3 shown in SEQ ID NO: 15; or

[0109] (iv) CDR1 shown in SEQ ID NO: 16, CDR2 shown in SEQ ID NO: 17, and CDR3 shown in SEQ ID NO: 18.

[0110] In some embodiments, the single variable domain comprises the amino acid sequence shown in SEQ ID NO: 19, 21, 23, or 25. In some more specific embodiments, the amino acid sequence of the single variable domain is as shown in SEQ ID NO: 19, 21, 23, or 25.

[0111] When an antigen-binding molecule contains two or more single variable domains, the same or different single variable domains can be selected.

[0112] The antigen-binding molecule includes antibodies, monospecific antibodies, multispecific antibodies, or immunoconjugates. In one embodiment, the antigen-binding molecule is an antibody. As a specific example, the antibody is a monospecific antibody; as another specific example, the antibody is a bispecific antibody. In one embodiment, the antibody or immunoconjugate contains an immunoglobulin constant region. In a more specific embodiment, the antibody or immunoconjugate contains human immunoglobulin Fc. Preferably, the Fc is the Fc of human IgG1, IgG2, IgG3, or IgG4.

[0113] In some implementations, the antigen-binding molecule is camel-derived, chimeric, or humanized.

[0114] In some embodiments, the antigen-binding molecule according to any of the above embodiments may include, alone or in combination, one or more of the following properties:

[0115] (i) Combined with human BCMA;

[0116] (ii) Combined with monkey BCMA;

[0117] (iii) Block the binding of APRIL to BCMA; or

[0118] (iv) It does not bind to human TACI or / and BAFFR proteins.

[0119] In some embodiments, the antigen-binding molecule binds to human BCMA. In some embodiments, the antigen-binding molecule has a binding affinity (KD) to human BCMA in the range of about 1E-12M to about 1E-08M, about 1E-11M to about 1E-08M, about 8.12E-10M to about 1.29E-10M, or about 8.12E-10M to about 3.13E-10M. In some embodiments, the antigen-binding molecule has a binding affinity (KD) to human BCMA in the range of about 1E-08M or less, about 1E-09M or less, about 8.12E-10M or less, about 6.49E-10M or less, about 3.13E-10M or less, or about 1.29E-10M or less. In some embodiments, the binding affinity KD of the antigen-binding molecule provided herein is measured using Biacore.

[0120] In some embodiments, the antigen-binding molecule binds to both human BCMA and monkey BCMA. For example, 1A10 single variable domain, 1A11 single variable domain, 1A10-Fc, and 1A11-Fc not only have good affinity for human BCMA but also bind to cynomolgus monkey BCMA. This cross-reactivity with monkey BCMA will facilitate the conduct and implementation of drug toxicology experiments.

[0121] In some implementations, the antigen-binding molecule blocks the binding of APRIL to BCMA.

[0122] In some embodiments, the antigen-binding molecule does not bind to human TACI and / or BAFFR proteins, exhibiting good specificity.

[0123] In some embodiments, the antigen-binding molecule combines the aforementioned properties (i)-(ii). In some embodiments, the antigen-binding molecule combines the aforementioned properties (i) and (iii); in some embodiments, the antigen-binding molecule combines the aforementioned properties (i), (iii), and (iv); in some embodiments, the antigen-binding molecule combines the aforementioned properties (i)-(iv).

[0124] This invention provides exemplary antigen-binding molecules, such as monospecific antibodies (including 1A1-Fc, 1A10-Fc, 1A11-Fc, and 1B10-Fc antibodies), which fuse a single variable domain with the Fc of human IgG1 to form a homodimer via the Fc. The amino acid sequences of exemplary monospecific antibodies are provided in Table S4 below.

[0125] Table S4: Full-length sequences of exemplary antigen-binding molecules

[0126]

[0127]

[0128] Composition

[0129] This invention provides pharmaceutical compositions comprising an active ingredient and a pharmaceutically acceptable carrier, wherein the active ingredient is a single variable domain as described herein or an antigen-binding molecule as described herein. In some embodiments, the pharmaceutical composition is formulated from any one or more of 1A1-Fc, 1A10-Fc, 1A11-Fc, and 1B10-Fc antibodies and a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers include, for example, excipients, diluents, encapsulating materials, fillers, buffers, or other reagents.

[0130] isolated nucleic acids

[0131] This invention provides isolated nucleic acids encoding a single variable domain or an antigen-binding molecule as described herein. In some embodiments, the nucleic acid encodes a single variable domain, such as 1A1-Fc, 1A10-Fc, 1A11-Fc, or 1B10-Fc. In some embodiments, the nucleic acid encodes an antigen-binding molecule, such as 1A1-Fc, 1A10-Fc, 1A11-Fc, or 1B10-Fc. The sequence listing provides exemplary examples of nucleic acid sequences with single variable domains and antigen-binding molecules.

[0132] carrier

[0133] This invention provides a vector comprising the isolated nucleic acid described herein. In some embodiments, the vector is a cloning vector; in other embodiments, the vector is an expression vector. The expression vector may be any expression vector capable of expressing the single variable domain or antigen-binding molecule described herein; a specific example is pcDNA3.1.

[0134] host cells

[0135] In some embodiments, this document provides a host cell comprising the vector described herein, the host cell being a suitable host cell for cloning or expressing a single variable domain or antigen-binding molecule. In some embodiments, the host cell is a prokaryotic cell. In other embodiments, the host cell is a eukaryotic cell. In some embodiments, the host cell is selected from yeast cells, mammalian cells, or other cells suitable for preparing antigen-binding molecules. Mammalian cells, for example, are Chinese hamster ovary (CHO) cells or CHO-S cells.

[0136] Methods for preparing single variable domain or antigen-binding molecules

[0137] In some embodiments, this document provides a method for preparing a single variable domain, the method comprising: culturing a host cell containing a nucleic acid encoding a single variable domain described herein, and recovering the single variable domain from the host cell or a host cell culture medium. In some embodiments, this document provides a method for preparing an antigen-binding molecule, the method comprising: culturing a host cell containing a nucleic acid encoding an antigen-binding molecule described herein, and recovering the antigen-binding molecule from the host cell or a host cell culture medium.

[0138] To generate the aforementioned single variable domain or antigen-binding molecule, a nucleic acid encoding the single variable domain or antigen-binding molecule is inserted into a vector for further cloning and / or expression in host cells. The nucleic acid can be obtained using various methods well-known in the art, such as gene splicing and chemical synthesis.

[0139] use

[0140] This invention provides the use of a single variable domain or antigen-binding molecule.

[0141] This invention provides a method for treating a subject with a BCMA-expressing tumor, comprising administering to the subject a therapeutically effective amount of the single variable domain, the antigen-binding molecule, or the composition described herein. Subjects requiring treatment include those who already have a disease or condition, and those who may develop a disease or condition and whose aim is to prevent, delay, or reduce the disease or condition. This invention also provides the use of the single variable domain, the antigen-binding molecule, or the composition described herein in the preparation of a medicament for treating a subject with a BCMA-expressing tumor.

[0142] This invention provides a method for inhibiting, reducing, or blocking BCMA signaling in cells, comprising administering an effective amount of the single variable domain, the antigen-binding molecule, or the composition described herein to the cells. This invention also provides the use of the single variable domain or antigen-binding molecule in the preparation of a medicament for inhibiting, reducing, or blocking BCMA signaling in cells. In some embodiments, the cells are tumor cells.

[0143] This invention provides a method for killing or inhibiting the growth of BCMA-expressing tumor cells, comprising contacting the tumor cells with a single variable domain, an antigen-binding molecule, or a composition described herein. This invention also provides the use of the single variable domain, the antigen-binding molecule, or the composition described herein in the preparation of a medicament for killing or inhibiting the growth of BCMA-expressing tumor cells.

[0144] The tumors mentioned above can be B-cell malignancies, such as lymphoma, myeloma, multiple myeloma, or leukemia.

[0145] This invention provides a method for treating a subject with an autoimmune disease, comprising administering to the subject a therapeutically effective amount of the single variable domain, the antigen-binding molecule, or the composition described herein. This invention also provides the use of the single variable domain, the antigen-binding molecule, or the composition described herein in the preparation of a medicament for treating a subject with an autoimmune disease. The autoimmune disease may be systemic lupus erythematosus.

[0146] In some embodiments, methods for detecting or measuring BCMA in a sample are provided, which include contacting the sample with a single variable domain or antigen-binding molecule as described herein and detecting or measuring the binding complex.

[0147] Although the foregoing invention has been described in considerable detail by way of example and embodiments for clarity of understanding, it will be apparent to those skilled in the art, based on the teachings of the invention, that certain changes and modifications may be made to the invention without departing from the spirit and scope of the appended claims. The following embodiments are provided by way of illustration only and are not intended to be limiting. Those skilled in the art will readily identify various non-critical parameters that may be changed or modified to produce substantially similar results. Detailed Implementation

[0149] Example 1: Construction of anti-BCMA single-domain antibody phage display library

[0150] 1.1 Animal Immunization

[0151] Recombinant human BCMA-Fc fusion protein (ACRO, catalog No. BC7-H5254) was emulsified with complete Freund's adjuvant at a 1:1 volume ratio and administered as an initial subcutaneous multi-site immunization to Bactrian camels. Subsequently, booster immunizations were administered every two weeks by emulsifying recombinant human BCMA-Fc fusion protein with incomplete Freund's adjuvant at a 1:1 volume ratio. Serum titers of anti-human BCMA antibodies were measured after the fourth or fifth immunization. Peripheral blood was collected from Bactrian camels after multiple rounds of immunization, and peripheral blood mononuclear cells (PBMCs) were isolated.

[0152] 1.2 RNA extraction

[0153] Using TRIzol TM Total RNA was extracted from PBMCs (from 1.1) using reagents. The quality of the extracted total RNA was assessed by 1% agarose gel electrophoresis and quantified by measuring absorbance at 260 nm and 280 nm, OD... 260nm / OD280nm The ratio should be between 1.8 and 2.0.

[0154] 1.3 V H H amplification

[0155] PrimeScript cDNA Synthesis Kit TM II. Using the 1st Strand cDNA Synthesis Kit (TAKARA, Catalog No. 6210A), total RNA was reverse transcribed into cDNA according to the instructions. The variable region sequence of the camel antibody was amplified using nested PCR, as follows: Using cDNA as a template, a first round of PCR amplification was performed using primers Call001 (SEQ ID NO:1) and Call002 (SEQ ID NO:2). The amplified DNA product fragment was purified using a gel extraction kit (QIAGEN, Catalog No. 28706). Using the first round PCR product as a template, a second round of PCR amplification was performed using primers V-Back (SEQ ID NO:3) and V-Fwd (SEQ ID NO:4). The amplified DNA product is V... H The H-coded fragment was purified using a gel extraction kit (QIAGEN, catalog No. 28706).

[0156] Call001(SEQ ID NO:1):GTCCTGGCTGCTCTTCTACAAGG

[0157] Call002(SEQ ID NO:2):GGTACGTGCTGTTGAACTGTTCC

[0158] V-Back (SEQ ID NO:3): GATGTGCAGCTGCAGGAGTCTGGRGGAGG

[0159] V-Fwd (SEQ ID NO:4): CTAGTGCGGCCGCTGAGGAGACGGTGACCTGGGT

[0160] The PCR reaction procedure for the first and second rounds was as follows: pre-denaturation at 94℃ for 6 min, followed by denaturation at 94℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 30 s, for a total of 30 cycles, and finally extension at 72℃ for 10 min.

[0161] 1.4 V H H phage library construction

[0162] V obtained from nested PCR amplification HThe H-coding fragment was digested with PstI / NotI restriction enzymes and inserted into the phage vector pMECS (NTCC Plasmid Vector Bacterial Cell Gene Depository Center, Product Catalog No. pMECS) to construct a recombinant vector, which was then electroporated into *E. coli* TG1 (Lucigen, Product Catalog No. 60502-1). A small portion of the transformed bacterial culture was diluted and plated on a selective plate containing 100 μg / ml ampicillin. The library size was calculated by colony counting, and 100 clones were randomly selected for sequencing to assess library quality. The remaining bacterial culture was plated on a selective plate containing 100 μg / ml ampicillin. Colony growth was scraped from the plate, glycerol was added, and the culture was frozen at -80°C as the primary culture for the library. V... H The H library was amplified to the logarithmic growth phase, and M13KO7 helper phage (New England Biolabs, catalog No. N0315S) was added for further amplification. The mixture was incubated overnight at 28°C with shaking at 200 rpm. The supernatant was collected by centrifugation, and 1 / 4 volume of PEG6000 / NaCl solution (20% PEG6000 (w / v), 2.5M NaCl) was added. The mixture was incubated on ice for 1-2 hours to precipitate the phage. The phage pellet was collected by centrifugation, resuspended in PBS, and stored at -80°C with 20% glycerol as a single-domain antibody phage display library.

[0163] Example 2: Screening of anti-human BCMA single-domain antibodies

[0164] 2.1 Selection

[0165] Solid-phase panning was used to pan the single-domain antibody phage display library. Recombinant BCMA-Avitage was included. TM (ACRO, Product Catalog No. BCA-H82E4) Phages obtained in step 1.4 were immobilized on a high-adsorption ELISA plate and blocked. The phages were then added to the wells and incubated at 37°C for 1-2 hours. The plates were washed 10 times with phosphate-Tween buffer (PBST) to remove non-specifically bound phages. After PBS washing, bound phages were eluted with trypsin. The enzyme was neutralized with 4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (AEBSF). The phages were then used to infect *E. coli* TG1 for amplification and subsequent library panning. After 2-3 rounds of enrichment through panning, the collected phages were used to infect logarithmically growing *E. coli* TG1 and plated on selective plates containing 20% ​​(w / v) glucose and 100 μg / ml ampicillin. Single colonies were picked and cultured, and expression was induced with isopropyl-β-D-thiogalactoside (IPTG) to prepare the supernatant.

[0166] 2.2 Identification of positive clones

[0167] Selected clones were identified positively using an indirect ELISA method targeting human BCMA-His (ACRO, catalog No. BCA-H522y). Human BCMA-His or the control protein human Fc protein (ACRO, catalog No. FCC-H5214) was coated onto a high-adsorption ELISA plate, blocked with blocking buffer, and incubated at 37°C for 1 hour with the supernatant prepared in step 2.1. After washing, HRP-conjugated anti-HA tag secondary antibody (GenScript, catalog No. A01296) was added, and the plate was incubated at 37°C for 0.5 hours. After 5 washes, a chromogenic substrate was added for development, and the absorbance signal values ​​at 450 nm and a reference wavelength of 650 nm were detected. Positive clones that only bound to human BCMA-His and had relatively high signal values ​​were selected for preservation and sequencing. Positive clones 1A1, 1A10, 1A11, and 1B10 were obtained. Sequence analysis showed that 1A1's V... H The nucleotide sequence of H is SEQ ID NO:20, and the amino acid sequence is SEQ ID NO:19; V of 1A10 H The nucleotide sequence of H is SEQ ID NO:22, and the amino acid sequence is SEQ ID NO:21; V of 1A11 H The nucleotide sequence of H is SEQ ID NO:24, and the amino acid sequence is SEQ ID NO:23; V of 1B10 H The nucleotide sequence of H is SEQ ID NO:26, and the amino acid sequence is SEQ ID NO:25.

[0168] Example 3: Preparation of anti-human BCMA V H H-Fc chimeric antibody

[0169] 3.1 V H Preparation of H-Fc chimeric antibodies

[0170] V of the screened positive clones H The connection between the H sequence and the human Fc region is used to construct V. H H-Fc chimeric antibody. Specifically, the V obtained from sequencing in section 2.2... H H sequence or anti-human BCMA V H The H control antibody (BM) sequence (amino acid sequence identical to SEQ ID NO:125 in CN109153731A) was inserted into the pCDNA3.1 eukaryotic expression vector containing the human IgG1 constant region (amino acid sequence SEQ ID NO:5), and Expifectamine was used. TM The CHO Transfection Kit transient expression system (Thermo Fisher Scientific Inc., Catalog No. A29129) expresses these V... HH-Fc chimeric antibody (BM-Fc as control). After purification using a protein A affinity column, V was detected by an indirect ELISA method targeting human BCMA-His protein (see 3.2 for the method). H The binding activity of the H-Fc chimeric antibody to human BCMA protein was investigated, and the binding of the antibody to human TACI and BAFFR proteins was detected using surface plasmon resonance (SPR) technology (see 3.3 for the method). The results showed that 1A1-Fc, 1A10-Fc, 1A11-Fc, and 1B10-Fc specifically bound to BCMA-His protein but not to human TACI or BAFFR proteins. Sequence analysis revealed the following full-length amino acid sequence for 1A1-Fc (SEQ ID NO:27, SEQ ID NO:28); the full-length amino acid sequence for 1A10-Fc (SEQ ID NO:29, SEQ ID NO:30); the full-length amino acid sequence for 1A11-Fc (SEQ ID NO:31, SEQ ID NO:32); and the full-length amino acid sequence for 1B10-Fc (SEQ ID NO:33, SEQ ID NO:34).

[0171] 3.2 Indirect ELISA method for detecting antibody binding to human BCMA-His protein

[0172] 2 μg / ml of human BCMA-His protein (ACRO, catalog No. BCA-H522y) was coated onto a high-adsorption ELISA plate, then blocked with 3% (w / v) BSA blocking buffer. 100 μl / well of anti-human BCMA V was added as a serially diluted (initial concentration 126 nM, 5-fold serial dilutions, 7 concentrations) H H-Fc chimeric antibody was incubated at 37°C for 1 hour, washed, and then HRP-conjugated anti-human IgG Fc-tagged secondary antibody (PerkinElmer, catalog No. NEF802001EA) was added. The mixture was incubated at 37°C for 0.5 hours, washed 5 times, and then 100 μl / well of TMB substrate solution (TIANGEN, catalog No. PA107) was added for color development. The absorbance signals at 450 nm and a reference wavelength of 650 nm were detected, and the fitted curve was calculated. Figure 1 And calculate the EC50 value (Table 1).

[0173] Table 1 V H Affinity of H-Fc chimeric antibody with human BCMA-His protein

[0174]

[0175] 3.3 Surface plasmon resonance technology for detecting antibody binding to human TACI and BAFFR proteins

[0176] The specificity of the anti-human BCMA VHH-Fc chimeric antibody was detected using a biomolecular interaction analysis system (GE, Biacore T200). Amino-conjugated anti-hIgG (Fc) antibody (GE, catalog No. BR-1008-39) was added to the CM5 sensor chip and diluted with running buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4·12H2O, 1.8 mM KH2PO4, 0.05% surfactant P-20 (w / v), pH 7.4). H H-Fc chimeric antibody was diluted to 2 μg / ml and captured for 90 s at a flow rate of 30 μl / min through the experimental channel. Human TACI or BAFFR protein was diluted to 100 nM with running buffer and bound at a flow rate of 50 μl / min; the binding signal curve was observed. No binding curves were observed for 1A1-Fc, 1A10-Fc, 1A11-Fc, and 1B10-Fc, indicating they did not bind to either TACI or BAFFR protein.

[0177] Example 4 Anti-human BCMA V H Affinity of H-Fc chimeric antibody with human and cynomolgus monkey BCMA

[0178] 4.1 Surface plasmon resonance technique was used to determine the affinity of the antibody for human and cynomolgus monkey BCMA.

[0179] Anti-human BCMA V was analyzed using a biomolecular interaction analysis system (GE, Biacore T200). H Affinity detection of H-Fc chimeric antibodies. Amino-conjugated Anti-hIgG (Fc) Antibody (GE, catalog No. BR-1008-39) was added to the CM5 sensor chip. Anti-human BCMA V was diluted with running buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4·12H2O, 1.8 mM KH2PO4, 0.05% surfactant P-20 (w / v), pH 7.4). HH-Fc chimeric antibody was diluted to 1 μg / ml and captured via the experimental channel at a flow rate of 30 μl / min. Human BCMA-His (ACRO, catalog No. BCA-H522y) or cynomolgus monkey BCMA-His (ACRO, catalog No. BCA-C52H7) was diluted with run buffer to 100 nM, 50 nM, 25 nM, 12.5 nmol / L, 6.25 nM, and 3.125 nM, respectively. Binding was performed at a flow rate of 50 μl / min for 200 s, followed by dissociation at 800 s. Data was acquired in real-time using BiaControl Software 2.0 and analyzed using BiaEvaluation Software 2.0. A Langmuir 1:1 model was used to fit the data, and the binding rate constant Ka (1 / Ms), dissociation rate constant Kd (1 / s), and equilibrium constant KD (M) were calculated. The test results are shown in Table 2. 1A1-Fc, 1A10-Fc, 1A11-Fc and 1B10-Fc all have high affinity for human BCMA protein. Among them, 1A10-Fc and 1A11-Fc have cross-reactivity with cynomolgus monkey BCMA protein.

[0180] Table 2 V H Affinity of H-Fc chimeric antibody with human and cynomolgus monkey BCMA

[0181]

[0182]

[0183] 4.2 Flow cytometry determination of antibody-cell binding

[0184] Flow cytometry was used to detect anti-human BCMA V. HThe H-Fc chimeric antibody was used to bind to target cells with different BCMA expression levels. CHO-hBCMA cells (Aikon Biomedical Technology (Suzhou) Co., Ltd., Product Catalog No. AKD001A) are a stable cell line with high BCMA expression; U266 cells (Basic Medical Cell Center, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences, Product Catalog No. 3111C0001CCC000684) are a natural human myeloma cell line with moderate BCMA expression; PRMI8226 cells (Basic Medical Cell Center, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences, Product Catalog No. 3111C0001CCC000083) are a natural human myeloma cell line with low BCMA expression; and HUVEC cells (ScienCell Research Laboratories, Product Catalog No. AKD001A 8000) are a human umbilical vein endothelial cell line that does not express BCMA. The antibody was serially diluted (initial concentration 126 nM, 5-fold serial dilutions, 6 concentrations) with anti-human BCMA V. H H-Fc chimeric antibody incubation for 2×10 5 Target cells were incubated on ice for 1 hour, then washed and incubated on ice for 0.5 hours with PE-labeled anti-human IgG Fc antibody (Jackson Immuno Research, catalog No. 109-116-170). After washing the cells, they were analyzed using a flow cytometer (Thermo Fisher Scientific Inc., Attune NXT).

[0185] like Figures 2A-2C As shown in Table 3, 1A1-Fc, 1A10-Fc, 1A11-Fc, and 1B10-Fc can all effectively target and bind to CHO-hBCMA cells with high BCMA expression levels and U266 cells with moderate BCMA expression levels. They also show significant binding with RPMI8226 cells with low BCMA expression levels. 1A10-Fc and 1A11-Fc bind to U266 cells more effectively than BM-Fc. Figure 2D As shown, 1A10-Fc and 1A11-Fc did not bind to HUVEC cells that do not express BCMA, but 1A1-Fc and 1B10-Fc did bind to HUVEC cells that do not express BCMA.

[0186] Table 3 Anti-human BCMA V H Affinity of H-Fc chimeric antibodies to target cells

[0187]

[0188] 4.3 Flow cytometry assay to determine the binding of antibodies to HEK293T cells transiently transfected with cynomolgus monkeys (BCMA)

[0189] The full-length BCMA gene (SEQ ID NO:6) from cynomolgus monkeys was synthesized in vitro and inserted into the pCDNA3.1 eukaryotic expression vector. Lipofectamine was used according to the manufacturer's protocol. TM The expression vector was transfected into HEK293T cells using a 3000 (Thermo Fisher Scientific Inc., Catalog No. L3000015) method. In short, HEK293T cells were transfected at a rate of 5 × 10⁻⁶ cells / year. 5 Cells were seeded into 6-well plates. After approximately 24 hours, the culture medium containing fetal bovine serum was aspirated and the cells were washed with PBS. Transfection reagent was then added to each well at a ratio of 5 μg DNA to 7.5 μl Lipo3000. After approximately 6 hours, the medium was replaced with one containing 10% fetal bovine serum (v / v). Cells were harvested for flow cytometry analysis approximately 24 hours after transfection.

[0190] The 1A10-Fc, 1A11-Fc, and BM-Fc antibodies were serially diluted (initial concentration 126 nM, 5-fold serial dilution, 5 concentrations; sample dilution buffer served as a negative control). Each was incubated for 2 × 10⁻⁶ days. 5 Transfected cynomolgus monkey BCMA and untransfected HEK293T cells were incubated on ice for 1 hour, then washed and incubated on ice for 0.5 hours with PE-labeled anti-human IgG Fc antibody (Jackson ImmunoResearch, catalog No. 109-116-170). After washing, the cells were analyzed by flow cytometry (Thermo Fisher Scientific Inc., Attune NXT). Figure 3A HEK293T cells (HEK293T-CynoBCMA) were transiently transfected with cynomolgus monkey BCMA. Figure 3B Using HEK293T cells untransfected with cynomolgus monkey BCMA, Table 4 shows the EC50 and maximum binding MFI (Bmax) values ​​of the Fc chimeric antibody binding to HEK293T cells transiently transfected with cynomolgus monkey BCMA. The results indicate that 1A10-Fc and 1A11-Fc antibodies bind to cynomolgus monkey BCMA in the cells, while the BM-Fc antibody does not bind to cynomolgus monkey BCMA.

[0191] Table 4 Anti-human BCMA V H Binding of H-Fc chimeric antibody to HEK293T cells transiently transfected from cynomolgus monkeys (BCMA)

[0192]

[0193] Example 5 Anti-human BCMA V H H-Fc chimeric antibody blocks the binding of APRIL to BCMA.

[0194] The anti-human BCMA V was serially diluted (initial concentration 252 nM, 5-fold serial dilution, 7 concentrations). H H-Fc chimeric antibodies 1A10-Fc and 1A11-Fc were mixed with 100 ng / ml biotin-conjugated recombinant BCMA-His protein (ACRO, catalog No. BCA-H522y) at a 1:1 volume ratio and incubated at room temperature for 1 hour. The mixture was then added to an ELISA plate immobilized with recombinant APRIL protein (ACRO, catalog No. APL-H5244). A control group containing only 50 ng / ml biotin-conjugated recombinant BCMA-His protein was also included. The plate was incubated at 37°C for 1 hour. Unbound biotin-conjugated BCMA-His protein was washed away, and HRP-conjugated streptavidin (eBioscience, catalog No. 18-4100-51) was added. After washing the plate five times, color development was performed. The absorbance signals at 450 nm and a reference wavelength of 650 nm were measured. The binding amount of each antibody at each concentration was calculated using the formula: Binding Amount = Sample Signal Value / Control Group Signal Value × 100%, and curve fitting was performed. The results are as follows: Figure 4 As shown in Table 5, 1A1-Fc, 1B10-Fc, 1A10-Fc and 1A11-Fc can all effectively block the binding of APRIL to BCMA.

[0195] like Figure 5A As shown, the amino acid sequences that differ between the human BCMA extracellular region and the cynomolgus monkey BCMA extracellular region are Gly6, Ala20, Ile22, Asn31, Val45, and Thr52. Clones 1A10 and 1A11 cross-react with cynomolgus monkey BCMA protein, suggesting that the possible epitopes of these two clones are located at Gln7–His19, and / or Pro23–Ser30, and / or Asn31–Ser44, and / or Thr46–Gly51. Figure 5B This is the extracellular region structure of human BCMA from the PDB database (PDB number: 2kn1). Figure 5A , 5B As shown, the extracellular region of human BCMA contains three pairs of disulfide bonds, namely Cys8-Cys21, Cys24-Cys37 and Cys28-Cys41; human BCMA mainly binds to APRIL on the β-hairpin structure (Bossen, C. et al. Semin. Immunol. 2006, 18(5):263-275). Based on this, it is speculated that the main binding sites of clones 1A10-Fc and 1A11-Fc are between Gln7 and His19, and / or between Pro23 and Ser30, and / or between Asn31 and Ser44.

[0196] Table 5 Anti-human BCMA V H H-Fc blocks the binding of APRIL to BCMA.

[0197]

[0198] Example 6 Anti-human BCMA V H Epitope Differences Among Different Clones

[0199] 6.1 ELISA (Checkerboard Method) Detection of Anti-human BCMA V H Competition among different clones

[0200] BCMA V H The H-Fc chimeric antibody was diluted to 2 μg / ml, coated onto a high-adsorption ELISA plate, washed, and then blocked; 20 μg / ml of human BCMA V was added. H H-Fc chimeric antibody and biotin-conjugated BCMA-His protein (ACRO, catalog No. BCA-H522y) were incubated at room temperature for 0.5 hours to obtain an antigen-antibody mixture. Following a checkerboard pattern, the incubated antibody-antigen mixture or biotin-conjugated BCMA-His protein alone (control group) was added sequentially at 100 μl / well to a plate and incubated at 37°C for 1 hour. Unbound biotin-conjugated BCMA-His protein was washed away, and HRP-conjugated streptavidin (eBioscience, catalog No. 18-4100-51) was added. After washing the plate 5 times, color development was performed. The absorbance signal values ​​at 450 nm and 650 nm reference wavelength were detected. The blocking rate of one antibody against the binding signal of another antibody to BCMA-Bio was calculated using the formula: Blocking rate = (Control group signal value - Sample group signal value) / Control group signal value × 100%. The results are shown in Table 6. The diagonal positions of the "\" in the chessboard (marked in gray) represent the positive control groups where antibodies competed against each other, with blocking rates all exceeding 99%. The blocking rate of 1A10-Fc against the binding of 1A11-Fc to human BCMA (32.6%) was less than 50%, and the blocking rate of 1A11-Fc against the binding of 1A10-Fc to human BCMA (21.6%) was also less than 50%, indicating that there was no significant competition between 1A10-Fc and 1A11-Fc, suggesting that 1A10-Fc and 1A11-Fc can simultaneously bind to different epitopes of the BCMA protein. Similarly, there was no significant competition between 1A10-Fc and 1A1-Fc, or between 1A10-Fc and 1B10-Fc, indicating that 1A10-Fc and 1A1-Fc can simultaneously bind to different epitopes of the BCMA protein, and 1A10-Fc and 1B10 can simultaneously bind to different epitopes of the BCMA protein. The blocking rates of 1A1-Fc, 1A11-Fc and 1B10-Fc all exceed 99%.

[0201] Table 6. ELISA (Chessboard Method) Epitope Competition

[0202] Chessboard Method 1A1-Fc 1A10-Fc 1A11-Fc 1B10-Fc 1A1-Fc 100.1％ 7.6％ 99.4％ 101.2％ 1A10-Fc 36.9％ 100.4％ 32.6％ 46.4％ 1A11-Fc 100.6％ 21.6％ 99.7％ 99.4％ 1B10-Fc 100.3％ 26.7％ 99.5％ 100.6％

[0203] 6.2 Analysis of Epitope Differences between Surface Plasma Technology and Resonance Technology

[0204] Epitope competition analysis was performed using a biomolecular interaction analysis system (GE, Biacore T200). An amino-conjugated Anti-His Antibody (GE, Catalog No. 28995056) was added to the CM5 sensor chip. BCMA-His protein (ACRO, Catalog No. BCA-H522y) was diluted to approximately 1 μg / ml with run buffer. Capture was performed through the experimental channel at a flow rate of 30 μl / min, and the capture signal was controlled between 180 RU and 190 RU by adjusting the binding time. Anti-human BCMA V was diluted with run buffer. H H-Fc chimeric antibody V H H-Fc1 was injected to 10 μg / ml (saturation concentration, the binding signal value remained unchanged after increasing the concentration) until the signal reached the plateau. Immediately after injection, another anti-human BCMA V was injected. H H-Fc chimeric antibody V H H-Fc2. Observe the antibody binding curves and record the binding signal values ​​of the two antibodies separately. The signal value changes are shown in Table 7. The signal value of 1A10-Fc antibody reaching saturation with BCMA is 472.5 RU; when 1A11-Fc is injected at this time, the saturation signal value is 579.0 RU, which is comparable to the saturation signal value of 653.1 RU of 1A11-Fc injected alone. The reverse is also true, and the cumulative signal values ​​of the two injection sequences are comparable, indicating that 1A10-Fc and 1A11-Fc can simultaneously bind to different epitopes on the BCMA protein.

[0205] Table 7 V H H-Fc antibody SPR signal value changes and analysis

[0206]

[0207] 6.3 Flow cytometry epitope difference analysis

[0208] Because the BCMA protein expressed on the cell membrane may differ from the free protein in terms of effective epitope exposure, flow cytometry was used to further confirm whether clones 1A10 and 1A11 could simultaneously bind to the BCMA protein on the cell membrane. U266 cells were used as the target cells. 20 μg / ml or 10 μg / ml of 1A10-Fc and 1A11-Fc antibodies were individually incubated for 2 × 10⁻⁶ cells / day. 5Target cells, or mix 20 μg / ml of 1A10-Fc antibody with 20 μg / ml of 1A11-Fc antibody at a 1:1 volume ratio and incubate for 2 × 10⁻⁶ days. 5 Target cells were incubated on ice for 1 hour, then washed and incubated with PE-labeled anti-human IgG Fc antibody (Jackson ImmunoResearch, catalog No. 109-116-170). After washing, the cells were analyzed using flow cytometry (Thermo Fisher Scientific Inc., Attune NXT). The results are shown in Table 8. When the concentration of the same antibody was increased by 10 μg / ml, the mean fluorescence intensity of the 1A10-Fc sample increased by 9.5% (902.0 / 823.5-1) and the mean fluorescence intensity of the 1A11-Fc sample increased by 0.6% (702.0 / 697.5-1), indicating that both antibodies were close to saturation concentration at 10 μg / ml. Based on this, adding 10 μg / ml of different antibodies, specifically 10 μg / ml of 1A10-Fc plus 10 μg / ml of 1A11-Fc, resulted in a 75.3% increase in the average fluorescence value (1443.5 / 823.5-1 = 75.3%); adding 10 μg / ml of 1A11-Fc plus 10 μg / ml of 1A10-Fc resulted in a 107.0% increase in the average fluorescence value (1443.5 / 697.5-1 = 107.0%). This indicates that the two antibodies, 1A10-Fc and 1A11-Fc, can simultaneously bind to different epitopes of the BCMA protein on the cell membrane.

[0209] The epitope relationships of 1A1, 1A10, 1A11, and 1B10 are inferred as follows: Figure 5C As shown: the epitopes of 1A10 binding to human BCMA have no overlap or only a small overlap with the epitopes of 1A1, 1A11, and 1B10, while the epitopes of 1A1, 1A11, and 1B10 binding to human BCMA have a large or complete overlap.

[0210] Table 8. Binding of anti-human BCMA VHH chimeric antibody to U266 cells.

[0211] sequence list <110> Chia Tai Tianqing Pharmaceutical Group Co., Ltd. <120> Combining BCMA's single variable domain with antigen-binding molecules <160> 36 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> Call001 Primer Sequence <400> 1 gtcctggctg ctcttctaca agg 23 <210> 2 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> Call002 primer sequence <400> 2 ggtacgtgct gttgaactgt tcc 23 <210> 3 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> V-Back primer sequence <400> 3 gatgtgcagc tgcaggagtc tggrggagg 29 <210> 4 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> V-Fwd primer sequence <400> 4 ctagtgcggc cgctgaggag acggtgacct gggt 34 <210> 5 <211> 232 <212> PRT <213> Homo sapiens <400> 5 Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala 1 5 10 15 Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro 20 25 30 Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val 35 40 45 Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val 50 55 60 Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln 65 70 75 80 Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln 85 90 95 Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala 100 105 110 Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro 115 120 125 Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr 130 135 140 Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser 145 150 155 160 Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr 165 170 175 Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr 180 185 190 Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe 195 200 205 Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys 210 215 220 Serum Leo Serum Leo Serum Pro Gly Lys 225 230 <210> 6 <211> 183 <212> PRT <213> Macaca fascicularis (Macaca fascicularis) <400> 6 Met Leu Gln Met Ala Arg Gln Cys Ser Gln Asn Glu Tyr Phe Asp Ser 1 5 10 15 Leu Leu His Asp Cys Lys Pro Cys Gln Leu Arg Cys Ser Ser Thr Pro 20 25 30 Pro Leu Thr Cys Gln Arg Tyr Cys Asn Ala Ser Met Thr Asn Ser Val 35 40 45 Lys Gly Met Asn Ala Ile Leu Trp Thr Cys Leu Gly Leu Ser Leu Ile 50 55 60 Ile Ser Leu Ala Val Phe Val Leu Thr Phe Leu Leu Arg Lys Met Ser 65 70 75 80 Ser Glu Pro Leu Lys Asp Glu Phe Lys Asn Thr Gly Ser Gly Leu Leu 85 90 95 Gly Met Ala Asn Ile Asp Leu Glu Lys Gly Arg Thr Gly Asp Glu Ile 100 105 110 Val Leu Pro Arg Gly Leu Glu Tyr Thr Val Glu Glu Cys Thr Cys Glu 115 120 125 Asp Cys Ile Lys Asn Lys Pro Lys Val Asp Ser Asp His Cys Phe Pro 130 135 140 Leu Pro Ala Met Glu Glu Gly Ala Thr Ile Leu Val Thr Thr Lys Thr 145 150 155 160 Asn Asp Tyr Cys Asn Ser Leu Ser Ala Ala Leu Ser Val Thr Glu Ile 165 170 175 Glu Lys Ser Ile Ser Ala Arg 180 <210> 7 <211> 5 <212> PRT <213> Bactrian camel (Camelus bactrianus) <400> 7 Gly Trp Asn Lys His 1 5 <210> 8 <211> 16 <212> PRT <213> Bactrian camel (Camelus bactrianus) <400> 8 Ser Ile Phe Arg Asp Gly Lys Thr Ala Tyr Thr Asp Ser Val Lys Gly 1 5 10 15 <210> 9 <211> 10 <212> PRT <213> Bactrian camel (Camelus bactrianus) <400> 9 Asp Leu Pro Gly Ser Gly Leu Pro Ala Phe 1 5 10 <210> 10 <211> 5 <212> PRT <213> Bactrian camel (Camelus bactrianus) <400> 10 Val Ala Cys Met Ala 1 5 <210> 11 <211> 17 <212> PRT <213> Bactrian camel (Camelus bactrianus) <400> 11 Thr Ile Val Ala Asp Phe Gly Thr Thr Asn Tyr Ala Ala Ser Val Lys 1 5 10 15 Gly <210> 12 <211> 14 <212> PRT <213> Bactrian camel (Camelus bactrianus) <400> 12 Thr Gln Arg Gly Gly Ile Asp Trp Cys Asp Glu Ile Asn Tyr 1 5 10 <210> 13 <211> 5 <212> PRT <213> Bactrian camel (Camelus bactrianus) <400> 13 Ser Ala Cys Met Gly 1 5 <210> 14 <211> 17 <212> PRT <213> Bactrian camel (Camelus bactrianus) <400> 14 Arg Ile Glu Thr Gly Tyr Gly Gly Thr Val Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 15 <211> 17 <212> PRT <213> Bactrian camel (Camelus bactrianus) <400> 15 Lys Arg Ser Trp Cys Thr Pro Thr Trp Trp His Glu Leu Asp Tyr Asn 1 5 10 15 Tyr <210> 16 <211> 5 <212> PRT <213> Bactrian camel (Camelus bactrianus) <400> 16 Gly Trp Asn Lys His 1 5 <210> 17<000D764><211> 16 <212> PRT <213> Bactrian camel (Camelus bactrianus) <400> 17 Ser Ile Phe Arg Asp Gly Lys Thr Ala Tyr Thr Asp Ser Val Lys Gly 1 5 10 15 <210> 18 <211> 10 <212> PRT <213> Bactrian camel (Camelus bactrianus) <400> 18 Asp Leu Pro Gly Ser Gly Leu Pro Glu Phe 1 5 10 <210> 19 <211> 118 <212> PRT <213> Bactrian camel (Camelus bactrianus) <400> 19 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Thr Ala Ser Gly Tyr Thr Phe Arg Gly Trp 20 25 30 Asn Lys His Trp Tyr Arg Gln Ala Pro Gly Lys Glu Arg Glu Leu Val 35 40 45 Ser Ser Ile Phe Arg Asp Gly Lys Thr Ala Tyr Thr Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Gln Asp Asn Ala Asp Ala Thr Val Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr Cys Lys 85 90 95 Tyr Asp Leu Pro Gly Ser Gly Leu Pro Ala Phe Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 <210> 20 <211> 354 <212> DNA <213> Bactrian camel (Camelus bactrianus) <400> 20 caggtgcagc tggtggagtc tgggggaggc tcggtgcagg ccggagggtc tctgagactc 60 tcctgtacag cctctggata caccttcagg ggctggaaca agcactggta ccgccaggct 120 ccagggaagg agcgcgagtt ggtctcgagc atctttcgtg atgggaagac agcctataca 180 gactccgtga agggccgatt caccatctct caagacaacg ccgacgcaac ggtgtatctg 240 caaatgaaca gcctgaaacc tgaggacacg gccatgtatt actgtaaata cgatctgcct 300 ggatctggtc ttcctgcatt ctggggccag gggaccctgg tcactgtctc atca 354 <210> 21 <211> 123 <212> PRT <213> Bactrian camel (Camelus bactrianus) <400> 21 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr Ser Ser Asn Val Ala 20 25 30 Cys Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Glu Arg Glu Trp Val 35 40 45 Ala Thr Ile Val Ala Asp Phe Gly Thr Thr Asn Tyr Ala Ala Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Gln Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Ser Ala Met Tyr Tyr Cys 85 90 95 Ala Ala Thr Gln Arg Gly Gly Ile Asp Trp Cys Asp Glu Ile Asn Tyr 100 105 110 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 22 <211> 369 <212> DNA <213> Bactrian camel (Camelus bactrianus) <400> 22 caggtgcagc tggtggagtc tgggggaggc tcggtgcagg ctggagggtc gctgagactc 60 tcctgtgccg cctccggata cagcagtaat gtggcatgca tggcctggta ccgccaggct 120 ccagggaagg agcgcgagtg ggtcgcaact attgttgctg atttcggtac cacaaactat 180 gccgcctccg tgaagggccg attcaccatc tcccagaca acggcagaa cacggtgtat 240 ctgcaaatga acagcctgaa acctgaggac tctgccatgt actactgtgc ggcaacccag 300 agggggtta tgactggtg tgatgaatt aattactggg gccaggggac cctggtcact 360 gtctcatca 369 <210> 23 <211> 126 <212> PRT <213> Camelus bactrianus (Camelus bactrianus) <400> 23 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Thr Phe Asn Ser Ala 20 25 30 Cys Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val 35 40 45 Only Arg Ile Glu Thr Gly Tyr Gly Thr Val Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr Cys 85 90 95 Ala Ala Lys Arg Ser Trp Cys Thr Pro Thr Trp Trp His Glu Leu Asp 100 105 110 Tyr Asn Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 24 <211> 378 <212> DNA <213> Bactrian camel (Camelus bactrianus) <400> 24 caggtgcagc tggtggagtc tgggggaggc tcggtgcagg ctggagggtc tctgagactc 60 tcctgtgcag cctctggagt cacttttaat agcgcatgta tgggttggtt ccgccaggct 120 ccagggaagg agcgcgaggg ggtcgcacgt attgaaactg gttatggtgg cactgtctat 180 gccgactccg tgaagggacg attcaccatc tcccgagaca acgccaagaa cacggtgtat 240 ctgcaaatga acagcctaaa acctgaggac actgccatgt actactgtgc ggctaagaga 300 tcctggtgta ctcctacgtg gtggcacgaa cttgactata actactgggg acaggggacc 360 caggtcactg tctcatca 378 <210> 25 <211> 118 <212> PRT <213> Bactrian camel (Camelus bactrianus) <400> 25 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Thr Ala Ser Gly Tyr Thr Phe Arg Gly Trp 20 25 30 Asn Lys His Trp Tyr Arg Gln Ala Pro Gly Lys Glu Arg Glu Leu Val 35 40 45 Ser Ser Ile Phe Arg Asp Gly Lys Thr Ala Tyr Thr Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Gln Asp Ser Ala Asp Ala Thr Val Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr Cys Lys 85 90 95 Tyr Asp Leu Pro Gly Ser Gly Leu Pro Glu Phe Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 <210> 26 <211> 354 <212> DNA <213> Bactrian camel (Camelus bactrianus) <400> 26 gaggtgcagc tggtggagtc tgggggaggc tcggtgcagg ccggagggtc tctgagactc 60 tcctgtacag cctctggata caccttcagg ggctggaaca agcactggta ccgccaggct 120 ccagggaagg agcgcgagtt ggtctcgagt atctttcgtg atgggaagac agcctataca 180 gactccgtga agggccgatt caccatctct caagacagcg ccgacgcaac ggtgtatctg 240 caaatgaaca gcctgaaacc tgaggacacg gccatgtatt actgtaaata cgatctgcct 300 ggatctggtc ttcctgagtt ctggggccag gggaccctgg tcactgtctc atca 354 <210> 27 <211> 350 <212> PRT <213> Artificial Sequence <220> <223> Full-length amino acid sequence of 1A1-Fc <400> 27 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Thr Ala Ser Gly Tyr Thr Phe Arg Gly Trp 20 25 30 Asn Lys His Trp Tyr Arg Gln Ala Pro Gly Lys Glu Arg Glu Leu Val 35 40 45 Ser Ser Ile Phe Arg Asp Gly Lys Thr Ala Tyr Thr Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Gln Asp Asn Ala Asp Ala Thr Val Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr Cys Lys 85 90 95 Tyr Asp Leu Pro Gly Ser Gly Leu Pro Ala Phe Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser Glu Pro Lys Ser Cys Asp Lys Thr His Thr 115 120 125 Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe 130 135 140 Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro 145 150 155 160 Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val 165 170 175 Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr 180 185 190 Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val 195 200 205 Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys 210 215 220 Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser 225 230 235 240 Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro 245 250 255 Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val 260 265 270 Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly 275 280 285 Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp 290 295 300 Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp 305 310 315 320 Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His 325 330 335 Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 340 345 350 <210> 28 <211> 1050 <212> DNA <213> Artificial Sequence <220> <223> Full - length nucleotide sequence of 1A1 - Fc <400> 28 caagtgcaac tggtggagtc tggaggcggt tccgtgcagg ccggcggctc cctgagactg 60 tcctgcaccg cttccggcta caccttcaga ggctggaaca agcactggta tcggcaggct 120 cctggcaaag aaagagagct ggtgtcctcc atcttccggg acggcaagac cgcctacacc 180 gactccgtga agggcagatt caccatctct caggacaacg ccgacgccac agtgtacctg 240 cagatgaact ctctgaagcc cgaggacacc gccatgtact actgcaagta cgacctgcct 300 ggatctggcc tgcccgcctt ctggggccaa ggcaccctgg taaccgtgtc gtccgagccc 360 aagtcttgcg acaagaccca cacctgtcct ccttgtcctg ctccggaact gctgggcggc 420 ccttccgtgt ttctgtttcc tccaaagcct aaggacacac tgatgatcag ccggacccct 480 gaggtgacct gcgtggtcgt ggatgtctct cacgaggatc ctgaggtgaa gttcaactgg 540 tacgtggatg gagtggaagt gcataacgct aaaaccaagc ctagagaaga gcagtacaac 600 tccacctaca gagtggtgtc cgtgctgacc gtgctgcacc aggattggct gaacggcaaa 660 gagtacaagt gcaaggtgtc caacaaggct ctgcctgccc ctatcgagaa gaccatctcc 720 aaggccaagg gccagcctcg ggagcctcaa gtgtacacc tgcctccttc tcgcgacgag 780 ctgaccaaga accaggtgtc tctgacctgc ctggtgaaag gcttctaccc ctccgacatc gccgtggaat gggagtccaa tggccagccc gagaacaact acaagaccac cccacctgtg ctggactctg atggctcctt cttcctgtac tccaagctga ccgtggacaa gtccagatgg 960 cagcagggca acgtgttctc ctgttctgtg atgcacgagg ccctgcacaa ccctacaca cagaagtccc tgagcctgtc tcctggcaag <210> 29 <211> 355 <212> PRT <213> Artificial Sequence <220> <223> 1A10‑Fc‑Fc‑Online             <400> 29 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ser Gly Tyr Ser Asn Val Ala 20 25 30 Cys Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Glu Arg Glu Trp Val 35 40 45 Click Download to save Ala Thr Ile Val Ala Asp Phe Gly Thr Thr Asn Tyr mp3 youtube com 50 55 60 Lys Gly Arg Phe Thr Ile Ser Gln Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Ser Ala Met Tyr Tyr Cys 85 90 95 Ala Ala Thr Gln Arg Gly Gly Ile Asp Trp Cys Asp Glu Ile Asn Tyr 100 105 110 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Glu Pro Lys Ser Cys 115 120 125 Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 130 135 140 Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 145 150 155 160 Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His 165 170 175 Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val 180 185 190 His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr 195 200 205 Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly 210 215 220 Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile 225 230 235 240 Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val 245 250 255 Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser 260 265 270 Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 275 280 285 Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro 290 295 300 Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 305 310 315 320 Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met 325 330 335 His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser 340 345 350 Pro Gly Lys 355 <210> 30 <211> 1065 <212> DNA <213> Artificial Sequence <220> <223> Full-length nucleotide sequence of 1A10-Fc <400> 30 caggtgcaac tggtggagtc tggcggcgga tctgtgcaag ctggcggatc cctgagactg 60 tcttgtgccg cttccggcta ctcctctaac gtggcctgta tggcctggta cagacaggcc 120 cctggcaaag aaagagagtg ggtcgccacc atcgtggccg atttcggcac caccaattac 180 gccgcttccg tgaagggcag attcaccatc tctcaggaca acgccaagaa caccgtgtac 240<00010​​​​​​​​​​​​​​tggctgaacg gcaaggagta caagtgcaag gtgtccaaca aggctctgcc tgctcctatc 720 gagaagacca tcagcaaggc caagggccag cctcgggagc ctcaagtgta caccctgcct 780 ccttctcggg acgagctgac caagaaccag gtgtctctta catgcctggt gaaaggcttc 840 tacccttccg acatcgccgt ggaatgggag tccaatggcc agcccgagaa caactacaag 900 accacacctc ctgtgctgga ctctgacggc tccttcttcc tgtactccaa gctgacagtg 960 gataagtcca gatggcagca gggcaacgtg ttctcctgct ccgtgatgca cgaggccctg 1020 cacaaccact acacccagaa gtctctgagc ctgtcccctg gaaaa 1065 <210> 31 <211> 358 <212> PRT <213> Artificial Sequence <220> <223> Full-length amino acid sequence of 1A11-Fc <400> 31 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Val Thr Phe Asn Ser Ala 20 25 30 Cys Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val 说明:原内容中 应为 ,已按正确格式翻译。 35 40 45 Ala Arg Ile Glu Thr Gly Tyr Gly Gly Thr Val Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr Cys 85 90 95 Ala Ala Lys Arg Ser Trp Cys Thr Pro Thr Trp Trp His Glu Leu Asp 100 105 110 Tyr Asn Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser Glu Pro 115 120 125 Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu 130 135 140 Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp 145 150 155 160 Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp 165 170 175 Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly 180 185 190 Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn 195 200 205 Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp 210 215 220 Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro 225 230 235 240 Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu 245 250 255 Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn 260 265 270 Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile 275 280 285 Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr 290 295 300 Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys 305 310 315 320 Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys 325 330 335 Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu 340 345 350 Ser Leu Ser Pro Gly Lys 355 <210> 32 <211> 1074 <212> DNA <213> Artificial Sequence <220> <223> Full-length nucleotide sequence of 1A11-Fc <400> 32 caggtgcagt tggttgaatc tggcggcgga tctgtgcagg ctggcggatc tctgagactg 60 tcctgtgccg cttccggcgt caccttcaac tccgcttgca tgggatggtt cagacaggcc 120 cctggcaaag agagagaggg cgtcgctagg atcgagaccg gctatggcgg aaccgtctac 180 gccgactccg tcaagggcag gttcaccatc agcagagaca acgccaagaa caccgtgtac 240 ctgcagatga actccctgaa gcccgaggac accgccatgt actactgtgc tgccaagaga 300 agctggtgca cccctacctg gtggcacgag ctggactaca actactgggg ccagggcaca 360 caggtcaccg tgtcctctga gcctaagtcc tgcgacaaga cccacacctg tcctccatgt 420 cctgctccag aactgctcgg cggaccttcc gtgttcctgt ttcctccaaa gcctaaggat 480 accctgatga tctctcggac ccctgaagtg acctgcgtgg tggtggatgt gtctcacgag 540 gatcccgaag tgaagttcaa ttggtacgtg gacggcgtgg aagtgcacaa tgctaagacc 600 aagcctagag aggaacagta caactccacc tatagagtgg tgtccgtgct gaccgtgctg 720. caccaggatt ggctgaacgg caagagtac aagtgcaagg tgtccaacaa ggccctgcct gctcctatcg aaaagaccat ctccaaggcc aagggccagc ctagggaacc ccaggtttac 780. accttgcctc catctcggga cgagctgacc aagaaccagg tgtccctgac ctgtctggtc 840 aagggcttct acccctccga tatcgccgtg gaatgggagt ctaatggcca gccagagaac aactacaaga caacccctcc tgtgctggac tccgacggct cattcttcct gtactccaag ctgacagtgg acaagtccag atggcagcag ggcaacgtgt tctcctgctc cgtgatgcac gaggccctgc acaatcacta cacccagaag tccctgtctc tgagccccgg caaa <210> 33 <211> 350 <212> PRT <213> Artificial Sequence <220> <223> 1B10‑Fc                             <400> 33 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Thr Ala Ser Gly Tyr Thr Phe Arg Gly Trp 20 25 30 Asn Lys His Trp Tyr Arg Gln Ala Pro Gly Lys Glu Arg Glu Leu Val 35 40 45 Ser Ser Ile Phe Arg Asp Gly Lys Thr Ala Tyr Thr Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Gln Asp Ser Ala Asp Ala Thr Val Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr Cys Lys 85 90 95 Tyr Asp Leu Pro Gly Ser Gly Leu Pro Glu Phe Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser Glu Pro Lys Ser Cys Asp Lys Thr His Thr 115 120 125 Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe 130 135 140 Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro 145 150 155 160 Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val 165 170 175 Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr 180 185 190 Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val 195 200 205 Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys 210 215 220 Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser 225 230 235 240 Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro 245 250 255 Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val 260 265 270 Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly 275 280 285 Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp 290 295 300 Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp 305 310 315 320 Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His 325 330 335 Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 340 345 350 <210> 34 <211> 1050 <212> DNA <213> Artificial Sequence <220> <223> Full-length nucleotide sequence of 1B10-Fc <400> 34 gaggtgcaac tggtggagtc tggaggcggt tccgtgcagg ccggcggctc cctgagactg 60 tcctgcaccg cttccggcta caccttcaga ggctggaaca agcactggta tcggcaggct 120 cctggcaaag aaagagagct ggtgtcctcc atcttccggg acggcaagac cgcctacacc 180 gactccgtga agggcagatt caccatctct caggactctg ccgacgccac agtgtacctg 240 cagatgaact ctctgaagcc cgaggacacc gccatgtact actgcaagta cgacctgcct 300 ggatctggcc tgcccgagtt ctggggccaa ggcaccctgg taaccgtgtc gtccgagccc 360 aagtcttgcg acaagaccca cacctgtcct ccttgtcctg ctccggaact gctgggcggc 420 ccttccgtgt ttctgtttcc tccaaagcct aaggacacac tgatgatcag ccggacccct 480 gaggtgacct gcgtggtcgt ggatgtctct cacgaggatc ctgaggtgaa gttcaactgg 540 tacgtggatg gagtggaagt gcataacgct aaaaccaagc ctagagaaga gcagtacaac 600 tccacctaca gagtggtgtc cgtgctgacc gtgctgcacc aggattggct gaacggcaaa 660 gagtacaagt gcaaggtgtc caacaaggct ctgcctgccc ctatcgagaa gaccatctcc 720 aaggccaagg gccagcctcg ggagcctcaa gtgtacaccc tgcctccttc tcgcgacgag 780 ctgaccaaga accaggtgtc tctgacctgc ctggtgaaag gcttctaccc ctccgacatc 840 gccgtggaat gggagtccaa tggccagccc gagaacaact acaagaccac cccacctgtg 900 ctggactctg atggctcctt cttcctgtac tccaagctga ccgtggacaa gtccagatgg 960 cagcagggca acgtgttctc ctgttctgtg atgcacgagg ccctgcacaa ccactacaca 1020 cagaagtccc tgagcctgtc tcctggcaag 1050 <210> 35 <211> 54 <212> PRT <213> Homo sapiens <400> 35 Met Leu Gln Met Ala Gly Gln Cys Ser Gln Asn Glu Tyr Phe Asp Ser 1 5 10 15 Leu Leu His Ala Cys Ile Pro Cys Gln Leu Arg Cys Ser Ser Asn Thr 20 25 30 Pro Pro Leu Thr Cys Gln Arg Tyr Cys Asn Ala Ser Val Thr Asn Ser 35 40 45 Val Lys Gly Thr Asn Ala 50 <210> 36 <211> 53 <212> PRT <213> Cynomolgus macaque (Macaca fascicularis) <400> 36 Met Leu Gln Met Ala Arg Gln Cys Ser Gln Asn Glu Tyr Phe Asp Ser 1 5 10 15 Leu Leu His Asp Cys Lys Pro Cys Gln Leu Arg Cys Ser Ser Thr Pro 20 25 30 Pro Leu Thr Cys Gln Arg Tyr Cys Asn Ala Ser Met Thr Asn Ser Val 35 40 45 Lys Gly Met Asn Ala 50

Claims

1. A separate single variable structural domain incorporating BCMA, wherein the single variable structural domain comprises CDR1, CDR2, and CDR3 selected from any one of the following groups: (ii) CDR1 of the amino acid sequence shown in SEQ ID NO: 10; CDR2 of the amino acid sequence shown in SEQ ID NO: 11; and CDR3 of the amino acid sequence shown in SEQ ID NO: 12; (iii) CDR1 of the amino acid sequence shown in SEQ ID NO: 13; CDR2 of the amino acid sequence shown in SEQ ID NO: 14; and CDR3 of the amino acid sequence shown in SEQ ID NO: 15; (i) CDR1 of the amino acid sequence shown in SEQ ID NO: 7; CDR2 of the amino acid sequence shown in SEQ ID NO: 8; and CDR3 of the amino acid sequence shown in SEQ ID NO: 9; or (iv) CDR1 of the amino acid sequence shown in SEQ ID NO: 16; CDR2 of the amino acid sequence shown in SEQ ID NO: 17; and CDR3 of the amino acid sequence shown in SEQ ID NO:

18.

2. A separate single variable domain that binds to BCMA, wherein the single variable domain comprises CDR1, CDR2, and CDR3 of a single variable domain as shown in SEQ ID NO: 21, 23, 19, or 25.

3. The isolated single variable domain according to claim 1 or 2, wherein the single variable domain comprises an amino acid sequence having at least 85% sequence identity with the sequence of SEQ ID NO: 19, 21, 23 or 25.

4. The isolated single variable domain according to claim 1 or 2, wherein the single variable domain comprises the amino acid sequence of SEQ ID NO: 19, 21, 23 or 25.

5. The isolated single variable domain according to claim 1 or 2, wherein the single variable domain is of camel origin or humanized.

6. The isolated single variable domain according to claim 1, wherein the single variable domain comprises: CDR1 of the amino acid sequence shown in SEQ ID NO: 10; CDR2 of the amino acid sequence shown in SEQ ID NO: 11; and CDR3 of the amino acid sequence shown in SEQ ID NO:

12.

7. The isolated single variable domain according to claim 6, wherein the single variable domain comprises an amino acid sequence having at least 85% sequence identity with the sequence of SEQ ID NO:

21.

8. The isolated single variable domain according to claim 6, wherein the single variable domain comprises an amino acid sequence having at least 87% sequence identity with the sequence of SEQ ID NO:

21.

9. The isolated single variable domain according to claim 6, wherein the single variable domain comprises an amino acid sequence having at least 89% sequence identity with the sequence of SEQ ID NO:

21.

10. The isolated single variable domain according to claim 6, wherein the single variable domain comprises an amino acid sequence having at least 90% sequence identity with the sequence of SEQ ID NO:

21.

11. The isolated single variable domain according to claim 6, wherein the single variable domain comprises an amino acid sequence having at least 91% sequence identity with the sequence of SEQ ID NO:

21.

12. The isolated single variable domain according to claim 6, wherein the single variable domain comprises an amino acid sequence having at least 92% sequence identity with the sequence of SEQ ID NO:

21.

13. The isolated single variable domain according to claim 6, wherein the single variable domain comprises an amino acid sequence having at least 93% sequence identity with the sequence of SEQ ID NO:

21.

14. The isolated single variable domain according to claim 6, wherein the single variable domain comprises an amino acid sequence having at least 95% sequence identity with the sequence of SEQ ID NO:

21.

15. The isolated single variable domain according to claim 1, wherein the single variable domain comprises: CDR1 of the amino acid sequence shown in SEQ ID NO: 13; CDR2 of the amino acid sequence shown in SEQ ID NO: 14; and CDR3 of the amino acid sequence shown in SEQ ID NO:

15.

16. The isolated single variable domain according to claim 15, wherein the single variable domain comprises an amino acid sequence having at least 85% sequence identity with the sequence of SEQ ID NO:

23.

17. The isolated single variable domain according to claim 15, wherein the single variable domain comprises an amino acid sequence having at least 87% sequence identity with the sequence of SEQ ID NO:

23.

18. The isolated single variable domain according to claim 15, wherein the single variable domain comprises an amino acid sequence having at least 89% sequence identity with the sequence of SEQ ID NO:

23.

19. The isolated single variable domain according to claim 15, wherein the single variable domain comprises an amino acid sequence having at least 90% sequence identity with the sequence of SEQ ID NO:

23.

20. The isolated single variable domain according to claim 15, wherein the single variable domain comprises an amino acid sequence having at least 91% sequence identity with the sequence of SEQ ID NO:

23.

21. The isolated single variable domain according to claim 15, wherein the single variable domain comprises an amino acid sequence having at least 92% sequence identity with the sequence of SEQ ID NO:

23.

22. The isolated single variable domain according to claim 15, wherein the single variable domain comprises an amino acid sequence having at least 93% sequence identity with the sequence of SEQ ID NO:

23.

23. The isolated single variable domain according to claim 15, wherein the single variable domain comprises an amino acid sequence having at least 95% sequence identity with the sequence of SEQ ID NO:

23.

24. The separable single variable structural domain according to any one of claims 1 or 2, 6-23, wherein the single variable structural domain exhibits one or a combination of the following properties: (i) Combined with human BCMA; (ii) Block the binding of APRIL to BCMA; or (iii) It does not bind to human TACI or / and BAFFR proteins.

25. An isolated antigen-binding molecule that binds to BCMA and comprises at least one single variable domain as described in any one of claims 1-24.

26. The isolated antigen-binding molecule according to claim 25, wherein the antigen-binding molecule is of camel origin, chimeric, or humanized.

27. The isolated antigen-binding molecule according to claim 25 or 26, wherein the antigen-binding molecule is an antibody.

28. The isolated antigen-binding molecule according to claim 27, wherein the antibody is a monospecific antibody or a multispecific antibody.

29. The isolated antigen-binding molecule of claim 27, wherein the antibody comprises an immunoglobulin constant region.

30. The isolated antigen-binding molecule of claim 29, wherein the immunoglobulin constant region comprises human immunoglobulin Fc.

31. The isolated antigen-binding molecule according to claim 30, wherein the human immunoglobulin Fc is the Fc of IgG1, IgG2, IgG3 or IgG4.

32. The isolated antigen-binding molecule according to claim 25, wherein the antigen-binding molecule comprises an amino acid sequence as shown in SEQ ID NO: 27, 29, 31 or 33.

33. The isolated antigen-binding molecule according to claim 25, wherein the isolated antigen-binding molecule exhibits one or a combination of the following properties: (i) Combined with human BCMA; (ii) Block the binding of APRIL to BCMA; and, (iii) It does not bind to human TACI or / and BAFFR proteins.

34. A composition comprising an active ingredient and a pharmaceutically acceptable carrier, wherein the active ingredient is a single variable domain as claimed in any one of claims 1-24 or an antigen-binding molecule as claimed in any one of claims 25-33.

35. An isolated nucleic acid encoding a single variable domain according to any one of claims 1-24 or an antigen-binding molecule according to any one of claims 25-33.

36. A vector comprising the isolated nucleic acid according to claim 35.

37. A host cell comprising the vector according to claim 36.

38. A method for preparing a single variable structural domain according to any one of claims 1-24, the method comprising: Culture a host cell containing a nucleic acid encoding a single variable domain as described in any one of claims 1-24, and recover the single variable domain from the host cell or the host cell culture medium.

39. A method for preparing an antigen-binding molecule according to any one of claims 25-33, the method comprising: Culture a host cell containing a nucleic acid encoding an antigen-binding molecule as described in any one of claims 25-33, and recover the antigen-binding molecule from the host cell or the host cell culture medium.

40. Use of the single variable domain of any one of claims 1-24, the antigen-binding molecule of any one of claims 25-33, or the composition of claim 34 in the preparation of a medicament for treating a subject with a tumor expressing BCMA, wherein, The tumor in question is myeloma.

41. The use according to claim 40, wherein the tumor is multiple myeloma.

Images