Multiplexed methods for detecting different analytes and different subsets / variations of analytes in a sample

CN115702249BActive Publication Date: 2026-09-08리졸브바이오사이언시즈게엠베하
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
CN202180041893.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2020-12-23
Filing Date
2021-06-18
Publication Date
2026-09-08
Estimated Expiration
2041-06-18

AI Technical Summary

Technical Problem

尤其,它们不灵活、昂贵、复杂、耗时并且经常提供不准确的结果

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003990904570000541
    Figure BDA0003990904570000541
  • Figure BDA0003990904570000551
    Figure BDA0003990904570000551
  • Figure BDA0003990904570000561
    Figure BDA0003990904570000561
Patent Text Reader

Abstract

The technology provided herein relates to multiplexed methods and kits for detecting different analytes and different subsets / variations of analytes in a sample, as well as in vitro methods for screening, identifying, and / or testing substances and / or drugs, in vitro methods for diagnosing diseases, and optical multiplexing systems.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The technologies provided herein relate to multiplex methods and kits for parallel detection of different analytes and different subgroups / variants of analytes in samples, which are performed by sequential signal encoding of the analytes, as well as in vitro methods for screening, identifying and / or testing substances and / or drugs and in vitro methods for diagnosing diseases, and optical multiplexing systems. Background Technology

[0002] The analysis and detection of small amounts of analytes in biological and non-biological samples has become routine practice in clinical and analytical settings. Numerous analytical methods have been developed for this purpose. Some of these employ coding techniques that assign specific, readable codes to specific first analytes, distinct from the codes assigned to specific second analytes.

[0003] One existing technique in this field is the so-called 'single-molecule fluorescence in situ hybridization' (smFISH), which is primarily developed for the detection of mRNA molecules in samples. In Lubeck et al. (2014), Single-cell in situ RNA profiling by sequential hybridization, Nat. Methods 11(4), pp. 360-361, target mRNA is detected via a set of specifically labeled probes. After one round of hybridization and detection, the mRNA-specific probe set is eluted from the mRNA, and the same probe set with other (or the same) fluorescent labels is used for the next round of hybridization and imaging to generate a gene-specific color code scheme over several rounds. This technique requires several differently labeled probe sets for each transcript and these probe sets need to be denatured after each round of detection.

[0004] Further developments in this technology do not use directly labeled probe sets. Instead, the oligonucleotides in the probe set provide nucleic acid sequences that serve as initiators for hybridization chain reactions (HCRs), a technique that enables signal amplification; see Shah et al. (2016), In situ transcription profiling of single cells reveals spatial organization of cells in the mouse hippocampus, Neuron 92(2), pp. 342-357.

[0005] Chen et al. (2015), RNA imaging. Spatially resolved, highly multiplexed RNA profiling in single cells, Science 348(6233):aaa6090, describes another technique called 'multiplexed error robust fluorescence in situ hybridization' (merFISH). In this technique, target mRNA is detected via a specific probe set that provides additional sequence elements for subsequent specific hybridization of fluorescently labeled oligonucleotides. Each probe set provides four different sequence elements out of a total of 16. After hybridization of the specific probe set with the target mRNA, a so-called readout hybridization is performed. In each readout hybridization, one of the 16 fluorescently labeled oligonucleotides complementary to one of the sequence elements is hybridized. All readout oligonucleotides use the same fluorescent color. After imaging, the fluorescence signal is destroyed by illumination, and the next round of readout hybridization is performed without a denaturation step. As a result, a binary code is generated for each mRNA species. The unique signal characteristics of the four signals in 16 rounds were generated using only a single round of hybridization to bind the specific probe set to the target mRNA, followed by 16 rounds of hybridization on the readout oligonucleotide labeled with a single fluorescent color.

[0006] Further developments in this technology have increased throughput by using two different fluorescent colors, eliminating the signal via disulfide bond cleavage between the readout oligonucleotide and the fluorescent label, and using alternative hybridization buffers; see Moffitt et al. (2016), High-throughput single-cell gene-expression profiling with multiplexed error-robust fluorescence in situ hybridization, Proc. Natl. Acad. Sci. US A. 113(39), p. 11046-11051.

[0007] The technique known as 'intron seqFISH' is described below: Shah et al. (2018), Dynamics and spatial genomics of the nascent transcriptome by intron seqFISH, Cell 117(2), p.363-376. In this technique, target mRNA is detected via a specific probe set that provides additional sequence elements for subsequent specific hybridization of fluorescently labeled oligonucleotides. Each probe set provides one of 12 possible sequence elements (representing 12 'pseudo-colors' used) in each round of color coding. Each round of color coding consists of four series of hybridizations. In each of these series of hybridizations, three readout probes (each labeled with a different fluorophore) hybridize with the corresponding element from the mRNA-specific probe set. After imaging, the readout probes are stripped with 55% formamide buffer, and the next hybridization is then performed. Color coding is completed after 5 rounds of color coding (each with 4 series of hybridizations).

[0008] EP 0 611 828 discloses probes that use bridging elements to recruit signal-generating elements to specifically bind analytes. More specifically, it describes the detection of nucleic acids via specific probes that recruit bridging nucleic acid molecules. These bridging nucleic acids ultimately recruit signal-generating nucleic acids. The document also describes the use of bridging elements, such as branched DNA, with more than one binding site for signal generation elements to amplify the signal.

[0009] Player et al. (2001), Single-copy gene detection using branched DNA (bDNA) in situ hybridization, J. Histochem. Cytochem. 49(5), pp. 603-611, describes a method in which a target nucleic acid is detected via a specific set of probes that provide additional sequence elements. In a second step, preamplifier oligonucleotides hybridize with this sequence element. The preamplifier oligonucleotide includes multiple binding sites for amplifier oligonucleotides used for hybridization in subsequent steps. These amplifier oligonucleotides provide multiple sequence elements for the labeled oligonucleotide. This establishes an oligonucleotide tree that leads to branching that amplifies the signal.

[0010] The following describes a further development of this mentioned method: Wang et al. (2012), RNAscope: an autism in situ RNA analysis platform for formalin-fixed, paraffin-embedded tissues, J. Mol. Diagn. 14(1), p. 22-29, which uses an alternative design of mRNA-specific probes. In this design, two mRNA-specific oligonucleotides must hybridize very closely to provide sequences that can recruit preamplified oligonucleotides. This improves the specificity of the method by reducing the number of false positive signals.

[0011] Choi et al. (2010), Programmable in situ amplification for multiplexed imaging of mRNA expression, Nat. Biotechnol. 28(11), pp. 1208-1212, disclose a method called 'HCR-hybridization chain reaction'. Target mRNA is detected via a specific set of probes that provide additional sequence elements. These additional sequence elements are the starting sequences that initiate the hybridization chain reaction. Essentially, the hybridization chain reaction is based on metastable oligonucleotide hairpins, which self-assemble into a polymer after the first hairpin is opened via the starting sequence.

[0012] Further development of this technology uses so-called split initiation probes, which must hybridize very closely to form the initiation sequence for HCR, similar to RNAscope technology, which reduces the number of false positive signals; see Choi et al. (2018), Third-generation in situ hybridization chain reaction: multiplexed, quantitative, sensitive, versatile, robust. Development 145(12).

[0013] Mateo et al. (2019), Visualizing DNA folding and RNA in embryos at single-cell resolution, Nature Vol, 568, p. 49ff, disclosed a method called 'Optical Reconstruction of Chromatin Structure (ORCA)'. This method aims to make chromosome lines visible.

[0014] EP 2 992 115 B1 describes a method for sequential single-molecule hybridization and provides techniques for detecting and / or quantifying nucleic acids in cells, tissues, organs or organisms by sequential barcoding.

[0015] However, the methods known in this field have many drawbacks. In particular, they are inflexible, expensive, complex, time-consuming, and often provide inaccurate results. Furthermore, existing methods have limited coding capabilities and do not meet the requirements of modern molecular biology and medicine.

[0016] In this context, the purpose of this disclosure is to provide a method that can reduce or even avoid the drawbacks of existing technical methods. Summary of the Invention

[0017] This disclosure relates to a novel multiplexing method for parallel detection of different analytes and different subgroups / variants of the analytes in a sample, which is performed by sequential signal encoding of the analytes and / or variants.

[0018] In particular, this disclosure relates to multiplex methods for detecting different analytes and different subgroups / variants of analytes in a sample, comprising:

[0019] (A) The sample is contacted with at least twenty (20) different sets of analyte-specific probes encoding at least 20 different analytes, each set of analyte-specific probes interacting with a different analyte, wherein, if the analyte is a nucleic acid, each set of analyte-specific probes includes at least five (5) analyte-specific probes that specifically interact with different substructures of the same analyte, each analyte-specific probe including

[0020] (aa) binding element (S), specifically interacts with one of the different analytes to be encoded, and

[0021] (bb) Identifier element (T), comprising a unique nucleotide sequence for the analyte being encoded (unique identifier sequence),

[0022] In this context, the analyte-specific probes from a specific analyte-specific probe group differ from those from another analyte-specific probe group in the nucleotide sequence of the identifier element (T).

[0023] In each analyte-specific probe set, the analyte-specific probes bind to the same analyte and include the same nucleotide sequence of a unique identifier element (T) for the analyte; and

[0024] The sample is brought into contact with at least two different sets of analyte-specific probes for at least one analyte and its variants.

[0025] Among these different groups, the analyte-specific probes interact with the same analyte, but with different substructures of the same analyte.

[0026] Specifically, the analyte-specific probes in the first analyte-specific probe group interact with the substructures included in all variants of the analyte.

[0027] Specifically, the analyte-specific probes (subgroup-specific probes) of the second analyte-specific probe group interact with substructures that are only included in specific variants of the analyte.

[0028] The first analyte-specific probe group comprises analyte-specific probes that include identical identifier elements (T), each identifier element comprising a nucleotide sequence unique to the analyte being encoded (a unique identifier sequence).

[0029] In this second analyte-specific probe set, the analyte-specific probes include the same identifier element (T), which comprises a nucleotide sequence unique to the analyte to be encoded (a unique identifier sequence).

[0030] The identifier element (T) of the analyte-specific probes in the first analyte-specific probe group is different from the identifier element (T) of the analyte-specific probes in the second analyte-specific probe group, in order to bind different decoding oligonucleotides and / or non-signal decoding oligonucleotides.

[0031] (B) Contact the sample with at least one decoding oligonucleotide set for each analyte, wherein in each decoding oligonucleotide set for an individual analyte, each decoding oligonucleotide comprises:

[0032] (aa) Identifier connector element (t), comprising a nucleotide sequence substantially complementary to at least a portion of the unique identifier sequence of the identifier element (T) of the corresponding analyte-specific probe set, and

[0033] (bb) Translator element (c), including nucleotide sequences that allow specific hybridization of signal oligonucleotides;

[0034] Among them, one set of decoding oligonucleotides used for individual analytes differs from another set of decoding oligonucleotides used for different analytes in terms of the first linker element (t); and

[0035] (C) Contact the sample with at least one group of signal oligonucleotides, each signal oligonucleotide comprising:

[0036] (aa) A translator linker element (C), comprising a nucleotide sequence substantially complementary to at least a portion of the nucleotide sequence of the translator element (C) included in the decoding oligonucleotide, and

[0037] (bb) Signal components.

[0038] (D) Detect the signal caused by the signal element;

[0039] (E) Selectively remove decoding oligonucleotides and signal oligonucleotides from the sample, thereby substantially maintaining the specific binding of the analyte-specific probe to the analyte to be encoded;

[0040] (F) Perform at least three (3) additional loops, including steps B) through E), to generate an encoding scheme with codewords for each analyte.

[0041] (G) Perform at least one (1) additional cycle including steps B) to E) to identify subgroup-specific probes, wherein, in particular, the cycle may be stopped at step (D).

[0042] Furthermore, this disclosure relates to improving the efficiency of coding schemes by using improved decoding oligonucleotides. The so-called "multi-decoder" allows the recruitment of more than one signaling oligonucleotide, and therefore new signal types can be generated by utilizing combinations of two or more different signaling oligonucleotides without reducing signal strength.

[0043] In another aspect, embodiments of this disclosure particularly relate to a method for detecting multiple analytes in a sample, the method being performed by sequentially signal encoding the analytes, the method comprising:

[0044] (A) The sample is contacted with at least twenty (20) different sets of analyte-specific probes encoding at least 20 different analytes, each set of analyte-specific probes interacting with a different analyte, wherein, if the analyte is a nucleic acid, each set of analyte-specific probes includes at least five (5) analyte-specific probes that specifically interact with different substructures of the same analyte, each analyte-specific probe including

[0045] (aa) binding element (S), specifically interacts with one of the different analytes to be encoded, and

[0046] (bb) Identifier element (T), comprising a unique nucleotide sequence for the analyte being encoded (unique identifier sequence),

[0047] In this context, the analyte-specific probes from a specific analyte-specific probe group differ from those from another analyte-specific probe group in the nucleotide sequence of the identifier element (T).

[0048] In each analyte-specific probe set, the analyte-specific probes bind to the same analyte and include the same nucleotide sequence of a unique identifier element (T) for the analyte; and

[0049] (B) Contact the sample with at least one decoding oligonucleotide set for each analyte, wherein in each decoding oligonucleotide set for an individual analyte, each decoding oligonucleotide comprises:

[0050] (aa) Identifier linker element (t), comprising a nucleotide sequence substantially complementary to at least a portion of the unique identifier sequence of the identifier element (T) of the corresponding analyte-specific probe set, and

[0051] (bb) Translator element (c), including nucleotide sequences that allow specific hybridization of signal oligonucleotides;

[0052] Among them, one set of decoding oligonucleotides used for individual analytes differs from another set of decoding oligonucleotides used for different analytes in terms of the first linker element (t); and

[0053] (C) Contact the sample with at least one group of signal oligonucleotides, each signal oligonucleotide comprising:

[0054] (aa) A translator linker element (C), comprising a nucleotide sequence substantially complementary to at least a portion of the nucleotide sequence of the translator element (C) included in the decoding oligonucleotide, and

[0055] (bb) Signal components.

[0056] (D) Detect the signal caused by the signal element;

[0057] (E) Selectively remove the decoding oligonucleotide and signal oligonucleotide from the sample, thereby substantially maintaining the specific binding of the analyte-specific probe to the analyte to be encoded;

[0058] (F) Perform at least three (3) additional loops, including steps B) to E), to generate an encoding scheme with codewords for each analyte, wherein the last loop may stop at step (D).

[0059] In another aspect, embodiments of this disclosure relate to a kit for multiplex analyte coding, the kit comprising:

[0060] (A) At least twenty (20) different analyte-specific probe sets for encoding at least 20 different analytes, each analyte-specific probe set interacting with a different analyte, wherein, if the analyte is a nucleic acid, each analyte-specific probe set includes at least five (5) analyte-specific probes that specifically interact with different substructures of the same analyte, each analyte-specific probe including

[0061] (aa) binding element (S), specifically interacts with one of the different analytes to be encoded, and

[0062] (bb) Identifier element (T), comprising a unique nucleotide sequence for the analyte being encoded (unique identifier sequence),

[0063] In this context, the analyte-specific probes from a specific analyte-specific probe group differ from those from another analyte-specific probe group in the nucleotide sequence of the identifier element (T).

[0064] In each analyte-specific probe set, the analyte-specific probes bind to the same analyte and include the same nucleotide sequence of a unique identifier element (T) for the analyte; and

[0065] (B) At least one decoding oligonucleotide set for each analyte, wherein, in each decoding oligonucleotide set for an individual analyte, each decoding oligonucleotide comprises:

[0066] (aa) Identifier linker element (t), comprising a nucleotide sequence substantially complementary to at least a portion of the unique identifier sequence of the identifier element (T) of the corresponding analyte-specific probe set, and

[0067] (bb) Translational elements (c) include nucleotide sequences that allow specific hybridization of signal oligonucleotides;

[0068] Among them, one set of decoding oligonucleotides used for an individual analyte differs from another set of decoding oligonucleotides used for different analytes in terms of the identifier linking element (t); and

[0069] (C) Signal oligonucleotide set, each signal oligonucleotide comprising:

[0070] (aa) A translator linker element (C), comprising a nucleotide sequence substantially complementary to at least a portion of the nucleotide sequence of the translator element (C) included in the decoding oligonucleotide, and

[0071] (bb) Signal components.

[0072] In another aspect, embodiments of this disclosure relate to in vitro methods for diagnosing diseases selected from the group consisting of: cancer, neuronal diseases, cardiovascular diseases, inflammatory diseases, autoimmune diseases, diseases caused by viral or bacterial infections, skin diseases, skeletal muscle diseases, dental diseases, and prenatal diseases, said methods including the use of multiple methods according to this disclosure.

[0073] In another aspect, embodiments of this disclosure provide an in vitro method for diagnosing plant diseases selected from the group consisting of: diseases caused by biotic stress, preferably diseases caused by infection and / or parasites, or diseases caused by abiotic stress, preferably diseases caused by nutrient deficiency and / or adverse environments, the method comprising using multiple methods according to this disclosure.

[0074] In another aspect, some embodiments of this disclosure relate to optical multiplexing systems suitable for the methods according to this disclosure, comprising at least:

[0075] - At least one reaction vessel for containing a kit or a portion thereof according to this disclosure;

[0076] - Detection unit, the detection unit including a microscope, especially a fluorescence microscope.

[0077] -Camera

[0078] - Liquid handling equipment.

[0079] In another aspect, some embodiments of this disclosure relate to a kit for multiplex analyte coding, the kit comprising:

[0080] (A) At least twenty (20) different analyte-specific probe sets for encoding at least 20 different analytes, each analyte-specific probe set interacting with a different analyte, wherein, if the analyte is a nucleic acid, each analyte-specific probe set includes at least five (5) analyte-specific probes that specifically interact with different substructures of the same analyte, each analyte-specific probe including

[0081] (aa) binding element (S), specifically interacts with one of the different analytes to be encoded, and

[0082] (bb) Identifier element (T), comprising a unique nucleotide sequence for the analyte being encoded (unique identifier sequence),

[0083] In this context, the analyte-specific probes from a specific analyte-specific probe group differ from those from another analyte-specific probe group in the nucleotide sequence of the identifier element (T).

[0084] In each analyte-specific probe set, the analyte-specific probes bind to the same analyte and include the same nucleotide sequence of a unique identifier element (T) for the analyte; and

[0085] (B) At least one decoding oligonucleotide set for each analyte, wherein, in each decoding oligonucleotide set for an individual analyte, each decoding oligonucleotide comprises:

[0086] (aa) Identifier linker element (t), comprising a nucleotide sequence substantially complementary to at least a portion of the unique identifier sequence of the identifier element (T) of the corresponding analyte-specific probe set, and

[0087] (bb) Translational elements (c) include nucleotide sequences that allow specific hybridization of signal oligonucleotides;

[0088] Among them, one set of decoding oligonucleotides used for an individual analyte differs from another set of decoding oligonucleotides used for different analytes in terms of the identifier linking element (t); and

[0089] (C) Signal oligonucleotide set, each signal oligonucleotide comprising:

[0090] (aa) A translator linker element (C), comprising a nucleotide sequence substantially complementary to at least a portion of the nucleotide sequence of the translator element (C) included in the decoding oligonucleotide, and

[0091] (bb) Signal components,

[0092] The kit includes at least two different sets of analyte-specific probes for the analyte.

[0093] Among these different groups, the analyte-specific probes interact with the same analyte, but with different substructures of the same analyte.

[0094] Specifically, the analyte-specific probes in the first analyte-specific probe group interact with the substructures included in all variants of the analyte.

[0095] Specifically, the analyte-specific probes (subgroup-specific probes) of the second analyte-specific probe group interact with substructures that are only included in specific variants of the analyte.

[0096] The first analyte-specific probe group comprises analyte-specific probes that include identical identifier elements (T), each identifier element comprising a nucleotide sequence unique to the analyte being encoded (a unique identifier sequence).

[0097] In this second analyte-specific probe set, the analyte-specific probes include the same identifier element (T), which comprises a nucleotide sequence unique to the analyte to be encoded (a unique identifier sequence).

[0098] The identifier element (T) of the analyte-specific probes in the first analyte-specific probe group is different from the identifier element (T) of the analyte-specific probes in the second analyte-specific probe group.

[0099] Furthermore, some implementations involve kits for multiplex analyte coding, including

[0100] (A) Optionally used to encode at least twenty (20) different analyte-specific probe sets, each analyte-specific probe set interacting with a different analyte, wherein, if the analyte is a nucleic acid, each analyte-specific probe set includes at least five (5) analyte-specific probes that specifically interact with different substructures of the same analyte, each analyte-specific probe including

[0101] (aa) binding element (S), specifically interacts with one of the different analytes to be encoded, and

[0102] (bb) Identifier element (T), comprising a unique nucleotide sequence for the analyte being encoded (unique identifier sequence),

[0103] In this context, the analyte-specific probes from a specific analyte-specific probe group differ from those from another analyte-specific probe group in the nucleotide sequence of the identifier element (T).

[0104] In each analyte-specific probe group, the analyte-specific probes bind to the same analyte and include the same nucleotide sequence of a unique identifier element (T) for the analyte; and

[0105] (B) At least one decoding oligonucleotide set for each analyte, wherein, in each decoding oligonucleotide set for an individual analyte, each decoding oligonucleotide comprises:

[0106] (aa) Identifier linker element (t), comprising a nucleotide sequence substantially complementary to at least a portion of the unique identifier sequence of the identifier element (T) of the corresponding analyte-specific probe set, and

[0107] (bb) Translational elements (c) include nucleotide sequences that allow specific hybridization of signal oligonucleotides;

[0108] Among them, one set of decoding oligonucleotides used for an individual analyte differs from another set of decoding oligonucleotides used for different analytes in terms of the identifier linking element (t); and

[0109] (C) Signal oligonucleotide set, each signal oligonucleotide comprising:

[0110] (aa) A translator linker element (C), comprising a nucleotide sequence substantially complementary to at least a portion of the nucleotide sequence of the translator element (C) included in the decoding oligonucleotide, and

[0111] (bb) Signal components.

[0112] In another aspect, some embodiments provide in vitro methods for screening, identifying, and / or testing substances and / or drugs, including:

[0113] (a) Contacting the test sample, including the sample, with the substance and / or drug.

[0114] (b) Different analytes in a sample are detected by sequential signal encoding of the analytes according to the method of this disclosure.

[0115] In another aspect, embodiments of this disclosure extend the multiplex method for detecting different analytes by targeting subgroups of targets in the sample (described in the first aspect). Sequential signal encoding of a probe set is performed as described, and at least one additional probe set is added to distinguish the target subgroups.

[0116] The decoding (multi-round) of the main analyte is performed as described (A to I of the first aspect). To identify subgroups of the analyte, additional signals are generated and analyzed in conjunction with the encoding of the main analyte. The method includes:

[0117] (A) The sample is contacted with at least twenty (20) different sets of analyte-specific probes encoding at least 20 different analytes, each set of analyte-specific probes interacting with a different analyte, wherein, if the analyte is a nucleic acid, each set of analyte-specific probes includes at least five (5) analyte-specific probes that specifically interact with different substructures of the same analyte, each analyte-specific probe including

[0118] (aa) binding element (S), specifically interacts with one of the different analytes to be encoded, and

[0119] (bb) Identifier element (T), comprising a unique nucleotide sequence for the analyte being encoded (unique identifier sequence),

[0120] In this context, the analyte-specific probes from a specific analyte-specific probe group differ from those from another analyte-specific probe group in the nucleotide sequence of the identifier element (T).

[0121] In each analyte-specific probe group, the analyte-specific probes bind to the same analyte and include the same nucleotide sequence of a unique identifier element (T) for the analyte; and,

[0122] (A2) Contact at least one subgroup of an analyte with a group of at least five (5) subgroup-specific probes, said subgroup-specific probes being different from the analyte-specific probes of another group of analyte-specific probes in terms of the nucleotide sequence of the identifier element (T).

[0123] (B) Contact the sample with at least one decoding oligonucleotide set for each analyte, wherein in each decoding oligonucleotide set for an individual analyte, each decoding oligonucleotide comprises:

[0124] (aa) Identifier linker element (t), comprising a nucleotide sequence substantially complementary to at least a portion of the unique identifier sequence of the identifier element (T) of the corresponding analyte-specific probe set, and

[0125] (bb) Translator element (c), including nucleotide sequences that allow specific hybridization of signal oligonucleotides;

[0126] Among them, one set of decoding oligonucleotides used for individual analytes differs from another set of decoding oligonucleotides used for different analytes in terms of the first linker element (t); and

[0127] (C) Contact the sample with at least one group of signal oligonucleotides, each signal oligonucleotide comprising:

[0128] (aa) A translator linker element (C), comprising a nucleotide sequence substantially complementary to at least a portion of the nucleotide sequence of the translator element (C) included in the decoding oligonucleotide, and

[0129] (bb) Signal components.

[0130] (G) Detect the signal caused by the signal element;

[0131] (H) Selectively remove the decoding oligonucleotide and signal oligonucleotide from the sample, thereby substantially maintaining the specific binding of the analyte-specific probe to the analyte to be encoded;

[0132] (I) Perform at least three (3) additional loops, including steps B) through E), to generate an encoding scheme with codewords for each analyte.

[0133] (J) Perform at least one (1) additional cycle including steps B) to E) to identify the subgroup-specific probes contacted in step A2), wherein, in particular, the last cycle may be stopped at step (D).

[0134] According to this disclosure, each target (e.g., the mRNA of a single gene) or group of targets uses a unique tag (identifier). Groups can be formed to indicate a certain identity, process, biological function, or disease (e.g., cell type, inflammation, signal processing, cancer).

[0135] Surprisingly, the methods and kits according to this disclosure result in reduced complexity. Many different probes with different binding sequences share the same (one per target) unique tag. These tags reduce sequence complexity (to one per target) and also possess predetermined constant properties (e.g., thermodynamic stability).

[0136] The advantages of the method and kit according to this disclosure are:

[0137] a) The process of identifying tags is fully flexible, such as using more or fewer signals and / or rounds, different numbers of fluorophores, and the total number of signals per tag → fewer targets (e.g., 20) can be identified with high confidence in fewer rounds (e.g., 4 rounds) compared to a large number of targets (e.g., 100, which require 8 rounds to achieve the same level of confidence), even if the exact same unique tag is used in both cases.

[0138] b) Use (recycle) all unique tags in many consecutive hybridization rounds, and all primary probes contribute (provide information about their identity) in each round of identification.

[0139] c) All labels share the same predefined properties (e.g., thermodynamic stability that allows selective denaturation).

[0140] d)

[0141] In some advantageous implementations, the unique label is designed as follows:

[0142] - There is no cross-hybridization between all oligonucleotides in the process (probe, decoder, readout), so all tag sequences can be used together (compatible).

[0143] - There is no cross-hybridization between connector elements (bridges) with different unique tags.

[0144] - The hybridization stability of the unique tag should be within a narrow range: as stable as possible (rapid hybridization, i.e., short cycle time), but significantly different from the primary probe (used for differential denaturation, without removing the primary probe) (in which case it is less stable).

[0145] Therefore, this specification specifically relates to the use of labeled and unlabeled nucleic acid sequence sets for the specific quantification and / or spatial detection of different analytes in parallel via specific hybridization. This technique allows for the differentiation of more distinct analytes compared to the various available detection signals. This differentiation is achieved via sequential signal encoding of the analytes, which is accomplished through several cycles of specific hybridization, signal detection, and selective elution of the hybridized nucleic acid sequences. Unlike other state-of-the-art methods, the oligonucleotides providing the detectable signal do not interact directly with the sample-specific nucleic acid sequence, but are mediated by so-called “decoding oligonucleotides.” This mechanism decouples the dependence between analyte-specific oligonucleotides and signal oligonucleotides. The use of decoding oligonucleotides allows for greater flexibility while significantly reducing the number of distinct signal oligonucleotides required, which in turn increases the encoding capability achievable through a certain number of detection rounds. The use of decoding oligonucleotides has led to sequential signal encoding techniques that are, for example, more flexible, cheaper, simpler, faster, and / or more accurate than other methods.

[0146] Examples of the use of kits and methods including subgroup-specific probes according to this disclosure are as follows:

[0147] 1.) Detection of fusion transcripts in cancer research

[0148] Gene fusion events that generate chimeric proteins are pathogenic factors in many cancer types, accounting for approximately 20% of all tumors (Mitelman 2007). Detection of RNA fusions has facilitated the molecular characterization and diagnosis of various tumors (Neckles 2020 review). Recently approved targeting of oncogenic fusion transcripts to degraded molecules suggests these are promising therapeutic targets. However, a more detailed understanding of the intertumor and intratumoral diversity of oncogenic fusion transcripts is needed, ideally at the cellular level, or even at subcellular resolution.

[0149] · Mitelman, F., Johansson, B., & Mertens, F. (2007): The impact of translocations and gene fusions on cancer causation. Nature Reviews. Cancer, 7(4), 233–245.

[0150] ·Neckles, C, Sundara Rajan, S, Caplen, NJ. (2020): Fusion transcripts: Unexploited vulnerabilities in cancer? WIREs RNA;11:e1562.https: / / doi.org / 10.1002 / wrna.1562

[0151] 2.) RNA subgroups (alternative splicing)

[0152] RNA splicing is a fundamental process of gene expression, and alternative splicing plays a crucial role in transcriptome complexity, cell type differentiation, and biological development. Detection of splice products is important because aberrant splicing can lead to a variety of diseases, including cancer and neurodegeneration. Splicing variability between individual cells is a major cause of gene expression heterogeneity. Studying RNA splice variants at the single-cell level will help decipher regulatory circuits, as well as classify and understand cell types and subtypes (Walks 2011). Previous studies have used single-molecule FISH (smFISH) to detect RNA splice variants. Vargas (2011) can detect unspliced ​​precursor mRNA, spliced ​​introns, and simultaneously spliced ​​mRNA in a single cell, but this does not allow for any multiplexing.

[0153] ·T.Maniatis, B.Tasic.(2002):Alternative pre-mRNA splicing and proteome expansion in metazoans.Nature,418,pp.236-243

[0154] ·Z. Waks, AMKlein, PASilver. (2011): Cell-to-cell variability of alternative RNA splicing. Mol. Syst. Biol., 7, p.506

[0155] ·DYVargas,K.Shah,M.Batish,M.Levandoski,S.Sinha,SAMarras,P.Schedl,S.Tyagi.(2011):Single-molecule imaging of transcriptionally coupled and uncoupled splicing.Cell,147,pp.1054-1065

[0156] 3.) Viral transcript length

[0157] Many viral genomes contain multiple promoters, which can lead to various types of mRNAs of different lengths, some of which share common components. Determining the exact length and composition is crucial for understanding the current stage of viral infection. For example, the HBV genome serves as a template for the synthesis of multiple genomic and subgenomic viral mRNA transcripts: four viral promoters (Core, PreS1, PreS2, and X) and two enhancers (Enhancer I and Enhancer II) control HBV transcription (Zheng 2004). Quantifying each of these subgenomic mRNA transcripts is key to understanding the stage of infection and replication status.

[0158] ·Zheng,Y.,Li,J.&Ou,J.(2004):Regulation of Hepatitis B Virus Core Promoter by Transcription Factors HNF1 and HNF4 and the Viral X Protein.78,6908–6914

[0159] Before describing this disclosure in detail, it should be understood that this disclosure is not limited to the specific components of the steps of the described method. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. It must be noted that, unless the context clearly specifies otherwise, the singular forms “a,” “an,” and “the” as used in the specification and appended claims include singular and / or plural references. Furthermore, it should be understood that where a parameter range is given by numerical value, that range is considered to include these limiting values. Attached Figure Description

[0160] Figure 1 In this implementation, the analyte is a nucleic acid and the probe set comprises oligonucleotides that specifically bind to the analyte. The probes include unique identifier sequences that allow decoding of oligonucleotide hybridization.

[0161] Figure 2 The analyte is a protein, and the probe set comprises an embodiment of a protein (here: an antibody) that specifically binds to the analyte. The probe includes a unique identifier sequence that allows decoding of oligonucleotide hybridization.

[0162] Figure 3: A flowchart of the method according to this disclosure.

[0163] Figure 4 Alternative for decoding and signaling oligonucleotide applications.

[0164] Figure 5 An example of signal encoding for three different nucleic acid sequences using two different signal types and three rounds of detection; in this example, the encoding scheme includes error detection.

[0165] Figure 6 The number of codewords generated (logarithmic scale) compared to the number of detection loops.

[0166] Figure 7 The overall efficiency of the 5-round coding scheme is calculated based on single-step efficiency.

[0167] Figure 8 Comparison of relative transcript abundance between different experiments.

[0168] Figure 9 Correlation of relative transcript abundance among different experiments.

[0169] Figure 10 Comparison of signal distribution among cells.

[0170] Figure 11 Comparison of intracellular signal distribution.

[0171] Figure 12 Distribution patterns of different cell cycle-dependent transcripts.

[0172] Figure 13 : Detect multiple targets using 8 rounds of code with 2 labels (A and B) and no label (-). represents targets 1, 2, 3, 4, 5, 20, and n. represents rounds 1, 2, 3, and 8 of the encoding scheme.

[0173] Figure 14 Detection of multiple targets can be performed using a coding scheme that encodes detectable markers. The termination scheme can also include a "0" as a marker. This indicates that transcripts were not detected at a specific location. Therefore, the coding scheme can be represented by the following construct using only two gene-specific probes:

[0174] 1) With detectable marker F: detectable during imaging

[0175] 2) Contains detectable marker F and quencher Q: undetectable during imaging.

[0176] 3) Contains quencher Q: undetectable during imaging.

[0177] 4) No label F: Undetectable during imaging

[0178] 5) No signal oligonucleotides: undetectable during imaging.

[0179] 6) Decoding oligonucleotides that cannot recruit signal oligonucleotides

[0180] 7) No decoder oligonucleotides: undetectable during imaging.

[0181] Figure 15 : Use additional subgroup-specific probe sets to detect subgroups of different targets (Round 0). This procedure involves contacting the analyte-specific probe sets in the common (shared) portion, and also contacting the subgroup-specific probe sets with the subgroup-determining (exclusive) portion (see Round 1; description, A2). Analytes are detected using probe sets combined with the shared portion (Rounds 1 to 4), using the decoding scheme also described. Round 5: In at least one dedicated round, only the subgroup-specific probe sets are detected. The presence of the exclusive portion of the target is then combined with the results of the previous rounds, allowing differentiation between subgroup 2' in Group 1 and subgroup 2' in Group 2.

[0182] Figure 16 Possible structures of multiple decoders. Numbers describe examples. (A) is the unique identifier sequence, (a) is the corresponding sequence of the decoding oligonucleotide or multiple decoder, and (c1) through (c3) are different sequence elements that specifically bind to different signal oligonucleotides. Examples 2 through 5 show different versions of multiple decoders. The order of the different sequence elements and the number of signal oligonucleotide binding elements are not fixed. Example 1 shows a normal decoding oligonucleotide because there is only one signal oligonucleotide binding element (c1).

[0183] Figure 17 This example illustrates signal encoding of three different nucleic acid sequences using multiple decoders, two different signal oligonucleotides that generate three different signal types, and three rounds of detection. In this example, the encoding scheme includes error detection and correction.

[0184] Figure 18 The number of codewords generated (logarithmic scale) is compared to the number of detection loops. The number of codewords in merFISH does not increase exponentially with the number of detection loops, but becomes less efficient with each additional loop. In contrast, the number of codewords increases exponentially for intronSeqFISH, the method of this disclosure without multiple decoders, and the method with multiple decoders. The slope of the curve for the method using multiple decoders is much higher than that of the prior art, resulting in more than 20,000,000 usable codewords after 20 detection loops. Detailed Implementation

[0185] This article discloses novel multiplex methods and kits for detecting different analytes and different subgroups / variants of analytes in samples.

[0186] This disclosure describes the use of labeled and unlabeled nucleic acid sequence sets for parallel, specific quantification and / or spatial detection of different analytes via specific hybridization. This technique allows for the differentiation of more distinct analytes compared to the various available detection signals. Differentiation can be achieved via sequential signal encoding of the analytes, which is accomplished through several cycles of specific hybridization, signal detection, and selective elution of the hybridized nucleic acid sequences.

[0187] Compared to other state-of-the-art methods, the oligonucleotides that provide detectable signals do not interact directly with sample-specific nucleic acid sequences, but are mediated by so-called "decoding oligonucleotides." This mechanism decouples the dependence between analyte-specific oligonucleotides and signal oligonucleotides. The use of decoding oligonucleotides allows for greater flexibility while significantly reducing the number of different signal oligonucleotides required, which in turn increases the encoding capability achievable through a certain number of detection rounds.

[0188] The use of decoding oligonucleotides has led to sequence signal encoding techniques, which are more flexible, cheaper, simpler, faster, and / or more accurate than other methods.

[0189] A. Definition

[0190] According to this disclosure, an "analyte" is an object that is specifically detected as present or absent in a sample and, where present, encodes it. It can be any kind of entity, including target proteins, peptides, proteins, or nucleic acid molecules (e.g., RNA, PNA, or DNA). An analyte provides at least one site for specific binding to an analyte-specific probe. Sometimes the term "analyte" is replaced by "target" herein. An "analyte" according to this disclosure includes a complex of objects (e.g., at least two individual nucleic acid, protein, or peptide molecules). In embodiments of this disclosure, an "analyte" does not include chromosomes. In another embodiment of this disclosure, an "analyte" does not include DNA. The term "analyte" according to this disclosure can include the group consisting of: different variants / implementations of the same analyte, such as splice variants of the analyte, variants including different introns and / or exons, sequences including UTRs, and / or sequences of different lengths. In particular, the basic sequence and variants have at least 50%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% sequence identity.

[0191] In some implementations, the analyte can be a “coding sequence,” “encoding sequence,” “structural nucleotide sequence,” or “structural nucleic acid molecule,” which refers to a nucleotide sequence that is typically translated into a polypeptide via mRNA when under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by the 5'-terminal translation start codon and the 3'-terminal translation stop codon. The coding sequence can include, but is not limited to, genomic DNA, cDNA, ESTs, and recombinant nucleotide sequences.

[0192] As used herein, a “sample” is a composition in liquid or solid form suspected of containing an analyte to be encoded. In particular, the sample is a biological sample, preferably comprising biological tissue, more preferably comprising biological cells and / or extracts and / or cell portions. For example, the cells are prokaryotic or eukaryotic cells, especially mammalian cells, particularly human cells. In some embodiments, the biological tissue, biological cells, extracts, and / or cell portions are immobilized. In particular, the analyte is immobilized in a permeabilized sample, such as a sample containing cells.

[0193] As used in this disclosure, the terms "cell," "cell line," and "cell culture" are used interchangeably, and all of these names include progeny. Therefore, the terms "transformer" or "transformed cell" include the primary target cell and the culture derived therefrom, regardless of the number of transductions. It is also understood that the DNA content of all progeny may not be exactly the same due to intentional or unintentional mutations. This includes mutant progeny with the same function as those screened in the initially transformed cells.

[0194] An "encoding scheme" describes a set of codewords associated with an analyte to be detected. Each codeword relates to one of the analytes and can be distinguished from all other codewords. A codeword is a sequence of symbols provided by the detection loops of the method. The symbols within a codeword are either detectable signals or signals that are not present. A codeword does not need to include all the different signals used in the method. The number of symbols in a codeword is defined by the number of detection loops.

[0195] As used herein, “oligonucleotide” refers to short nucleic acid molecules such as DNA, PNA, LNA, or RNA. Depending on the number of consecutive sequence elements, the length of an oligonucleotide ranges from 4 to 200 nucleotides (nt), preferably 6 to 80 nt, more preferably 8 to 60 nt, more preferably 10 to 50 nt, and even more preferably 12 to 35 nt. Nucleic acid molecules can be entirely or partially single-stranded. Oligonucleotides can be linear or may include hairpin or loop structures. Oligonucleotides may include modifications such as biotin, labeled moieties, blocking moieties, or other modifications.

[0196] An analyte-specific probe consists of at least two elements: a so-called binding element (S) that specifically interacts with one of the analytes, and a so-called identifier element (T) that includes a unique identifier sequence. The binding element (S) can be a nucleic acid such as a hybridization sequence or aptamer, or a peptide structure such as an antibody.

[0197] In particular, in some embodiments, the binding element (S) includes a portion which is either an affinity portion of an affinity substance or the entire affinity substance, selected from the group consisting of: antibodies, antibody fragments, receptor ligands, enzyme substrates, lectins, cytokines, lymphokines, interleukins, angiogenic or virulence factors, allergens, peptide allergens, recombinant allergens, allergen idiotype antibodies, autoimmune-inducing structures, tissue rejection-inducing structures, immunoglobulin constant regions and their derivatives, mutants or combinations thereof. In another advantageous embodiment, the antibody fragment is Fab, scFv; a single domain or a fragment thereof, dual scFv, Fab2, Fab3, microantibodies, giant antibodies, biantibodies, triantibodies, tetraantibodies, or tandabs, especially single-chain variable region fragments (scFvs).

[0198] Compared to other unique identifiers, the "unique identifier sequence" included in an analyte-specific probe is unique within its sequence. In this context, "unique" means that it specifically recognizes only one analyte, such as cyclin A, cyclin D, cyclin E, etc., or alternatively, it specifically recognizes only a group of analytes, regardless of whether the group of analytes includes a gene family. Therefore, the analyte or group of analytes to be encoded by this unique identifier can be distinguished from all other analytes or groups of analytes to be encoded based on the unique identifier sequence of the identifier element (T). In other words, there is only one "unique identifier sequence" for a particular analyte or group of analytes, but no more than one, i.e., not even two. Due to the uniqueness of the unique identifier sequence, the identifier element (T) hybridizes with exactly one type of decoding oligonucleotide. The length of the unique identifier sequence is in the range of 8-60 nt, preferably 12-40 nt, more preferably 14-20 nt, depending on the number of analytes encoded in parallel and the desired stability of the interaction. The unique identifier can be a sequence element of the analyte-specific probe, attached directly or through a linker, covalent bond, or high-affinity binding mode, such as antibody-antigen interactions, streptavidin-biotin interactions, etc. It should be understood that the term "analyte-specific probe" includes multiple probes that may differ in their binding elements (S): each probe binds to the same analyte but may bind to different portions of it, such as different (e.g., adjacent) or overlapping portions of the nucleotide sequence included in the nucleic acid molecule to be encoded. However, each of the multiple probes includes the same identifier element (T).

[0199] The "decoding oligonucleotide" consists of at least two sequence elements. One sequence element, called the "identifier linker element" (t) or "first linker element" (t), specifically binds to a unique identifier sequence, and the other, called the "translation element" (c), specifically binds to a signal oligonucleotide. The length of the sequence elements is in the range of 8-60 nt, preferably 12-40 nt, more preferably 14-20 nt, depending on the number of analytes to be encoded in parallel, the desired stability of the interaction, and the number of different signal oligonucleotides used. The two sequence elements may be the same length or different lengths.

[0200] In some advantageous embodiments, the decoding oligonucleotide in the kits and / or methods of this disclosure may be a “multi-decoder.” A “multi-decoder” is a decoding oligonucleotide consisting of at least three sequence elements. One sequence element (identifier linker element(t)) may specifically bind a unique identifier sequence (identifier element(T)), and at least two other sequence elements (translation element(c)) may specifically bind different signal oligonucleotides (each of these sequence elements specifically binds a signal oligonucleotide that is different from all other signal oligonucleotides recruited by the other elements of the multi-decoder). The length of the sequence elements is in the range of 8-60 nt, preferably 12-40 nt, more preferably 14-20 nt, depending on the number of analytes being detected in parallel, the required stability, and the number of different signal oligonucleotides used. The lengths of the sequence elements may be the same or may be different.

[0201] Therefore, in some advantageous embodiments, the decoding oligonucleotide is a multi-decoder comprising the following:

[0202] - Identifier linker element (t), comprising a nucleotide sequence substantially complementary to at least a portion of the unique identifier sequence of the identifier element (T) of the corresponding analyte-specific probe set, and

[0203] - At least two translational elements (c), each comprising a nucleotide sequence that allows specific hybridization of different signal oligonucleotides.

[0204] Therefore, the first translation element and the second translation element bind to different signal oligonucleotides. In particular, the difference between the signal oligonucleotides lies in the type of signaling elements included in the signal oligonucleotide, such as the type of fluorophore.

[0205] As used herein, a “signal oligonucleotide” comprises at least two elements, namely a so-called “translation linker element” (C) or “second linker element” (C), having a nucleotide sequence that specifically hybridizes to at least a portion of the nucleotide sequence of the translation linker element (C) of the decoding oligonucleotide, and a “signal element” that provides a detectable signal. This element can actively generate a detectable signal or provide such a signal via manipulation (e.g., fluorescence excitation). Typical signal elements are, for example, enzymes, fluorophores, radioactive elements, or dyes that catalyze detectable reactions.

[0206] A “group” refers to multiple parts or objects, such as analyte-specific probes or decoding oligonucleotides, regardless of whether the individual members of the multiple groups are the same or different from each other. In an analyte-specific probe group, the analyte-specific probes are identical in the identifier element (T) but may include different binding elements (S) for interacting specifically with the same analyte but for interacting specifically with different substructures of the same analyte to be encoded.

[0207] "Selective denaturation" can be a process that removes the bound decoding oligonucleotide and signal oligonucleotide with maximum efficiency while maintaining hybridization of the target-specific probe with maximum efficiency. The overall efficiency of these two combined events can be at least: 0.22 for two detection cycles, 0.37 for three detection cycles, 0.47 for four detection cycles, 0.55 for five detection cycles, 0.61 for six detection cycles, 0.65 for seven detection cycles, 0.69 for eight detection cycles, 0.72 for nine detection cycles, 0.74 for ten detection cycles, 0.76 for eleven detection cycles, and 0.78 for twelve detection cycles.

[0208] In embodiments of this disclosure, a single group refers to multiple oligonucleotides.

[0209] An "analyte-specific probe set" refers to multiple parts or objects (e.g., analyte-specific probes) that are distinct from each other and bound to independent regions of the analyte. A single analyte-specific probe set is further characterized by at least the same unique identifier.

[0210] The "subgroup-specific probe set" can include the same characteristics as the "analyte-specific probe set," but differs in how it encodes and decodes information. The "subgroup-specific probe set" is only used to add information (mainly presence / absence) to codes already encoded by the "analyte-specific probe set."

[0211] An analyte “subgroup” or “variant” refers to an implementation of the analyte, wherein the variant includes common or “shared” elements (e.g., the same nucleic acid sequence) included in all implementations (or variants) of the same analyte, as well as at least one additional element that distinguishes the analyte (target) subgroup / variant from each other and / or from the base analyte.

[0212] In some embodiments, a subgroup / variant of at least one analyte having a set of at least five (5) is contacted with a subgroup-specific probe that has a different nucleotide sequence of identifier element (T) from another set of analyte-specific probes.

[0213] A “decoding oligonucleotide set” refers to a set of decoding oligonucleotides that are specific to a particular unique identifier required for encoding independently of codeword length. Each decoding oligonucleotide in the “decoding oligonucleotide set” and all decoding oligonucleotides bind to the same unique identifier element (T) of the analyte-specific probe.

[0214] In some implementations, this binding or hybridization pattern of the decoded oligonucleotide can be translated into a "codeword". For example, for an analyte, the codeword could also be "101" and "110", where a value of 1 indicates binding and a value of 0 indicates no binding. In other implementations, the codeword can also have a longer length (see [link to implementation]). Figure 13 The codeword can be directly correlated with the specific, unique identifier sequence of the analyte-specific probe. Therefore, different analyte-specific probes can match certain codewords, and the binding pattern of the decoded oligonucleotide can then be used to identify the different analytes associated with the analyte-specific probe. However, if there is no obvious binding, then in this example the codeword would be "000".

[0215] In some implementations, the values ​​in each codeword can also be assigned in different ways. For example, a value of 0 can represent binding, while a value of 1 represents no binding. Similarly, a value of 1 can represent the binding of a secondary nucleic acid probe to one type of signal entity, while a value of 0 can represent the binding of a secondary nucleic acid probe to another type of distinguishable signal entity. For example, these signal entities can be distinguished by different colors of fluorescence. In some cases, the values ​​in the codeword are not limited to 0 and 1. These values ​​can also be extracted from larger letters, such as ternary (e.g., 0, 1, and 2) or quaternary (e.g., 0, 1, 2, and 3) systems. For example, each distinct value can be represented by a different distinguishable signal entity, including (in some cases) a value that can be represented by the absence of a signal.

[0216] The codewords used for each analyte can be assigned sequentially or randomly. For example, the first analyte could be assigned to 101, while the second nucleic acid target could be assigned to 110. Additionally, in some implementations, error detection or correction systems, such as the Hamming system, Golay code, or extended Hamming system (or SECDED system, i.e., single error correction, double error detection), can be used to assign codewords. Generally, such systems can be used to identify where an error has occurred, and in some cases, they can also be used to correct errors and determine what the correct codeword should be. For example, a codeword such as 001 could be detected as invalid and corrected to 101 using such a system, for example, if 001 had not previously been assigned to a different target sequence. Many different error correction codes can be used, many of which have previously been developed for the computer industry; however, such error correction systems are generally not used in biological systems. Additional examples of such error correction codes are discussed in more detail below.

[0217] "Substantially complementary" means that, when referring to two nucleotide sequences, the two sequences can specifically hybridize with each other under stringent conditions, forming a hybrid nucleic acid molecule with a sense strand and an antisense strand linked by hydrogen bonds (Watson-and-Crick base pairs). "Substantially complementary" includes not only perfect base pairing along the entire strand, i.e., perfectly complementary sequences, but also imperfectly complementary sequences, which still possess the ability to hybridize under stringent conditions. It is generally accepted among experts that "substantially complementary" sequences share at least 88% sequence identity with perfectly or completely complementary sequences.

[0218] "Percentage sequence identity" or "percentage identity" then means that, after comparing the sequence to be compared ("comparison sequence") with the described or claimed sequence ("reference sequence"), the sequence is compared with the claimed or described sequence. The percentage identity is then determined according to the following formula: Percentage identity = 100[1 - (C / R)]

[0219] Where C is the number of differences between the reference and comparison sequences in terms of alignment length.

[0220] (i) For each base or amino acid in the reference sequence for which there is no corresponding alignment base or amino acid in the comparison sequence, and

[0221] (ii) Each gap in the reference sequence and

[0222] (iii) Each pair of pairs of bases or amino acids in the reference sequence that are different from the pair of pairs of bases or amino acids in the comparison sequence constitutes a difference, and (iiii) the comparison must start from position 1 of the comparison sequence;

[0223] Furthermore, R is the number of bases or amino acids in the reference sequence over the entire length of the comparison sequence, and any vacancies generated in the reference sequence are also counted as bases or amino acids.

[0224] If the percentage identity between the comparison sequence and the reference sequence is approximately equal to or greater than the specified minimum percentage identity, then the comparison sequence and the reference sequence have the specified minimum percentage identity, even if there are places in the comparison where the percentage identity calculated above is less than the specified percentage identity.

[0225] In the “incubation” step as understood herein, the respective parts or objects, such as probes or oligonucleotides, are brought into contact with each other under conditions known to those skilled in the art that allow for specific binding or hybridization reactions, such as pH, temperature, and salinity. Therefore, these steps can preferably be carried out in a liquid environment, such as a buffer system known in the art.

[0226] The “removal” step according to this disclosure may include washing away the portion or object to be removed, such as a probe or oligonucleotide, by means of certain conditions as known in the art, such as pH, temperature, salt conditions, etc.

[0227] It should be understood that, in embodiments of the method according to this disclosure, multiple analytes can be encoded in parallel. This requires the use of different sets of analyte-specific probes in step (1). A particular set of analyte-specific probes differs from another set. This means that the analyte-specific probes of set 1 bind to analyte 1, the analyte-specific probes of set 2 bind to analyte 2, the analyte-specific probes of set 3 bind to analyte 3, and so on. In this embodiment, different sets of decoding oligonucleotides are also required in the method according to this disclosure.

[0228] The decoding oligonucleotides of a specific group are different from those of another group. This means that the decoding oligonucleotide of group 1 binds to the analyte-specific probe of group 1, the decoding oligonucleotide of group 2 binds to the analyte-specific probe of group 2, the decoding oligonucleotide of group 3 binds to the analyte-specific probe of group 3, and so on.

[0229] In this embodiment where multiple analytes are to be encoded in parallel, different analyte-specific probe sets can be provided as premixes of different analyte-specific probe sets and / or different decoding oligonucleotide sets can be provided as premixes of different decoding oligonucleotide sets. Each mixture can be contained in a single vial. Alternatively, different analyte-specific probe sets and / or different decoding oligonucleotide sets can be provided separately in the steps.

[0230] A "kit" is a combination of individual components that can be used to carry out the purposes and / or methods of this disclosure, wherein these components are optimized for use together in the method. Kits may also contain additional reagents, chemicals, buffers, reaction vials, etc., which can be used to carry out the methods according to this disclosure. Such kits unify all the essential elements required to work with the methods according to this disclosure, thus minimizing the risk of error. Therefore, such kits also allow semi-skilled laboratory personnel to perform the methods according to this disclosure.

[0231] The terms "quencher," "quencher dye," or "quencher molecule" refer to a dye or equivalent molecule capable of reducing the fluorescence of a fluorescent reporter dye or donor dye, such as nucleoside guanosine (G) or 2'-deoxyguanosine (dG). Quenching dyes can be fluorescent or non-fluorescent. When the quencher is a fluorescent dye, its fluorescence wavelength is typically significantly different from that of the reporter dye, and quencher fluorescence is usually not monitored during assays. Some embodiments of this disclosure disclose signal oligonucleotides comprising quenchers and / or combinations of quenchers with signal elements (see [link to documentation]). Figure 14 And therefore the signal oligonucleotides are undetectable during imaging.

[0232] In embodiments of this disclosure, the sample is a biological sample, preferably including biological tissue, and more preferably including biological cells. The biological sample may be derived from organs, organoids, cell cultures, stem cells, cell suspensions, primary cells, samples infected by viruses, bacteria, or fungi, eukaryotic or prokaryotic samples, smears, disease samples, or tissue sections.

[0233] This method is particularly suitable for encoding, identifying, detecting, counting, or quantifying analytes or individual analyte molecules in biological samples, such as samples containing nucleic acids or proteins as said analytes. It should be understood that biological samples can be in their natural form (i.e., liquid, semi-liquid, solid, etc.) or processed, for example, as a dried film on the surface of a device, which can be reliquefied prior to performing this method.

[0234] In another embodiment of this disclosure, biological tissues and / or biological cells are fixed prior to step (2). For example, in some embodiments, cells and / or tissues are fixed before the introduction of probes, for example, to maintain the position of analytes such as nucleic acids within the cells. Techniques for fixing cells are known to those skilled in the art. As a non-limiting example, chemicals such as formaldehyde, paraformaldehyde, glutaraldehyde, ethanol, methanol, acetone, acetic acid, etc., can be used to fix cells. In one embodiment, Hepes-glutamate buffer-mediated organic solvent (HOPE) can be used to fix cells.

[0235] The advantage of this approach is that the analyte to be encoded, such as nucleic acid or protein, is immobilized and cannot escape. In doing so, the analyte is then ready for better detection or encoding by the method according to this disclosure.

[0236] In another embodiment within the analyte-specific probe set, the individual analyte-specific probe includes binding elements (S1, S2, S3, S4, S5) that specifically interact with different substructures of one of the analytes to be encoded.

[0237] This measure makes the method more robust and reliable because the signal strength obtained at the end of the method or cycle is increased. It should be understood that individual probes in a group, when binding to the same analyte, differ in their binding sites or locations on or at the analyte. The binding elements S1, S2, S3, S4, S5, etc., of the first, second, third, fourth, and fifth analyte-specific probes thus bind to or bind to different sites; however, these sites may or may not overlap.

[0238] In an advantageous embodiment, this disclosure relates to a kit for multiplex analyte coding, comprising:

[0239] (A) At least twenty (20) different analyte-specific probe sets for encoding at least 20 different analytes, each analyte-specific probe set interacting with a different analyte, wherein, if the analyte is a nucleic acid, each analyte-specific probe set includes at least five (5) analyte-specific probes that specifically interact with different substructures of the same analyte, and optionally, at least one subgroup-specific probe set to distinguish targets (analytes / variants) having shared and exclusive portions of the analytes, each analyte-specific probe including

[0240] (aa) binding element (S), specifically interacts with one of the different analytes to be encoded, and

[0241] (bb) Identifier element (T), comprising a unique nucleotide sequence for the analyte being encoded (unique identifier sequence),

[0242] Among them, the analyte-specific probes of a specific analyte-specific probe group differ from those of another analyte-specific probe group in the nucleotide sequence of the identifier element (T).

[0243] In each analyte-specific probe set, the analyte-specific probes bind to the same analyte and include the same nucleotide sequence of a unique identifier element (T) for the analyte; and

[0244] (B) At least one decoding oligonucleotide set for each analyte, wherein, in each decoding oligonucleotide set for an individual analyte, each decoding oligonucleotide comprises:

[0245] (aa) Identifier linker element (t), comprising a nucleotide sequence substantially complementary to at least a portion of the unique identifier sequence of the identifier element (T) of the corresponding analyte-specific probe set, and

[0246] (bb) Translational elements (c) include nucleotide sequences that allow specific hybridization of signal oligonucleotides;

[0247] Among them, one set of decoding oligonucleotides used for an individual analyte differs from another set of decoding oligonucleotides used for different analytes in terms of the identifier linking element (t); and

[0248] (C) Signal oligonucleotide set, each signal oligonucleotide comprising:

[0249] (aa) A translator linker element (C), comprising a nucleotide sequence substantially complementary to at least a portion of the nucleotide sequence of the translator element (C) included in the decoding oligonucleotide, and

[0250] (bb) Signal components.

[0251] According to this disclosure, multiplex methods or assays allow for the simultaneous measurement of multiple analytes, which can be used to determine the presence or absence of multiple predetermined (known) analytes (such as nucleic acid target sequences) in a sample. An analyte can be "predetermined" because its sequence is known to be designed as a probe to bind to that target.

[0252] In some advantageous embodiments according to this disclosure, at least 20, particularly at least 25, particularly at least 30 different analytes in a sample are detected and / or quantified in parallel. For example, there may be at least 5, at least 10, at least 20, at least 50, at least 75, at least 100, at least 300, at least 1,000, at least 3,000, at least 10,000, or at least 30,000 distinguishable analyte-specific probes applied to the sample (e.g., simultaneously or sequentially).

[0253] In some advantageous embodiments for multiplexing, twenty (20) or more different sets of analyte-specific probes are required to encode at least 20 or more different analytes, particularly more than 50, more than 100, or more than 200. In the multiplexing methods of this disclosure, in particular, at least 20 different sets of analytes (e.g., mRNA molecules) (i.e., tags) are targeted.

[0254] In an advantageous embodiment, the kit includes at least two different sets of analyte-specific probes for each analyte.

[0255] Among these different groups, the analyte-specific probes interact with the same analyte, but with different substructures of the same analyte.

[0256] Specifically, the analyte-specific probes in the first analyte-specific probe group interact with the substructures included in all variants of the analyte.

[0257] Specifically, the analyte-specific probes of the second analyte-specific probe group (subgroup-specific probe group) interact with substructures that are only included in specific variants of that analyte.

[0258] The first analyte-specific probe group comprises analyte-specific probes that include the same identifier element (T), which includes a nucleotide sequence unique to the analyte being encoded (a unique identifier sequence).

[0259] The second analyte-specific probe group includes analyte-specific probes that share the same identifier element (T), which comprises a unique nucleotide sequence (unique identifier sequence) for the analyte being encoded.

[0260] In this group, the identifier element (T) of the analyte-specific probes in the first analyte-specific probe group is different from the identifier element (T) of the analyte-specific probes in the second analyte-specific probe group, so as to bind different decoding oligonucleotides and / or non-signal decoding oligonucleotides.

[0261] In some advantageous implementations, at least four rounds are performed to collect information for analyte identification, where multiple readouts improve identification accuracy and avoid false positives. Unique tags can be identified using various techniques, including, for example, direct or indirect hybridization using labeled probes, or sequencing (through synthesis, ligation). In particular, the tag's identity can be encoded by a single signal (binary code), two or more signals, where the signals can be fluorescently labeled (e.g., attached to oligonucleotides).

[0262] In some advantageous embodiments according to this disclosure, the kit does not include an analyte-specific probe set as defined under section A).

[0263] Preferably, if the analyte in the kit or method according to this disclosure is a nucleic acid, each analyte-specific probe set includes at least five (5) analyte-specific probes, particularly at least ten (10) analyte-specific probes, particularly at least fifteen (15) analyte-specific probes, particularly at least twenty (20) analyte-specific probes, which specifically interact with different substructures of the same analyte. Nucleic acid analytes include specific DNA molecules, such as genomic DNA, nuclear DNA, mitochondrial DNA, viral DNA, bacterial DNA, extracellular or intracellular DNA, etc., and specific mRNA molecules, such as hnRNA, miRNA, viral RNA, bacterial RNA, extracellular or intracellular RNA, etc.

[0264] Preferably, if the analyte in the kit or method according to this disclosure is a peptide, polypeptide or protein, each analyte-specific probe set includes at least two (2) analyte-specific probes, particularly at least three (3) analyte-specific probes, particularly at least four (4) analyte-specific probes, which specifically interact with different substructures of the same analyte.

[0265] In some advantageous embodiments according to this disclosure, the kit includes at least two different groups of signaling oligonucleotides, wherein the signaling oligonucleotides in each group include different signaling elements and different linker elements (C).

[0266] In particular, the kit may include at least two different sets of decoding oligonucleotides for each analyte, wherein the decoding oligonucleotides included in these different sets include the same identifier linker element (t), which includes a nucleotide sequence substantially complementary to at least a portion of the unique identifier sequence of the identifier element (T) of the corresponding analyte-specific probe set, and wherein the decoding oligonucleotides of the different sets of each analyte differ in terms of the translator element (c), which includes a nucleotide sequence that allows specific hybridization of the signal oligonucleotide.

[0267] In some embodiments, the kit may include at least two different sets of decoding oligonucleotides for each analyte, wherein the decoding oligonucleotides included in these different sets contain the same identifier linker element(t), which includes a nucleotide sequence substantially complementary to at least a portion of the unique identifier sequence of the identifier element(T) of the corresponding analyte-specific probe set, and wherein the decoding oligonucleotides for the different sets of at least one analyte differ in terms of a translator element(c), which includes a nucleotide sequence that allows specific hybridization of the signal oligonucleotide.

[0268] In some advantageous embodiments, the number of different decoding oligonucleotide sets for each analyte, including different translator elements (c), corresponds to the number of different signal oligonucleotide sets including different linker elements (C). However, the decoding oligonucleotides in a particular decoding oligonucleotide set interact with the same identifier element (T) that is unique to that particular analyte. In particular, all decoding oligonucleotide sets for different analytes may include one or more translator elements (c) of the same type.

[0269] On the other hand, this disclosure generally relates to a method comprising the following actions: exposing a sample to a plurality of analyte-specific probes; determining, for each analyte-specific probe, the binding of the analyte-specific probe within the sample; generating codewords based on the binding of the analyte-specific probe, decoding oligonucleotide, and signal oligonucleotide; and matching the codewords with valid codewords for at least some of the codewords. In some embodiments, this binding or hybridization pattern of the analyte-specific probe, decoding oligonucleotide, and signal oligonucleotide can be translated into a “codeword.” For example, for a first analyte and a second analyte, the codewords could be “101” and “110”, respectively, where a value of 1 indicates binding of the following items, and a value of 0 indicates no binding of the following items: binding of the decoding oligonucleotide and / or binding of the signal oligonucleotide, and the absence and / or quenching of a signal element. Thus, the analyte in the detection round / cycle is undetectable during imaging.

[0270] To generate such zeros (0) in the codewords of an individual analyte, the kit may include:

[0271] (D) At least one non-signal decoding oligonucleotide set for binding to a specific identifier element (T) of an analyte-specific probe, wherein decoding oligonucleotides in the same non-signal decoding oligonucleotide set interact with the same different identifier element (T).

[0272] Each non-signal decoding oligonucleotide includes an identifier linker element (t) comprising a nucleotide sequence substantially complementary to at least a portion of a unique identifier sequence, and each non-signal decoding oligonucleotide does not include a translator element (c) containing a nucleotide sequence that allows specific hybridization of the signal oligonucleotide.

[0273] To generate such zeros (0) in the codewords of an individual analyte, the kit may include:

[0274] (D) At least one non-signal decoding oligonucleotide set for binding to a specific identifier element (T) of an analyte-specific probe, wherein decoding oligonucleotides in the same non-signal decoding oligonucleotide set interact with the same different identifier element (T).

[0275] Each non-signal decoding oligonucleotide includes an identifier linker element (t) comprising a nucleotide sequence substantially complementary to at least a portion of the unique identifier sequence, and a translation element (c) that does not interact / bind with the signal oligonucleotide due to an unstable binding sequence and / or because the translation element is too short, the translation element (c) comprising a nucleotide sequence that allows specific hybridization of the signal oligonucleotide.

[0276] In some advantageous embodiments, the kit includes:

[0277] (D) At least two (2) different non-signal decoding oligonucleotide sets for binding to at least two different identifier elements (T) of an analyte-specific probe, each non-signal decoding oligonucleotide set interacting with a different identifier element (T),

[0278] Each non-signal decoding oligonucleotide includes an identifier linker element (t) comprising a nucleotide sequence substantially complementary to at least a portion of a unique identifier sequence, and each non-signal decoding oligonucleotide does not include a translator element (c) containing a nucleotide sequence that allows specific hybridization of the signal oligonucleotide.

[0279] In some advantageous embodiments, different non-signal decoding oligonucleotide groups may be included in a premixture of different non-signal decoding oligonucleotide groups or exist separately.

[0280] Furthermore, in some advantageous embodiments, the kit may include:

[0281] (E) Non-signal oligonucleotide group, each non-signal oligonucleotide comprising:

[0282] (aa) A translator linker element (C), comprising a nucleotide sequence substantially complementary to at least a portion of the nucleotide sequence of the translator element (c), and

[0283] (bb) Quencher (Q), signal element and quencher (Q), or excluding signal element.

[0284] In some advantageous embodiments, the kit includes:

[0285] (E) At least two non-signal oligonucleotide groups, each non-signal oligonucleotide comprising:

[0286] (aa) A translator linker element (C), comprising a nucleotide sequence substantially complementary to at least a portion of the nucleotide sequence of the translator element (c), and

[0287] (bb) Quencher (Q), signal element and quencher (Q), or excluding signal element.

[0288] In some advantageous embodiments, different non-signal oligonucleotide groups may be included in a premixture of different non-signal oligonucleotide groups or exist separately.

[0289] Furthermore, in some implementations, the decoding oligonucleotides in a particular decoding oligonucleotide set interact with the same identifier element (T) that is unique to a particular analyte.

[0290] In some advantageous embodiments, different decoding oligonucleotide sets may be included in a premixture of different decoding oligonucleotide sets or exist separately. In some advantageous embodiments, different analyte-specific probe sets may be included in a premixture of different analyte-specific probe sets or exist separately. In some advantageous embodiments, different signaling oligonucleotide sets may be included in a premixture of different signaling oligonucleotide sets or exist separately.

[0291] In some advantageous embodiments, a mixture of decoding oligonucleotides and / or multiple decoders that specifically hybridize with a unique identifier sequence of a probe set is provided. In some embodiments, the decoding oligonucleotide comprises at least two sequence elements: a first element complementary to the unique identifier sequence of the corresponding probe set and a second sequence element (translation element) providing a sequence for specific hybridization with a signal oligonucleotide, the translation element defining the type of signal recruited to the decoding oligonucleotide. In some embodiments, a multiple decoder comprising at least three sequence elements is used: a first element complementary to the unique identifier sequence of the corresponding probe set, and at least additional sequence elements (translation elements) providing a sequence for specific hybridization with at least two different signal oligonucleotides. The translation element defines the type of signal recruited to the multiple decoder. Figure 17Different possible structures of the multiple decoder can be seen. Since the multiple decoder does recruit complete signal oligonucleotides for each translator element, the signal intensity in each channel is no less than that of the decoding oligonucleotide.

[0292] The use of multiple decoders further improves the efficiency of the coding scheme. Figure 17 A possible encoding scheme using multiple decoders is shown, which utilizes a decoding oligonucleotide with two sequence elements based on the same conditions used for the instance. It can be clearly seen that utilizing... Figure 5 Using the same number of rounds and the same number of different signal oligonucleotides in the examples, the coding scheme based on multiple decoders can produce a higher Hamming distance.

[0293] As mentioned above, the analyte to be encoded can be a nucleic acid, preferably DNA, PNA or RNA, especially mRNA, peptide, polypeptide, protein and / or mixtures thereof.

[0294] In some advantageous embodiments, the binding element (S) includes an amino acid sequence that allows specific binding to the analyte to be encoded. The binding element (S) may include a portion derived from an affinity moiety or the entire affinity substance, selected from the group consisting of: antibodies, antibody fragments, anticalin proteins, receptor ligands, enzyme substrates, lectins, cytokines, lymphokines, interleukins, angiogenic or virulence factors, allergens, peptide allergens, recombinant allergens, allergen idiotype antibodies, autoimmune-inducing structures, tissue rejection-inducing structures, immunoglobulin constant regions, and combinations thereof.

[0295] In some advantageous embodiments, the binding element (S) may include an antibody or antibody fragment selected from the group consisting of: Fab, scFv; a single domain or a fragment thereof, dual scFv, F(ab)2, F(ab)3, microantibody, dual antibody, triantibody, tetraantibody and tandab.

[0296] This disclosure particularly relates to a method for detecting multiple analytes in a sample, the method being performed by sequentially encoding the analytes, the method comprising the following steps:

[0297] (A) The sample is contacted with at least twenty (20) different sets of analyte-specific probes encoding at least 20 different analytes, each set of analyte-specific probes interacting with a different analyte, wherein, if the analyte is a nucleic acid, each set of analyte-specific probes includes at least five (5) analyte-specific probes that specifically interact with different substructures of the same analyte, each analyte-specific probe including

[0298] (aa) binding element (S), specifically interacts with one of the different analytes to be encoded, and

[0299] (bb) Identifier element (T), comprising a unique nucleotide sequence for the analyte being encoded (unique identifier sequence),

[0300] Among them, the analyte-specific probes of a specific analyte-specific probe group differ from those of another analyte-specific probe group in the nucleotide sequence of the identifier element (T).

[0301] In each analyte-specific probe set, the analyte-specific probes bind to the same analyte and include the same nucleotide sequence of a unique identifier element (T) for the analyte; and

[0302] (B) Contact the sample with at least one decoding oligonucleotide set for each analyte, wherein in each decoding oligonucleotide set for an individual analyte, each decoding oligonucleotide comprises:

[0303] (aa) Identifier linker element (t), comprising a nucleotide sequence substantially complementary to at least a portion of the unique identifier sequence of the identifier element (T) of the corresponding analyte-specific probe set, and

[0304] (bb) Translational elements (c) include nucleotide sequences that allow specific hybridization of signal oligonucleotides;

[0305] Among them, one set of decoding oligonucleotides used for individual analytes differs from another set of decoding oligonucleotides used for different analytes in terms of the first linker element (t); and

[0306] (C) Contact the sample with at least one group of signal oligonucleotides, each signal oligonucleotide comprising:

[0307] (aa) A translator linker element (C), comprising a nucleotide sequence substantially complementary to at least a portion of the nucleotide sequence of the translator element (C) included in the decoding oligonucleotide, and

[0308] (bb) Signal components.

[0309] (D) Detecting signals caused by signal elements;

[0310] (E) Selectively remove decoding oligonucleotides and signal oligonucleotides from the sample, thereby essentially maintaining the specific binding of the analyte-specific probe to the analyte to be encoded;

[0311] (F) Perform at least three (3) additional loops, including steps B) to E), to generate an encoding scheme with codewords for each analyte, wherein the last loop may stop at step (D).

[0312] As described above, the method according to this disclosure includes selectively removing decoding oligonucleotides and signal oligonucleotides from the sample, thereby substantially maintaining the specific binding of the analyte-specific probe to the analyte to be encoded. In particular, all steps are performed sequentially. However, some steps can be performed simultaneously, especially steps A) to C), and especially B) and C).

[0313] This approach establishes the requirement for another round / cycle of binding additional decoding oligonucleotides to the same analyte-specific probe, ultimately producing a code or encoding scheme that includes more than one signal. This step is achieved by applying conditions and factors familiar to those skilled in the art, such as pH, temperature, salt conditions, oligonucleotide concentration, polymers, etc.

[0314] In another embodiment of this disclosure, the method may include repeating steps (B)-(E) at least three times to generate an encoding scheme. Using this approach, four signals are encoded in the case of four cycles / rounds implemented by the user, where 'n' is an integer representing the number of rounds. The encoding capability of the method according to this disclosure is thus increased depending on the nature of the analyte and the operator's needs. In embodiments of this disclosure, the encoding scheme is predetermined and assigned to the analyte to be encoded.

[0315] However, this measure enables precise experimental setup by providing the appropriate order of the decoded and signal oligonucleotides used, thus allowing specific analytes to be correctly assigned to the corresponding coding scheme. The decoded oligonucleotides used in repeated steps (B)-(D2) may include the same translator element (c2) as the decoded oligonucleotide used in previous steps (B)-(E). In another embodiment of this disclosure, the decoded oligonucleotides used in repeated steps (B)-(E) include a translator element (c2) different from the translator element (c1) of the decoded oligonucleotide used in previous steps (B)-(E). It should be understood that the decoded element may or may not change round-by-round (i.e., in the second round (B)-(E) including translator element c2, in the third round (B)-(E) including translator element c3, in the fourth round (B)-(E) including translator element c4, etc.), where 'n' is an integer representing the round number.

[0316] The signaling oligonucleotide used in repeated steps (B)-(E) may include the same signal element as the decoding oligonucleotide used in the preceding steps (B)-(E). In another embodiment of this disclosure, the signaling oligonucleotide used in repeated steps (B)-(E) includes a different signal element than the decoding oligonucleotide used in the preceding steps (B)-(E). In some embodiments, the use of non-signaling oligonucleotides and / or non-signaling decoding oligonucleotides for the individual analyte results in a value of 0 in the codeword at that cycle / position. In some embodiments, the decoding oligonucleotide of the individual analyte is not in contact with the sample during repeated cycles, which also produces a value of 0 in the codeword at that cycle / position.

[0317] This method provides the same or different signals in each round, thereby generating an encoding scheme characterized by a sequence of signals composed of many different signals. This method allows for the generation of unique codes or codewords that are distinct from all other codewords in the encoding scheme. In another embodiment of this disclosure, the binding element (S) of the analyte-specific probe comprises a nucleic acid containing a nucleotide sequence that allows for specific binding to, and preferably specific hybridization to, the analyte to be encoded.

[0318] In another embodiment of this disclosure, the presence or absence of exclusive elements can be detected by performing step G) to detect subgroups of the same type of analyte (variant).

[0319] In an advantageous embodiment, the sample is contacted with at least two different sets of analyte-specific probes for each analyte.

[0320] Among these different groups, the analyte-specific probes interact with the same analyte, but with different substructures of the same analyte.

[0321] Specifically, the analyte-specific probes in the first analyte-specific probe group interact with the substructures included in all variants of the analyte.

[0322] Specifically, the analyte-specific probes of the second analyte-specific probe group (subgroup-specific probe group) interact with substructures that are only included in specific variants of the analyte.

[0323] The first analyte-specific probe group comprises analyte-specific probes that include the same identifier element (T), which includes a nucleotide sequence unique to the analyte being encoded (a unique identifier sequence).

[0324] The second analyte-specific probe group includes analyte-specific probes that share the same identifier element (T), which comprises a unique nucleotide sequence (unique identifier sequence) for the analyte being encoded.

[0325] In this group, the identifier element (T) of the analyte-specific probes in the first analyte-specific probe group is different from the identifier element (T) of the analyte-specific probes in the second analyte-specific probe group, so as to bind different decoding oligonucleotides and / or non-signal decoding oligonucleotides.

[0326] In some advantageous embodiments, all steps are automated, particularly steps B) through F), especially by using a robotic system and / or an optical multiplexing system according to this disclosure. In some instances, the steps can be performed in a fluid system.

[0327] As described above, the method according to this disclosure generates an encoding scheme with codewords for each analyte. Therefore, each analyte can be associated with a specific codeword, wherein the codeword comprises multiple positions, and wherein each position corresponds to a cycle, thereby generating multiple distinguishable encoding schemes with multiple codewords. In particular, the encoding scheme can be predetermined and assigned to the analyte to be encoded.

[0328] In some advantageous embodiments, the codeword obtained for an individual analyte during the executed loop includes the detected signal and at least one additional element corresponding to the undetected signal, such as 0, 1 or 0, 1, 2, etc. (see also...) Figure 13 and Figure 14 Especially if using according to Figure 14 Non-signal probes numbered 2 to 4 or such Figure 14 The non-signal decoding oligonucleotide shown in number 5, or if no decoding oligonucleotide contacts the corresponding identifier sequence included in the analyte-specific probe that interacts with the corresponding analyte in the sample during a cycle, then no signal of at least one analyte is detected in at least one cycle. During this cycle, the position has a value of zero (0).

[0329] In some advantageous embodiments, the codeword position is zero (0) for at least one individual analyte. In particular, the codeword zero (0) is generated by not using a decoding oligonucleotide having an identifier linker element (t) comprising a nucleotide sequence substantially complementary to at least a portion of the unique identifier sequence of the identifier element (T) of the corresponding analyte-specific probe of the individual analyte. As described above, in some embodiments, if the codeword position is zero (0) for at least one individual analyte in the cycle, the corresponding decoding oligonucleotide having an identifier linker element (t) comprising a nucleotide sequence substantially complementary to at least a portion of the unique identifier sequence of the identifier element (T) of the corresponding analyte-specific probe of the individual analyte is not used.

[0330] Furthermore, in some advantageous embodiments, the sample is contacted with at least two different groups of signaling oligonucleotides, wherein each group of signaling oligonucleotides includes different signaling elements and different linker elements (C).

[0331] In a more specific implementation, the sample is contacted with at least two different decoding oligonucleotide sets for each analyte.

[0332] Among these different groups, the decoding oligonucleotides include the same identifier linker element (t), which comprises a nucleotide sequence substantially complementary to at least a portion of the unique identifier sequence of the identifier element (T) of the corresponding analyte-specific probe group, and

[0333] The decoding oligonucleotides of different groups of each analyte differ in terms of translation element (c), which includes a nucleotide sequence that allows specific hybridization of the signal oligonucleotide.

[0334] In a more specific implementation, the sample is contacted with at least two different decoding oligonucleotide sets for each analyte.

[0335] Among these different groups, the decoding oligonucleotides include the same identifier linker element (t), which comprises a nucleotide sequence substantially complementary to at least a portion of the unique identifier sequence of the identifier element (T) of the corresponding analyte-specific probe group, and

[0336] Among them, the decoding oligonucleotides of different groups of each analyte differ in terms of translation element (c), which includes a nucleotide sequence that allows specific hybridization of the signal oligonucleotide;

[0337] In this configuration, only one decoding oligonucleotide set for each analyte is used per cycle, and / or different decoding oligonucleotide sets are used in different cycles, while the corresponding signal oligonucleotide set is used in the same cycle, especially...

[0338] Among them, the group that retains decoding oligonucleotides and / or non-signal decoding oligonucleotides is used for optional detection of analyte subgroups.

[0339] In some advantageous embodiments, the number of different decoding oligonucleotide sets for each analyte, including different translational elements (c), corresponds to the number of different signal oligonucleotide sets, including different linker elements (C). All decoding oligonucleotide sets for different analytes may include one or more translational elements (c) of the same type.

[0340] In some advantageous embodiments of the method according to this disclosure, the sample is contacted with at least one non-signal decoding oligonucleotide set for binding a specific identifier element (T) of an analyte-specific probe, wherein decoding oligonucleotides in the same non-signal decoding oligonucleotide set interact with the same different identifier element (T), wherein each non-signal decoding oligonucleotide includes an identifier linker element (t) comprising a nucleotide sequence substantially complementary to at least a portion of a unique identifier sequence, and each non-signal decoding oligonucleotide does not include a translator element (c) containing a nucleotide sequence that allows specific hybridization of the signal oligonucleotide.

[0341] As described above, the sample may be contacted with at least two (2) different non-signal decoding oligonucleotide groups for binding at least two different identifier elements (T) of an analyte-specific probe, each non-signal decoding oligonucleotide group interacting with a different identifier element (T), wherein each non-signal decoding oligonucleotide includes an identifier linker element (t) comprising a nucleotide sequence substantially complementary to at least a portion of a unique identifier sequence, and each non-signal decoding oligonucleotide does not include a translator element (c) containing a nucleotide sequence that allows specific hybridization of the signal oligonucleotide.

[0342] In some advantageous embodiments of the method according to this disclosure, different non-signal decoding oligonucleotide groups may be included in a premixture of different non-signal decoding oligonucleotide groups or exist separately.

[0343] Furthermore, in some advantageous embodiments of the method according to this disclosure, the sample is contacted with a group of non-signal oligonucleotides, each non-signal oligonucleotide comprising:

[0344] (aa) A translator linker element (C), comprising a nucleotide sequence substantially complementary to at least a portion of the nucleotide sequence of the translator element (c), and

[0345] (bb) Quencher (Q), signal element and quencher (Q), or excluding signal element.

[0346] In another embodiment, the sample may come into contact with:

[0347] At least two non-signal oligonucleotide groups, each non-signal oligonucleotide comprising:

[0348] (aa) A translator linker element (C), comprising a nucleotide sequence substantially complementary to at least a portion of the nucleotide sequence of the translator element (c), and

[0349] (bb) Quencher (Q), signal element and quencher (Q), or excluding signal element.

[0350] As mentioned above, different non-signal oligonucleotide groups can be included in a premixture of different non-signal oligonucleotide groups or exist separately.

[0351] In another implementation, the decoding oligonucleotides in a particular decoding oligonucleotide set interact with the same identifier element (T) that is unique to a particular analyte.

[0352] As described above, different decoding oligonucleotide sets may be included in or separately from different premixes of decoding oligonucleotide sets, and different analyte-specific probe sets may be included in or separately from different premixes of analyte-specific probe sets, and different signaling oligonucleotide sets may be included in or separately from different premixes of signaling oligonucleotide sets.

[0353] In some advantageous embodiments of the method according to this disclosure, the binding element (S) comprises a nucleic acid containing a nucleotide sequence that allows specific binding to, and preferably specific hybridization to, the analyte to be encoded.

[0354] In some advantageous embodiments of the method according to this disclosure, unbound analyte-specific probes can be removed, especially by washing, after step A) and before step B); unbound decoding oligonucleotides can be removed, especially by washing, after step B) and before step C); and unbound signal oligonucleotides can be removed, especially by washing, after step C) and before step D).

[0355] In some advantageous embodiments of the method according to this disclosure, the analyte-specific probe can be incubated with the sample, thereby allowing the analyte-specific probe to bind specifically to the analyte to be encoded. In addition, the decoding oligonucleotide can be incubated with the sample, thereby allowing the decoding oligonucleotide to specifically hybridize with the identifier element (T) of the respective analyte-specific probe. Furthermore, the signal oligonucleotide can be incubated with the sample, thereby allowing the signal oligonucleotide to specifically hybridize with the translator element (T) of the respective decoding oligonucleotide.

[0356] As described above, the analyte to be encoded can be a nucleic acid, preferably DNA, PNA, or RNA, especially mRNA, peptide, polypeptide, protein, or a combination thereof. Therefore, the binding element (S) can include an amino acid sequence that allows specific binding to the analyte to be encoded. Examples of binding elements (S) are portions derived from the affinity portion of an affinity substance or the entire affinity substance, selected from the group consisting of: antibodies, antibody fragments, anticalin proteins, receptor ligands, enzyme substrates, lectins, cytokines, lymphokines, interleukins, angiogenic or virulence factors, allergens, peptide allergens, recombinant allergens, allergen idiotype antibodies, autoimmune-inducing structures, tissue rejection-inducing structures, immunoglobulin constant regions, and combinations thereof. In particular, the binding element (S) is an antibody or antibody fragment selected from the group consisting of: Fab, scFv; single domain or fragment thereof, dual scFv, Fab 2, Fab 3, microantibodies, dual antibodies, triple antibodies, tetraantibodies, and tandabs.

[0357] Through this approach, the method is further developed to the point that the encoded analyte can be detected by any means suitable for visualizing the signal element. Examples of detectable physical characteristics include, for example, light, chemical reactions, molecular weight, radioactivity, etc.

[0358] In some advantageous embodiments, the signal generated by the signaling element, and therefore especially by the binding of the decoding oligonucleotide to the signaling oligonucleotide interacting with the corresponding analyte probe bound to the respective analyte, is determined by the following:

[0359] (a) Imaging at least a portion of the sample; and / or

[0360] (b) Use of optical imaging techniques; and / or

[0361] (c) Use of fluorescence imaging techniques; and / or

[0362] (d) Multicolor fluorescence imaging technology; and / or

[0363] (e) Super-resolution fluorescence imaging technology.

[0364] The kits and methods disclosed herein can be ideally used for in vitro diagnostic methods of diseases selected from the group consisting of: cancer, neuronal diseases, cardiovascular diseases, inflammatory diseases, autoimmune diseases, diseases caused by viral or bacterial infections, skin diseases, musculoskeletal diseases, dental diseases, and prenatal diseases.

[0365] Furthermore, the kits and methods according to this disclosure can also be ideally used for in vitro methods of diagnosing plant diseases selected from the group consisting of: diseases caused by biotic stress, preferably diseases caused by infection and / or parasites, or diseases caused by abiotic stress, preferably diseases caused by nutrient deficiency and / or adverse environments.

[0366] Furthermore, the kits and methods according to this disclosure can also be ideally used for in vitro methods of screening, identifying, and / or testing substances and / or drugs, the methods comprising:

[0367] (a) Contacting the test sample, including the sample, with the substance and / or drug.

[0368] (b) Different analytes in a sample are detected by sequential signal encoding of the analytes according to the method of this disclosure.

[0369] An optical multiplexing system suitable for the method according to this disclosure, comprising at least:

[0370] - A reaction vessel for containing a kit or a portion thereof according to this disclosure;

[0371] - Detection unit, which includes a microscope, especially a fluorescence microscope.

[0372] -Camera;

[0373] - Liquid handling equipment.

[0374] In some implementations, the optical multiplexing system may further include heating and cooling devices and / or robotic systems.

[0375] Examples of suitable construction techniques or materials applicable in conjunction with this disclosure may be described in, for example, commonly assigned U.S. Patent No. 6,734,401 entitled “(Improved Sample Processing Devices, Systems and Methods)” (Bedingham et al.) and U.S. Patent Application Publication No. US 2002 / 0064885 entitled “Sample Processing Devices”. Other available apparatus configurations can be found in, for example, U.S. Provisional Patent Application Serial No. 60 / 214,508, filed June 28, 2000, entitled "Thermal Processing Devices and Methods"; U.S. Provisional Patent Application Serial No. 60 / 214,642, filed June 28, 2000, entitled "Sample Processing Devices, Systems and Methods"; U.S. Provisional Patent Application Serial No. 60 / 237,072, filed October 2, 2000, entitled "Sample Processing Devices, Systems and Methods"; and U.S. Provisional Patent Application Serial No. 60 / 260,063, filed January 6, 2001, entitled "Sample Processing Devices, Systems and Methods". The patent application serial number 60 / 284,637, filed April 18, 2001, entitled "Enhanced Sample Processing Devices, Systems, and Methods"; and U.S. Patent Application Publication No. US2002 / 0048533, entitled "Sample Processing Devices and Carriers". Other possible device configurations can be found, for example, in U.S. Patent No. 6,627,159 entitled "Centrifugal Filling of Sample Processing Devices" (Bedingham et al.).

[0376] The optical multiplexing system according to this disclosure may include multiple processing chambers (e.g., reaction vessels), each for containing a corresponding sample and one or more probe sets, such as analyte-specific probe sets, decoding oligonucleotide / non-signal oligonucleotide sets, and / or signal oligonucleotide / non-signal oligonucleotide sets. For example, the processing chambers may be included in a rotatable disk or in a movable plate such as a 96-well plate; an engine for rotating the disk or moving the plate, wherein the engine may in particular be part of a robotic system.

[0377] The optical multiplexing system according to this disclosure may further include at least one or more optical modules, and in particular, the system includes a housing having at least one or more locations suitable for receiving optical modules, wherein each of the plurality of optical modules can be removed from the location of the housing.

[0378] In some advantageous embodiments, the optical multiplexing system according to this disclosure may include a detector, and in particular an optical fiber bundle coupled to a plurality of optical modules to transmit fluorescence from the plurality of optical modules to the detector.

[0379] In particular, one or more optical modules include optical channels, each optical module having a light source selected for exciting one of different dyes and a lens for capturing the emitted fluorescence, the one or more optical modules being optically configured to query fluorescent dyes at different wavelengths.

[0380] In another embodiment, the system may include a microfluidic cartridge (also referred to herein as a microfluidic device) having at least one flow channel. The optical multiplexing system includes a fluorescence imaging system. Other features of the system may include a temperature measurement and / or control system. In some embodiments, the system includes a pressure measurement and control system for applying variable pneumatic pressure, for example, to the microfluidic cartridge. The optical multiplexing system may include a storage device, such as a well plate, for containing multiple reagents. Furthermore, the optical multiplexing system may include a liquid handling system, particularly including, for example, at least one robotic pipette, for aspirating, mixing, and dispensing reagent mixtures, for example, into the microfluidic cartridge and / or into one or more reaction vessels. Additionally, the system may include means for data storage, processing, and output; and, in particular, a system controller to coordinate the various means and functions.

[0381] In some embodiments, the methods according to this disclosure encode nucleic acid analytes, such as mRNA, for example, mRNA encoding a specific protein.

[0382] In some advantageous embodiments, the methods described herein are used to specifically detect many different analytes in parallel. This technique allows for the differentiation of a greater number of analytes than the different signals available. The process involves at least four consecutive rounds of specific binding, signal detection, and selective denaturation (if a next round is needed), ultimately producing a signal code. To decouple the dependence between analyte-specific binding and the oligonucleotide that provides the detectable signal, so-called “decoding” oligonucleotides are introduced. Decoding oligonucleotides transcribe information from the analyte-specific probe set into signal oligonucleotides.

[0383] In a particular embodiment, the method may include the following steps: 1. providing one or more analyte-specific probe sets, each consisting of one or more distinct probes, each probe differing in the binding portion that specifically interacts with the analyte, all probes in a single probe set being associated with a sequence element (unique identifier) ​​that is unique to the single probe set and allows for specific hybridization of the decoding oligonucleotide; 2. specific binding of the probe set to the target binding site of the analyte; 3. removal of unbound probes (e.g., by a washing step); 4. providing a mixture of decoding oligonucleotides that specifically hybridize with the unique identifier sequence of the probe set, the decoding oligonucleotide comprising at least two sequence elements: a first element complementary to the unique identifier sequence of the corresponding probe set and a second sequence element (translation element) providing a sequence for specific hybridization of the signaling oligonucleotide, the translation element defining the signaling oligonucleotide recruited to the decoding oligonucleotide. 5. Specific hybridization of the decoding oligonucleotide with a unique identifier sequence provided by the bound probe set; 6. Removal of unbound decoding oligonucleotides (e.g., by a washing step); 7. Provision of a mixture of signal oligonucleotides comprising a detectable signal and a nucleic acid sequence specifically hybridized with a translation element of one of the decoding oligonucleotides used in the previous hybridization step; 8. Specific hybridization of the signal oligonucleotides; 9. Removal of unbound signal oligonucleotides; 10. Detection of the signal; 11. Selective release of the decoding and signal oligonucleotides while the binding of the specific probe set to the analyte is almost or completely unaffected; 12. Removal of the released decoding and signal oligonucleotides (e.g., by a washing step) while the binding of the specific probe set to the analyte is almost or completely unaffected; repeating steps 4 through 12 at least three times until a sufficient number of signals are detected to generate a coding scheme for each different target analyte.

[0384] It should be understood that the foregoing features and the features to be mentioned below can be used not only in the combinations indicated in their respective cases, but also in other combinations or individually, without departing from the scope of this disclosure.

[0385] This disclosure will now be further explained by means of embodiments that lead to additional features, characteristics, and advantages of this disclosure. These embodiments are purely illustrative in nature and do not limit the scope or boundaries of this disclosure. Features mentioned in a particular embodiment are general features of this disclosure and apply not only to that particular embodiment but also independently in the context of any embodiment of this disclosure.

[0386] The method disclosed herein is used for the parallel and specific detection of many different analytes. This technique allows for the differentiation of a greater number of analytes than the different signals available. The process preferably includes at least two consecutive rounds of specific binding, signal detection, and selective denaturation (if a next round is needed), ultimately generating a signal code. To decouple the dependence between analyte-specific binding and the oligonucleotide that provides the detectable signal, so-called “decoding” oligonucleotides are introduced. Decoding oligonucleotides transcribe information from the analyte-specific probe set into signal oligonucleotides.

[0387] Methods and Examples

[0388] In application variants, the analyte or target is a nucleic acid, such as DNA or RNA, and the probe set comprises oligonucleotides that are fully complementary to the entire sequence or a subsequence of the nucleic acid sequence to be detected. Figure 1 The nucleic acid sequence-specific oligonucleotide probe set includes an analyte-specific probe (1) comprising a binding element (S) that specifically hybridizes to a target nucleic acid sequence to be detected, and an identifier element (T) containing a nucleotide sequence (unique identifier sequence) that is unique to the analyte-specific probe set.

[0389] In an advantageous embodiment of this disclosure, the analyte / target is a nucleic acid, such as RNA, and two probe sets comprising oligonucleotides that are partially or completely complementary to a different region of a single nucleic acid sequence target. Figure 15 The nucleic acid sequence-specific oligonucleotide probe set comprises two analyte-specific probe sets, each (1 and 1', 2 and 2') including a binding element (S) that specifically hybridizes to the target nucleic acid sequence to be detected, and a distinct identifier element (T) comprising a nucleotide sequence unique to the analyte-specific probe set (unique identifier sequence). These two sets are used for decoding the analyte (1, 2) and for detecting the presence / absence of exclusive elements that distinguish analyte subgroups (1' and 2').

[0390] In other application variations, the analyte or target is a protein and the probe set includes one or more proteins, such as antibodies. Figure 2The protein-specific probe set includes analyte-specific probes (1) that include binding elements (T) such as (highly) variable regions of antibodies that specifically interact with the target protein to be detected, and identifier elements (T).

[0391] In other application variants, at least one analyte is a nucleic acid and at least a second analyte is a protein, and at least a first probe set binds to the nucleic acid sequence and at least a second probe set specifically binds to the protein analyte. Other combinations are also possible.

[0392] The general implementation of the method disclosed herein may be as follows:

[0393] Step 1: Apply at least 20 analyte or target-specific probe sets. Incubate the target nucleic acid sequence together with probe sets consisting of oligonucleotides having sequences complementary to the target nucleic acid. In this example, a probe set of 5 different probes is shown, each probe including a sequence element (S1 to S5) complementary to a single subsequence of the target nucleic acid sequence. In this example, the regions do not overlap. Each oligonucleotide targeting the same nucleic acid sequence includes an identifier element or a unique identifier sequence (T).

[0394] Step 2: Hybridization of the probe set. The probe set is hybridized with the target nucleic acid sequence under conditions that allow for specific hybridization. After incubation, the probes hybridize with their corresponding target sequences, providing identifier elements (T) for the next step.

[0395] Step 3: Remove unbound probes. After hybridization, remove unbound oligonucleotides, for example, by a washing step.

[0396] Step 4: Apply the decoding oligonucleotide. Apply the decoding oligonucleotide, which consists of at least two sequence elements (t) and (c). Although the sequence element (t) is complementary to the unique identifier sequence (T), the sequence element (c) provides the region (translation element) for subsequent hybridization of the signal oligonucleotide.

[0397] Step 5: Hybridization of the decoding oligonucleotide. The decoding oligonucleotide hybridizes with the unique identifier sequence (T) of the probe (T) via its complementary first sequence element (t). After incubation, the decoding oligonucleotide provides the translator sequence element (c) for the subsequent hybridization step.

[0398] Step 6: Remove excess decoding oligonucleotides. After hybridization, remove unbound decoding oligonucleotides, for example, by a washing step.

[0399] Step 7: Apply signal oligonucleotide. The signal oligonucleotide is applied. The signal oligonucleotide includes at least one second linker element (C) substantially complementary to the translator sequence element (C) and at least one signal element providing a detectable signal (F).

[0400] Step 8: Hybridization of the signal oligonucleotide. The signal oligonucleotide hybridizes with the translator element (c) of the decoding oligonucleotide via a complementary sequence linker element (c). After incubation, the signal oligonucleotide hybridizes with its corresponding decoding oligonucleotide and provides a detectable signal (F).

[0401] Step 9: Remove excess signal oligonucleotides. After hybridization, remove unbound signal oligonucleotides, for example, by a washing step.

[0402] Step 10: Signal detection. Detect the signal provided by the signal oligonucleotide.

[0403] The final round of testing does not require the following steps (steps 11 and 12).

[0404] Step 11: Selective Denaturation. This dissolves the hybridization between the unique identifier sequence (T) and the first sequence element (t) of the decoding oligonucleotide. Destabilization can be achieved through various mechanisms well known to those skilled in the art, such as increased temperature, denaturing agents, etc. Target-specific probes or analyte-specific probes are unaffected by this step.

[0405] Step 12: Removal of denatured decoding oligonucleotides. Denatured decoding and signal oligonucleotides are removed (e.g., by a washing step), leaving a specific probe set with a free, unique identifier sequence, which can be reused in the next round of hybridization and detection (steps 4 through 10). This detection cycle (steps 4 through 12) is repeated at least four times until the planned encoding scheme is complete.

[0406] In some advantageous implementations, in step 13, additional loops of steps 4 through 10 are performed to read subgroup / variant-specific signals.

[0407] Another embodiment of the general method of this disclosure using multiple decoders may be ( Figure 16 ):

[0408] Step 1: Target Nucleic Acids: In this embodiment, three different target nucleic acids (A), (B), and (C) must be detected and distinguished using only two different types of signal oligonucleotides. A specific encoding scheme was established before the experiment began. In this embodiment, the three different nucleic acid sequences are encoded by three rounds of detection with three different signal types (1), (2), and (1 / 2), and a Hamming distance of 3 is generated to allow for false detections. The planned codewords are:

[0409] Sequence A: (1)–(1)–(2)

[0410] Sequence B: (2)–(2)–(1 / 2)

[0411] Sequence C: (1 / 2)–(1 / 2)–(1)

[0412] Step 2: Probe Hybridization: For each target nucleic acid, a unique probe set is applied, which specifically hybridizes with the corresponding target nucleic acid sequence. Each probe set is provided with a unique identifier sequence (T1), (T2), or (T3). In this way, each different target nucleic acid is uniquely labeled. In this embodiment, sequence (A) is labeled with (T1), sequence (B) is labeled with (T2), and sequence (C) is labeled with (T3). Figure 16 The diagram in the image summarizes Figure 3 Steps 1 to 3.

[0413] Step 3: Hybridization of Decoding Oligonucleotides and Multiple Decoders: For each unique identifier present, apply a decoding oligonucleotide or multiple decoder that specifically hybridizes with the corresponding unique identifier sequence through its first sequence element (here, (t1) vs. (T1), (t2) vs. (T2), and (t3) vs. (T3)). Each of the decoding oligonucleotides or multiple decoders provides one or two translational elements that define the signal to be generated after the signal oligonucleotide hybridization. Here, nucleic acid sequence (A) is labeled with (c1), (B) with (c2), and (C) is labeled with translational elements (c1) and (c2) to generate a signal (1 / 2). Figure 16 The diagram in the image summarizes Figure 3 Steps 4 to 6.

[0414] Step 4: Hybridization of signal oligonucleotides: For each type of translational element, a signal oligonucleotide with a specific signal that can be distinguished from the signals of other signal oligonucleotides is applied. The signal oligonucleotide can specifically hybridize with the corresponding translational element. Figure 16 The diagram in the image summarizes Figure 3 Steps 7 to 9

[0415] Step 5: Signal detection for the encoding scheme: Detecting different signals. It should be noted that in this embodiment, nucleic acids (A), (B), and (C) can already be distinguished after the first round of detection. This is consistent with... Figure 5 Step 5 creates a comparison. Figure 5 Step 5 is explained by the additional signal type (1 / 2) that can be achieved through multiple decoders. Although nucleic acid sequences can already be distinguished, the additional rounds help to achieve a planned Hamming distance of 3. Figure 16 The diagram in the image corresponds to Figure 3 Step 10.

[0416] Step 6: Selective denaturation: such as Figure 3In steps 11 and 12, the decoding (and signaling) oligonucleotides and / or multiple decoders of all nucleic acid sequences to be detected are selectively denatured and removed. Subsequently, the unique identifier sequences of different probe sets can be used for the next round of hybridization and detection.

[0417] Step 7: Second Round of Detection: The next round of hybridization and detection is performed as described in steps 3 through 5. Note that in this new round, the mixing of different decoding oligonucleotides and multiple decoders has changed. For example, the decoding oligonucleotides of the nucleic acid sequence (A) used in the first round include sequence elements (t1) and (c1), while the new multiple decoders in the second round include sequence elements (t1), (c1), and (c2). Note that a Hamming distance of 2 has now been given after two rounds, which is what it is after three rounds. Figure 3 The final result of the embodiments in the example.

[0418] Step 8: Third Round Detection: New combinations of decoding oligonucleotides and / or multiple decoders are used again to generate new signal combinations. After signal detection, the resulting codewords for the three different nucleic acid sequences are not only unique and therefore distinguishable, but also have a Hamming distance of 3 from other codewords. Due to this Hamming distance, errors in signal detection (signal exchange) will not produce valid codewords and can therefore be detected, and are also corrected due to the Hamming distance of 3. Figure 3 The encoding scheme is the opposite. This allows for the differentiation of three different nucleic acids using two different signals in three rounds of detection, thus enabling error detection and correction.

[0419] It should be noted that in each round of detection, the type of signal provided by a specific unique identifier is controlled by the use of a specific decoding oligonucleotide. As a result, the sequence of the decoding oligonucleotide applied in the detection cycle transcribes the binding specificity of the probe set into a unique signal sequence.

[0420] The steps of decoding oligonucleotide hybridization (steps 4 to 6) and signal oligonucleotide hybridization (steps 7 to 9) can also be combined in two alternative ways, such as... Figure 4 As shown in the image.

[0421] Option 1: Simultaneous hybridization. Alternative: Figure 3 Steps 4 to 9, including specific hybridization of the decoding oligonucleotide and the signal oligonucleotide, can also be performed simultaneously. After removing redundant decoding and signal oligonucleotides, this leads to... Figure 3 The same result is shown in step 9.

[0422] Option 2: Preheating. (Besides...) Figure 3 In addition to option 1, decoding oligonucleotides and signaling oligonucleotides can be pre-incubated in separate reactions and then applied to target nucleic acids with a set of specific probes that have already been bound.

[0423] 1. Implementation of signal encoding for three different nucleic acid sequences using two different signal types and three rounds of detection. example

[0424] Figure 3 This illustrates the general concept of generating and detecting specific signals mediated by decoding oligonucleotides. It does not show the general concept of encoding that can be implemented through this procedure. (For illustration...) Figure 3 The diagram illustrates the purpose of the process in generating encoding schemes. Figure 5 A general embodiment of a multi-round coding experiment using three different nucleic acid sequences is shown. In this embodiment, the coding scheme includes error detection.

[0425] Step 1: Target Nucleic Acids. In this embodiment, three different target nucleic acids (A), (B), and (C) must be detected and distinguished using only two different types of signals. A certain encoding scheme was set up before the experiment began. In this embodiment, the three different nucleic acid sequences are encoded by three rounds of detection with two different signals (1) and (2), and the resulting Hamming distance is 2 to allow for false detections. The planned codewords are:

[0426] Sequence A: (1)–(2)–(2);

[0427] Sequence B: (1)–(1)–(1);

[0428] Sequence C: (2)–(1)–(2).

[0429] Step 2: Hybridization of the probe set. For each target nucleic acid, a dedicated probe set is applied, which specifically hybridizes with the corresponding target nucleic acid sequence. Each probe set is provided with a unique identifier sequence (T1), (T2), or (T3). In this way, each different target nucleic acid is uniquely labeled. In this embodiment, sequence (T) is labeled with (T1), sequence (B) with (T2), and sequence (C) with (T3). The diagram summarizes... Figure 3 Steps 1 to 3.

[0430] Step 3: Hybridization of the decoding oligonucleotides. For each unique identifier present, a decoding oligonucleotide is applied that specifically hybridizes with the corresponding unique identifier sequence (here, (t1) vs. (T1), (t2) vs. (T2), and (t3) vs. (T3)) through its first sequence element. Each decoding oligonucleotide provides a translation element that defines the signal that will be generated after the signal oligonucleotide hybridization. Here, nucleic acid sequences (A) and (B) are labeled with translation element (c1), and sequence (C) is labeled with (c2). The diagram summarizes... Figure 3 Steps 4 to 6.

[0431] Step 4: Hybridization of signal oligonucleotides. For each type of translational element, a signal oligonucleotide with a specific signal (2) that can be distinguished from the signals of other signal oligonucleotides is applied. The signal oligonucleotide can hybridize specifically with the corresponding translational element. The diagram summarizes... Figure 3 Steps 7 to 9.

[0432] Step 5: Signal detection for the encoding scheme. Detect different signals. Note that in this embodiment, nucleic acid sequence (C) can be distinguished from other sequences by the unique signal (2) it provides, while sequences (A) and (B) provide the same type of signal (1) and cannot be distinguished after the first detection cycle. This is because the number of different nucleic acid sequences to be detected exceeds the number of different signals available. The illustration corresponds to... Figure 3 Step 10.

[0433] Step 6: Selective denaturation. For example... Figure 3 In steps 11 and 12, the decoding (and signaling) oligonucleotides of all nucleic acid sequences to be detected are selectively denatured and removed. Afterward, the unique identifier sequences for each probe set can be used for the next round of hybridization and detection.

[0434] Step 7: Second Round of Detection. The next round of hybridization and detection is performed as described in steps 3 through 5. It should be noted that in this new round, the mixing of the different decoding oligonucleotides has changed. For example, the decoding oligonucleotides for the nucleic acid sequence (A) used in the first round include sequence elements (t1) and (c1), while the new decoding oligonucleotides include sequence elements (c1) and (c2). Note that due to the unique combination of signals from the first and second rounds, all three sequences can now be clearly distinguished.

[0435] Step 8: Third Round of Detection. The new combination of decoding oligonucleotides is used again to generate a new signal combination. After signal detection, the resulting codewords for the three different nucleic acid sequences are not only unique and therefore distinguishable, but also have a Hamming distance of 2 from the other codewords. Due to the Hamming distance, errors in signal detection (signal exchange) will not produce valid codewords and can therefore be detected. In this way, three different nucleic acids can be distinguished with two different signals in three rounds of detection, thus allowing for error detection.

[0436] 2. Advantages over existing technologies

[0437] Encoding strategy

[0438] A particular advantage of the method according to this disclosure, compared to state-of-the-art methods, is that the use of decoding oligonucleotides breaks the dependency between target-specific probes and signaling oligonucleotides.

[0439] Without decoupling target-specific probes and signal generation, using two different molecular tags will only generate two different signals for a given target. Each of these molecular tags can only be used once. Multiple readouts of the same molecular tag do not add information about the target. To generate an encoding scheme, the target-specific probe set (SeqFISH) needs to be changed after each round, or multiple molecular tags (such as merFISH, intronSeqFISH) must exist on the same probe set.

[0440] Following the method disclosed herein, different signals are achieved by using different decoding oligonucleotides that reuse the same unique identifier (molecular tag) and a small number of different, primarily cost-intensive, signaling oligonucleotides. This offers several advantages compared to other methods.

[0441] (1) The encoding scheme is not defined by a target-specific probe set, which is the case for all other methods in the prior art. Here, the encoding scheme is transcribed from decoding oligonucleotides. This results in greater flexibility regarding the number of rounds and greater freedom in signal selection within the codewords. Looking at prior art methods (e.g., merFISH or intronSeqFISH), the encoding scheme for all target sequences (the number, type, and sequence of detectable signals) is predefined by the presence of different tag sequences on a specific probe set (4 out of 16 different tags per probe set in the case of merFISH, and 5 out of 60 different tags in the case of intron FISH). To generate a sufficient number of different tags per probe set, these methods use rather complex oligonucleotide designs, with multiple tags present on a single target-specific oligonucleotide. To change the encoding scheme for a particular target nucleic acid, the specific probe set must be changed. The method described in this disclosure uses a single unique tag sequence (unique identifier) ​​for each analyte, as it can be reused in each round of detection to generate new information. The encoding scheme is defined by the order of the decoding oligonucleotides used in the detection rounds. Therefore, the encoding scheme is not predefined by specific probes (or unique tag sequences), but can be adapted to different needs, even during experiments. This is achieved by simply changing the decoding oligonucleotides used in the detection rounds or adding additional detection rounds.

[0442] (2) In existing methods, the number of different signal oligonucleotides must match the number of different tag sequences (16 in the case of merFISH and 60 in the case of intronSeqFISH). Using the method according to this disclosure, the number of different signal oligonucleotides matches the number of different signals used. Therefore, for the method described herein, the number of signal oligonucleotides remains constant and never exceeds the number of different signals, but increases with the complexity of the coding schemes in existing methods (requiring more detection rounds and more different signal oligonucleotides). As a result, the method described herein leads to a significantly reduced complexity (unintended interactions between signal oligonucleotides and the environment or with each other) and a significantly reduced assay cost, since the main cost factor is the signal oligonucleotides.

[0443] In existing methods, the number of distinct signals generated by a target-specific probe set is limited by the number of distinct tag sequences that the probe set can provide. Since each additional tag sequence increases the total size of the target-specific probe, the number of distinct tags a single probe can provide is finite. This limitation is caused by the increasing size dependence of several issues (unexpected intermolecular and intramolecular interactions, cost, diffusion rate, stability, errors during synthesis, etc.). Furthermore, the total number of target-specific probes that can be applied to a particular analyte is limited. In the case of nucleic acids, this limitation is caused by the length of the target sequence and the appropriate ratio of binding sites. These factors severely limit the number of distinct signals that the probe set can provide (4 signals in the case of merFISH and 5 signals in the case of intronSeqFISH). This limitation significantly affects the number of distinct codewords that can be generated through a given number of detection rounds. In the method of this disclosure, only one tag is required and can be freely reused in each round of detection. This results in low oligonucleotide complexity / length, while simultaneously leading to the maximum possible coding efficiency (number of colors). 轮数 Our method differs significantly from other methods in its coding capabilities, such as... Figure 1 and Figure 5 As shown in the figure. Therefore, in the method of this disclosure, far fewer rounds of detection are required to produce the same amount of information. Fewer rounds of detection are associated with: lower cost, shorter experimental time, lower complexity, higher stability and success rate, less data to be collected and analyzed, and higher accuracy of results.

[0444] Coding ability

[0445] All three methods compared in Table 1 below use specific probe sets that are invariant across different detection rounds. For intronSeqFISH, four rounds of detection are required to generate one round of encoded pseudocolor, therefore only data from rounds 4, 8, 12, 16, and 20 are given. The merFISH method uses a constant number of four signals, so data starts with the fewest possible number of rounds. After eight rounds of detection, our method surpasses the maximum encoding capability achieved by merFISH after 20 rounds (indicated by one asterisk), and after 12 rounds of detection, it surpasses the maximum encoding capability of intron FISH (indicated by two asterisks). For the method according to this disclosure, it is assumed that three different signals are used (as with intronSeqFISH).

[0446]

[0447]

[0448] Table 1: Comparison of Coding Capabilities

[0449] like Figure 6 As shown, the number of codewords in merFISH does not increase exponentially with the number of detection cycles, but becomes less efficient with each additional round. In contrast, the number of codewords in intronSeqFISH according to the method of this disclosure increases exponentially. The slope of the curve for the proposed method is much higher than that for intron FISH, resulting in an increase of more than 10,000 times in the number of usable codewords after 20 rounds of detection.

[0450] It should be noted that this maximum efficiency of encoding capability is also achieved in the case of seqFISH, where the specific probes denature after each round of detection, and the new probe set specifically hybridizes with the target sequence of each round of detection. However, this method has significant drawbacks compared to encoding schemes that use only one type of specific hybridization (all other methods):

[0451] (1) In order to effectively denature the specific probe, rather rough conditions (high temperature, high denaturant concentration, long incubation time) must be used, which may lead to a higher possibility of analyte loss or damage.

[0452] (2) For each round of detection, a separate probe set must be used for each target nucleic acid sequence. Therefore, the number of specific probes required for the experiment is proportional to the number of different signals required by the coding scheme. This significantly increases the complexity and cost of the assay.

[0453] (3) Since the hybridization efficiency of each target nucleic acid molecule is affected by a certain probability, the fluctuation of signal intensity between different detection rounds is much higher than that of the method using only one specific hybridization event, which reduces the proportion of complete code.

[0454] (4) Specific hybridization takes much longer than hybridization of signal or decoding oligonucleotides (as can be seen in the methods section of intronSeqFISH, merFISH and seqFISH publications), which greatly increases the time required to complete the experiment.

[0455] For these reasons, all other methods use a single specific hybridization event and suffer from the major drawback of lower code complexity, thus requiring more rounds of detection and higher oligonucleotide design complexity.

[0456] The method disclosed herein combines the advantages of seqFISH (primarily complete freedom regarding the coding scheme) with all the advantages of methods that use only one specific hybridization event, while eliminating the main problems of such methods.

[0457] It should be noted that the large number of codewords generated after 20 rounds can also be used to introduce higher Hamming distances (differences) between different codewords, thereby allowing error detection for 1, 2, or even more errors, and even error correction. Therefore, even very high coding capabilities still have practical significance.

[0458] For the detection of subgroups / variants within groups of analytes / targets that share certain parts (e.g., mRNA splicing variants), two separate codewords might be used. However, the signal will be generated at exactly the same physical location, so the mixed readout will be a result of the initial approach. This problem can be avoided by using additional rounds to add information to the established codewords.

[0459] As mentioned above, the use of multiple decoders further increases the coding capability of the coding scheme. The use of multiple decoders is no longer limited to different signal types having the exact same number of different signal oligonucleotides and corresponding translator elements, but rather adds the following signal types that can be used: (N x (N+1)) / 2 (where N is the number of different signal oligonucleotides used). For the code with 3 different signal oligonucleotides used in Table 1, this means that the following 7 different signal types can be used: (S1), (S2), (S3), (S1 / S2), (S1 / S3), (S2 / S3), (S1 / S2 / S3). The impact on coding efficiency can be seen in Table 1b and... Figure 18 I saw it in the middle.

[0460]

[0461]

[0462] Table 1b shows the coding capabilities of the four methods.

[0463] All four methods compared in Table 1b use specific probe sets that are invariant across different detection rounds. For intronSeqFISH, four detection rounds are required to generate one round of encoded pseudocolor, therefore only data from rounds 4, 8, 12, 16, and 20 are given. The merFISH method uses a constant number of four signals, so data starts with the fewest possible number of rounds. After four detection rounds, the method described here with multiple decoders exceeds the maximum encoding capability achieved with 20 rounds of merFISH (indicated by one asterisk), after seven detection rounds it exceeds the maximum encoding capability of intron FISH (indicated by two asterisks), and after twelve detection rounds it exceeds the maximum encoding capability of the method of this disclosure (indicated by three asterisks). It is assumed that three different signal oligonucleotides are used (as with intronSeqFISH).

[0464] 3. Selective denaturation, oligonucleotide assembly, and the reuse of unique identifiers are remarkably efficient. The key elements of the method according to this disclosure are a sequential process of decoding oligonucleotide binding, signal oligonucleotide binding, signal detection, and selective denaturation. This process must be repeated several times (depending on the codeword length) to generate the coding scheme. Since the same unique identifier is reused in each detection cycle, all events from the first to the last detection cycle are interdependent. Furthermore, selective denaturation depends on two distinct events: while the decoding oligonucleotide must dissolve from the unique identifier with maximum efficiency, the specific probe must maintain hybridization with maximum efficiency.

[0465] Therefore, the efficiency E of the entire encoding process can be described by the following equation:

[0466] E=B sp x(B de x B si x E de x S sp ) n

[0467] E = Total efficiency

[0468] B sp = Binding of specific probes

[0469] B de =Decoding the binding of oligonucleotides

[0470] B si = Binding of signal oligonucleotides

[0471] E de =Removal of decoding oligonucleotides

[0472] S sp =Stability of specific probes during the removal process

[0473] n = Number of detection loops

[0474] Based on this equation, the efficiency of each individual step can be estimated for the overall efficiency of a given method. The calculation here is based on the assumption that each process has the same efficiency. The overall efficiency describes the portion of the total signal that has been successfully decoded.

[0475] The overall efficiency of this method depends on the efficiency of each individual step, which is described by the equation. Under the assumption of a uniformly distributed efficiency, a graph of the overall efficiency versus the efficiency of each individual step can be plotted, as shown below. Figure 7 As shown in the figure, the actual overall efficiency of the coding scheme with 5 detection cycles can only be achieved with a single-step efficiency significantly higher than 90%. For example, to achieve an overall efficiency of 50%, an average efficiency of 97.8% within each single step is required. These calculations are even based on the assumption of 100% signal detection and analysis efficiency. Due to the broad DNA melting curves of oligonucleotides of various sequences, the inventors assumed before the experiment that selective denaturation was inefficient for decoding oligonucleotides and that sequence-specific binding probes were not stable enough. Contrary to this assumption, we found that all steps exhibited remarkable efficiency and high stability of sequence-specific probes during selective denaturation.

[0476] Through experiments, the inventors achieved a total decoding efficiency of approximately 30% to 65% based on 5 detection loops. Calculations of the efficiency for each single step (Bsp, Bde, Bsi, Ede, Ssp) using the above formula show an average efficiency of approximately 94.4% to 98%. These high efficiencies are quite surprising and were not easily anticipated by those skilled in the art.

[0477] 4. Experimental data

[0478] background

[0479] This experiment demonstrates parallel-specific detection of 10 to 50 different mRNA species with single-molecule resolution. It is based on a coding scheme with 5 detection cycles, 3 different fluorescence signals, and no signal gap with a Hamming distance of 2 (false detection). The experiment demonstrates the feasibility and functionality of the method according to this disclosure.

[0480] Oligonucleotides and their sequences

[0481] All oligonucleotide sequences used in the experiments (target-specific probes, decoding oligonucleotides, and signal oligonucleotides) are listed in the sequence listing in the appendix. The signal oligonucleotide R:ST05*O_Atto594 was purchased from biomers.net GmbH. All other oligonucleotides were purchased from Integrated DNA Technologies. The oligonucleotides were dissolved in water. Stock solutions (100 μM) were stored at -20°C.

[0482] Experiment Overview

[0483] Fifty different target-specific probes were divided into five groups. The names of the transcripts to be detected were the same as the names of the target-specific probe groups (transcript variant names from www.ensemble.org). The term "new" indicates a modified probe design. All oligonucleotide sequences of the probe groups can be found in the sequence listing. This listing lists the unique identifier names of the probe groups and the names of the decoding oligonucleotides used in different detection cycles. The generated codes show the fluorescent signal sequences generated during the five detection cycles (G (green) = Alexa Fluor 488, O (orange) = Atto 594, Y (yellow) = Alexa Fluor 546).

[0484]

[0485]

[0486]

[0487]

[0488] Table 2: Experiment Overview

[0489] Changes in the experiment

[0490] Some changes have been made to the experiments. Experiments 1 through 4 differ primarily in the number of transcripts detected in parallel. Groups listed as target-specific probe sets are shown in Table 6. Experiments 5 through 8 are single-round, single-target controls used for comparison with the decoded signals.

[0491]

[0492] Table 3: Experimental Variations

[0493] Experimental details

[0494] A. Cell seeding and culture

[0495] HeLa cells were grown in HeLa cell culture medium until near 100% confluence was achieved. The HeLa cell culture medium consisted of DMEM (Thermo Fisher, catalog number: 31885), 10% FCS (Biochrom, catalog number: S0415), 1% penicillin-streptomycin (Sigma-Adrich, catalog number: P0781), and 1% MEM non-essential amino acid solution (Thermo Fisher, catalog number: 11140035). After aspirating the cell culture medium, the cells were washed with PBS (1.424 g / L Na2HPO4*2H2O, 0.276 g / L NaH2PO4*2H2O, 8.19 g / L NaCl in water, pH 7.4), and then incubated at 37°C for 5 min with trypsin EDTA solution (Sigma-Aldrich, catalog number: T3924) for trypsin digestion. Cells were then seeded into the wells of a μ-Slide8 Well ibidiTreat (Ibidi, catalog number: 80826). The cell count per well was adjusted to achieve approximately 50% confluence after cell adhesion. Cells were incubated overnight with 200 μl of HeLa cell culture medium per well.

[0496] B. Cell fixation

[0497] After aspirating the cell culture medium and washing twice with 200 μl of 37°C warm PBS per well, the cells were fixed at -20°C for 10 min with 200 μl of pre-cooled methanol (-20°C, Roth, catalog number: 0082.1).

[0498] C. Re-dyeing with Sudan Black

[0499] Aspirate the methanol and add 150 μl of 0.2% Sudan Black solution diluted in 70% ethanol to each well. Incubate the wells in the dark at room temperature for 5 min. After incubation, wash the cells three times with 400 μl of 70% ethanol per well to remove excess Sudan Black solution.

[0500] D. Hybridization of analyte / target-specific probes

[0501] Prior to hybridization, cells were equilibrated with 200 μl of SM-wash buffer. SM-wash buffer consisted of 30 mM Na3 citrate, 300 mM NaCl, pH 7, 10% formamide (Roth, catalog: P040.1), and 5 mM ribonucleoside vanadyl complex (NEB, catalog: S1402S). For each target-specific probe set, 1 μl of a 100 μM oligonucleotide stock solution was added to the mixture. The oligonucleotide stock solution consisted of equimolar amounts of all target-specific oligonucleotides for the corresponding target-specific probe set. The total volume of the mixture was adjusted to 100 μl with water and mixed with 100 μl of 2x concentrated hybridization buffer. 2x concentrated hybridization buffer consisted of 120 mM Na3 citrate, 1200 mM NaCl, pH 7, 20% formamide, and 20 mM ribonucleoside vanadyl complex. Add 200 μl of the resulting hybridization mixture to the corresponding wells and incubate at 37 °C for 2 h. Then wash the cells three times with 200 μl of target probe washing buffer per well for 10 min at 37 °C. The target probe washing buffer consisted of 30 mM Na3 citrate, 300 mM NaCl, pH 7, 20% formamide, and 5 mM vanadate ribonucleoside complex.

[0502] E. Decoding the hybridization of oligonucleotides

[0503] Prior to hybridization, cells were equilibrated with 200 μl of SM-wash buffer. For each decoding oligonucleotide, 1.5 μl of 5 μM stock solution was added to the mixture. The total volume of the mixture was adjusted to 75 μl with water and mixed with 75 μl of 2x concentrated hybridization buffer. The resulting 150 μl decoding oligonucleotide hybridization mixture was added to the corresponding well and incubated at room temperature for 45 min. Cells were then washed three times with 200 μl of SM-wash buffer per well for 2 min at room temperature.

[0504] F. Hybridization of signal oligonucleotides

[0505] Prior to hybridization, cells were equilibrated with 200 μl of SM-W wash buffer. The signal oligonucleotide hybridization mixture was identical for all rounds 1 through 4 and consisted of 0.3 μM of each signal oligonucleotide in 1x concentrated hybridization buffer (see Table A3). In each round, 150 μl of this solution was added to each well and incubated at room temperature for 45 min. The procedure for experiments 5 through 8 was the same except that the final concentration of each signal oligonucleotide was 0.15 μM. Cells were then washed three times at room temperature with 200 μl of SM-W wash buffer for 2 min each.

[0506] G. Fluorescence and white light imaging

[0507] Cells were washed once with 200 μl of imaging buffer per well at room temperature. In experiments without Trolox (see Table 7, last column), the imaging buffer consisted of 30 mM Na3 citrate, 300 mM NaCl, pH 7, and 5 mM vanadate ribonucleoside complex. In experiments with Trolox, the imaging buffer also contained 10% VectaCell Trolox Antifade reagent (Vector laboratories, catalog number: CB-1000), resulting in a final Trolox concentration of 10 mM.

[0508] A Zeiss Axiovert 200M microscope, featuring a 63x oil immersion objective (Zeiss, apochromatic objective) with a numerical aperture of 1.4, a pco.edge 4.2 CMOS camera (PCO AG), and an LED light source (Zeiss, Colibri 7), was used for regional imaging. The filter group and LED wavelength were adjusted to optimal values ​​for the different fluorophores used. The illumination time per image was 1000 ms for Alexa Fluor 546 and Atto 594, and 400 ms for Alexa Fluor 488.

[0509] In each experiment, three regions were randomly selected for imaging. For each region, a z-stack of 32 images was detected with a z-step of 350 nm. Additionally, a white-light image was captured from these regions. In experiments with more than one detection cycle, the regions detected in the first round were found and imaged in every subsequent round.

[0510] H. Selective denaturation

[0511] For selective denaturation, each well was incubated at 42 °C with 200 μl of SM-wash buffer for 6 min. This procedure was repeated six times.

[0512] In experiments 1 through 4, steps (E) through (H) were repeated 5 times. Step (H) was omitted in the 5th detection cycle.

[0513] I. Analysis

[0514] Semi-automatic analysis of raw data was performed using a custom ImageJ plugin to distinguish specific fluorescence signals in the background. The resulting 3D point clouds from all three fluorescence channels were combined with a custom VBA script in the computer. The combined 3D point clouds from five detection cycles were cross-referenced based on the VBA script. The cross-references revealed the codewords of the unique signals detected. The successfully decoded signals were used for quantitative and spatial analysis of experiments based on the custom VBA script and the ImageJ plugin.

[0515] result

[0516] 1. The absolute number of decoded signals

[0517] Table 4 below lists the absolute number of successfully decoded signals for all transcripts in each region of each experiment. In summary, the sum of correct codes describes the total number of decoded signals assigned to detectable transcripts in the corresponding experiment, while the sum of incorrect codes represents the total number of undetectable decoded signals in the corresponding experiment. The total number of signals includes both successfully decoded and unsuccessfully decoded signals.

[0518]

[0519]

[0520]

[0521]

[0522]

[0523] Table 4: Absolute Number of Decoded Signals

[0524] Table 4 shows that the number of incorrectly decoded signals is very small compared to the number of correctly decoded signals. The absolute value of the decoded signals for a particular transcript is very similar across different regions of an experiment. The proportion of signals that can be successfully decoded ranges from 27.1% to 64.5%. This proportion depends on the number of transcripts and / or the total number of signals present in the corresponding region / experiment.

[0525] in conclusion

[0526] The method disclosed herein generates a small number of misassigned codewords and can therefore be considered specific. The proportion of successfully decoded signals is very high, even with a very high number of signals per region and a very high number of transcripts detected in parallel. The high proportion of assignable signals and high specificity make this method practical.

[0527] Comparison of relative transcript abundance between different experiments

[0528] like Figure 8 The diagram shows that, for two comparisons (A and B), the overlap of transcripts detected between experiments was used for analysis. Each bar represents the mean abundance of all three regions in the experiment. The standard deviation between these regions is also indicated.

[0529] Correlation of relative transcript abundance between different experiments

[0530] As from Figure 9As can be seen, the mean relative abundance of transcripts from Experiment 1 correlated with the abundance of overlapping transcripts from Experiments 3, 4, and 2. The correlation coefficients and the formulas used for linear regression indicate each correlation.

[0531] Figure 8 The low standard deviation indicates low variation in relative abundance between different regions within an experiment. The differences in relative abundance between transcripts from different experiments are also very low. Comparisons of transcripts from group 1 detected in experiments 1, 2, and 3 are shown. Figure 8 A) This is also the case. The same is true for transcripts from groups 2, 3, and 4, which overlap between experiments 1, 2, and 4. These very high correlations in abundance can also be seen in… Figure 9 As observed, the abundance of transcripts from Experiment 1 was highly correlated with the abundances from other multi-round experiments. The correlation factor ranged between 0.88 and 0.91, while the slope of the linear regression ranged between 0.97 and 1.05.

[0532] in conclusion

[0533] The relative abundance of transcripts was highly correlated across different regions within an experiment and also across different experiments. This can be achieved through... Figure 3 and Figure 4 The comparison clearly shows that the main difference between experiments lies in the number of different targets and therefore the total number of signals detected. Therefore, the number of transcripts detected, as well as the number and density of signals, do not interfere with the method's ability to accurately quantify transcript quantity. The very good correlation further supports the specificity and stability of the method, even with a large number of signals.

[0534] Comparison of intercellular signal distribution

[0535] exist Figure 10 The image stack shows the maximum projection. A: Region 1 of Experiment 7 (single-round, single-transcriptional experiment detection SPOCK1), B: 2D projection of all selected signals from Region 1 of Experiment 1, assigned to SPOCK1, C: Region 1 of Experiment 8 (single-round, single-transcriptional experiment detection THRAP3), D: 2D projection of all selected signals from Region 1 of Experiment 1, assigned to THRAP3.

[0536] Comparison of intracellular signal distribution

[0537] exist Figure 11The image stack shows the maximum projection. The corresponding magnified sub-regions are shown. A: Region 1 of Experiment 8 (single-round, single-transcriptional experiment detection THRAP3), B: 2D projection of selected signals from Region 1 of Experiment 1, assigned to THRAP3, C: Region 1 of Experiment 5 (single-round, single-transcriptional experiment detection DDX5), D: 2D projection of all selected signals from Region 1 of Experiment 1, assigned to DDX5.

[0538] Figure 10 This demonstrates significant differences in the intercellular distribution of different transcripts. SPOCK1 appears to be very abundant in some cells, but almost absent in others. Figure 10 A). THRAP3 showed a more uniform distribution in all cells of the region ( Figure 10 C). These spatial distribution patterns can also be clearly observed through point clouds assigned to the corresponding transcripts from Experiment 1. Figure 10 (B and D).

[0539] Figure 11 This demonstrates significant differences in the intercellular distribution of different transcripts. THRAP3 can be observed primarily in the periphery (cytoplasm) of cells. Figure 11 A), while DDX5 showed higher abundance in the central part of the cell (nucleus). Figure 11 C). These intracellular distributions can also be observed using point clouds from Experiment 1 assigned to THRAP3 and DDX5. Figure 11 (B and D).

[0540] in conclusion

[0541] Beyond the reliability of the quantification, the point clouds from multiple rounds of experiments also revealed the same intracellular and intercellular distribution patterns of the transcripts. This was clearly demonstrated by directly comparing the assigned point clouds with the signals from a single round of experiments that detected only one type of characteristic mRNA.

[0542] Distribution patterns of different cell cycle-dependent transcripts

[0543] Figure 12 All images show region 1 of Experiment 1. In each image, a point cloud assigned to a specific transcript is shown: A: CCNA2, B: CENPE, C: CCNE1, D: All transcripts. Figure 12 Transcripts of three different cell cycle-dependent proteins are shown. CENPE ( Figure 12 B) is also known as centromere protein E and accumulates during G2 phase. It is proposed to be responsible for spindle elongation and chromosome movement. It is absent during interphase. CCNA2 ( Figure 12A) is also known as cyclin A2. It regulates cell cycle progression by interacting with CDK1 during the transition from G2 to M phase. Interestingly, both mRNA species exhibit significant co-localization. They are primarily found in the three central cells of region 1. CCNE1 ( Figure 12 C) Also known as cyclin E1. This cyclin interacts with CDK2 and is responsible for the transition from G1 phase to S phase. Figure 12 It is clearly shown that the transcript of this gene is not present in the three central cells, but rather distributed fairly evenly in the other cells. Therefore, it shows antilocalization relative to the other two transcripts. The corresponding point cloud data comes from a point cloud with a very large number of points and a very high point density. Figure 12 D gives an impression).

[0544] in conclusion

[0545] Figure 12 The three decoded point clouds of cell cycle-dependent proteins shown in the figure illustrate distribution patterns that can be interpreted through their respective functions. These data strongly suggest that the methods of this disclosure reliably generate biologically relevant data, even when the number of signals per cell is small (…). Figure 12 C) and the signal density is very high ( Figure 12 D).

[0546] sequence list

[0547] In the accompanying sequence listing, SEQ ID No. 1-1247 refers to the nucleotide sequence of an exemplary target-specific oligonucleotide. The listed oligonucleotides consist of a target-specific binding site (5'-end), a spacer / linker sequence (gtaac or tagac), and a unique identifier sequence, which are identical for all oligonucleotides in a probe set.

[0548] In the accompanying sequence listing, SEQ ID No. 1248-1397 refers to the nucleotide sequence of an exemplary decoded oligonucleotide.

[0549] In the accompanying sequence listing, SEQ ID Nos. 1398-1400 refer to the nucleotide sequences of exemplary signal oligonucleotides. For each signal oligonucleotide, the corresponding fluorophore appears twice. One fluorophore is covalently linked to the 5' end, and the other is covalently linked to the 3' end. SEQ ID No. 1398 includes “5Alex488N” at its 5' end and “3AlexF488N” at its 3' end. SEQ ID No. 1399 includes “5Alex546” at its 5' end and “3Alex546N” at its 3' end. SEQ ID No. 1400 includes “Atto594” at both its 5' and 3' ends. sequence list <110> RESOLVE BIOSCIENCES GMBH <120> Multiple methods for detecting different analytes and different subgroups / variants of analytes in a sample. <130> PPI22172085GB <160> 1400 <170> BiSSAP 1.3.6 <210> 1 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 1 actactagag accggtagaa atgagtaacg attaccgact tatcc 45 <210> 2 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 2 tggcggggaa cgaagtatat agtaacgatt accgacttat cc 42 <210> 3 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 3 tggcgtcaat ggttgcggtg taacgattac cgacttatcc 40 <210> 4 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 4 tcggtcactc gaataacccg gtaacgatta ccgacttatc c 41 <210> 5 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 5 ctccaaatcg aggtgcacca gtaacgatta ccgacttatc c 41 <210> 6 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 6 ggccagttcc cgagttggtg taacgattac cgacttatcc 40 <210> 7 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 7 agacttcaag cgacatgctc tgtaacgatt accgacttat cc 42 <210> 8 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 8 ggagcaccac cgtagataca agtaacgatt accgacttat cc 42 <210> 9 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 9 ctctccaaat cacgtatttg tgggtaacga ttaccgactt atcc 44 <210> 10 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 10 agagtttgcc tatcaggtct tattgtaacg attaccgact tatcc 45 <210> 11 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 11 ggccaagtcg cactccacag taacgattac cgacttatcc 40 <210> 12 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 12 tccttttcta cgtcatgaca cagtaacgat taccgactta tcc 43 <210> 13 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 13 ttccattaga cgaataagtt tttcagtaac gattaccgac ttatcc 46 <210> 14 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 14 tttctggtaa gctcatcaca tctgtaacga ttaccgactt atcc 44 <210> 15 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 15 gagttagggt agtcataatt gatgagtaac gattaccgac ttatcc 46 <210> 16 <211> 47 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 16 ttcttccaat tcgatgaata taatccgtaa cgattaccga cttatcc 47 <210> 17 <211> 48 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 17 tgttattagg tgtaaagaaa gtgtatggta acgattaccg acttatcc 48 <210> 18 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 18 gagataaggt cgctcacttg cgtaacgatt accgacttat cc 42 <210> 19 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 19 acctctgtct tcgaccaact ggtaacgatt accgacttat cc 42 <210> 20 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 20 acccctggaa cgacctgaac gtaacgatta ccgacttatc c 41 <210> twenty one <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> twenty one agtatctgtc ccgacggtca gtaacgatta ccgacttatc c 41 <210> twenty two <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> twenty two accccttttg cccgcagagg taacgattac cgacttatcc 40 <210> twenty three <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> twenty three tttaagcagg ctagagtaac ctcgtaacga ttaccgactt atcc 44 <210> twenty four <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> twenty four gcattggata accaatcata ggtggtaacg attaccgact tatcc 45 <210> 25 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 25 tcccctagtc cgagttgctc gtaaccctaa ttatgggaat c 41 <210> 26 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 26 ccaatttgca cttggatgtg tagtaaccct aattatggga atc ​​43 <210> 27 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 27 ttttgccagt agaacaagca tggtaaccct aattatggga atc ​​43 <210> 28 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 28 ggaggcaagg ttccgcaacg taaccctaat tatgggaatc 40 <210> 29 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 29 agaattccac gtaaatcaca tgcgtaaccc taattatggg aatc 44 <210> 30 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 30 tatgcatgta cagggaagta tccgtaaccc taattatggg aatc 44 <210> 31 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 31 gtgtgcatgc cttagaaaaa gcgtaaccct aattatggga atc ​​43 <210> 32 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 32 agcttttgtg cccttatcat gagtaaccct aattatggga atc ​​43 <210> 33 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 33 cttcattagt atcttgtcac ttggggtaac cctaattatg ggaatc 46 <210> 34 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 34 agatgatgac cctaccaaat ttgggtaacc ctaattatgg gaatc 45 <210> 35 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 35 aggcaagaga tagatatgtg ggcgtaaccc taattatggg aatc 44 <210> 36 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 36 cagctgccac tataatcatg tttgtaaccc taattatggg aatc 44 <210> 37 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 37 ggaacatgct aatttaaggt gagtgtaacc ctaattatgg gaatc 45 <210> 38 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 38 aggactttgc tatatcaagt agttcgtaac cctaattatg ggaatc 46 <210> 39 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 39 aaaggagata gtaacaatgg ttttcgtaac cctaattatg ggaatc 46 <210> 40 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 40 aaatcagtgg ttcaccctgt tcgtaaccct aattatggga atc ​​43 <210> 41 <211> 48 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 41 cttgtcataa gataattagg caaattagta accctaatta tgggaatc 48 <210> 42 <211> 47 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 42 tcattaagtt aatgctaagg atctttgtaa ccctaattat gggaatc 47 <210> 43 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 43 tgtcactggt acaagtggac ttgtaaccct aattatggga atc ​​43 <210> 44 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 44 ttggtcacta tacaagtgac ttctgtaacc ctaattatgg gaatc 45 <210> 45 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 45 aggaaaatgg gcgtaaagga gggtaaccct aattatggga atc ​​43 <210> 46 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 46 ttcatctaca atagggacaa caaacgtaac cctaattatg ggaatc 46 <210> 47 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 47 gataagtcta cgtggaaaag catgtaaccc taattatggg aatc 44 <210> 48 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 48 caggactaca gttaagcatt tactgtaacc ctaattatgg gaatc 45 <210> 49 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 49 gtctaggaaa ttgccgtggt tggtaaccct aattatggga atc ​​43 <210> 50 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 50 aatcatcgtc tcgaaagcgg tgtaacccta attatgggaa tc 42 <210> 51 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 51 cttgaccaaa ttcgaaggtc cagtaaccct aattatggga atc ​​43 <210> 52 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 52 gatgactctg ttcgcatcct cggtaaccct aattatggga atc ​​43 <210> 53 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 53 gatgctagtg tcaaacctgc cgtaacccta attatgggaa tc 42 <210> 54 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 54 tgatacaggg ctcgtactta tccgtaaccc taattatggg aatc 44 <210> 55 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 55 aggagtcaca cgagttgaaa aggtaaccct aattatggga atc ​​43 <210> 56 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 56 ctcattacac cgaggtatga agggtaaccc taattatggg aatc 44 <210> 57 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 57 ctctgtcacg gctcgggtgg taaccctaat tatgggaatc 40 <210> 58 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 58 ctaccatatg tacccgacct cagtaaccct aattatggga atc ​​43 <210> 59 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 59 aaccttaggt cgggtataga gaggtaaccc taattatggg aatc 44 <210> 60 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 60 gaagcactta gacactgtaa ggcgtaaccc taattatggg aatc 44 <210> 61 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 61 aataatcacc ggcagtaacg ggtaacccta attatgggaa tc 42 <210> 62 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 62 aggaagaaac ctatggcaga cagtaaccct aattatggga atc ​​43 <210> 63 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 63 catgtgttat tacgatgttc tttgtgtaac cctaattatg ggaatc 46 <210> 64 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 64 actactgttt ggtacttgta tctggtaacc ctaattatgg gaatc 45 <210> 65 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 65 aaatcagtgg cggacagtag cgtaacccta attatgggaa tc 42 <210> 66 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 66 caggcaatgc cgactggatt gtaaccctaa ttatgggaat c 41 <210> 67 <211> 48 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 67 tcttatctaa gaccaactat aggtatggta accctaatta tgggaatc 48 <210> 68 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 68 gggactgtc tattgagcac tcgtaaccct aattatggga atc ​​43 <210> 69 <211> 47 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 69 attacaatct ttagtactca tggaaagtaa ccctaattat gggaatc 47 <210> 70 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 70 aaggtattct catgcctaga atattgtaac cctaattatg ggaatc 46 <210> 71 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 71 tggacagaca cgttgtcatt tggtaaccct aattatggga atc ​​43 <210> 72 <211> 48 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 72 ctctcattac aatgctatac atttaacgta accctaatta tgggaatc 48 <210> 73 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 73 tgcagctcgc aacggaacaa gtaacggatt ttacaacttt a 41 <210> 74 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 74 gagtccatcc ggacattgac ctgtaacgga ttttacaact tta 43 <210> 75 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 75 cttgaacggc ctcgacgagg gtaacggatt ttacaacttt a 41 <210> 76 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 76 cctcctcggt tatattggcc ccgtaacgga ttttacaact tta 43 <210> 77 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 77 accgagactt cgaaaatgaa cgagtaacgg attttacaac ttta 44 <210> 78 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 78 cctctggctc gaaactgaaa gggtaacgga ttttacaact tta 43 <210> 79 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 79 tgctatggac tagatctcgg caagtaacgg attttacaac ttta 44 <210> 80 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 80 gccttgaccg gtcagaagac ggtaacggat tttacaactt ta 42 <210> 81 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 81 taccacagag atcgcagctg cgtaacggat tttacaactt ta 42 <210> 82 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 82 accagcccga acctcgcccg taacggattt tacaacttta 40 <210> 83 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 83 actgtatgct tgccggtaat tctgtaacgg attttacaac ttta 44 <210> 84 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 84 gaacatgaac cggccccgac gtaacggatt ttacaacttt a 41 <210> 85 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 85 caggaatccc gtcaagggtg ggtaacggat tttacaactt ta 42 <210> 86 <211> 47 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 86 tctcgattta cctcgtttaa gatctcgtaa cggattttac aacttta 47 <210> 87 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 87 agaaccatgg tcgaactgac ctgtaacgga ttttacaact tta 43 <210> 88 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 88 tctgaggggc tacgctgaga gtaacggatt ttacaacttt a 41 <210> 89 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 89 aagcctctgt tacgcccacg gtaacggatt ttacaacttt a 41 <210> 90 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 90 aatgattcaa ctcgtactgg atcccgtaac ggattttaca acttta 46 <210> 91 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 91 cctcggaaat cccgattctg atagtaacgg attttacaac ttta 44 <210> 92 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 92 ggcccctact cggttgtggg gtaacggatt ttacaacttt a 41 <210> 93 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 93 ggaaaatgga acgaaactcc tgttgtaacg gattttacaa cttta 45 <210> 94 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 94 ctgggtcgtg cgaggtcctg taacggattt tacaacttta 40 <210> 95 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 95 cacggggcta ggacggggtg taacggattt tacaacttta 40 <210> 96 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 96 ccgatggcgt actcgtcggg taacccttat tcggtacta 39 <210> 97 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 97 gatcagatca gaatccgagg tggtaacccttattcggtac ta 42 <210> 98 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 98 ggttgtactc gcgacagttg gtaaccctta ttcggtacta 40 <210> 99 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 99 gacctgctca ttcgaggtga gtaaccctta ttcggtacta 40 <210> 100 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 100 tcacgtagta gcggcttcgg taacccttat tcggtacta 39 <210> 101 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 101 ccaaagatgg gcctacttgt cagtaacccttattcggtac ta 42 <210> 102 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 102 gacagagctg cacgcttggg taacccttat tcggtacta 39 <210> 103 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 103 ctgggcctgt ttgcgctcag taacccttat tcggtacta 39 <210> 104 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 104 tccttaggca tgcgcggcgt aacccttatt cggtacta 38 <210> 105 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 105 cagcggcagt actcgctgtg taacccttat tcggtacta 39 <210> 106 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 106 atgccaccga tgacccgcgt aacccttatt cggtacta 38 <210> 107 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 107 atcagcgtcg ctccctcggt aacccttatt cggtacta 38 <210> 108 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 108 ctttgagagc tcgaacatcg tgtaaccctt attcggtact a 41 <210> 109 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 109 ttccagtagt taaggcagag cagtaacccttattcggtac ta 42 <210> 110 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 110 gagctgcagg atcgggtccg taacccttat tcggtacta 39 <210> 111 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 111 acatgagtgg tttcgtagcg ggtaaccctt attcggtact a 41 <210> 112 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 112 tgccgatgac atggaactcg gtaaccctta ttcggtacta 40 <210> 113 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 113 tggtgtaatt gaccttgtag gtagtaaccc ttattcggta cta 43 <210> 114 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 114 cattggccga aagcaggctg taacccttat tcggtacta 39 <210> 115 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 115 gagacctctg ccgaaactgg gtaaccctta ttcggtacta 40 <210> 116 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 116 agtcttgtgc ttcgggtcaa agtaaccctt attcggtact a 41 <210> 117 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 117 cctcttctcg cctggcatag ggtaaccctt attcggtact a 41 <210> 118 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 118 gtaacggtga aaatggaccg ggtaaccctt attcggtact a 41 <210> 119 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 119 tccctctaag ggattaatgc cagtaacccttattcggtac ta 42 <210> 120 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 120 agttcaagta tcccgcgact agtaacaatt agagtgaaat acc 43 <210> 121 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 121 gaacgcaggc tgtttactgt tgtaacaatt agagtgaaat acc 43 <210> 122 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 122 ggtccaggta aactaatggc tggtaacaat tagagtgaaa tacc 44 <210> 123 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 123 ctctgttgag tttacctcgc aagtaacaat tagagtgaaa tacc 44 <210> 124 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 124 tacttcaact aaccagtcca cggtaacaat tagagtgaaa tacc 44 <210> 125 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 125 ccatgagaca aggcttaaga ctgtaacaat tagagtgaaa tacc 44 <210> 126 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 126 cggccaaaga atagtcgtag cgtaacaatt agagtgaaat acc 43 <210> 127 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 127 ccatttccct aaggtatgtg tgagtaacaa ttagagtgaa atacc 45 <210> 128 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 128 ctctcatact gttagtgatg tctggtaaca attagagtga aatacc 46 <210> 129 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 129 cagctttgtc ccgtgactgt gtaacaatta gagtgaaata cc 42 <210> 130 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 130 tgctgcaatg ctagcagcgg taacaattag agtgaaatac c 41 <210> 131 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 131 aagacaggaa cctatcaatg tagtgtaaca attagagtga aatacc 46 <210> 132 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 132 tagattagat tatgcccaag tcaggtaaca attagagtga aatacc 46 <210> 133 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 133 catgtaaccc actttaggtt tacagtaaca attagagtga aatacc 46 <210> 134 <211> 47 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 134 ccagtctttc gtattaatga ttcaggtaac aattagagtg aaatacc 47 <210> 135 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 135 tgcaacccgt ctcgtcttcg gtaacaatta gagtgaaata cc 42 <210> 136 <211> 47 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 136 gtgtaggtat catctgtaat gtacagtaac aattagagtg aaatacc 47 <210> 137 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 137 tcccggactt cagtaccgcg taacaattag agtgaaatac c 41 <210> 138 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 138 cgaggaggtt gcgaaaggcg taacaattag agtgaaatac c 41 <210> 139 <211> 49 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 139 tatacatata ctcaacactt atagagggta acaattagag tgaaatacc 49 <210> 140 <211> 49 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 140 gtaatagata ccataatttg tacttgggta acaattagag tgaaatacc 49 <210> 141 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 141 tgctgctgcg ctagacccgt aacaattaga gtgaaatacc 40 <210> 142 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 142 gcgtggcgag ccaaagacgt aacaattaga gtgaaatacc 40 <210> 143 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 143 tccgcggttg ttggacgggt aacaattaga gtgaaatacc 40 <210> 144 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 144 ctgtcacata cgcaaactgg tgtaacatcg ttatagctag a 41 <210> 145 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 145 tcgccatata ccggtcaaag agtaacatcg ttatagctag a 41 <210> 146 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 146 tggatggtgc aataatccga gggtaacatc gttatagcta ga 42 <210> 147 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 147 agtgctgatc ccttaagtat gtcgtaacat cgttatagct aga 43 <210> 148 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 148 acctccatta accaatccag aaggtaacat cgttatagct aga 43 <210> 149 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 149 tggtgtactt gacccactta tttgtaacat cgttatagct aga 43 <210> 150 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 150 cagaagagaa cgtggagcag ggtaacatcg ttatagctag a 41 <210> 151 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 151 tccctgtgaa gtttatagac ttcagtaaca tcgttatagc taga 44 <210> 152 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 152 tgtaaaagca aacgcacgcc gtaacatcgt tatagctaga 40 <210> 153 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 153 attcagatga cgagaaatga tacagtaaca tcgttatagc taga 44 <210> 154 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 154 tggtcacgcc atttccggcg taacatcgtt atagctaga 39 <210> 155 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 155 agcaagtata ccataaggaa attcagtaac atcgttatag ctaga 45 <210> 156 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 156 ctcgccgtcc tgtcgatttt gtaacatcgt tatagctaga 40 <210> 157 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 157 agcgagccga gaactccggt aacatcgtta tagctaga 38 <210> 158 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 158 tattttgttc agacaacatg gctgtaacat cgttatagct aga 43 <210> 159 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 159 ccacttggta caacggagcc gtaacatcgt tatagctaga 40 <210> 160 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 160 cagaacacct gcgaggagag gtaacatcgt tatagctaga 40 <210> 161 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 161 ttcatcagcg acgcccctgg taacatcgtt atagctaga 39 <210> 162 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 162 cctgcaaaaa aacggtcacg tgtaacatcg ttatagctag a 41 <210> 163 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 163 tgtgggagtc ccttaggtca agtaacatcg ttatagctag a 41 <210> 164 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 164 gcatcggggag cacgcactgt aacatcgtta tagctaga 38 <210> 165 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 165 ggctctgcac aacgcttgcg taacatcgtt atagctaga 39 <210> 166 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 166 agccaggaca caatagtcag ggtaacatcg ttatagctag a 41 <210> 167 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 167 agccaggaca caatagtcag ggtaacatcg ttatagctag a 41 <210> 168 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 168 ttgcacatcc tacggtcttc tgtaacttac tacggagtta ac 42 <210> 169 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 169 gtagctcatt cgcaaatctt gggtaactta ctacggagtt aac 43 <210> 170 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 170 cctttaagcg cgtcgtgtcc gtaacttact acggagttaa c 41 <210> 171 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 171 cctcgacgca tgatgccggt aacttactac ggagttaac 39 <210> 172 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 172 gccccatggc tcgtgtaggg taacttacta cggagttaac 40 <210> 173 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 173 ccaattgtgt tccggcaagt tgtaacttac tacggagtta ac 42 <210> 174 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 174 gataggattt ggtcggaaac ctgtaactta ctacggagtt aac 43 <210> 175 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 175 tagttgccaa cggtgttgta gtaacttact acggagttaa c 41 <210> 176 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 176 cttggcctat gcggaagtaa cgtaacttac tacggagtta ac 42 <210> 177 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 177 ctcgcagcga taggaaccat gtaacttact acggagttaa c 41 <210> 178 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 178 tttgcattcg tccatatcaa ctggtaactt actacggagt taac 44 <210> 179 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 179 tcaatatcaa cgggtaaacc gggtaactta ctacggagtt aac 43 <210> 180 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 180 ttgttaactga cgtgggaaat attggtaact tactacggag ttaac 45 <210> 181 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 181 tctccgctga tacccgggtg taacttacta cggagttaac 40 <210> 182 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 182 ggccagtcac cgaaatttca tgtaacttac tacggagtta ac 42 <210> 183 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 183 agttcgtagc ctatctcaca ctgtaactta ctacggagtt aac 43 <210> 184 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 184 cacattcccg tacgtttgct ggtaacttac tacggagtta ac 42 <210> 185 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 185 agtgagtccc tatgtatcct ttctgtaact tactacggag ttaac 45 <210> 186 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 186 aagcattata acgtgatcca caggtaactt actacggagt taac 44 <210> 187 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 187 tgcgccctga agcgcacgta acttactacg gagttaac 38 <210> 188 <211> 47 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 188 taaaaaatag cacgattaca gtatacgtaa cttactacgg agttaac 47 <210> 189 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 189 catatcgacg gattgagcct aacgtaactt actacggagt taac 44 <210> 190 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 190 cggtttctcg cgagagaaat agtaacttac tacggagtta ac 42 <210> 191 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 191 cttcccatct cgtgtaacat gagtaactta ctacggagtt aac 43 <210> 192 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 192 gcatttcaca tcggactgta ccgtaacttc gaaacggaaa c 41 <210> 193 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 193 tggaattctc ggcggaccag taacttcgaa acggaaac 38 <210> 194 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 194 gaagtggaaa tacgaccttt gcgtaacttc gaaacggaaa c 41 <210> 195 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 195 gctggtccct tgcgtaacat gtaacttcga aacggaaac 39 <210> 196 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 196 ttttcatcta ttcgagatgc tcccgtaact tcgaaacgga aac 43 <210> 197 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 197 tattcatccc gtggggtagt agtaacttcg aaacggaaac 40 <210> 198 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 198 taaaaatagg cccggatttg tctgtaactt cgaaacggaa ac 42 <210> 199 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 199 tccaaccttg acgacaagat agggtaactt cgaaacggaa ac 42 <210> 200 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 200 aggcaacagt cgaaccattc tgtaacttcg aaacggaaac 40 <210> 201 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 201 gcttcatttg cgactgctct tgtaacttcg aaacggaaac 40 <210> 202 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 202 catcaggacg cttgtattgg tggtaacttc gaaacggaaa c 41 <210> 203 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 203 atcttcaatc cgagaatcca gcgtaacttc gaaacggaaa c 41 <210> 204 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 204 ctgtagtgtg gtagtaagga agagtaactt cgaaacggaa ac 42 <210> 205 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 205 gaacacctta cttacaacac ctggtaactt cgaaacggaa ac 42 <210> 206 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 206 gtacattgta caccgttaca atgggtaact tcgaaacgga aac 43 <210> 207 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 207 tttcaagtcg tctatgttag ctggtaactt cgaaacggaa ac 42 <210> 208 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 208 caaagcaact atatgaagct tcattgtaac ttcgaaacgg aaac 44 <210> 209 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 209 catacttcta tcgagagctc agggtaactt cgaaacggaa ac 42 <210> 210 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 210 acgaagaaat cgagtaggtc tagggtaact tcgaaacgga aac 43 <210> 211 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 211 gaatcattga gtcgaccctt cagtaacttc gaaacggaaa c 41 <210> 212 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 212 tgatgtgctt aagtagtgca gcgtaacttc gaaacggaaa c 41 <210> 213 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 213 tccacggcat gatacataca acgtaacttc gaaacggaaa c 41 <210> 214 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 214 tctcagagca tcccgaatcc agtaacttcg aaacggaaac 40 <210> 215 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 215 gtggaacgaa gagtaggtag tttgtaactt cgaaacggaa ac 42 <210> 216 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 216 gatcaatact ggacggagtc aggtaacctc gtcggatca 39 <210> 217 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 217 gagcttgtta ctcgtgcctt ggtaacctcg tcggatca 38 <210> 218 <211> 37 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 218 cttcttacac ttgcggacgc gtaacctcgt cggatca 37 <210> 219 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 219 caatacctat tccgttacac acttgtaacc tcgtcggatc a 41 <210> 220 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 220 gctccttcag tccggtttta ttgtaacctc gtcggatca 39 <210> 221 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 221 gacgcacgag ccgtgatctg taacctcgtc ggatca 36 <210> 222 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 222 gactgctaag gcataggaat tttcgtaacc tcgtcggatc a 41 <210> 223 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 223 caccacataa ttacggggac acgtaacctc gtcggatca 39 <210> 224 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 224 cggcaaggcc cttcgcagta acctcgtcgg atca 34 <210> 225 <211> 37 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 225 tccatctggt acgtggtggg gtaacctcgt cggatca 37 <210> 226 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 226 gtcctgccgc gtatgatttc tgtaacctcg tcggatca 38 <210> 227 <211> 37 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 227 tgttcaggct gacgactgca gtaacctcgt cggatca 37 <210> 228 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 228 gcatggaggt ccgtcctgtg taacctcgtc ggatca 36 <210> 229 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 229 ttgagggagc gtaatcccaa ggtaacctcg tcggatca 38 <210> 230 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 230 ccggcgtctg cgtacttccg taacctcgtc ggatca 36 <210> 231 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 231 cgactatctg cgtctatcat ccgtaacctc gtcggatca 39 <210> 232 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 232 gagaattcga tgatcaactc acggtaacct cgtcggatca 40 <210> 233 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 233 tggcctgtcg tccggtctgt aacctcgtcg gatca 35 <210> 234 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 234 cagggattcc gtcatatggc tgtaacctcg tcggatca 38 <210> 235 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 235 agacatcgat ggtacatatg ggtgtaacct cgtcggatca 40 <210> 236 <211> 37 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 236 tctgagctgt atcgctgcaa gtaacctcgt cggatca 37 <210> 237 <211> 37 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 237 tcttaggccc attcgttgga gtaacctcgt cggatca 37 <210> 238 <211> 37 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 238 ttatacaccg tgccgaacgc gtaacctcgt cggatca 37 <210> 239 <211> 37 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 239 atgccctttg cgatctgcac gtaacctcgt cggatca 37 <210> 240 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 240 ggcagaattc cgaagttcag cgtaacataa tcgtagtttc gg 42 <210> 241 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 241 gtttccttca cgacaggtgt ggtaacataa tcgtagtttc gg 42 <210> 242 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 242 ctggtagaaa tgcgactaaa gacgtaacat aatcgtagtt tcgg 44 <210> 243 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 243 tgaccagcat cgtttcatct aatgtaacat aatcgtagtt tcgg 44 <210> 244 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 244 ttcgaagttc aaccgagtga cgtaacataa tcgtagtttc gg 42 <210> 245 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 245 ccaccaatcc aatgcggaat tgtaacataa tcgtagtttc gg 42 <210> 246 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 246 agactcggtg ccattcgtat tgtaacataa tcgtagtttc gg 42 <210> 247 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 247 ataactgcta actgcgcaac cgtaacataa tcgtagtttc gg 42 <210> 248 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 248 gtagtgaggc cgcttataac cagtaacata atcgtagttt cgg 43 <210> 249 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 249 ggtgatgatt cgatggagtg aagtaacata atcgtagttt cgg 43 <210> 250 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 250 ctgctgcttt acgtttggtg cgtaacataa tcgtagtttc gg 42 <210> 251 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 251 tcatcaacca cgtctttgga tagtaacata atcgtagttt cgg 43 <210> 252 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 252 aggcagatct taaagtgttg gttgtaacat aatcgtagtt tcgg 44 <210> 253 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 253 tgagggctta tacgaaagca aggtaacata atcgtagttt cgg 43 <210> 254 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 254 gctcagtact gactttggta tgtgtaacat aatcgtagtt tcgg 44 <210> 255 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 255 cagtcaatca ttagatccac atctgtaaca taatcgtagt ttcgg 45 <210> 256 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 256 ggaagctgct cgtcgaagcg taacataatc gtagtttcgg 40 <210> 257 <211> 47 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 257 gagaagatac ttatagcttc ttgtctgtaa cataatcgta gtttcgg 47 <210> 258 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 258 tcaatgctat ctaactgatg aagagtaaca taatcgtagt ttcgg 45 <210> 259 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 259 atcttcccaa ttgatgtaag tacttgtaac ataatcgtag tttcgg 46 <210> 260 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 260 catcacagtc cgagacgccg taacataatc gtagtttcgg 40 <210> 261 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 261 cattccaccg gcctgtgcgg taacataatc gtagtttcgg 40 <210> 262 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 262 ggacagcact actctagagt aaggtaacat aatcgtagtt tcgg 44 <210> 263 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 263 tgccaagtaa cttagcacac ccgtaacata atcgtagttt cgg 43 <210> 264 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 264 gtgccacctt tcaccgtgag taaccggtag aattacgg 38 <210> 265 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 265 ccgcaggtac gacttgcctg taaccggtag aattacgg 38 <210> 266 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 266 tgggcttcaa tcagatggtc agtaaccggt agaattacgg 40 <210> 267 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 267 agaacaccag ggtacgcata gtgtaaccgg tagaattacg g 41 <210> 268 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 268 tctccgagag tgtcagcggg taaccggtag aattacgg 38 <210> 269 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 269 gtcttcccgg ccggtcttgg taaccggtag aattacgg 38 <210> 270 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 270 catgttgcag attgtcgcca gtaaccggta gaattacgg 39 <210> 271 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 271 ggttcagtcg tttgcgaaca gtaaccggta gaattacgg 39 <210> 272 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 272 agctaccaat tagacccact cggtaaccgg tagaattacg g 41 <210> 273 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 273 cgtagttctc gtctccgatc agtaaccggt agaattacgg 40 <210> 274 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 274 ggagctgaac ttgacgccag gtaaccggta gaattacgg 39 <210> 275 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 275 taatggatgt actcgttggg cgtaaccggt agaattacgg 40 <210> 276 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 276 tctgtgcata gccgtcccgg taaccggtag aattacgg 38 <210> 277 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 277 tggctggacg gatcggatcg taaccggtag aattacgg 38 <210> 278 <211> 37 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 278 ggtttgcgtc gttgcggcgt aaccggtaga attacgg 37 <210> 279 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 279 tctctgggga cgtgacaaag gtaaccggta gaattacgg 39 <210> 280 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 280 gaattcatca gctagattgg caagtaaccg gtagaattac gg 42 <210> 281 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 281 tcactccgtg ggctaagcgg taaccggtag aattacgg 38 <210> 282 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 282 tgtaagggaa cacggaagtg ggtaaccggt agaattacgg 40 <210> 283 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 283 ctcaatggtg gcgcggatcg taaccggtag aattacgg 38 <210> 284 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 284 aaccactcaa tctgcgtctc ggtaaccggt agaattacgg 40 <210> 285 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 285 gctgtagggc gccattttgt gtaaccggta gaattacgg 39 <210> 286 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 286 tgagtgacgg cattgcgcag taaccggtag aattacgg 38 <210> 287 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 287 caaagtggct catcgccacc gtaaccggta gaattacgg 39 <210> 288 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 288 tctatatgct aaatgtattg ccatggtaac gcttctcata acact 45 <210> 289 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 289 ctatgaaact tcgtggtcac tccgtaacgc ttctcataac act 43 <210> 290 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 290 aactaactca tctgcagtac catgtaacgc ttctcataac act 43 <210> 291 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 291 aaaacctgct tgatccacat tctgtaacgc ttctcataac act 43 <210> 292 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 292 acattaacaa atcactcttg attcagtaac gcttctcata acact 45 <210> 293 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 293 ttttgcttag ctcatggtaa acagtaacgc ttctcataac act 43 <210> 294 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 294 gaggagctgt tggataaata attttgtaac gcttctcata acact 45 <210> 295 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 295 aagcaggcag gtattgtatg attgtaacgc ttctcataac act 43 <210> 296 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 296 gcaacttata tatcagtggt gaatggtaac gcttctcata acact 45 <210> 297 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 297 agattatgta tgcatgagaa ccaacgtaac gcttctcata acact 45 <210> 298 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 298 gatcatgact ctccttatgg ttaatgtaac gcttctcata acact 45 <210> 299 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 299 tgtgaaaccg gtttataaac ctagtaacgc ttctcataac act 43 <210> 300 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 300 aataagatta gctactgtct acagtggtaa cgcttctcat aacact 46 <210> 301 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 301 taaacaaata gtgatacatc cacacgtaac gcttctcata acact 45 <210> 302 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 302 ttcagtcatc taacaatgta ttcctgtaac gcttctcata acact 45 <210> 303 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 303 agctgtggga aagtctttaa ctcgtaacgc ttctcataac act 43 <210> 304 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 304 atagatgaac tattgatgta cacaacgtaa cgcttctcat aacact 46 <210> 305 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 305 tacagatgaa attgagacct aaaacgtaac gcttctcata acact 45 <210> 306 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 306 agcaatttgg gttaacagaa atagagtaac gcttctcata acact 45 <210> 307 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 307 aatccaatgg gataagtact attagtgtaa cgcttctcat aacact 46 <210> 308 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 308 aatgttattc cgtggaaaat tacatgtaac gcttctcata acact 45 <210> 309 <211> 47 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 309 ttacagaatt gtgtctgaaa aattatggta acgcttctca taacact 47 <210> 310 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 310 atcagagagg cgctatgcct gtaacgcttc tcataacact 40 <210> 311 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 311 cggcgacacg atacagcggt aacgcttctc ataacact 38 <210> 312 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 312 cacttcaaat gcgcaacaag cgtaacgtcg ctgaaaaatc 40 <210> 313 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 313 gtaagcactg cgcaagacaa gtaacgtcgc tgaaaaatc 39 <210> 314 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 314 gtgatgagct cgacaggata ttgtaacgtc gctgaaaaat c 41 <210> 315 <211> 37 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 315 atggcgtcgt cggcacacgt aacgtcgctg aaaaatc 37 <210> 316 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 316 tttacaacag cgtggcaagt ggtaacgtcg ctgaaaaatc 40 <210> 317 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 317 aggcatgaag tgagacaatg cgtaacgtcg ctgaaaaatc 40 <210> 318 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 318 cctggctagt ggtatatgtc acgtaacgtc gctgaaaaat c 41 <210> 319 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 319 gctgatgatg ttcaagcgca gtaacgtcgc tgaaaaatc 39 <210> 320 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 320 ctgccagtta gttaggcaag ttgtaacgtc gctgaaaaat c 41 <210> 321 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 321 gcagctccgg gctacaagtg taacgtcgct gaaaaatc 38 <210> 322 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 322 tggcagctgt ctaactggag cgtaacgtcg ctgaaaaatc 40 <210> 323 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 323 acgcgtgtgc gagtagatgg taacgtcgct gaaaaatc 38 <210> 324 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 324 agctccacga aggatgccag taacgtcgct gaaaaatc 38 <210> 325 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 325 tgaggacggc atcgagatcc gtaacgtcgc tgaaaaatc 39 <210> 326 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 326 gtcttgagac ccggtcttgg gtaacgtcgc tgaaaaatc 39 <210> 327 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 327 agtggtctgg atcggtgcgg taacgtcgct gaaaaatc 38 <210> 328 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 328 tccattctgg gtcgagtgga gtaacgtcgc tgaaaaatc 39 <210> 329 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 329 ggaccccaag gtgttccaag gtaacgtcgc tgaaaaatc 39 <210> 330 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 330 agcagcttgg ctactccccg taacgtcgct gaaaaatc 38 <210> 331 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 331 tttgggtatg ggtactgtgt agagtaacgt cgctgaaaaa tc 42 <210> 332 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 332 gccgcaggga tagatccagg gtaacgtcgc tgaaaaatc 39 <210> 333 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 333 tgaagacagt cctatggact tccgtaacgt cgctgaaaaa tc 42 <210> 334 <211> 37 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 334 aagctgaagc gcgggtcagt aacgtcgctg aaaaatc 37 <210> 335 <211> 37 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 335 ccacgcagcc cttcgagagt aacgtcgctg aaaaatc 37 <210> 336 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 336 tagtaggtgt cgacaactag agcgtaactc ttcaagatta atacc 45 <210> 337 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 337 gatggtcctg atcgagaaac cagtaactct tcaagattaa tacc 44 <210> 338 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 338 aagaggactt cgctgaattg acgtaactct tcaagattaa tacc 44 <210> 339 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 339 gaacctccga ctgtatgtca gcgtaactct tcaagattaa tacc 44 <210> 340 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 340 tctgaattag agcgatgttg acagtaactc ttcaagatta atacc 45 <210> 341 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 341 gcattcctcc gatcgcacag taactcttca agattaatac c 41 <210> 342 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 342 ctctatattt agctcgctgt tcaagtaact cttcaagatt aatacc 46 <210> 343 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 343 tattcatcac ggcgcgcttg taactcttca agattaatac c 41 <210> 344 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 344 cattggggac cgtgcataaa agtaactctt caagattaat acc 43 <210> 345 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 345 caaggggtgc actatttggg agtaactctt caagattaat acc 43 <210> 346 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 346 ggaccgtatt tcggcgaaat agtaactctt caagattaat acc 43 <210> 347 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 347 atactgcact tgtcggcatg agtaactctt caagattaat acc 43 <210> 348 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 348 atggcagatc gatccattgg tgtaactctt caagattaat acc 43 <210> 349 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 349 tccctttgga ccgtcaagaa ggtaactctt caagattaat acc 43 <210> 350 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 350 aggcttgctg acatacgcag gtaactcttc aagattaata cc 42 <210> 351 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 351 cttgctttgt gcgaacaccc gtaactcttc aagattaata cc 42 <210> 352 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 352 ctgatatcga atgcaatgga tgagtaactc ttcaagatta atacc 45 <210> 353 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 353 taggactggt ccgtcaaaaa cgtaactctt caagattaat acc 43 <210> 354 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 354 tgaccattct cgggacacta acgtaactct tcaagattaa tacc 44 <210> 355 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 355 atgattgggt ccgtaaaaat gcgtaactct tcaagattaa tacc 44 <210> 356 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 356 gtttcatgta tggtaggacc accgtaactc ttcaagatta atacc 45 <210> 357 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 357 ctcttgcatc gtagcgaact agtaactctt caagattaat acc 43 <210> 358 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 358 atgatgattc cctcggtcag agtaactctt caagattaat acc 43 <210> 359 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 359 agtagagaag atcgctgata tccggtaact cttcaagatt aatacc 46 <210> 360 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 360 aacccttgac atcgccagtt tgtaacgtac cgtttgtata tg 42 <210> 361 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 361 gaaggttaaa cgagatttcc aaaggtaacg taccgtttgt atatg 45 <210> 362 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 362 gccactcgac atttctgccg gtaacgtacc gtttgtatat g 41 <210> 363 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 363 tcatactgtc cgcaacatcc ggtaacgtac cgtttgtata tg 42 <210> 364 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 364 gccactcgac atttctgccg gtaacgtacc gtttgtatat g 41 <210> 365 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 365 tcatactgtc cgcaacatcc ggtaacgtac cgtttgtata tg 42 <210> 366 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 366 tgaattttgc ccgaacttca ctgtaacgta ccgtttgtat atg 43 <210> 367 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 367 acacactcgg agcgcgcgta acgtaccgtt tgtatatg 38 <210> 368 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 368 caaacctata tgcccgttga ctgtaacgta ccgtttgtat atg 43 <210> 369 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 369 caggaacctt taccatgttc atggtaacgt accgtttgta tatg 44 <210> 370 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 370 gaaaatctct acggatgaat ttcttgtaac gtaccgtttg tatatg 46 <210> 371 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 371 gctgctaaga tagccttgtg aggtaacgta ccgtttgtat atg 43 <210> 372 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 372 tggcactaaa aaccggagaa cgtaacgtac cgtttgtata tg 42 <210> 373 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 373 tgcgggaccg ccgatacagt aacgtaccgt ttgtatatg 39 <210> 374 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 374 ggaaattaaa cggagtctta caacgtaacg taccgtttgt atatg 45 <210> 375 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 375 agccagagag cggtatgccg taacgtaccg tttgtatatg 40 <210> 376 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 376 ccaccaagtg gggatgtgac gtaacgtacc gtttgtatat g 41 <210> 377 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 377 cacacatgac ctttaagcgc tgtaacgtac cgtttgtata tg 42 <210> 378 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 378 tccacagatt gcgctgtcta gtaacgtacc gtttgtatat g 41 <210> 379 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 379 ctccacggac aggttatactgc gtaacgtacc gtttgtatat g 41 <210> 380 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 380 gcgtcatggc gtcagcacgt aacgtaccgt ttgtatatg 39 <210> 381 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 381 tcctggccgg caacacacgt aacgtaccgt ttgtatatg 39 <210> 382 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 382 agccattttg tcgaggtttg ggtaacgtac cgtttgtata tg 42 <210> 383 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 383 catccgaagc atgatagttg atggtaacgt accgtttgta tatg 44 <210> 384 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 384 tagtgtgttg cgtatcaagt atctagacga tgcgaattaa cac 43 <210> 385 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 385 ttattgtgaa ctctagacat gagagtagac gatgcgaatt aacac 45 <210> 386 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 386 acagtgaata ctaagactgt aaaaactaga cgatgcgaat taacac 46 <210> 387 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 387 acacaaggca cgtagaaaca gtagacgatg cgaattaaca c 41 <210> 388 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 388 caatggacag cggttgtgaa atagacgatg cgaattaaca c 41 <210> 389 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 389 caccatcacc tatcgacaga gttagacgat gcgaattaac ac 42 <210> 390 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 390 cattgcatta cgttccacat ggtagacgat gcgaattaac ac 42 <210> 391 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 391 acacagagtg tccgataccc atagacgatg cgaattaaca c 41 <210> 392 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 392 ggtgattaca ttgagtgcta gggatagacga tgcgaattaa cac 43 <210> 393 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 393 tccacataag cgttcaaggt atagacgatg cgaattaaca c 41 <210> 394 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 394 cagaataatc gctattccta gctgtagacg atgcgaatta acac 44 <210> 395 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 395 ttacactcat acgtcgccgg tagacgatgc gaattaacac 40 <210> 396 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 396 tggccataaa ggctacttac aattagacga tgcgaattaa cac 43 <210> 397 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 397 tttcaagtta ttcgatctgc taacctagac gatgcgaatt aacac 45 <210> 398 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 398 agttagtcaa ggactttat aaggttagac gatgcgaatt aacac 45 <210> 399 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 399 ttacctcaaa tacgggctac catagacgat gcgaattaac ac 42 <210> 400 <211> 47 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 400 gagttatatt actctaacta aagccagtag acgatgcgaa ttaacac 47 <210> 401 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 401 ttgtcaacac gcataaaatc tgctagacga tgcgaattaa cac 43 <210> 402 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 402 tcatatacaa tcggggatct gagtagacga tgcgaattaa cac 43 <210> 403 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 403 cccacaaaaa tacccgtaag ttatagacga tgcgaattaa cac 43 <210> 404 <211> 47 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 404 cactaaatta ttacgaattt tgcaaagtag acgatgcgaa ttaacac 47 <210> 405 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 405 tcaaataaaa accgtcaaaa gtttatagac gatgcgaatt aacac 45 <210> 406 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 406 agtgcaatgg tatcacgtac tgtagacgat gcgaattaac ac 42 <210> 407 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 407 atgtgtcttg caattggatt ccctagacga tgcgaattaa cac 43 <210> 408 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 408 ggtgtgcgcg tcgtacacta gacccgttat aagtgttg 38 <210> 409 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 409 gtgtttaggg tcgcggttga tagacccgtt ataagtgttg 40 <210> 410 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 410 gagaatggcg aagtaaatgc cctagacccg ttataagtgt tg 42 <210> 411 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 411 gtagatggaa tagacacggc tgtagacccg ttataagtgt tg 42 <210> 412 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 412 gctcttaatg catggtacaa ctgtagaccc gttataagtg ttg 43 <210> 413 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 413 aaaccagtat ttcgtcacag tgatagaccc gttataagtg ttg 43 <210> 414 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 414 gatgggaacg gtgtagagat gttagacccg ttataagtgt tg 42 <210> 415 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 415 ttccaaatgc cgtcaaaact gttagacccg ttataagtgt tg 42 <210> 416 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 416 tgggtcacag acggtgtggt agacccgtta taagtgttg 39 <210> 417 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 417 aatcaggtat acttctatcc ttgaaataga cccgttataa gtgttg 46 <210> 418 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 418 tgctgtatta gcaacttgga acttagaccc gttataagtg ttg 43 <210> 419 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 419 gccaataaag cgatggttga tctagaccccg ttataagtgt tg 42 <210> 420 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 420 gtaaggatca ctggatccta ctgtagaccc gttataagtg ttg 43 <210> 421 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 421 gacctcattc agttgatgag aggtagaccc gttataagtg ttg 43 <210> 422 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 422 gcataacaga cggttgcaag ttagacccgt tataagtgtt g 41 <210> 423 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 423 acctaaagcg agttgctgag ttagacccgt tataagtgtt g 41 <210> 424 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 424 gagtcagaaa cacgcatgga atagacccgt tataagtgtt g 41 <210> 425 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 425 agcaactctg ataggctcac actagacccg ttataagtgt tg 42 <210> 426 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 426 ccatacccac tacggataaa gatgtagacc cgttataagt gttg 44 <210> 427 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 427 gctttctgta cgactcaggt tttagacccg ttataagtgt tg 42 <210> 428 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 428 caatgttgag ccactaaacc actagacccg ttataagtgt tg 42 <210> 429 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 429 atgcttggat taggtccaaa gctagaccccg ttataagtgt tg 42 <210> 430 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 430 cccggtgatg gattagtttg gtagacccgt tataagtgtt g 41 <210> 431 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 431 ccatggccat accctggaat ttagacccgt tataagtgtt g 41 <210> 432 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 432 attatactgt ccagcgtagg tggtagacaa ccgtcgttaa g 41 <210> 433 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 433 tcctggtaag gataggtacc atgtagacaa ccgtcgttaa g 41 <210> 434 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 434 cactgaaata ggacggaatc tgctagacaa ccgtcgttaa g 41 <210> 435 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 435 aaagtttattggcgcttgcc gtagacaacc gtcgttaag 39 <210> 436 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 436 gcaatgccat tagcgatacg atagacaacc gtcgttaag 39 <210> 437 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 437 tgattgaaca ccacgcgaca tagacaaccg tcgttaag 38 <210> 438 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 438 agtcttcgaa gcactattgc catagacaac cgtcgttaag 40 <210> 439 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 439 tcaatggttg atcggcctct ctagacaacc gtcgttaag 39 <210> 440 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 440 tggcatgatg tctaatagga gtctagacaa ccgtcgttaa g 41 <210> 441 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 441 ctgcggttta gccttgacgt tagacaaccg tcgttaag 38 <210> 442 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 442 cccagaggac gccatcattt tagacaaccg tcgttaag 38 <210> 443 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 443 tttcttgaaa gacgacagca gttagacaac cgtcgttaag 40 <210> 444 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 444 attaaatgtt cggaaggatg acctagacaa ccgtcgttaa g 41 <210> 445 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 445 tcttttgtca gcacggttgc tagacaaccg tcgttaag 38 <210> 446 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 446 ctggatcagc tcgaccagga tagacaaccg tcgttaag 38 <210> 447 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 447 accatggtcc gacttctgcc tagacaaccg tcgttaag 38 <210> 448 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 448 ctggatattc ggttatctgg gctagacaac cgtcgttaag 40 <210> 449 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 449 atccccttta cgatactctt cagtagacaa ccgtcgttaa g 41 <210> 450 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 450 tccagagcgg gaacagtatg tagacaaccg tcgttaag 38 <210> 451 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 451 gttgcctgca taagatgggc tagacaaccg tcgttaag 38 <210> 452 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 452 ccttttgtgc cgatgacccg tagacaaccg tcgttaag 38 <210> 453 <211> 37 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 453 gcttccgtgg actgggacgt agacaaccgt cgttaag 37 <210> 454 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 454 ccatagaagg acgaggtatt tcctagacaa ccgtcgttaa g 41 <210> 455 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 455 agaatgagtc gctgctcgat atagacaacc gtcgttaag 39 <210> 456 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 456 gcttcgacaa acgcaaagcg tagactcaat gatgataaag a 41 <210> 457 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 457 gctagttcac agaaagacca ttttagactc aatgatgata aaga 44 <210> 458 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 458 cagctcatcg aaagcgaccc tagactcaat gatgataaag a 41 <210> 459 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 459 cggctgctac aaacctcggt agactcaatg atgataaaga 40 <210> 460 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 460 aacaatttga aggccccaca atagactcaa tgatgataaa ga 42 <210> 461 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 461 gcgtctgcac cggagactta gactcaatga tgataaaga 39 <210> 462 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 462 gcgctgctca ggcattggta gactcaatga tgataaaga 39 <210> 463 <211> 47 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 463 ttgttgtgta acaacataat ttcaagtaga ctcaatgatg ataaaga 47 <210> 464 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 464 ctccacgtcg gcgtgcatag actcaatgat gataaaga 38 <210> 465 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 465 ctgcggggat tgtagccggt agactcaatg atgataaaga 40 <210> 466 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 466 atcttagcta ctgaccggct atagactcaa tgatgataaa ga 42 <210> 467 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 467 aagagattat acgcctcacg gatagactca atgatgataa aga 43 <210> 468 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 468 tttcgagtaa cgaaattagc tcctagactc aatgatgata aaga 44 <210> 469 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 469 gacccgcaga ttggcacgta gactcaatga tgataaaga 39 <210> 470 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 470 atggccccaa tctcgtttgg tagactcaat gatgataaag a 41 <210> 471 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 471 ccagtagcta taacgaagtc ctctagactc aatgatgata aaga 44 <210> 472 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 472 acaaattccc ggacactatg gatagactca atgatgataa aga 43 <210> 473 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 473 ttcacagagt tgataaggcc actagactca atgatgataa aga 43 <210> 474 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 474 aactttgccg gtctctttac attagactca atgatgataa aga 43 <210> 475 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 475 ttccaatgtg caagaatgat ttcttagact caatgatgat aaaga 45 <210> 476 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 476 ctccttctgg ggtatttcct gctagactca atgatgataa aga 43 <210> 477 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 477 ccacttcagt tggccggtat agactcaatg atgataaaga 40 <210> 478 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 478 tccgtcaacg tccgcagtta gactcaatga tgataaaga 39 <210> 479 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 479 agtgagatcg ccatagtgca atagactcaa tgatgataaa ga 42 <210> 480 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 480 gaaggtgacc ctataaggag tcatagacta caacaaaaga tcg 43 <210> 481 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 481 aacaccgctt gcatagttgt gtagactaca acaaaagatc g 41 <210> 482 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 482 tacagacgcg gaatcattct ctagactaca acaaaagatc g 41 <210> 483 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 483 tggaggaaat gagcatgacc ttagactaca acaaaagatc g 41 <210> 484 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 484 atggtgtaca ctcgaggctg atagactaca acaaaagatc g 41 <210> 485 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 485 ccttgtggta gacgttcagc ttagactaca acaaaagatc g 41 <210> 486 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 486 ggatcaggtt taatggtcac tatgtagact acaacaaaag atcg 44 <210> 487 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 487 cacacggtca acgctgtaca tagactacaa caaaagatcg 40 <210> 488 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 488 caggtgtttg cggaagttcc tagactacaa caaaagatcg 40 <210> 489 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 489 gtgctcatgg tcgtagagga tagactacaa caaaagatcg 40 <210> 490 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 490 aagtcaaagt acgtctcgat cattagacta caacaaaaga tcg 43 <210> 491 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 491 tcgtagcagc cgttggagat agactacaac aaaagatcg 39 <210> 492 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 492 tcgtggccag agtaggcatt agactacaac aaaagatcg 39 <210> 493 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 493 ggtactctcc aaacgctcgg tagactacaa caaaagatcg 40 <210> 494 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 494 aggtacgaat agggatgtcg tctagactac aacaaaagat cg 42 <210> 495 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 495 agggtatcgt acatcgttcc aatagactac aacaaaagat cg 42 <210> 496 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 496 caggtgatct gcgccgttgt agactacaac aaaagatcg 39 <210> 497 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 497 ccacaggcga tacaaccggt agactacaac aaaagatcg 39 <210> 498 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 498 cagcagcttc gagtgctggt agactacaac aaaagatcg 39 <210> 499 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 499 ccctcacagg acgtcgtcat agactacaac aaaagatcg 39 <210> 500 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 500 gcacgaagcc ttcggtgtct agactacaac aaaagatcg 39 <210> 501 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 501 tgggaagtgt cggctttcat gtagactaca acaaaagatc g 41 <210> 502 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 502 tgggaagtgt cggctttcat gtagactaca acaaaagatc g 41 <210> 503 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 503 tgctcgcact ttggccgcta gactacaaca aaagatcg 38 <210> 504 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 504 gtcttttggc acggtttctg ttagactgta ttcaacgtcc 40 <210> 505 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 505 tacttcttca acgcgaagag ctagactgta ttcaacgtcc 40 <210> 506 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 506 tttgaggttg tatccgctgc ttagactgta ttcaacgtcc 40 <210> 507 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 507 caagttgact aaatctcgta ctttctagac tgtattcaac gtcc 44 <210> 508 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 508 gccttattaa cggtatcttc agaatagact gtattcaacg tcc 43 <210> 509 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 509 tgttctggat ttcgcaggtc ctagactgta ttcaacgtcc 40 <210> 510 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 510 gctttatcag gttatgttgc atgtagactg tattcaacgt cc 42 <210> 511 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 511 gattctggct tatagggtat tcactagact gtattcaacg tcc 43 <210> 512 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 512 ttttcctccc gcaattccta gatagactgt attcaacgtc c 41 <210> 513 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 513 tgtttccgtc aaatcgtgtg gtagactgta ttcaacgtcc 40 <210> 514 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 514 ggttccctct agatcttgcc tttagactgt attcaacgtc c 41 <210> 515 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 515 gcatgtacca cctatcatct aatgtagact gtattcaacg tcc 43 <210> 516 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 516 gttgccaaca cgagctgact tagactgtat tcaacgtcc 39 <210> 517 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 517 actgactact agttcaagcg catagactgt attcaacgtc c 41 <210> 518 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 518 tctcttgctc gctttggacc tagactgtat tcaacgtcc 39 <210> 519 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 519 cactgctaga acaactatca atttgtagac tgtattcaac gtcc 44 <210> 520 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 520 ttacatggct taagttgggg agtagactgt attcaacgtc c 41 <210> 521 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 521 gtgaggggac gctcttgtat ttagactgta ttcaacgtcc 40 <210> 522 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 522 aacggtgcta tgcctagtag atagactgta ttcaacgtcc 40 <210> 523 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 523 tttgccttcc ctagagtgct atagactgta ttcaacgtcc 40 <210> 524 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 524 atgtcccaat ggatacttaa agcctagact gtattcaacg tcc 43 <210> 525 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 525 cttccagtaa cgagatactt tccttagact gtattcaacg tcc 43 <210> 526 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 526 caaccatgaa ttagtccctt gggtagactg tattcaacgt cc 42 <210> 527 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 527 cagcattatt agacacttta actgttagac tgtattcaac gtcc 44 <210> 528 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 528 tgcacatatg attgacgctc agtagactct tatattgagt ggt 43 <210> 529 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 529 ttcaccgcct gcaacaagat agactctttat attgagtggt 40 <210> 530 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 530 ttcacttaca ggtaacacca agttagactc ttatattgag tggt 44 <210> 531 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 531 aagcaataga tcgtccataa gttatagact cttatattga gtggt 45 <210> 532 <211> 48 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 532 tacaagaacc ctaattgtaa taatagatag actcttatat tgagtggt 48 <210> 533 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 533 gaataggacc aaagtgtccc ttgtagactc ttatattgag tggt 44 <210> 534 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 534 tccatcagga ctaaatctca cactagactc ttatattgag tggt 44 <210> 535 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 535 aaaggccata cgtttttcct acctagactc ttatattgag tggt 44 <210> 536 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 536 gcagtgtaca atgaacgaga aattagactc ttatattgag tggt 44 <210> 537 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 537 ggcattctgc tttaagatca gaatagactc ttatattgag tggt 44 <210> 538 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 538 ggccagccac gattcacagt agactctttat attgagtggt 40 <210> 539 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 539 gaagccagcg accggactta gactcttata ttgagtggt 39 <210> 540 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 540 ctgagggtcg tcgttgtctt tagactctta tattgagtgg t 41 <210> 541 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 541 ctgaaccact ggcatagagt tctagactct tatattgagt ggt 43 <210> 542 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 542 aaatcaacca cgggtcgcgt agactctttat attgagtggt 40 <210> 543 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 543 agcaacagtc gacgagggat agactctttat attgagtggt 40 <210> 544 <211> 48 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 544 atatattcca tactactaac agacatatag actcttatat tgagtggt 48 <210> 545 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 545 tccacaccgg catcggctag actcttatat tgagtggt 38 <210> 546 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 546 agaagggcaa tccggtggct agactctttat attgagtggt 40 <210> 547 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 547 tcaggggagtc tgcgaccagt agactctttat attgagtggt 40 <210> 548 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 548 gctttgccag ctcaccactt agactctttat attgagtggt 40 <210> 549 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 549 aaatacccat aaggcgtgat gctagactct tatattgagt ggt 43 <210> 550 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 550 attactatcc tgcgtgaaat ccatagactc ttatattgag tggt 44 <210> 551 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 551 cccaaagtcg aacagttttg tctagactct tatattgagt ggt 43 <210> 552 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 552 tcctcaaatg tccgaggatg atagacctat tctatgcttc g 41 <210> 553 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 553 gtgaacacaa cgtaagaaca ggtagaccta ttctatgctt cg 42 <210> 554 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 554 actcctctgg ttacgcttca tttagaccta ttctatgctt cg 42 <210> 555 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 555 acctaacata accgtgctgc ctagacctat tctatgcttc g 41 <210> 556 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 556 ttcagttgac cgtctggagaca ctagacctat tctatgcttc g 41 <210> 557 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 557 ctctgacaca cgtaacaata acatagacct attctatgct tcg 43 <210> 558 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 558 agtaatgtga ggtacaactg cattagacct attctatgct tcg 43 <210> 559 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 559 gcttctttcc cgcccaaaat atagacctat tctatgcttc g 41 <210> 560 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 560 aaagaaaagc ggtctactag attatagacc tattctatgc ttcg 44 <210> 561 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 561 tgacgtgcgg cgaaatttat gtagacctat tctatgcttc g 41 <210> 562 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 562 gcttattgca gcgatggatg atagacctat tctatgcttc g 41 <210> 563 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 563 tgtcagtaga cgatagagga ggtagaccta ttctatgctt cg 42 <210> 564 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 564 ttggttccga ctacccaaca gtagacctat tctatgcttc g 41 <210> 565 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 565 ctcttaagta cgcaataatt ctctctagac ctattctatg cttcg 45 <210> 566 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 566 gttccgtata tgtcggatct ctctagacct attctatgct tcg 43 <210> 567 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 567 aaattcaccg gacggagtgt ttagacctat tctatgcttc g 41 <210> 568 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 568 tttgtgaaac cgtagtggct cttagaccta ttctatgctt cg 42 <210> 569 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 569 acctctttaa cgaaggtgtc agtagaccta ttctatgctt cg 42 <210> 570 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 570 ggactccggt tctaacttgg ttagacctat tctatgcttc g 41 <210> 571 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 571 atctctatat gacgtgctgt tggtagacct attctatgct tcg 43 <210> 572 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 572 gttggaatta ttcggagact gagtagacct attctatgct tcg 43 <210> 573 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 573 gcacatttga cgacggcttc tagacctatt ctatgcttcg 40 <210> 574 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 574 actccgtgta aacgcagtgg tagacctatt ctatgcttcg 40 <210> 575 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 575 acacataact cgttaacacg ttctagacct attctatgct tcg 43 <210> 576 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 576 cagatctgtt gagctaacag ggtagacatg ttataccatg cg 42 <210> 577 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 577 ttctagacta tgcaaccctc taggtagaca tgttatacca tgcg 44 <210> 578 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 578 cacccatgtg agtaatacac tgctagacat gttataccat gcg 43 <210> 579 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 579 agtcccatat tgccgttcat gctagacatg ttataccatg cg 42 <210> 580 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 580 atttcctcat aacggtcatg gctagacatg ttataccatg cg 42 <210> 581 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 581 ttatactgccta gctagcaggt tatagacatg ttataccatg cg 42 <210> 582 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 582 acgtgccctt ggtactatga ctagacatgt tataccatgc g 41 <210> 583 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 583 cttgccaaac cctagcttgg atagacatgt tataccatgc g 41 <210> 584 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 584 attatcactt aacgaaggtc ctttgtagac atgttatacc atgcg 45 <210> 585 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 585 atatacagcc taagcaccaa ttatgtagac atgttatacc atgcg 45 <210> 586 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 586 ggcaacaaaa cgtcatggca tagacatgtt ataccatgcg 40 <210> 587 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 587 gtctgaggac taaccctaaa gggtagacat gttataccat gcg 43 <210> 588 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 588 cttaaaatag atcgaaactc tgtctctaga catgttatac catgcg 46 <210> 589 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 589 tgatctgtac aagctacgattttatagaca tgttatacca tgcg 44 <210> 590 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 590 aaatcagtta taccaagggg agatagacat gttataccat gcg 43 <210> 591 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 591 taggaaaaca tacgtatact gaatatagac atgttatacc atgcg 45 <210> 592 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 592 agttggcctc acgttgcatt tagacatgtt ataccatgcg 40 <210> 593 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 593 tttggtctcg gcttgcgaat tagacatgtt ataccatgcg 40 <210> 594 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 594 cagtagtcaa cgcagcactc atagacatgt tataccatgc g 41 <210> 595 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 595 caacaggatc acctaatatt cccatagaca tgttatacca tgcg 44 <210> 596 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 596 tttggacaga tatctcctcg aaatagacat gttataccat gcg 43 <210> 597 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 597 aaaggctatc tacactttgg caatagacat gttataccat gcg 43 <210> 598 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 598 tgcctggatc ctatcccgac tagacatgtt ataccatgcg 40 <210> 599 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 599 tgtggtcacc tacacgctgc tagacatgtt ataccatgcg 40 <210> 600 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 600 ggtgagctgg taatctgacc ttagacaatc tatttaccct acg 43 <210> 601 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 601 gttgcaggca tgacgcaagt agacaatcta tttaccctac g 41 <210> 602 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Target-specific oligonucleotides <400> 602 aaaacgccta cgcatcatgt ctagacaatc tatttaccct acg 43 <210> 603 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Target-speci...

Claims

1. A multiplex method for detecting different analytes and different subgroups / variants of analytes in a sample for non-disease diagnostic purposes, comprising: (A) The sample is contacted with at least twenty different sets of analyte-specific probes encoding at least 20 different analytes, each set of analyte-specific probes interacting with a different analyte, wherein, for any of the analytes, if the analyte is a nucleic acid, the analyte-specific probe set corresponding to that analyte comprises at least five analyte-specific probes that specifically interact with different substructures of the same analyte, each analyte-specific probe comprising: (aa) binding elements that specifically interact with one of the different analytes to be encoded, and (bb) Identifier element, comprising a nucleotide sequence unique to the analyte to be encoded, wherein the nucleotide sequence unique to the analyte to be encoded is a unique identifier sequence. In this context, the analyte-specific probes of a particular analyte-specific probe group differ from those of another analyte-specific probe group in terms of the nucleotide sequence of the identifier element. In each analyte-specific probe group, the analyte-specific probes bind to the same analyte and include the same nucleotide sequence of a unique identifier element for the analyte; and The sample is brought into contact with at least two different sets of analyte-specific probes for at least one analyte and its variants. Among these different groups, the analyte-specific probes interact with the same analyte, but with different substructures of the same analyte. Specifically, the analyte-specific probes in the first analyte-specific probe group interact with the substructures included in all variants of the analyte. Specifically, the analyte-specific probes of the second analyte-specific probe group interact with substructures included only in variants of the analyte, and the analyte-specific probes of the second analyte-specific probe group are subgroup-specific probes. The first analyte-specific probe group comprises analyte-specific probes that share the same identifier element. This identifier element includes a nucleotide sequence unique to the analyte being encoded, and this unique nucleotide sequence is a unique identifier sequence. In the second analyte-specific probe group, the analyte-specific probes include identical identifier elements, each identifier element comprising a nucleotide sequence unique to the analyte to be encoded, which is a unique identifier sequence. The identifier elements of the analyte-specific probes in the first analyte-specific probe group are different from those in the second analyte-specific probe group, in order to bind different decoding oligonucleotides and / or non-signal decoding oligonucleotides. (B) Contact the sample with at least one decoding oligonucleotide set for each analyte, wherein in each decoding oligonucleotide set for an individual analyte, each decoding oligonucleotide comprises: (aa) Identifier linker element, comprising at least a portion of a nucleotide sequence complementary to the unique identifier sequence of the identifier element of the corresponding analyte-specific probe set, and (bb) Translational elements, including nucleotide sequences that allow specific hybridization of signal oligonucleotides; Among them, one set of decoding oligonucleotides used for individual analytes differs from another set of decoding oligonucleotides used for different analytes in terms of identifier linker elements; and (C) Contact the sample with at least one group of signal oligonucleotides, each signal oligonucleotide comprising: (aa) A translator linker element, comprising a nucleotide sequence complementary to at least a portion of the nucleotide sequence of the translator element included in the decoding oligonucleotide, and (bb) Signal components; (D) Detect the signal caused by the signal element; (E) Selectively remove the decoding oligonucleotide and signal oligonucleotide from the sample to maintain the specific binding of the analyte-specific probe to the analyte to be encoded; (F) Perform at least three additional loops, including steps B) through E), to generate an encoding scheme with codewords for each analyte. (G) Perform at least one additional cycle including steps B) to E) to identify subgroup-specific probes.

2. The method according to claim 1, wherein, The analyte-specific probe set includes at least five subgroup-specific probes that specifically interact with different substructures of the same variant of the analyte.

3. The method according to claim 1, wherein, For any of the analytes, if the analyte is a nucleic acid, then the analyte-specific probe set corresponding to the analyte includes at least ten analyte-specific probes, each of which interacts with a different substructure of the same analyte specifically.

4. The method according to claim 1, wherein, A subgroup of at least one analyte is contacted with a group of at least five subgroup-specific probes, the subgroup-specific probes being different from the analyte-specific probes of another group of analyte-specific probes in terms of the nucleotide sequence of the identifier element.

5. The method according to claim 1, wherein, The sample is brought into contact with the subgroup-specific probe set according to claim 1, wherein the method includes additional cycles containing steps B) to E) to identify variants that interact with the subgroup-specific probes.

6. The method according to claim 1, wherein, All steps are automated.

7. The method according to claim 1, wherein, All steps take place within a fluid system.

8. The method according to claim 1, wherein, Each analyte is associated with a specific codeword, wherein the codeword comprises multiple positions, and wherein each position corresponds to a cycle, thereby generating multiple distinguishable encoding schemes with multiple codewords.

9. The method according to claim 1, wherein, The encoding scheme is predetermined and assigned to the analyte to be encoded.

10. The method according to claim 1, wherein, The codeword obtained for the individual analyzer during the execution loop includes the detected signal and at least one additional element corresponding to the undetected signal.

11. The method according to claim 1, wherein, No signal was detected for at least one analyte within at least one cycle.

12. The method according to claim 1, wherein, For at least one individual analyte, the position of the codeword is zero.

13. The method according to claim 1, wherein, The codeword zero is generated by decoding oligonucleotides without using identifier linker elements, the identifier linker elements comprising at least a portion of a unique identifier sequence of the identifier element of the corresponding analyte-specific probe of the individual analyte.

14. The method according to claim 1, wherein, If, in this cycle, the codeword position is zero for at least one individual analyte, the corresponding decoding oligonucleotide with an identifier linker element comprising a nucleotide sequence complementary to at least a portion of the unique identifier sequence of the identifier element of the corresponding analyte-specific probe of the individual analyte is not used.

15. The method according to claim 1, wherein, The sample is contacted with at least two different groups of signaling oligonucleotides, wherein each group of signaling oligonucleotides includes different signaling elements and different linker elements.

16. The method according to claim 1, wherein, The sample is contacted with at least two different decoding oligonucleotide sets for each analyte. The decoding oligonucleotides included in these different groups comprise the same identifier linker element, which includes a nucleotide sequence complementary to at least a portion of the unique identifier sequence of the identifier element in the corresponding analyte-specific probe group. The decoding oligonucleotides of different groups of each analyte differ in terms of the translational elements, which include nucleotide sequences that allow specific hybridization of the signal oligonucleotides.

17. The method according to claim 1, wherein, The sample is contacted with at least two different decoding oligonucleotide sets for each analyte. The decoding oligonucleotides included in these different groups comprise the same identifier linker element, which includes a nucleotide sequence complementary to at least a portion of the unique identifier sequence of the identifier element in the corresponding analyte-specific probe group. The decoding oligonucleotides of different groups of each analyte differ in terms of translational elements, which include nucleotide sequences that allow specific hybridization of the signal oligonucleotide; In this process, only one decoding oligonucleotide set for each analyte is used in each cycle, and / or different decoding oligonucleotide sets are used in different cycles, while the corresponding signaling oligonucleotide set is used in the same cycle.

18. The method according to claim 1, wherein, The number of different decoding oligonucleotide sets for each analyte, including different translation elements, corresponds to the number of different signaling oligonucleotide sets, including different linker elements.

19. The method according to claim 1, wherein, All decoding oligonucleotide sets used for different analytes include one or more translational elements of the same type.

20. The method according to claim 1, wherein, Contact the sample with the following: At least one set of non-signal decoding oligonucleotides for binding to the identifier element of an analyte-specific probe, wherein decoding oligonucleotides in the same set of non-signal decoding oligonucleotides interact with the same different identifier element. Each non-signal decoding oligonucleotide includes an identifier linker element comprising a nucleotide sequence complementary to at least a portion of a unique identifier sequence, and each non-signal decoding oligonucleotide does not include a translator element containing a nucleotide sequence that allows specific hybridization of the signal oligonucleotide.

21. The method according to claim 1, wherein, Contact the sample with the following: At least two distinct non-signal decoding oligonucleotide sets are used to bind to at least two distinct identifier elements of an analyte-specific probe, each non-signal decoding oligonucleotide set interacting with a distinct identifier element. Each non-signal decoding oligonucleotide includes an identifier linker element comprising a nucleotide sequence complementary to at least a portion of a unique identifier sequence, and each non-signal decoding oligonucleotide does not include a translator element containing a nucleotide sequence that allows specific hybridization of the signal oligonucleotide.

22. The method according to claim 21, wherein, The different non-signal decoding oligonucleotide groups are included in a premixture of different non-signal decoding oligonucleotide groups or exist separately.

23. The method according to claim 1, wherein, Contact the sample with the following: Non-signal oligonucleotides, each comprising: (aa) A translator linker element comprising a nucleotide sequence complementary to at least a portion of the nucleotide sequence of the translator element, and (bb) Quenching agent only, or a combination of signal element and quenching agent, or no signal element.

24. The method according to claim 1, wherein, Contact the sample with the following: At least two non-signal oligonucleotide groups, each non-signal oligonucleotide comprising: (aa) A translator linker element comprising a nucleotide sequence complementary to at least a portion of the nucleotide sequence of the translator element, and (bb) Quenching agent only, or a combination of signal element and quenching agent, or no signal element.

25. The method according to claim 23, wherein, Different non-signal oligonucleotide groups are included in premixes of different non-signal oligonucleotide groups or exist separately.

26. The method according to claim 1, wherein, The decoding oligonucleotides in the decoding oligonucleotide set interact with the same identifier element that is unique to the analyte.

27. The method according to claim 1, wherein, Different decoding oligonucleotide groups are included in premixes of different decoding oligonucleotide groups or exist separately.

28. The method according to claim 1, wherein, The different analyte-specific probe sets are included in premixes of different analyte-specific probe sets or exist separately.

29. The method according to claim 1, wherein, The different signaling oligonucleotide groups are included in a premixture of different signaling oligonucleotide groups or exist separately.

30. The method according to claim 1, wherein, The sample is a biological sample.

31. The method according to claim 30, wherein, The sample includes biological tissue, or the sample includes biological cells and / or extracts and / or portions of cells; the cells are prokaryotic or eukaryotic cells.

32. The method according to claim 31, wherein, The biological tissue, the biological cells, the extract, and / or portions of the cells are fixed.

33. The method according to claim 1, wherein, The analyte is immobilized in the permeabilized sample.

34. The method according to claim 1, wherein, The binding element comprises a nucleic acid containing a nucleotide sequence that allows specific binding to the analyte to be encoded.

35. The method according to claim 1, wherein, After step A) and before step B), remove unbound analyte-specific probes.

36. The method according to claim 1, wherein, After step B) and before step C), remove unbound decoding oligonucleotides.

37. The method according to claim 1, wherein, After step C) and before step D), remove unbound signal oligonucleotides.

38. The method according to claim 1, wherein, The analyte-specific probe is incubated with the sample, thereby allowing the analyte-specific probe to bind specifically to the analyte to be encoded.

39. The method according to claim 1, wherein, The decoding oligonucleotide is incubated with the sample, thereby allowing the decoding oligonucleotide to specifically hybridize with the identifier element of the respective analyte-specific probe.

40. The method according to claim 1, wherein, The signal oligonucleotide is incubated with the sample, thereby allowing the signal oligonucleotide to specifically hybridize with the translational elements of the respective decoding oligonucleotide.

41. The method according to claim 1, wherein, The analyte to be encoded is a nucleic acid.

42. The method according to claim 1, wherein, The analyte to be encoded is a peptide, polypeptide, or protein.

43. The method according to claim 1, wherein, The binding element includes an amino acid sequence that allows specific binding to the analyte to be encoded.

44. The method according to claim 1, wherein, The binding element comprises a portion thereof, which is either an affinity portion of an affinity substance or the entire affinity substance, wherein the affinity substance is selected from the group consisting of: antibodies, antibody fragments, anticalin proteins, receptor ligands, enzyme substrates, lectins, cytokines, lymphokines, interleukins, angiogenic or virulence factors, allergens, peptide allergens, recombinant allergens, allergen idiotype antibodies, autoimmune-inducing structures, tissue rejection-inducing structures, immunoglobulin constant regions, and combinations thereof.

45. The method according to claim 1, wherein, The binding element is an antibody or antibody fragment selected from the group consisting of: Fab, scFv; single domain or fragment thereof, dual scFv, Fab 2, Fab 3, microantibody, dual antibody, triple antibody, tetraantibody, and tandab.

46. ​​The method according to claim 1, wherein, The signal generated by the signal element is determined by the following: (a) Imaging at least a portion of the sample; and / or (b) Use of optical imaging techniques; and / or (c) Use of fluorescence imaging techniques; and / or (d) Multicolor fluorescence imaging technology; and / or (e) Super-resolution fluorescence imaging technology.

47. The method according to any one of claims 1 to 46, wherein, At least one of the decoding oligonucleotides in the decoding oligonucleotide set is a multi-decoder comprising: (aa) Identifier linker element, comprising at least a portion of a nucleotide sequence complementary to the unique identifier sequence of the identifier element of the corresponding analyte-specific probe set, and (bb) At least two translational elements, wherein the translational elements comprise different nucleotide sequences that allow specific hybridization of different signal oligonucleotides.

48. The method according to claim 47, wherein, The different signaling oligonucleotides include different signaling elements and different linker elements.

49. A kit for multiplex analyte coding, comprising: (A) At least twenty different analyte-specific probe sets for encoding at least 20 different analytes, each analyte-specific probe set interacting with a different analyte, wherein... For any of the analytes, if the analyte is a nucleic acid, then the analyte-specific probe set corresponding to the analyte includes at least five analyte-specific probes that specifically interact with different substructures of the same analyte, each analyte-specific probe including... (aa) binding elements that specifically interact with one of the different analytes to be encoded, and (bb) Identifier element, comprising a nucleotide sequence unique to the analyte to be encoded, wherein the nucleotide sequence unique to the analyte to be encoded is a unique identifier sequence. In this context, the analyte-specific probes of a particular analyte-specific probe group differ from those of another analyte-specific probe group in terms of the nucleotide sequence of the identifier element. In each analyte-specific probe group, the analyte-specific probes bind to the same analyte and include the same nucleotide sequence of a unique identifier element for the analyte; and (B) At least one decoding oligonucleotide set for each analyte, wherein, in each decoding oligonucleotide set for an individual analyte, each decoding oligonucleotide comprises: (aa) Identifier linker element, comprising at least a portion of a nucleotide sequence complementary to the unique identifier sequence of the identifier element of the corresponding analyte-specific probe set, and (bb) Translational elements, including nucleotide sequences that allow specific hybridization of signal oligonucleotides; Among them, one set of decoding oligonucleotides for an individual analyte differs from another set of decoding oligonucleotides for different analytes in terms of the identifier linker element; and (C) Signal oligonucleotide set, each signal oligonucleotide comprising: (aa) A translator linker element, comprising a nucleotide sequence complementary to at least a portion of the nucleotide sequence of the translator element included in the decoding oligonucleotide, and (bb) Signal element.

50. The kit according to claim 49, wherein, The kit includes at least two different sets of analyte-specific probes for the analyte. Among these different groups, the analyte-specific probes interact with the same analyte, but with different substructures of the same analyte. Specifically, the analyte-specific probes in the first analyte-specific probe group interact with the substructures included in all variants of the analyte. Specifically, the analyte-specific probes of the second analyte-specific probe group interact with substructures included only in variants of the analyte, and the analyte-specific probes of the second analyte-specific probe group are subgroup-specific probes. The first analyte-specific probe group comprises analyte-specific probes that share the same identifier element. This identifier element includes a nucleotide sequence unique to the analyte being encoded, and this unique nucleotide sequence is a unique identifier sequence. In the second analyte-specific probe group, the analyte-specific probes include identical identifier elements, each identifier element comprising a nucleotide sequence unique to the analyte to be encoded, which is a unique identifier sequence. The identifier elements of the analyte-specific probes in the first analyte-specific probe group are different from those in the second analyte-specific probe group.

51. The kit according to claim 49, wherein, The kit includes at least five subgroup-specific probe sets, which differ from the analyte-specific probes in the nucleotide sequence of the identifier element in another analyte-specific probe set.

52. The kit according to claim 49, wherein, The kit does not include the group of analyte-specific probes and / or subgroup-specific probes as defined in claim 47.

53. The kit according to claim 49, wherein, For any of the analytes, if the analyte is a nucleic acid, then the analyte-specific probe set corresponding to the analyte includes at least ten analyte-specific probes, which specifically interact with different substructures of the same analyte.

54. The kit according to claim 49, wherein, For any of the analytes, if the analyte is a peptide, polypeptide, or protein, then the analyte-specific probe set corresponding to the analyte includes at least two analyte-specific probes that specifically interact with different substructures of the same analyte.

55. The kit according to claim 49, wherein, The kit comprises at least two different groups of signaling oligonucleotides, wherein each group of signaling oligonucleotides comprises different signaling elements and different linker elements.

56. The kit according to claim 49, wherein, The kit includes at least two distinct decoding oligonucleotide sets for each analyte. The decoding oligonucleotides included in these different groups comprise the same identifier linker element, which includes a nucleotide sequence complementary to at least a portion of the unique identifier sequence of the identifier element in the corresponding analyte-specific probe group. The decoding oligonucleotides of different groups of each analyte differ in terms of the translational elements, which include nucleotide sequences that allow specific hybridization of the signal oligonucleotides.

57. The kit according to claim 49, wherein, The kit includes at least two distinct decoding oligonucleotide sets for each analyte. The decoding oligonucleotides included in these different groups comprise the same identifier linker element, which includes a nucleotide sequence complementary to at least a portion of the unique identifier sequence of the identifier element in the corresponding analyte-specific probe group. The decoding oligonucleotides used for different groups of at least one analyte differ in relation to the translational elements, which include nucleotide sequences that allow specific hybridization of the signal oligonucleotide.

58. The kit according to claim 49, wherein, The number of different decoding oligonucleotide sets for each analyte, including different translation elements, corresponds to the number of different signaling oligonucleotide sets, including different linker elements.

59. The kit according to claim 49, wherein, The decoding oligonucleotides in the decoding oligonucleotide set interact with the same identifier element that is unique to the analyte.

60. The kit according to claim 49, wherein, All decoding oligonucleotide sets used for different analytes include one or more translational elements of the same type.

61. The kit according to claim 49, wherein, The kit includes: (D) At least one set of non-signal decoding oligonucleotides for binding to the identifier element of an analyte-specific probe, wherein decoding oligonucleotides in the same set of non-signal decoding oligonucleotides interact with the same different identifier element. Each non-signal decoding oligonucleotide includes an identifier linker element comprising a nucleotide sequence complementary to at least a portion of a unique identifier sequence, and each non-signal decoding oligonucleotide does not include a translator element containing a nucleotide sequence that allows specific hybridization of the signal oligonucleotide.

62. The kit according to claim 49, wherein, The kit includes: (D) At least two distinct non-signal decoding oligonucleotide sets for binding to at least two distinct identifier elements of an analyte-specific probe, each non-signal decoding oligonucleotide set interacting with a distinct identifier element. Each non-signal decoding oligonucleotide includes an identifier linker element comprising a nucleotide sequence complementary to at least a portion of a unique identifier sequence, and each non-signal decoding oligonucleotide does not include a translator element containing a nucleotide sequence that allows specific hybridization of the signal oligonucleotide.

63. The kit according to claim 49, wherein, Different non-signal decoding oligonucleotide groups are included in premixes of different non-signal decoding oligonucleotide groups or exist separately.

64. The kit according to claim 49, wherein, The kit includes: (E) Non-signal oligonucleotide group, each non-signal oligonucleotide comprising: (aa) A translator linker element comprising a nucleotide sequence complementary to at least a portion of the nucleotide sequence of the translator element, and (bb) Quenching agent only, or a combination of signal element and quenching agent, or no signal element.

65. The kit according to claim 49, wherein, The kit includes: (E) At least two non-signal oligonucleotide groups, each non-signal oligonucleotide comprising: (aa) A translator linker element comprising a nucleotide sequence complementary to at least a portion of the nucleotide sequence of the translator element, and (bb) Quenching agent only, or a combination of signal element and quenching agent, or no signal element.

66. The kit according to claim 49, wherein, Different non-signal oligonucleotide groups are included in premixes of different non-signal oligonucleotide groups or exist separately.

67. The kit according to claim 49, wherein, The decoding oligonucleotides in the decoding oligonucleotide set interact with the same identifier element that is unique to the analyte.

68. The kit according to claim 49, wherein, Different decoding oligonucleotide groups are included in premixes of different decoding oligonucleotide groups or exist separately.

69. The kit according to claim 49, wherein, Different analyte-specific probe sets are included in premixes of different analyte-specific probe sets or exist separately.

70. The kit according to claim 49, wherein, Different signal oligonucleotide groups are included in a premixture of different signal oligonucleotide groups or exist separately.

71. The kit according to claim 49, wherein, The analyte to be encoded is a nucleic acid.

72. The kit according to claim 49, wherein, The analyte to be encoded is a peptide, polypeptide, or protein.

73. The kit according to claim 49, wherein, The binding element includes an amino acid sequence that allows specific binding to the analyte to be encoded.

74. The kit according to claim 49, wherein, The binding element comprises a portion thereof, which is either an affinity portion of an affinity substance or the entire affinity substance, wherein the affinity substance is selected from the group consisting of: antibodies, antibody fragments, anticalin proteins, receptor ligands, enzyme substrates, lectins, cytokines, lymphokines, interleukins, angiogenic or virulence factors, allergens, peptide allergens, recombinant allergens, allergen idiotype antibodies, autoimmune-inducing structures, tissue rejection-inducing structures, immunoglobulin constant regions, and combinations thereof.

75. The kit according to claim 49, wherein, The binding element is an antibody or antibody fragment selected from the group consisting of: Fab, scFv; single domain or fragment thereof, dual scFv, F(ab)2, F(ab)3, microantibody, dual antibody, triantibody, tetraantibody and tandab.

76. The kit according to any one of claims 49 to 75, wherein, At least one of the decoding oligonucleotides in the decoding oligonucleotide set is a multi-decoder comprising: -(aa) Identifier linker element, comprising a nucleotide sequence complementary to at least a portion of the unique identifier sequence of the identifier element of the corresponding analyte-specific probe set, and -(bb) At least two translational elements, wherein the translational elements comprise different nucleotide sequences that allow specific hybridization of different signal oligonucleotides.

77. The kit according to claim 76, wherein, The different signaling oligonucleotides include different signaling elements and different linker elements.

78. A multiplex method for detecting different analytes in a sample for non-disease diagnostic purposes, the method comprising sequentially signal encoding the analytes, the method comprising: (A) The sample is contacted with at least twenty different sets of analyte-specific probes encoding at least 20 different analytes, each set of analyte-specific probes interacting with a different analyte, wherein, for any of the analytes, if the analyte is a nucleic acid, the analyte-specific probe set corresponding to that analyte comprises at least five analyte-specific probes that specifically interact with different substructures of the same analyte, each analyte-specific probe comprising: (aa) binding elements that specifically interact with one of the different analytes to be encoded, and (bb) Identifier element, comprising a nucleotide sequence unique to the analyte to be encoded, wherein the nucleotide sequence unique to the analyte to be encoded is a unique identifier sequence. In this context, the analyte-specific probes of a particular analyte-specific probe group differ from those of another analyte-specific probe group in terms of the nucleotide sequence of the identifier element. In each analyte-specific probe group, the analyte-specific probes bind to the same analyte and include the same nucleotide sequence of a unique identifier element for the analyte; and (B) Contact the sample with at least one decoding oligonucleotide set for each analyte, wherein in each decoding oligonucleotide set for an individual analyte, each decoding oligonucleotide comprises: (aa) Identifier linker element, comprising at least a portion of a nucleotide sequence complementary to the unique identifier sequence of the identifier element of the corresponding analyte-specific probe set, and (bb) Translational elements, including nucleotide sequences that allow specific hybridization of signal oligonucleotides; Among them, one set of decoding oligonucleotides used for individual analytes differs from another set of decoding oligonucleotides used for different analytes in terms of identifier linker elements; and (C) Contact the sample with at least one group of signal oligonucleotides, each signal oligonucleotide comprising: (aa) A translator linker element, comprising a nucleotide sequence complementary to at least a portion of the nucleotide sequence of the translator element included in the decoding oligonucleotide, and (bb) Signal components; (D) Detect the signal caused by the signal element; (E) Selectively remove the decoding oligonucleotide and signal oligonucleotide from the sample to maintain the specific binding of the analyte-specific probe to the analyte to be encoded; (F) Perform at least three additional loops, including steps B) through E), to generate an encoding scheme with codewords for each analyte.

79. The method according to claim 78, wherein, For any of the analytes, if the analyte is a nucleic acid, then the analyte-specific probe set corresponding to the analyte includes at least ten analyte-specific probes, each of which interacts with a different substructure of the same analyte specifically.

80. The method according to claim 78, wherein, The sample is brought into contact with at least two different sets of analyte-specific probes for use with the analyte. Among these different groups, the analyte-specific probes interact with the same analyte, but with different substructures of the same analyte. Specifically, the analyte-specific probes in the first analyte-specific probe group interact with the substructures included in all variants of the analyte. Specifically, the analyte-specific probes of the second analyte-specific probe group interact with substructures included only in variants of the analyte, and the analyte-specific probes of the second analyte-specific probe group are a subgroup-specific probe group. The first analyte-specific probe group comprises analyte-specific probes that share the same identifier element. This identifier element includes a nucleotide sequence unique to the analyte being encoded, and this unique nucleotide sequence is a unique identifier sequence. The second analyte-specific probe group comprises analyte-specific probes that share the same identifier element, which includes a nucleotide sequence unique to the analyte being encoded. This unique nucleotide sequence is a unique identifier sequence. The identifier elements of the analyte-specific probes in the first analyte-specific probe group are different from those in the second analyte-specific probe group.

81. The method according to claim 78, wherein, A subgroup of at least one analyte is contacted with a group of at least five subgroup-specific probes, the subgroup-specific probes being different from the analyte-specific probes of another group of analyte-specific probes in terms of the nucleotide sequence of the identifier element.

82. The method according to claim 78, wherein, The sample is brought into contact with the subgroup-specific probe set according to claim 30, wherein the method includes additional cycles containing steps B) to E) to identify variants that interact with the subgroup-specific probes.

83. The method according to claim 78, wherein, All steps are automated.

84. The method according to claim 78, wherein, All steps take place within a fluid system.

85. The method according to claim 78, wherein, Each analyte is associated with a specific codeword, wherein the codeword comprises multiple positions, and wherein each position corresponds to a cycle, thereby generating multiple distinguishable encoding schemes with multiple codewords.

86. The method according to claim 78, wherein, The encoding scheme is predetermined and assigned to the analyte to be encoded.

87. The method according to claim 78, wherein, The codeword obtained for the individual analyzer during the execution loop includes the detected signal and at least one additional element corresponding to the undetected signal.

88. The method according to claim 78, wherein, No signal was detected for at least one analyte within at least one cycle.

89. The method according to claim 78, wherein, For at least one individual analyte, the position of the codeword is zero.

90. The method according to claim 78, wherein, The codeword zero is generated by decoding oligonucleotides without using identifier linker elements, the identifier linker elements comprising at least a portion of a unique identifier sequence of the identifier element of the corresponding analyte-specific probe of the individual analyte.

91. The method according to claim 78, wherein, If, in this cycle, the codeword position is zero for at least one individual analyte, the corresponding decoding oligonucleotide with an identifier linker element comprising a nucleotide sequence complementary to at least a portion of the unique identifier sequence of the identifier element of the corresponding analyte-specific probe of the individual analyte is not used.

92. The method according to claim 78, wherein, The sample is contacted with at least two different groups of signaling oligonucleotides, wherein each group of signaling oligonucleotides includes different signaling elements and different linker elements.

93. The method according to claim 78, wherein, The sample is contacted with at least two different decoding oligonucleotide sets for each analyte. The decoding oligonucleotides included in these different groups comprise the same identifier linker element, which includes a nucleotide sequence complementary to at least a portion of the unique identifier sequence of the identifier element in the corresponding analyte-specific probe group. The decoding oligonucleotides of different groups of each analyte differ in terms of the translational elements, which include nucleotide sequences that allow specific hybridization of the signal oligonucleotides.

94. The method according to claim 78, wherein, The sample is contacted with at least two different decoding oligonucleotide sets for each analyte. The decoding oligonucleotides included in these different groups comprise the same identifier linker element, which includes a nucleotide sequence complementary to at least a portion of the unique identifier sequence of the identifier element in the corresponding analyte-specific probe group. The decoding oligonucleotides of different groups of each analyte differ in terms of translational elements, which include nucleotide sequences that allow specific hybridization of the signal oligonucleotide; In this process, only one decoding oligonucleotide set for each analyte is used in each cycle, and / or different decoding oligonucleotide sets are used in different cycles, while the corresponding signaling oligonucleotide set is used in the same cycle.

95. The method according to claim 78, wherein, The number of different decoding oligonucleotide sets for each analyte, including different translation elements, corresponds to the number of different signaling oligonucleotide sets, including different linker elements.

96. The method according to claim 78, wherein, All decoding oligonucleotide sets used for different analytes include one or more translational elements of the same type.

97. The method according to claim 78, wherein, Contact the sample with the following: At least one set of non-signal decoding oligonucleotides for binding to the identifier element of an analyte-specific probe, wherein decoding oligonucleotides in the same set of non-signal decoding oligonucleotides interact with the same different identifier element. Each non-signal decoding oligonucleotide includes an identifier linker element comprising a nucleotide sequence complementary to at least a portion of a unique identifier sequence, and each non-signal decoding oligonucleotide does not include a translator element containing a nucleotide sequence that allows specific hybridization of the signal oligonucleotide.

98. The method according to claim 78, wherein, Contact the sample with the following: At least two distinct non-signal decoding oligonucleotide sets are used to bind to at least two distinct identifier elements of an analyte-specific probe, each non-signal decoding oligonucleotide set interacting with a distinct identifier element. Each non-signal decoding oligonucleotide includes an identifier linker element comprising a nucleotide sequence complementary to at least a portion of a unique identifier sequence, and each non-signal decoding oligonucleotide does not include a translator element containing a nucleotide sequence that allows specific hybridization of the signal oligonucleotide.

99. The method according to claim 78, wherein, The different non-signal decoding oligonucleotide groups are included in a premixture of different non-signal decoding oligonucleotide groups or exist separately.

100. The method according to claim 78, wherein, Contact the sample with the following: Non-signal oligonucleotides, each comprising: (aa) A translator linker element comprising a nucleotide sequence complementary to at least a portion of the nucleotide sequence of the translator element, and (bb) Quenching agent only, or a combination of signal element and quenching agent, or no signal element.

101. The method according to claim 78, wherein, Contact the sample with the following: At least two non-signal oligonucleotide groups, each non-signal oligonucleotide comprising: (aa) A translator linker element comprising a nucleotide sequence complementary to at least a portion of the nucleotide sequence of the translator element, and (bb) Quenching agent only, or a combination of signal element and quenching agent, or no signal element.

102. The method according to claim 100, wherein, Different non-signal oligonucleotide groups are included in premixes of different non-signal oligonucleotide groups or exist separately.

103. The method according to claim 78, wherein, The decoding oligonucleotides in the decoding oligonucleotide set interact with the same identifier element that is unique to the analyte.

104. The method according to claim 78, wherein, Different decoding oligonucleotide groups are included in premixes of different decoding oligonucleotide groups or exist separately.

105. The method according to claim 78, wherein, The different analyte-specific probe sets are included in premixes of different analyte-specific probe sets or exist separately.

106. The method according to claim 78, wherein, The different signaling oligonucleotide groups are included in a premixture of different signaling oligonucleotide groups or exist separately.

107. The method according to claim 78, wherein, The sample is a biological sample.

108. The method according to claim 107, wherein, The sample includes biological tissue, or the sample includes biological cells and / or extracts and / or portions of cells; the cells are prokaryotic or eukaryotic cells.

109. The method according to claim 108, wherein, The biological tissue, the biological cells, the extract, and / or portions of the cells are fixed.

110. The method according to claim 78, wherein, The analyte is immobilized in the permeabilized sample.

111. The method according to claim 78, wherein, The binding element comprises a nucleic acid containing a nucleotide sequence that allows specific binding to the analyte to be encoded.

112. The method according to claim 78, wherein, After step A) and before step B), remove unbound analyte-specific probes.

113. The method according to claim 78, wherein, After step B) and before step C), remove unbound decoding oligonucleotides.

114. The method according to claim 78, wherein, After step C) and before step D), remove unbound signal oligonucleotides.

115. The method according to claim 78, wherein, The analyte-specific probe is incubated with the sample, thereby allowing the analyte-specific probe to bind specifically to the analyte to be encoded.

116. The method according to claim 78, wherein, The decoding oligonucleotide is incubated with the sample, thereby allowing the decoding oligonucleotide to specifically hybridize with the identifier element of the respective analyte-specific probe.

117. The method according to claim 78, wherein, The signal oligonucleotide is incubated with the sample, thereby allowing the signal oligonucleotide to specifically hybridize with the translational elements of the respective decoding oligonucleotide.

118. The method according to claim 78, wherein, The analyte to be encoded is a nucleic acid.

119. The method according to claim 78, wherein, The analyte to be encoded is a peptide, polypeptide, or protein.

120. The method according to claim 78, wherein, The binding element includes an amino acid sequence that allows specific binding to the analyte to be encoded.

121. The method according to claim 78, wherein, The binding element comprises a portion thereof, which is either an affinity portion of an affinity substance or the entire affinity substance, wherein the affinity substance is selected from the group consisting of: antibodies, antibody fragments, anticalin proteins, receptor ligands, enzyme substrates, lectins, cytokines, lymphokines, interleukins, angiogenic or virulence factors, allergens, peptide allergens, recombinant allergens, allergen idiotype antibodies, autoimmune-inducing structures, tissue rejection-inducing structures, immunoglobulin constant regions, and combinations thereof.

122. The method according to claim 78, wherein, The binding element is an antibody or antibody fragment selected from the group consisting of: Fab, scFv; single domain or fragment thereof, dual scFv, Fab 2, Fab 3, microantibody, dual antibody, triple antibody, tetraantibody, and tandab.

123. The method according to claim 78, wherein, The signal generated by the signal element is determined by the following: (f) Image at least a portion of the sample; and / or (g) Use of optical imaging techniques; and / or (h) Use of fluorescence imaging techniques; and / or (i) multicolor fluorescence imaging technology; and / or (j) Super-resolution fluorescence imaging technology.

124. The method according to any one of claims 78 to 123, wherein, At least one of the decoding oligonucleotides in the decoding oligonucleotide set is a multi-decoder comprising: -(aa) Identifier linker element, comprising a nucleotide sequence complementary to at least a portion of the unique identifier sequence of the identifier element of the corresponding analyte-specific probe set, and -(bb) At least two translational elements, wherein the translational elements comprise different nucleotide sequences that allow specific hybridization of different signal oligonucleotides.

125. The method according to claim 124, wherein, The different signaling oligonucleotides include different signaling elements and different linker elements.

126. Use of the reagent in the preparation of a reagent kit for diagnosing diseases selected from the group consisting of: cancer, neuronal diseases, cardiovascular diseases, inflammatory diseases, autoimmune diseases, diseases caused by viral or bacterial infections, skin diseases, skeletal muscle diseases, dental diseases, and prenatal diseases; in, The reagents include: (A) At least twenty different analyte-specific probe sets for encoding at least 20 different analytes, each analyte-specific probe set interacting with a different analyte, wherein, for any of the analytes, if the analyte is a nucleic acid, the analyte-specific probe set corresponding to the analyte includes at least five analyte-specific probes that specifically interact with different substructures of the same analyte, each analyte-specific probe including... (aa) binding elements that specifically interact with one of the different analytes to be encoded, and (bb) Identifier element, comprising a nucleotide sequence unique to the analyte to be encoded, wherein the nucleotide sequence unique to the analyte to be encoded is a unique identifier sequence. In this context, the analyte-specific probes of a particular analyte-specific probe group differ from those of another analyte-specific probe group in terms of the nucleotide sequence of the identifier element. In each analyte-specific probe group, the analyte-specific probes bind to the same analyte and include the same nucleotide sequence of a unique identifier element for the analyte; and (B) At least one decoding oligonucleotide set for each analyte, wherein, in each decoding oligonucleotide set for an individual analyte, each decoding oligonucleotide comprises: (aa) Identifier linker element, comprising at least a portion of a nucleotide sequence complementary to the unique identifier sequence of the identifier element of the corresponding analyte-specific probe set, and (bb) Translational elements, including nucleotide sequences that allow specific hybridization of signal oligonucleotides; Among them, one set of decoding oligonucleotides for an individual analyte differs from another set of decoding oligonucleotides for different analytes in terms of the identifier linker element; and (C) Signal oligonucleotide set, each signal oligonucleotide comprising: (aa) A translator linker element, comprising a nucleotide sequence complementary to at least a portion of the nucleotide sequence of the translator element included in the decoding oligonucleotide, and (bb) Signal element.

127. An optical multiplexing system for the method according to any one of claims 1 to 48 and / or claims 78 to 125, comprising at least: - A reaction vessel for containing a kit or a portion thereof according to any one of claims 49 to 77; - Detection unit, the detection unit including a microscope -Camera - Liquid handling equipment.

128. The optical multiplexing system according to claim 127, wherein, The system further includes heating and cooling devices.

129. The optical multiplexing system according to any one of claims 127 to 128, wherein, The system further includes a robotic system.

130. An in vitro method for testing substances and / or drugs, comprising: (a) Contacting the test sample, including the sample, with the substance and / or drug. (b) Different analytes in a sample are detected by sequential signal encoding of the analytes using the method of any one of claims 1 to 48 and / or claims 78 to 125.

131. The in vitro method according to claim 130, wherein, The sample is a biological sample.

Citation Information

Patent Citations

  • Composition for use in an assay method utilizing polynucleotide sequences

    EP0611828A1

  • Multiplex labeling of molecules by sequential hybridization barcoding

    EP2992115B1

  • Sample processing devices and carriers

    US20020048533A1

  • Sample processing devices

    US20020064885A1

  • Centrifugal filling of sample processing devices

    US6627159B1