Microorganism having enhanced l-branched amino acid production ability and method for producing l-branched amino acid using the same

Abstract

A microorganism with enhanced activity of acetic acid metabolism regulator A and a method for producing L-branched amino acids using the microorganism are disclosed.

Description

Technical Field

[0001] This disclosure relates to microorganisms with enhanced activity of acetic acid metabolism regulator A for the production of L-branched amino acids and methods for producing L-branched amino acids using them. Background Technology

[0002] L-amino acids, as the basic structural units of proteins, are used as major components in pharmaceuticals, food additives, animal feed, nutritional supplements, pesticides, disinfectants, and more. Specifically, branched-chain amino acids (BCAAs), the collective name for the essential amino acids L-valine, L-leucine, and L-isoleucine, are known for their antioxidant effects and their direct role in promoting protein synthesis in muscle cells.

[0003] Meanwhile, the production of branched-chain amino acids using microorganisms is mainly carried out by Escherichia or Corynebacterium species, and it is known to produce branched-chain amino acids through the biosynthesis of pyruvate via various stages using 2-ketoisocaproic acid as a precursor (US 10316297 B2, US 10526586 B2, and US10072278B2). However, a problem with the production of L-branched-chain amino acids using these microorganisms is that it is not easy to achieve large-scale industrial production. Summary of the Invention

[0004] [Technical Issues]

[0005] Against this backdrop, as a result of extensive efforts to enhance the ability of microorganisms to produce L-branched amino acids, the inventors have discovered that the ability to produce L-branched amino acids is significantly enhanced by increasing the expression of microbial acetic acid metabolism regulator A (hereinafter referred to as RamA), thereby completing this disclosure.

[0006] [Technical Solution]

[0007] One object of this disclosure is to provide microorganisms for the production of L-branched amino acids with enhanced activity of acetic acid metabolism regulator A.

[0008] Another object of this disclosure is to provide microorganisms that produce L-branched amino acids, comprising polynucleotides having promoter activity and including the substitution of different nucleotides at one or more corresponding positions selected from the following positions: nucleotides 34, 36, 37, 41 and 43 of the nucleotide sequence shown in SEQ ID NO: 1.

[0009] Another object of this disclosure is to provide a method for producing L-branched amino acids, the method comprising culturing microorganisms in a culture medium.

[0010] Another object of this disclosure is to provide a polynucleotide having promoter activity and comprising the substitution of a different nucleotide at one or more corresponding positions selected from the following: positions 34, 36, 37, 41 and 43 of the nucleotide sequence shown in SEQ ID NO: 1.

[0011] [Beneficial Effects]

[0012] L-branched amino acids can be produced in high yields by culturing microorganisms that produce L-branched amino acids, including polynucleotides of the present disclosure.

[0013] Furthermore, the amino acids produced in this disclosure can be used in a variety of products, such as human food, feed additives or pharmaceuticals, and animal feed or animal feed additives. Detailed Implementation

[0014] This disclosure will be described in detail. Furthermore, the various descriptions and embodiments disclosed herein can be applied to different descriptions and embodiments herein. In addition, all combinations of the various components disclosed herein are included within the scope of this disclosure. Moreover, the scope of this disclosure should not be limited by the descriptions provided below.

[0015] Those skilled in the art will recognize or be able to determine that, using no more than conventional experimentation, various equivalents of the specific embodiments of this disclosure can be obtained. Such equivalents are intended to be included within the scope of the appended claims.

[0016] One aspect of this disclosure provides microorganisms that produce L-branched amino acids, which have enhanced activity of acetic acid metabolism regulator A.

[0017] As used herein, the term "acetic acid metabolism regulator A" refers to a regulatory protein associated with acetic acid metabolism, which is the target protein of this disclosure and may be encoded by the ramA gene.

[0018] In this disclosure, the expression of acetic acid metabolism regulator A can be enhanced, and the enhanced expression can lead to an increased ability to produce L-branched amino acids.

[0019] As used herein, the term “enhancement” of the activity of acetic acid metabolism regulator A means that the activity of acetic acid metabolism regulator A is increased compared to its intrinsic activity. Enhancement can be used interchangeably with activation, upregulation, overexpression, and increase. In this regard, activation, enhancement, upregulation, overexpression, and increase can include all those exhibiting activities not originally present or exhibiting improved activities compared to intrinsic or pre-modification activities. “Intrinsic activity” refers to the activity of a specific peptide originally possessed by the parental strain or unmodified microorganism before transformation, when the microorganism is transformed through genetic modifications induced by natural or artificial factors. This term can be used interchangeably with “pre-modification activity.” “Enhancement,” “upregulation,” “overexpression,” or “increase” of peptide activity compared to intrinsic activity means that the activity and / or concentration (expression level) of a specific peptide is improved compared to those originally possessed by the parental strain or unmodified microorganism before transformation.

[0020] Enhancement can be achieved by introducing exogenous peptides or by enhancing the activity and / or increasing the concentration (expression level) of endogenous peptides. Whether the activity of acetic acid metabolism regulator A is enhanced can be determined based on improvements / increases in peptide activity or expression levels or the amount of product released from the peptide.

[0021] The enhancement of the activity of acetic acid metabolism regulator A can be achieved by applying various methods known in the art, and the methods are not limited, as long as the activity of the target peptide is enhanced compared with that of the unmodified microbe. Specifically, any genetic engineering and / or protein engineering methods known in the art as routine molecular biology methods can be used without limitation (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1–16, Sambrook et al. Molecular Cloning 2012).

[0022] Specifically, the enhanced activity of acetic acid metabolism regulator A can be achieved through the following:

[0023] 1) Increase the copy number of the polynucleotide encoding this polypeptide in the cell;

[0024] 2) Replace the gene expression regulatory sequence encoding the polypeptide on the chromosome with a sequence that improves the expression of the polypeptide or introduce a modification therein;

[0025] 3) Modify the start codon or the coding nucleotide sequence of the 5'-UTR region of the transcript of the gene encoding the polypeptide;

[0026] 4) Modify the amino acid sequence of the polypeptide to enhance its activity;

[0027] 5) Modify the sequence of the polynucleotide encoding the polypeptide to enhance the activity of the polypeptide (e.g., modify the nucleotide sequence of the polypeptide gene to encode a modified polypeptide with enhanced activity);

[0028] 6) Introduce an exogenous polypeptide with the activity of the polypeptide and encode its exogenous polynucleotide;

[0029] 7) Optimize the codons of the polynucleotides encoding the polypeptide;

[0030] 8) Modification or chemical modification of the exposed region by analyzing the three-dimensional structure of the polypeptide; or

[0031] 9) Any combination of two or more of the above 1) to 8), but not limited thereto.

[0032] More specifically,

[0033] The increase in the copy number of the polynucleotide encoding the polypeptide, as described in 1) above, can be achieved by introducing a vector into a host cell that replicates and functions independently of the host cell and is operatively linked to the polynucleotide encoding the polypeptide. Alternatively, the increase in copy number can be achieved by introducing one or two or more copies of the polynucleotide encoding the polypeptide into the chromosome of the host cell. Introduction into the chromosome can be accomplished by introducing a vector capable of inserting the polynucleotide into the host cell's chromosome, but is not limited to this. Vectors are described below.

[0034] The replacement of the gene expression regulatory sequence (or expression regulatory region) encoding the polypeptide on the chromosome described in 2) above with a sequence that improves the expression of the polypeptide, or the introduction of modifications therein, can be achieved, for example, by inducing mutations in the sequence—through deletion, insertion, non-conservative or conserved substitution, or any combination thereof—or by replacing the gene expression regulatory sequence with a sequence capable of improving the expression of the polypeptide, to further enhance the activity of the expression regulatory region. The expression regulatory region may include, but is not limited to, promoters, operon sequences, ribosome binding site coding sequences, sequences regulating transcription or translation termination, enhancers, etc. The replacement can be specifically performed by replacing an endogenous promoter with a strong heterologous promoter, but is not limited thereto.

[0035] Examples of strong promoters known in the art may include, but are not limited to, the CJ1 to CJ7 promoters (US Patent No. 7662943B2), the lac promoter, the trp promoter, the trc promoter, the tac promoter, the λ phage PR promoter, the PL promoter, the tet promoter, the gapA promoter, the SPL7 promoter, the SPL13(sm3) promoter (US Patent No. 10584338 B2), the O2 promoter (US Patent No. 10273491 B2), the tkt promoter, and the yccA promoter.

[0036] The modification described in 3) above, which modifies the start codon or the 5'-UTR region of the gene transcript encoding the polypeptide, can be achieved, for example, by replacing the nucleotide sequence with a nucleotide sequence encoding another start codon (with a higher polypeptide expression level than the endogenous start codon), but is not limited thereto.

[0037] The modified amino acid or nucleotide sequences described in 4) and 5) above can be achieved by inducing mutations in the amino acid sequence of the polypeptide or the nucleotide sequence encoding the polypeptide—through deletion, insertion, non-conservative or conserved substitution or any combination thereof—or by replacing the amino acid or nucleotide sequence with a modified amino acid or nucleotide sequence that has stronger activity or a modified amino acid or nucleotide sequence that increases activity, to further enhance the activity of the polypeptide, but is not limited thereto. The substitution can be specifically carried out by inserting a polynucleotide into the chromosome via homologous recombination, but is not limited thereto. In this regard, the vector used may further include selection markers to confirm its insertion into the chromosome. Selection markers will be described below.

[0038] The exogenous polypeptide possessing the activity described in 6) above can be achieved by introducing an exogenous polynucleotide encoding a polypeptide exhibiting the same / similar activity as the polypeptide into a host cell. There are no specific limitations on the source or sequence of the exogenous polynucleotide, as long as it exhibits the same / similar activity as the polypeptide. The method used in the introduction can be suitably selected by those skilled in the art. Because the introduced polynucleotide is expressed in the host cell, the polypeptide is produced and its activity can be increased.

[0039] The optimization of the codons encoding the polynucleotides described in 7) above can be achieved by optimizing the codons to increase the transcription or translation of endogenous polynucleotides in the host cell, or by optimizing the codons to allow for the optimization of the transcription or translation of exogenous polynucleotides in the host cell.

[0040] The modification or chemical modification described in 8) above, the exposed region selected by analyzing the three-dimensional structure of the polypeptide, can be achieved, for example, by: determining candidate template proteins based on the similarity between sequences, by comparing the sequence information of the polypeptide to be analyzed with a database storing existing protein sequence information, determining the structure based on this, selecting the exposed region to be modified or chemically modified, and modifying or chemically modifying the exposed region.

[0041] The enhancement of the activity of the acetic acid metabolism regulator A as described above can be an increase in the activity or concentration (expression level) of the polypeptide compared to the activity or concentration of the acetic acid metabolism regulator A expressed in wild-type or unmodified microbial strains, or an increase in the amount of product obtained from the polypeptide, but is not limited thereto.

[0042] More specifically, as used herein, the term "gene expression regulatory sequence"—which may be used interchangeably with "gene expression regulatory region"—refers to a sequence operatively linked to a target gene to induce expression of the target gene, and may include the modified polynucleotides of this disclosure. As stated above, the gene expression regulatory sequence of this disclosure may refer to promoters, enhancers, etc., that carry out gene transcription, and may further include the following concepts: operon sequences that control transcription, sequences encoding appropriate mRNA ribosome binding sites, and DNA that regulates the termination of transcription and translation.

[0043] In embodiments of this disclosure, the gene expression regulatory sequence may be a promoter, but is not limited thereto.

[0044] In embodiments of this disclosure, the expression of acetic acid metabolism regulator A can be enhanced by introducing modifications into the promoter or by replacing the promoter with a promoter that has stronger activity, but is not limited thereto.

[0045] As used herein, the term "promoter" refers to an untranslated nucleotide sequence that includes a polymerase-binding site, is located upstream of the coding region, and has the activity to initiate transcription of a target gene into mRNA; that is, a DNA region that causes the initiation of gene transcription when a polymerase binds to it. Promoters can be located in the 5' region of the mRNA transcription start site.

[0046] As used herein, the term "operably ligated" refers to a sequence functionally ligated to a target gene such that a polynucleotide having the promoter activity of this disclosure initiates and mediates transcription of the target gene. Operable ligation can be achieved using genetic recombination techniques known in the art, and can be performed using site-specific DNA cutting and ligation with restriction enzymes, ligases, etc., but is not limited thereto.

[0047] In this disclosure, a target gene refers to a gene encoding a target protein whose expression will be regulated in a microorganism. Specifically, the gene may be, but is not limited to, a gene encoding an acetic acid metabolism regulator A. More specifically, the gene may be the ramA gene, but is not limited to it.

[0048] Furthermore, the ramA gene can be an endogenous or exogenous gene, and can include mutations that regulate its activity. The sequence of the ramA gene can be readily obtained by those skilled in the art from known databases such as GenBank of the National Institutes of Health (USA).

[0049] Another aspect of this disclosure provides microorganisms that produce L-branched amino acids, comprising polynucleotides having promoter activity and including the substitution of different nucleotides at one or more corresponding positions selected from the nucleotide sequence shown in SEQ ID NO: 1 at positions 34, 36, 37, 41 and 43.

[0050] As used herein, the term "polynucleotide" refers to a DNA chain of a certain minimum length that is a nucleotide polymer, in which nucleotide monomers are linked together in a long chain by covalent bonds.

[0051] In consideration of the description of “promoter”, the term “polynucleotide with promoter activity” may be used interchangeably with “modified polynucleotide”, “modified promoter” or “modified ramA promoter”, and all of the above terms may be used herein.

[0052] In this regard, the term “modification” refers to genetically or non-genetically stable phenotypic changes and can be used interchangeably with “mutation” in this article.

[0053] Specifically, the modified polynucleotides of this disclosure can have altered (increased) promoter activity compared to unmodified polynucleotides. Therefore, the expression of the ramA gene (i.e., the target gene operatively linked to the modified polynucleotides of this disclosure) and the activity of the protein encoded by the ramA gene can be regulated (increased), and the expression of other genes, as well as the target gene, can also be regulated.

[0054] For the purposes of this disclosure, a promoter-active polynucleotide refers to, but is not limited to, a polynucleotide that enables the expression of a protein involved in increasing the production of amino acids (specifically branched-chain amino acids, more specifically including amino acids including leucine, valine, and isoleucine).

[0055] As used herein, the term “the polynucleotide sequence shown in SEQ ID NO: 1” may refer to the promoter sequence of the gene encoding the acetic acid metabolism regulator A (RamA).

[0056] The promoter-active polynucleotide disclosed herein is a modified polynucleotide that does not have a naturally derived sequence but has promoter activity, and its operatively linked target protein expression can be increased compared to the polynucleotide sequence shown in SEQ ID NO: 1.

[0057] Specifically, the modified polynucleotide of this disclosure can be a polynucleotide in which the nucleotide sequence shown in SEQ ID NO: 1, i.e. the promoter sequence of the ramA gene, is modified, and at least one nucleotide selected from the 34th, 36th, 37th, 41st and 43rd nucleotides of the sequence can be replaced by different nucleotides.

[0058] More specifically, the modified polynucleotides of this disclosure may include, in the nucleotide sequence shown in SEQ ID NO: 1, the 34th nucleotide being substituted with T; the 36th nucleotide being substituted with T; the 37th nucleotide being substituted with G; the 41st nucleotide being substituted with T; the 43rd nucleotide being substituted with A; or any combination thereof, but not limited thereto. With this modification, the polynucleotides of this disclosure may consist of a nucleotide sequence selected from SEQ ID NO: 3 to 5.

[0059] In one embodiment, the modified polynucleotide of this disclosure may include, in the nucleotide sequence shown in SEQ ID NO: 1, the nucleotide at position 34 being substituted with T; the nucleotide at position 36 being substituted with T; and the nucleotide at position 37 being substituted with G. In this case, the modified polynucleotide of this disclosure may consist of SEQ ID NO: 5.

[0060] In another embodiment, the modified polynucleotide of this disclosure may include, in the nucleotide sequence shown in SEQ ID NO: 1, the 41st nucleotide being substituted with T; and the 43rd nucleotide being substituted with A. In this case, the modified polynucleotide of this disclosure may consist of SEQ ID NO: 4.

[0061] In another embodiment, the modified polynucleotide of this disclosure may include, in the nucleotide sequence shown in SEQ ID NO: 1, the 34th nucleotide being substituted with T; the 36th nucleotide being substituted with T; the 37th nucleotide being substituted with G; the 41st nucleotide being substituted with T; and the 43rd nucleotide being substituted with A. In this case, the modified polynucleotide of this disclosure may consist of SEQ ID NO: 3.

[0062] The microorganisms that produce L-branched amino acids according to this disclosure may be microorganisms that have promoter activity and include, in the nucleotide sequence shown in SEQ ID NO: 1, the 34th nucleotide is replaced by T; the 36th nucleotide is replaced by T; the 37th nucleotide is replaced by G; the 41st nucleotide is replaced by T; the 43rd nucleotide is replaced by A; or any combination thereof.

[0063] Specifically, the microorganisms for producing L-branched amino acids disclosed herein may be microorganisms comprising polynucleotides that have promoter activity and consist of a nucleotide sequence selected from SEQ ID NO: 3 to 5 or a nucleotide sequence having at least 80% or more but less than 100% sequence homology with it. The modified polynucleotides of this disclosure will be described in more detail below.

[0064] As used herein, the term "branched amino acid" refers to an amino acid having a branched alkyl group in its side chain, and includes valine, leucine, and isoleucine. Specifically, in this disclosure, a branched amino acid can be an L-branched amino acid, and an L-branched amino acid can be L-valine, L-leucine, and L-isoleucine, but is not limited thereto.

[0065] As used herein, the term "microorganisms producing branched-chain amino acids" includes all wild-type microorganisms and those that undergo natural or artificial genetic modifications, and can be microorganisms that include genetic modifications to produce target branched-chain amino acids or have improved activity, wherein a particular mechanism is weakened or enhanced by the introduction of a foreign gene or by enhancing or inactivating the activity of an endogenous gene. In this disclosure, "microorganisms capable of producing L-branched-chain amino acids" may be used interchangeably with "microorganisms producing branched-chain amino acids" and "microorganisms with the capacity to produce branched-chain amino acids".

[0066] For the purposes of this disclosure, the microorganism can be any microorganism capable of producing branched-chain amino acids and including the modified polynucleotides of this disclosure. Specifically, the microorganism producing branched-chain amino acids can be a microorganism characterized by an increased ability to produce the target branched-chain amino acid by including the modified polynucleotide. Specifically, in this disclosure, the microorganism producing branched-chain amino acids, or the microorganism capable of producing branched-chain amino acids, can be, but is not limited to, a microorganism in which some genes in the branched-chain amino acid biosynthesis pathway are enhanced or weakened, or a microorganism in which some genes in the branched-chain amino acid degradation pathway are enhanced or weakened.

[0067] In one embodiment, in this disclosure, *Corynebacterium* microorganisms with branched-chain amino acid production capacity can refer to *Corynebacterium* microorganisms containing the modified polynucleotides of this disclosure or transformed with a vector including a gene encoding the polynucleotides of this disclosure to have improved branched-chain amino acid production capacity. "*Corynebacterium* microorganisms with enhanced branched-chain amino acid production capacity" means microorganisms with enhanced branched-chain amino acid production capacity compared to the amino acid production capacity of the parental strain before transformation or unmodified microorganisms. "Unmodified microorganisms" does not exclude strains with naturally occurring mutations and refers to microorganisms that do not contain the polynucleotides of this disclosure or microorganisms not transformed with a vector containing the polynucleotides of this disclosure.

[0068] Corynebacterium species can specifically include, but are not limited to, Corynebacterium glutamicum, Corynebacterium ammoniagenes, Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium thermoaminogenes, Corynebacterium efficiens, and Corynebacterium stationis.

[0069] As used herein, the term "vector" refers to an artificial DNA molecule that comprises genetic material enabling the expression of a target polypeptide in a suitable host cell. Specifically, it is a DNA construct—a nucleotide sequence comprising a polynucleotide encoding the target polypeptide and operatively linked to an appropriate expression regulatory region capable of expressing the target gene. After transformation of a suitable host cell with the vector, the vector can replicate or function independently of the host genome, or it can integrate into the genome.

[0070] There are no specific limitations on the vectors used in this disclosure, and any vector known in the art may be used. Examples of conventional vectors may include natural or recombinant plasmids, granules, viruses, and bacteriophages. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21A, etc., may be used as phage vectors or granule vectors. As plasmid vectors, pDZ, pBR, pUC, pBluescriptII, pGEM, pTZ, pCL, pET, etc., may be used. Specifically, pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, and pCC1BAC vectors may be used.

[0071] For example, a target polynucleotide can be inserted into a chromosome using a chromosome insertion vector. Insertion of the polynucleotide into the chromosome can be performed by any method known in the art, such as homologous recombination, but not limited to this. The polynucleotide may also include a selection marker to confirm the chromosome insertion. The selection marker is used to select cells transformed by the vector, i.e., to identify whether the target nucleic acid molecule has been inserted, and may use markers that provide selective phenotypes such as drug resistance, nutrient requirements, cytotoxic agent resistance, or surface peptide expression. Transformed cells can be selected because only cells expressing the selection marker can survive or exhibit different phenotypes under conditions treated with a selection agent.

[0072] As used herein, the term "transformation" refers to the process of introducing a vector containing a target polynucleotide into a host cell or microorganism, thereby enabling the polynucleotide to be expressed in the host cell. The transformed polynucleotide can be inserted into the host cell's chromosome or located outside the chromosome, as long as the polypeptide is expressed in the host cell. Furthermore, the polynucleotide can comprise DNA and / or RNA encoding the target polypeptide. The polynucleotide can be introduced into the host cell in any form, as long as it is introduced into the host cell and expressed therein. For example, the polynucleotide can be introduced into the host cell in the form of an expression cassette (i.e., a gene construct containing all the essential elements required for self-replication). The expression cassette can generally include a promoter, transcription termination signal, ribosome binding site, and translation termination signal operably linked to the polynucleotide. The expression cassette can be in the form of a self-replicating expression vector. Furthermore, the polynucleotide can be introduced into the host cell in its original form and operably linked to the desired sequence for expression in the host cell, but is not limited thereto.

[0073] Another aspect of this disclosure provides a method for producing L-branched amino acids, comprising culturing microorganisms in a culture medium.

[0074] In addition, methods for producing L-branched amino acids may also include recovering or separating the target substance from the culture medium or microorganisms.

[0075] "Polynucleotides", "Corynebacterium", "carriers" and "L-branched amino acids" are as described above.

[0076] As used herein, the term "culture" refers to the growth of the microorganisms of this disclosure in a suitably adjusted environment. The culture process of this disclosure can be carried out using suitable culture media and culture conditions known in the art. Those skilled in the art can appropriately adjust the culture process according to the selected strain. Specifically, culture can be carried out by batch culture, continuous culture, and fed-batch culture, but is not limited thereto.

[0077] As used herein, the term "culture medium" refers to a material in which the nutrients required for the culture of the microorganisms of this disclosure are mixed as the main elements and provide the nutrients and growth factors necessary for survival and growth, as well as water. Specifically, although there are no specific limitations on the culture medium and other culture conditions of the Corynebacterium spp. microorganisms of this disclosure—as long as the medium is commonly used for culturing microorganisms—the microorganisms of this disclosure can be cultured under aerobic conditions in a common culture medium containing appropriate carbon sources, nitrogen sources, phosphorus sources, inorganic compounds, amino acids and / or vitamins—while adjusting temperature, pH, etc.

[0078] Specifically, the culture medium used for Corynebacterium microorganisms is disclosed in the document ("Manual of Methods for General Bacteriology", the American Society for Bacteriology (Washington D.C., USA, 1981)).

[0079] In this disclosure, carbohydrates such as glucose, sucrose, lactose, fructose, and maltose; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid, and citric acid; and amino acids such as glutamic acid, methionine, and lysine can be used as carbon sources. In addition, natural organic nutrients such as starch hydrolysates, molasses, blackstrap molasses, rice bran, cassava, bagasse, and corn steep liquor can also be used. Specifically, carbohydrates such as glucose and aseptically pretreated molasses (i.e., molasses converted to reducing sugars) can be used, and any other suitable carbon source can also be used without limitation. These carbon sources can be used alone or in combination of at least two, but are not limited thereto.

[0080] As nitrogen sources, inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate can be used; and organic nitrogen sources such as amino acids, such as glutamic acid, methionine, and glutamine, peptone, NZ-amine, meat extracts, yeast extracts, malt extracts, corn steep liquor, casein hydrolysate, fish or its degradation products, and defatted soybean meal or its degradation products. These nitrogen sources can be used alone or in combination of at least two, but are not limited thereto.

[0081] Potassium dihydrogen phosphate, dipotassium hydrogen phosphate, or their corresponding sodium-containing salts can be used as phosphorus sources. Sodium chloride, calcium chloride, ferric chloride, magnesium sulfate, ferric sulfate, manganese sulfate, calcium carbonate, etc., can be used as inorganic compounds. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors can be added to the culture medium in batches or continuously, but are not limited to this.

[0082] Furthermore, during the cultivation of the microorganisms disclosed herein, the pH of the culture medium can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid in an appropriate manner. Additionally, foam formation can be prevented during cultivation by using antifoaming agents such as fatty acid polyethylene glycol esters. Moreover, oxygen or oxygen-containing gases can be injected into the culture medium to maintain it under aerobic conditions, or nitrogen, hydrogen, or carbon dioxide gases can be injected to maintain it under anaerobic and microaerobic conditions without injecting any other gas, but this is not a limitation.

[0083] In this disclosure, the culture temperature can be maintained between 20°C and 45°C, specifically between 25°C and 40°C, and the culture can be carried out for about 10 to 160 hours, but is not limited thereto.

[0084] L-branched amino acids produced by the culture method disclosed herein can be released into the culture medium or retained in the cells.

[0085] The method for producing L-branched amino acids according to this disclosure may also include preparing the microorganisms of this disclosure, preparing a culture medium for culturing the strains, or any combination thereof (in any order, regardless of the sequence), for example, prior to culturing.

[0086] The method for producing L-branched amino acids according to this disclosure may further include recovering L-branched amino acids from a culture medium (in which culture has been carried out) or from the microorganisms of this disclosure. The recovery step may be performed separately after the culture process.

[0087] According to the methods for culturing microorganisms disclosed herein, such as batch, continuous, or fed-batch methods, the recovery step can be performed by collecting the target L-branched amino acids using suitable methods known in the art. For example, centrifugation, filtration, treatment with a protein precipitant (salting out), extraction, ultrasonic disintegration, ultrafiltration, dialysis, various chromatographic methods such as molecular sieve chromatography (gel permeation), adsorption chromatography, ion exchange chromatography and affinity chromatography, HPLC, SMB, and any combination thereof can be used. The target L-branched amino acids can be recovered from the culture medium or microorganisms using any suitable method known in the art.

[0088] Additionally, the method for producing L-branched amino acids according to this disclosure may also include a purification step. Purification can be performed using suitable methods known in the art. For example, when the method for producing L-branched amino acids according to this disclosure includes a recovery step and a purification step, the recovery step and the purification step may be performed continuously or discontinuously, regardless of the order, or may be performed simultaneously or as an integrated step, but are not limited thereto.

[0089] Another aspect of this disclosure provides a polynucleotide having promoter activity and comprising at least one nucleotide selected from the nucleotide sequence shown in SEQ ID NO: 1, at positions 34, 36, 37, 41 and 43, being substituted with a different nucleotide.

[0090] "Polynucleotides" and "promoters" are as described above.

[0091] Furthermore, the modified polynucleotide sequences disclosed herein can be modified by mutagenesis methods known in the art, such as direct evolution and site-directed mutagenesis.

[0092] Therefore, the modified polynucleotide of this disclosure may include a polynucleotide having the following nucleotide sequence: wherein the 34th base is fixed as T; the 36th base is fixed as T; the 37th base is fixed as G; the 41st base is fixed as T; and the 43rd base is fixed as A, and the other parts of the nucleotide sequence have at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% homology or identity with the nucleotide sequence of SEQ ID NO: 3.

[0093] Additionally, the modified polynucleotides of this disclosure may include polynucleotides having the following nucleotide sequence: wherein the 41st base is fixed as T; and the 43rd base is fixed as A, and the other portions of the nucleotide sequence have at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with the nucleotide sequence of SEQ ID NO: 4.

[0094] Furthermore, the modified polynucleotides of this disclosure may include polynucleotides having the following nucleotide sequence: wherein the 34th base is fixed as T; the 36th base is fixed as T; and the 37th base is fixed as G, and the other portions of the sequence have at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with the nucleotide sequence of SEQ ID NO: 5.

[0095] In this case, the nucleotide sequence having the aforementioned homology or identity can exclude sequences with 100% identity or can be sequences with less than 100% identity.

[0096] Obviously, any polynucleotide having a nucleotide sequence including the deletion, modification, substitution or addition of one or more nucleotides other than position 34, 36, 37, 41 or 43 is within the scope of this disclosure, provided that the nucleotide sequence maintains homology and has the same or equivalent biological activity as at least one nucleotide sequence selected from SEQ ID NO: 3 to 5.

[0097] As used herein, the terms “homology” or “identity” refer to the degree of correlation between two given amino acid sequences or nucleotide sequences and can be expressed as a percentage. The terms homology and identity are generally used interchangeably.

[0098] Sequence homology or identity of conserved polynucleotides or polypeptides can be determined using standard alignment algorithms, and can be combined with default gap penalties established by the program. Essentially, homologous or identical sequences can hybridize fully or partially with each other under moderately or highly stringent conditions. Clearly, hybridization involves the hybridization of a polynucleotide with a polynucleotide containing a universal codon or a codon that takes into account codon degeneracy.

[0099] Homology, similarity, or identity between two sequences of a polynucleotide or polypeptide can be determined using any computer algorithm known in the art, such as the “FASTA” program, which utilizes the default parameters introduced by Pearson et al. (1988) Proc. Natl. Acad. Sci. USA 85:2444. Alternatively, homology, similarity, or identity can be determined using the following: the Needleman-Wunsch algorithm executed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, TrendsGenet. 16: 276–277) (version 5.0.0 or later) (including the GCG package (Devereux, J. et al., Nucleic AcidsResearch 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, SF et al., J MOLEC BIOL 215: 403 (1990); Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994 and CARILLO et al. (1988) SIAM J Applied Math 48: 1073). (Wunsch, 1970, J.Mol.Biol.48:443–453). For example, homology, similarity, or identity can be determined using information from the National Center for Biotechnology databases BLAST or ClustalW.

[0100] Homology, similarity, or identity between polynucleotides or polypeptides can be determined by comparing sequence information using the GAP computer program, introduced by Needleman et al. (1970), J Mol Biol. 48:443 as disclosed by Smith and Waterman, Adv. Appl. Math (1981) 2:482. In short, the GAP program defines similarity as the number of similar alignment symbols (i.e., nucleotides or amino acids) divided by the total number of symbols in the shorter of the two sequences. The default parameters for the GAP program may include: (1) a binary comparison matrix (containing a value of 1 to indicate sameness and 0 to indicate difference) and a weighted comparison matrix as described in Gribskov, et al. (1986), Nucl. Acids Res. 14:6745—as described in Schwartz and Dayhoff, eds., Atlas Of Protein Sequence and Structure, National Biomedical Research Foundation, pp. 353–358 (1979) (or the EDNAFULL (NCBI NUC4.4 version of EMBOSS) replacement matrix); (2) a penalty of 3.0 per vacancy, with an additional penalty of 0.10 per symbol in each vacancy (or a penalty of 10 for vacancy opening and 0.5 for vacancy expansion); and (3) no penalty for terminal vacancy.

[0101] Furthermore, the modified polynucleotides of this disclosure may include various modifications made in the coding region that do not alter the nucleotide sequence, provided by codon degeneracy or by considering the preferred codons of the living organism expressing the polynucleotide. Additionally, the polynucleotide may, without limitation, include any nucleotide sequence having promoter activity and hybridizing with a probe constructed using a known gene sequence (e.g., a nucleotide sequence that is fully or partially complementary to that nucleotide sequence under stringent conditions) to include at least one substituted nucleotide in the nucleotide sequence of SEQ ID NO: 1. The term "stringent conditions" refers to conditions that allow specific hybridization between polynucleotides. Such conditions are disclosed in detail in known documents (e.g., J. Sambrook et al.). For example, the conditions may include hybridization between genes with high homology (e.g., 40% or more homology, specifically 70% or more, 80% or more, 85% or more, 90% or more, more specifically 95% or more, even more specifically 97% or more, most specifically 99% or more), without hybridization between genes with less homology or identity than those mentioned above, or hybridization once, specifically two or three times—under the usual washing conditions of Southern hybridization, at the following salt concentrations and temperatures: 60°C, 1×SSC and 0.1% SDS, specifically 60°C, 0.1×SSC, 0.1% SDS, more specifically 68°C, 0.1×SSC and 0.1% SDS.

[0102] Hybridization requires two nucleic acids to have complementary sequences, although base mismatches may occur depending on the strictness of the hybridization process. The term "complementary" is used to describe the relationship between the bases of nucleotides that are capable of hybridizing with each other. For example, in the case of DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Therefore, this disclosure may include not only substantially similar nucleic acid sequences but also isolated nucleic acid fragments that are complementary to the complete sequence.

[0103] Specifically, polynucleotides with homology or identity can be detected using the above hybridization conditions, including at 55°C and T. m The hybridization process under the value. Furthermore, T... m The value may be, but is not limited to, 60°C, 63°C or 65°C, and may be appropriately adjusted by those skilled in the art for the intended purpose.

[0104] The appropriate stringency of polynucleotide hybridization can depend on the length and complementarity of the polynucleotides, and these parameters are well known in the art (Sambrook et al., ibid., 9.50-9.51, 11.7-11.8).

[0105] Specifically, the statement "the modified polynucleotide consists of a nucleotide sequence selected from SEQ ID NO: 3 to 5 or a nucleotide sequence having at least 80% or more and less than 100% sequence homology" does not exclude the addition and / or deletion and / or mutation of nucleotides that may occur during the process of linking to the target gene (e.g., using restriction enzymes) – in the case where the polynucleotide is used as a promoter in a state linked to the target gene.

[0106] For example, a polynucleotide consisting of a nucleotide sequence selected from SEQ ID NO: 3 to 5 and having promoter activity may also include a polynucleotide that hybridizes under stringent conditions with a complete or partial complementary nucleotide sequence selected from SEQ ID NO: 3 to 5 to have the promoter activity of this disclosure.

[0107] Microorganisms that modify polynucleotides, including those of this disclosure, are characterized by increased production of branched-chain amino acids, including valine, leucine, or isoleucine. While wild-type strains of the genus *Corynebacterium* cannot produce branched-chain amino acids or produce only trace amounts, the significance of the promoter-active polynucleotides of this disclosure lies in their increased production of branched-chain amino acids.

[0108]

Example

[0109] The present disclosure will be described in more detail below with reference to the following embodiments. However, the following embodiments are merely shown as examples of the present disclosure, and the scope of the disclosure is not limited thereto.

[0110] Example 1. Selection of mutant strains with enhanced valine production capacity through artificial mutagenesis

[0111] Example 1-1. Artificial Mutation Induced by UV Radiation

[0112] To select mutant strains with enhanced valine (a representative branched-chain amino acid) production capacity, *Corynebacterium glutamicum* KCCM11201P (Korean Patent No. 10-1117022), a valine-producing strain, was plated on an agar-containing nutrient medium and cultured at 30°C for 36 hours. Hundreds of colonies were obtained and exposed to UV radiation at room temperature to induce random mutations in the strain's genome.

[0113] Examples 1-2. Evaluation and selection of fermentation titers for mutant-induced strains

[0114] To select mutant strains with enhanced L-valine production compared to the parent strain *Corynebacterium glutamicum* KCCM11201P, fermentation titers were tested on randomly induced mutant strains. After subculturing each colony in nutrient medium, each strain was inoculated into a 250 mL corner-baffled flask containing 25 mL of production medium and incubated at 30 °C with shaking at 200 rpm for 72 h. The concentration of L-valine was then analyzed by HPLC, and the analytical concentrations are shown in Table 1 below.

[0115] Nutrient medium (pH 7.2)

[0116] 10g glucose, 5g gravy, 10g polypeptone, 2.5g sodium chloride, 5g yeast extract, 20g agar, 2g urea (based on 1L distilled water)

[0117] Production culture medium (pH 7.0)

[0118] 100g glucose, 40g ammonium sulfate, 2.5g soy protein, 5g corn steep liquor, 3g urea, 1g dipotassium hydrogen phosphate, 0.5g magnesium sulfate heptahydrate, 100μg biotin, 1mg thiamine-HCl, 2mg calcium pantothenate, 3mg nicotinamide, and 30g calcium carbonate (based on 1L distilled water)

[0119] Table 1

[0120]

[0121]

[0122] Compared with the KCCM11201P strain used as a control, the A7 strain with the greatest increase in valine production was selected (see Table 1).

[0123] Example 2. Confirmation of mutations via gene sequencing

[0124] The major genes of strain A7, which exhibits enhanced valine production, were sequenced and compared with those of strains KCCM11201P and wild-type Corynebacterium glutamicum ATCC14067. The results confirmed that strain A7 contains a mutation at the promoter position of the acetic acid metabolism regulator A.

[0125] Specifically, it was confirmed that strain A7 has the nucleotide sequence of SEQ ID NO:2, which includes a mutation at the promoter region (SEQ ID NO:1) of the ramA gene.

[0126] In the following examples, the effects of modifications at specific locations in the ramA gene promoter region on the production of valine, isoleucine, and leucine (branched-chain amino acids from Corynebacterium spp.) and the effects of enhanced RamA expression through modification or substitution of the ramA gene promoter on the production of valine, isoleucine, and leucine were investigated.

[0127] Example 3. Construction of the modified strain and confirmation of valine production capacity

[0128] Example 3-1. Introduction of promoter modification in Corynebacterium glutamicum strain KCCM11201P and evaluation of L-valine production capacity.

[0129] To insert the modified polynucleotide of the ramA gene promoter represented by SEQ ID NO: 2 into Corynebacterium glutamicum KCCM11201P, a vector containing the target modification was prepared. Specifically, genomic DNA of strain A7 was extracted using the G-spin Total DNA Extraction Mini Kit (Intron, catalog number 17045) according to the kit's protocol, and PCR was performed using this genomic DNA as a template. PCR was performed under the following conditions: denaturation at 94°C for 5 minutes; 25 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 150 seconds; followed by polymerization at 72°C for 7 minutes, yielding a 1114 bp PCR product (hereinafter referred to as "Modification Introduced Fragment 1") using SEQ ID NO: 9 and 10.

[0130] After treating the obtained modified introduction fragment 1 with the restriction enzyme XbaI (New England Biolabs, Beverly, MA), modified introduction fragment 1 was ligated into the pDZ vector (Korean Patent No. 10-0924065 and International Patent Application Publication No. 2008-033001) treated with the same restriction enzyme using T4 ligase (New England Biolabs, Beverly, MA). After transforming *E. coli* DH5α with the constructed gene, transformed strains were selected in LB medium containing kanamycin, and DNA was obtained from it using a DNA-spin plasmid DNA purification kit (iNtRON) to prepare the pDZ-Pm-ramA vector containing modified introduction fragment 1.

[0131] Table 2

[0132] Primers Base sequence SEQ ID NO: Pm(TATAAT)-F1 gctctagaTAGGCCGGTTCGGACTCGCCCTGCC SEQ ID NO:9 Pm(TATAAT)-R1 gctctagaaacgtgcgcgcagtcatggtgactt SEQ ID NO:10

[0133] Corynebacterium glutamicum KCCM11201P was transformed using the pDZ-Pm-ramA vector via chromosomal homologous recombination (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). Strains that had inserted the vector into the chromosome via homologous sequence recombination were selected in a medium containing kanamycin (25 mg / L). Then, PCR was performed on the Corynebacterium glutamicum transformants that underwent secondary recombination using SEQ ID NO: 9 and 10, and strains with inserted modifications in the promoter region upstream of ramA (SEQ ID NO: 1) on the chromosome were confirmed. This recombinant strain was named Corynebacterium glutamicum KCCM11201P-Pm-ramA.

[0134] To compare the valine production capacity between *Corynebacterium glutamicum* KCCM11201P and KCCM11201P-Pm-ramA, a flask evaluation was performed. After subculturing each strain in nutrient medium, they were inoculated into 250 mL baffled Erlenmeyer flasks containing 25 mL of production medium and incubated at 30 °C with shaking at 200 rpm for 72 hours. The concentration of L-valine was then analyzed by HPLC, and the analytical concentrations of L-valine are shown in Table 3 below.

[0135] Nutrient medium (pH 7.2)

[0136] 10g glucose, 5g gravy, 10g polypeptone, 2.5g sodium chloride, 5g yeast extract, 20g agar, 2g urea (based on 1L distilled water)

[0137] Production culture medium (pH 7.0)

[0138] 100g glucose, 40g ammonium sulfate, 2.5g soy protein, 5g corn steep liquor, 3g urea, 1g dipotassium hydrogen phosphate, 0.5g magnesium sulfate heptahydrate, 100μg biotin, 1mg thiamine-HCl, 2mg calcium pantothenate, 3mg nicotinamide, 30g calcium carbonate (based on 1L distilled water)

[0139] Table 3

[0140] L-valine production capacity of KCCM11201P and KCCM11201P-Pm-ramA

[0141]

[0142]

[0143] The results showed that the L-valine production capacity of the KCCM11201P-Pm-ramA strain was enhanced by approximately 23% compared to KCCM11201P.

[0144] Example 3-2. Construction of Corynebacterium glutamicum KCCM11201P mutant strain with modified and replaced promoter and evaluation of the L-valine production capacity of the constructed strain.

[0145] As shown in the results of Example 3-1 above, it was confirmed that modifying the ramA gene promoter enhanced valine production. Therefore, a vector for improving or replacing the ramA promoter was constructed based on the modified promoter of SEQ ID NO: 2 to further increase ramA expression.

[0146] To construct the modified vector, primers 3 (SEQ ID NO: 11) to 10 (SEQ ID NO: 18) of Table 4 were synthesized to have xbaI restriction enzyme regions at the 5' and 3' ends.

[0147] The improved ramA promoters were named Pm1, Pm2, and Pm3-ramA. Pm1-ramA was constructed using primer pairs of SEQ ID NO: 11 and 13, and primer pairs of SEQ ID NO: 12 and 14. Pm2-ramA was constructed using primer pairs of SEQ ID NO: 11 and 15, and primer pairs of SEQ ID NO: 12 and 14. Furthermore, Pm3-ramA was constructed using primer pairs of SEQ ID NO: 11 and 17, and primer pairs of SEQ ID NO: 12 and 18.

[0148] PCR was performed using primers and chromosomal DNA from wild-type Corynebacterium glutamicum as templates [Sambrook et al., Molecular Cloning, a Laboratory Manual (1989), Cold Spring Harbor Laboratories].

[0149] In this case, PCR was performed under the following conditions: denaturation at 95°C for 5 minutes; 30 cycles of denaturation at 94°C for 30 seconds, annealing at 56°C for 30 seconds, and polymerization at 72°C for 1 minute; followed by polymerization at 72°C for 7 minutes.

[0150] Then, the PCR product obtained from the above process and the previously prepared pDZ-Pm-ramA vector were treated with xbaI restriction enzyme, followed by fusion cloning. Fusion cloning utilizes... The HD cloning kit (Clontech) was used to transform *E. coli* DH5α and plated on LB agar containing kanamycin (25 mg / L). Colonies transformed with plasmids containing the target gene were selected by PCR, and the plasmids were extracted and named pDZ-Pm1-ramA, pDZ-Pm2-ramA, and pDZ-Pm3-ramA, respectively.

[0151] Table 4

[0152]

[0153]

[0154] In addition, separately, in order to replace the ramA promoter with the stronger promoter Pcj7, primers 11 (SEQ ID NO: 19) to 16 (SEQ ID NO: 24) in Table 4 were synthesized to have xbaI restriction enzyme regions at the 5' and 3' ends.

[0155] The pDZ-Pcj7-ramA vector was constructed using the primer pairs of SEQ ID NO: 19 and 20; the primer pairs of SEQ ID NO: 21 and 22; and the primer pairs of SEQ ID NO: 23 and 24 in the same manner as the vector construction method in Example 3-1 above.

[0156] Corynebacterium glutamicum KCCM11201P was transformed using pDZ-Pm1-ramA, pDZ-Pm2-ramA, pDZ-Pm3-ramA, and pDZ-Pcj7-ramA vectors via chromosomal homologous recombination (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). Strains with the vectors inserted into their chromosomes via homologous sequence recombination were selected in a medium containing kanamycin (25 mg / L). PCR was then performed on the Corynebacterium glutamicum transformants that underwent secondary recombination using SEQ ID NO: 9 and 10 to confirm strains with modified ramA promoters and strains replaced by the Pcj7 promoter.

[0157] Among the recombinant strains, Corynebacterium glutamicum KCCM11201P-Pm1-ramA, KCCM11201P-Pm2-ramA, and KCCM11201P-Pm3-ramA were named CA08-1518, CA08-1519, and CA08-1520, respectively, and were deposited on April 27, 2020, at the Korean Culture Center of Microorganisms (KCCM), an international depository recognized under the Budapest Treaty, with accession numbers KCCM12704P, KCCM12705P, and KCCM12706P, respectively.

[0158] Additionally, the strain with the Pcj7 promoter substituted was named KCCM11201P-Pcj7-ramA. Valine production capacity was then evaluated in the same manner as in Example 3-1 above, and the results are shown in Table 5 below.

[0159] Table 5

[0160]

[0161]

[0162] Based on the results in Table 5, it was confirmed that the L-valine production of strains KCCM11201P-Pm1-ramA (CA08-1518), KCCM11201P-Pm2-ramA (CA08-1519), and KCCM11201P-Pm3-ramA (CA08-1520), which include an improved promoter compared to strain KCCM11201P, increased by approximately 27%, 23%, and 19%, respectively, similar to or higher than the L-valine production capacity of strain KCCM11201P-Pcj7-ramA, which is replaced by a stronger promoter.

[0163] Example 3-3: Construction of mutant strains of Corynebacterium glutamicum CJ7V strain with modified and replaced ramA gene promoter and evaluation of the L-valine production capacity of the constructed strains.

[0164] To determine whether enhanced L-valine production was achieved in other L-valine-producing strains belonging to Corynebacterium glutamicum, a modification [ilvN(A42V); Biotechnology and Bioprocess Engineering, June 2014, Volume 19, Issue 3, pp 456-467] was introduced into wild-type Corynebacterium glutamicum ATCC14067 to prepare a strain with enhanced L-valine production capacity.

[0165] Specifically, genomic DNA was extracted from wild-type Corynebacterium glutamicum strain ATCC14067 using the G-spin Total DNA Extraction Mini Kit (Intron, catalog 17045) according to the kit's protocol. This genomic DNA was used as a template for PCR. To construct a vector introducing the A42V modification into the ilvN gene, gene fragments A and B were obtained using primer pairs SEQ ID NO: 25 and 26, and primer pairs SEQ ID NO: 27 and 28, respectively. PCR was performed under the following conditions: denaturation at 94°C for 5 minutes; 25 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 60 seconds, followed by polymerization at 72°C for 7 minutes.

[0166] As a result, polynucleotide fragments A and B, each consisting of 537 bp, were obtained. Using these two fragments as templates, overlap PCR was performed via SEQ ID NO: 25 and 26 to obtain a PCR product of 1044 bp (hereinafter referred to as "modification-introduced fragment 2").

[0167] After treating the introduced modified fragment 2 with the restriction enzyme XbaI (New England Biolabs, Beverly, MA), the modified introduced fragment 2 was ligated into the pDZ vector treated with the same restriction enzyme using T4 ligase (New England Biolabs, Beverly, MA). After transforming *E. coli* DH5α with the constructed gene, transformed strains were selected in LB medium containing kanamycin, and DNA was obtained from the transformed DNA using a DNA-spin plasmid DNA purification kit (iNtRON). The A42V modified vector used to introduce the ilvN gene was named pDZ-ilvN(A42V).

[0168] Table 6

[0169] Primers Base sequence SEQ ID NO: Primer 17 aatttctagaggcagaccctattctatgaagg SEQ ID NO:25 Primer 18 agtgtttcggtctttacagacacgagggac SEQ ID NO:26 Primer 19 gtccctcgtgtctgtaaagaccgaaacact SEQ ID NO:27 Primer 20 aatttctagacgtgggagtgtcactcgcttgg SEQ ID NO:28

[0170] Subsequently, wild-type Corynebacterium glutamicum ATCC14067 was transformed with the pDZ-ilvN(A42V) vector via chromosomal homologous recombination (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). Strains whose chromosomes had been inserted into the vector via homologous sequence recombination were selected in a medium containing kanamycin (25 mg / L). The gene fragments were then amplified by PCR using Corynebacterium glutamicum transformants that had undergone secondary recombination using SEQ ID NO: 25 and 26, and the modified strains were confirmed by gene sequencing. The recombinant strain was named Corynebacterium glutamicum CJ7V.

[0171] Finally, Corynebacterium glutamicum CJ7V was transformed with the vector in the same manner as in Examples 3-1 and 3-2, and the strains were named Corynebacterium glutamicum CJ7V-Pm1-ramA, CJ7V-Pm2-ramA, CJ7V-Pm3-ramA, and CJ7V-Pcj7-ramA, respectively. To compare the L-valine production capacity among the constructed strains, the strains were cultured in the same manner as in Example 3-1 above, and the L-valine concentration was analyzed. The analyzed concentrations of L-valine are shown in Table 7 below.

[0172] Table 7

[0173] Comparison of L-valine production capacity

[0174]

[0175] As shown in Table 7, it was confirmed that the L-valine production of strains CJ7V-Pm1-ramA, CJ7V-Pm2-ramA, and CJ7V-Pm3-ramA, which contain the improved promoter, increased by approximately 23%, 18%, and 14%, respectively, which is similar to or higher than the L-valine production capacity of strain CJ7V-Pcj7-ramA with a stronger promoter substitution.

[0176] Examples 3-4: Construction of mutant strains of Corynebacterium glutamicum CJ8V with modified and substituted ramA gene promoters and evaluation of the L-valine production capacity of the constructed strains.

[0177] To determine whether enhanced L-valine production capacity was achieved in other L-valine-producing strains belonging to Corynebacterium glutamicum, a modification was introduced into wild-type Corynebacterium glutamicum ATCC13869 in the same manner as in Examples 3-3 to prepare a strain with L-valine production capacity, and this recombinant strain was named Corynebacterium glutamicum CJ8V.

[0178] Finally, *Corynebacterium glutamicum* CJ8V was transformed with the vector in the same manner as in Examples 3-1 and 3-2, and the strains were named *Corynebacterium glutamicum* CJ8V-Pm1-ramA, CJ8V-Pm2-ramA, CJ8V-Pm3-ramA, and CJ8V-Pcj7-ramA, respectively. To compare L-valine production capacity among the constructed strains, the strains were cultured in the same manner as in Example 3-1 above, and the concentration of L-valine was analyzed. The analyzed concentrations of L-valine are shown in Table 8 below.

[0179] Table 8

[0180] L-valine production capacity

[0181]

[0182]

[0183] As shown in Table 8, it was confirmed that compared with the CJ8V strain, the L-valine production of the CJ8V-Pm1-ramA, CJ8V-Pm2-ramA and CJ8V-Pm3-ramA strains, including the improved promoter, increased by approximately 21%, 16% and 10%, respectively, which is similar to or higher than the L-valine production capacity of the CJ8V-Pcj7-ramA strain with a stronger promoter substitution.

[0184] Example 4. This example introduces promoter-modified L-leucine-producing Corynebacterium glutamicum KCCM11661P and... Construction of the KCCM11662P mutant strain and evaluation of its L-leucine production capacity.

[0185] Corynebacterium glutamicum KCCM11661P and KCCM11662P were transformed using pDZ-Pm1-ramA, pDZ-Pm2-ramA, pDZ-Pm3-ramA, and pDZ-Pcj7-ramA vectors via chromosomal homologous recombination (van der Rest et al., Appl Microbiol Biotechnol 52:541–545, 1999). Strains with vectors inserted into their chromosomes via homologous sequence recombination were selected in a medium containing kanamycin (25 mg / L). Then, PCR was performed on the Corynebacterium glutamicum transformants that underwent secondary recombination using SEQ ID NO: 9 and 10 to confirm strains with modified ramA promoters and strains replaced by Pcj7. The recombinant strains were named Corynebacterium glutamicum KCCM11661P-Pm1-ramA, KCCM11661PPm2-ramA, KCCM11661P-Pm3-ramA, KCCM11661P-Pcj7-ramA, KCCM11662P-Pm1-ramA, KCCM11662P-Pm2-ramA, KCCM11662P-Pm3-ramA, and KCCM11662P-Pcj7-ramA, respectively.

[0186] The constructed strains were cultured and their leucine production capacity was compared using the following method.

[0187] After subculturing each strain in nutrient medium, each strain was inoculated into a 250 mL baffled Erlenmeyer flask containing 25 mL of production medium and cultured at 30 °C with shaking at 200 rpm for 72 hours. The concentration of L-leucine was then analyzed by HPLC, and the analytical concentrations of L-leucine are shown in Table 9 below.

[0188] <Nutritional medium (pH 7.2)>

[0189] 10g glucose, 5g gravy, 10g polypeptone, 2.5g sodium chloride, 5g yeast extract, 20g agar, 2g urea (based on 1L distilled water)

[0190] <Production medium (pH 7.0)>

[0191] 50g glucose, 20g ammonium sulfate, 20g corn steep liquor, 1g dipotassium hydrogen phosphate, 0.5g magnesium sulfate heptahydrate, 100μg biotin, 1mg thiamine-HCl, and 15g calcium carbonate (based on 1L distilled water)

[0192] Table 9 L-Leucine Production Capacity

[0193]

[0194]

[0195] The results showed that the L-leucine production of strains KCCM11661P-Pm1-ramA, KCCM11661P-Pm2-ramA, and KCCM11661P-Pm3-ramA, including the improved promoter, was increased by 11%, 7%, and 11%, respectively, compared with strain KCCM11661P. This was similar to or higher than the L-leucine production capacity of strain KCCM11661P-Pcj7-ramA, which was replaced by a stronger promoter.

[0196] Furthermore, it was confirmed that the L-leucine production of strains KCCM11662P-Pm1-ramA, KCCM11662P-Pm2-ramA, and KCCM11662P-Pm3-ramA, including the improved promoter, was increased by 10%, 6%, and 10%, respectively, compared with strain KCCM11662P, and was similar to or higher than that of strain KCCM11662P-Pcj7-ramA with a stronger promoter substitution.

[0197] Example 5. Construction and evaluation of L-isoleucine production capacity of Corynebacterium KCCM11248P mutant strain with modified and replaced ramA gene promoter.

[0198] To determine whether the enhanced L-isoleucine production capacity was achieved in other L-isoleucine-producing strains belonging to Corynebacterium glutamicum, the Corynebacterium glutamicum strain KCCM11248P, which produces L-isoleucine, was transformed with a vector in the same manner as in Examples 3-1 and 3-2 above. The transformed strains were named Corynebacterium glutamicum KCCM11248P-Pm-ramA, KCCM11248P-Pm1-ramA, KCCM11248P-Pm2-ramA, KCCM11248P-Pm3-ramA, and KCCM11248P-Pcj7-ramA, respectively. Strains KCCM11248P-Pm-ramA, KCCM11248P-Pm1-ramA, KCCM11248P-Pm2-ramA, KCCM11248P-Pm3-ramA, and KCCM11248P-Pcj7-ramA were cultured using the following method, and their isoleucine production capacity was evaluated.

[0199] Each strain was inoculated into a 250mL Erlenmeyer flask with a baffle containing 25mL of seed culture medium and cultured at 30°C with shaking at 200rpm for 20 hours. Then, 1mL of seed culture medium was inoculated into a 250mL Erlenmeyer flask with a baffle containing 24mL of production culture medium and cultured at 30°C with shaking at 200rpm for 48 hours. The compositions of the seed culture medium and production culture medium are as follows.

[0200] Seed culture medium (pH 7.0)

[0201] 20g glucose, 10g peptone, 5g yeast extract, 1.5g urea, 4g KH₂PO₄, 8g K₂HPO₄, 0.5g MgSO₄·7H₂O, 100μg biotin, 1000μg thiamine HCl, 2000μg calcium pantothenate, and 2000μg nicotinamide (based on 1L distilled water)

[0202] <Production medium (pH 7.0)>

[0203] 50g glucose, 12.5g (NH4)2SO4, 2.5g soy protein, 5g corn steep liquor, 3g urea, 1g KH2PO4, 0.5g MgSO4·7H2O, 100μg biotin, 1000μg thiamine HCl, 2000μg calcium pantothenate, 3000μg nicotinamide, 30g CaCO3 (based on 1L distilled water)

[0204] After cultivation, the concentration of L-isoleucine was measured by HPLC, and the measured concentration of L-isoleucine is shown in Table 10 below.

[0205] Table 10

[0206]

[0207] The results showed that the L-isoleucine production of strains KCCM11248P-Pm1-ramA, KCCM11248P-Pm2-ramA, and KCCM11248P-Pm3-ramA, which contained the improved promoter, increased by 39%, 32%, and 18%, respectively, compared with strain KCCM11248P. This was similar to or higher than the L-isoleucine production capacity of strain KCCM11248P-Pcj7-ramA, which was replaced by a stronger promoter.

[0208] The above description of this disclosure is provided for illustrative purposes, and those skilled in the art will understand that various changes and modifications can be made without altering the technical concept and essential characteristics of this disclosure. Therefore, it is apparent that the above embodiments are exemplary in all respects and do not limit this disclosure. Consequently, the scope of this disclosure is not limited by the detailed description but by the claims and their equivalents, and all variations within the scope of the claims and their equivalents shall be construed as being included in this disclosure.

[0209]

[0210]

[0211] <110> CJ Daiichi Sugar Co., Ltd. <120> Microorganisms that enhance L-branched amino acid production capacity and methods for producing L-branched amino acids using them. <130> OPA21067-PCT <150> KR 10-2020-0061175 <151> 2020-05-21 <160> 28 <170> KoPatentIn 3.0 <210> 1 <211> 55 <212> DNA <213> Artificial sequence <220> <223> RamA gene promoter <400> 1 gcgatccgcc tcgactatgt tcacccccaa aggggaagta cactgtaccc ttgtc 55 <210> 2 <211> 125 <212> DNA <213> Artificial sequence <220> <223> RamA gene promoter variants <400> 2 gcgatccgcc tcgactatgt tcacccccaa aggggaagta taatgtaccc ttgtcgaatg 60 attgttatactc gtgacgcgcc ctatgggtgt accagcacgg gtgtaaagca ggaggaaatc 120 tgaag 125 <210> 3 <211> 55 <212> DNA <213> Artificial sequence <220> <223> RamA gene promoter variant Pm1 <400> 3 gcgatccgcc tcgactatgt tcacccccaa aggtgtggta taatggaccc ttgtc 55 <210> 4 <211> 55 <212> DNA <213> Artificial sequence <220> <223> RamA gene promoter variant Pm2 <400> 4 gcgatccgcc tcgactatgt tcacccccaa aggggaagta taatggaccc ttgtc 55 <210> 5 <211> 55 <212> DNA <213> Artificial sequence <220> <223> RamA gene promoter variant Pm3 <400> 5 gcgatccgcc tcgactatgt tcacccccaa aggtgtggta cactggaccc ttgtc 55 <210> 6 <211> 512 <212> DNA <213> Artificial sequence <220> <223> RamA gene promoter variant Pcj7 <400> 6 gcgatccgcc tcgactatgt tcacccccaa aggggaagta cactgtaccc ttgtcgaatg 60 attgttactc gtgacgcgcc ctatgggtgt accagcacgg gtgtaaagca ggaggaaatc 120 tgaaggtacc gccggcatag cctaccgatg tagattccac cccatctgtc tcccagtaca 180 ttttttcatg accccagaaa catcccagcg ctactaatag ggagcgttga ccttccttcc 240 acggaccggt aatcggagtg cctaaaaccg catgcggctt aggctccaag ataggttctg 300 cgcggccggg taatgcatct tctttagcaa caagttgagg ggtaggtgca aataagaacg 360 acatagaaat cgtctccttt ctgtttttaa tcaacataca ccaccaccta aaaattcccc 420 gaccagcaag ttcacagtat tcgggcacaa tatcgttgcc aaaatattgt ttcggaatat 480 catgggatac gtacccaacg aaaggaaaca ct 512 <210> 7 <211> 846 <212> DNA <213> Artificial sequence <220> <223> RamA gene ATCC14067 <400> 7 gtggataccc agcggattaa agatgacgaa gatgctattc gttcggcgct gacatcgctg 60 aaaaccgcaa caggcatccc agtcaccatg ttcgccactg tgttgcagga caatcgcctg 120 caaattactc agtgggttgg gttgcgtacc ccggctctgc agaatctggt cattgaacca 180 ggtgtgggcg ttggtggacg cgtcgtcgca acccgtcgtc cggttggtgt gagtgattac 240 accagggcaa atgtcatttc acatgagaag gattccgcga ttcaggatga gggccttcat 300 tccattgtcg cagttcccgt gatcgtgcac cgcgaaatcc gtggcgtttt gtatgttggc 360 gttcactctg cggtgcgtct cggcgacact gttattgaag aagtcaccat gactgcgcgc 420 acgttggaac aaaacctggc gatcaactcc gcgcttcgcc gcaatggcgt tcctgatggt 480 cgcggttccc tcaaagctag ccgcgtgatg aatggggcgg agtgggagca ggttcgttcc 540 actcattcca agctgcgcat gctggcaaat cgtgtgaccg atgaggatct gcgccgcgat 600 ttggaagagc tttgcgatca gatggtcacc ccagtccgca tcaagcagac caccaagctg 660 tccgcgcgtg agttggacgt gctggcttgt gtcgcgctcg gtcacaccaa cgtcgaagct 720 gctgaagaga tgggcatcgg cgcggaaacc gtcaagagct acctgcgctc ggtcatgcgc 780 aagctcggcg cccacacgcg ctacgaggca gtcaacgcag cacgccggat cggcgcactg 840 ccttaa 846 <210> 8 <211> 281 <212> PRT <213> Artificial Sequence <220> <223> RamA gene ATCC14067 a.a. <400> 8 Met Asp Thr Gln Arg Ile Lys Asp Asp Glu Asp Ala Ile Arg Ser Ala 1 5 10 15 Leu Thr Ser Leu Lys Thr Ala Thr Gly Ile Pro Val Thr Met Phe Ala 20 25 30 Thr Val Leu Gln Asp Asn Arg Leu Gln Ile Thr Gln Trp Val Gly Leu 35 40 45 Arg Thr Pro Ala Leu Gln Asn Leu Val Ile Glu Pro Gly Val Gly Val 50 55 60 Gly Gly Arg Val Val Ala Thr Arg Arg Pro Val Gly Val Ser Asp Tyr 65 70 75 80 Thr Arg Ala Asn Val Ile Ser His Glu Lys Asp Ser Ala Ile Gln Asp 85 90 95 Glu Gly Leu His Ser Ile Val Ala Val Pro Val Ile Val His Arg Glu 100 105 110 Ile Arg Gly Val Leu Tyr Val Gly Val His Ser Ala Val Arg Leu Gly 115 120 125 Asp Thr Val Ile Glu Glu Val Thr Met Thr Ala Arg Thr Leu Glu Gln 130 135 140 Asn Leu Ala Ile Asn Ser Ala Leu Arg Arg Asn Gly Val Pro Asp Gly 145 150 155 160 Arg Gly Ser Leu Lys Ala Ser Arg Val Met Asn Gly Ala Glu Trp Glu 165 170 175 Gln Val Arg Ser Thr His Ser Lys Leu Arg Met Leu Ala Asn Arg Val 180 185 190 Thr Asp Glu Asp Leu Arg Arg Asp Leu Glu Glu Leu Cys Asp Gln Met 195 200 205 Val Thr Pro Val Arg Ile Lys Gln Thr Thr Lys Leu Ser Ala Arg Glu 210 215 220 Leu Asp Val Leu Ala Cys Val Ala Leu Gly His Thr Asn Val Glu Ala 225 230 235 240 Ala Glu Glu Met Gly Ile Gly Ala Glu Thr Val Lys Ser Tyr Leu Arg 245 250 255 Ser Val Met Arg Lys Leu Gly Ala His Thr Arg Tyr Glu Ala Val Asn 260 265 270 Ala Ala Arg Arg Ile Gly Ala Leu Pro 275 280 <210> 9 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 9 gctctagata ggccggttcg gactcgccct gcc 33 <210> 10 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 10 gctctagaaa cgtgcgcgca gtcatggtga ctt 33 <210> 11 <211> 50 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 11 gctcggtacc cggggatcct ctagataggc cggttcggac tcgccctgcc 50 <210> 12 <211> 50 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 12 ttacgccaag cttgcatgct ctagaaacgt gcgcgcagtc atggtgactt 50 <210> 13 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 13 cgacaagggt ccattatacc acacctttgg gggt 34 <210> 14 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 14 acccccaaag gtgtggtata atggaccctt gtcg 34 <210> 15 <211> 29 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 15 tcgacaaggg tacatattatac ttccccttt 29 <210> 16 <211> 29 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 16 aaaggggaag tataatgtac ccttgtcga 29 <210> 17 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 17 aagggtacag tgtaccacac ctttgggggt 30 <210> 18 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 18 acccccaaag gtgtggtaca ctgtaccctt 30 <210> 19 <211> 50 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 19 attcgagctc ggtacccggt ctagatcaag aaactgcagg tgtgtaccga 50 <210> 20 <211> 50 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 20 catcggtagg ctatgccggc ggtaccttca gatttcctcc tgctttacac 50 <210> twenty one <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primers <400> twenty one gtaccgccgg catagcctac cgatg 25 <210> twenty two <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primers <400> twenty two agtgtttcctttcgttgggt acgta 25 <210> twenty three <211> 50 <212> DNA <213> Artificial sequence <220> <223> Primers <400> twenty three tacgtaccca acgaaaggaa acactgtgga tacccagcgg attaaagatg 50 <210> twenty four <211> 50 <212> DNA <213> Artificial sequence <220> <223> Primers <400> twenty four tgcatgcctg caggtcgact ctagaatcgc ggcgcagatc ctcatcggtc 50 <210> 25 <211> 32 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 25 aatttctaga ggcagaccct attctatgaa gg 32 <210> 26 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 26 agtgtttcgg tctttacaga cacgagggac 30 <210> 27 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 27 gtccctcgtg tctgtaaaga ccgaaacact 30 <210> 28 <211> 32 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 28 aatttctaga cgtgggagtg tcactcgctt gg 32

Claims

1. Corynebacterium glutamicum that produces L-branched amino acids ( Corynebacterium glutamicum Microorganisms that possess enhanced activity of acetic acid metabolism regulator A. The microorganisms described herein contain polynucleotides with promoter activity of acetic acid metabolism regulator A. The polynucleotide thereon consists of a nucleotide sequence selected from SEQ ID NO: 3-5.

2. A method for producing L-branched amino acids, the method comprising culturing the Corynebacterium glutamicum microorganism according to claim 1 in a culture medium.

3. The method according to claim 2, further comprising recovering or separating the L-branched amino acid from the culture medium or the microorganism.

4. A polynucleotide having promoter activity of acetic acid metabolism regulator A, and wherein the polynucleotide is composed of a nucleotide sequence selected from SEQ ID NO: 3-5.

Images