Vibrio cholerae bacteriophage for preventing and treating vibrio disease of aquatic animals and application thereof

CN115717128BActive Publication Date: 2026-08-18XIAMEN CANCO BIOTECH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211607604.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-14
Publication Date
2026-08-18
Estimated Expiration
2042-12-14

AI Technical Summary

Technical Problem

目前抗生素等化学制剂对水产病害的防治效果并不好,药效短,见效差,且容易导致病原耐药性增强

Benefits of technology

[0004] This invention aims to at least partially solve one of the technical problems in related technologies. To this end, this invention provides a Vibrio cholerae bacteriophage for the prevention and control of Vibrio diseases in aquatic animals and its application. This bacteriophage has a broad phage spectrum, capable of simultaneously lysing six different hosts, and can lyse 44 strains of Vibrio cholerae, 23 strains of Vibrio harveyi, and 16 strains of Vibrio parahaemolyticus. It can more effectively solve the problem of various bacterial diseases in aquaculture and has good application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003998389920000041
    Figure BDA0003998389920000041
  • Figure BDA0003998389920000042
    Figure BDA0003998389920000042
  • Figure BDA0003998389920000051
    Figure BDA0003998389920000051
Patent Text Reader

Abstract

The application provides a Vibrio cholerae bacteriophage for preventing and treating vibrio disease of aquatic animals and application thereof, the bacteriophage is preserved in China Center for Type Culture Collection on November 5, 2021, and the preservation number is CCTCC M 20211375.The bacteriophage is a new species of bacteriophage of the class of tailed bacteriophages, the family of Schitoviridae, the whole genome of the bacteriophage is OP313112.1 in the NCBI official website GeneBank.The bacteriophage has a wide phage spectrum, can crack 6 different species of vibrio at the same time, can crack 44 strains of Vibrio cholerae, 23 strains of Vibrio harveyi, 16 strains of Vibrio parahaemolyticus, 15 strains of Vibrio alginolyticus, 10 strains of Vibrio campbellii and 8 strains of Vibrio vulnificus at the same time, can more effectively solve the problem of multiple bacterial disease infections in aquaculture, and can be used as a microecological preparation for preventing and treating vibrio diseases such as Vibrio cholerae, Vibrio harveyi and Vibrio parahaemolyticus of aquatic animals.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of aquatic disease control technology, specifically to a Vibrio cholerae bacteriophage for the prevention and control of Vibrio diseases in aquatic animals and its application. Background Technology

[0002] Vibrio cholerae belongs to the genus Vibrio of the family Vibrionaceae. It is a Gram-negative bacterium widely distributed in aquatic environments. The bacteria are curved or comma-shaped, possessing a single flagellum and pili, and some have capsules; they are motile. Vibrio cholerae is an important pathogen for fish and humans. The non-O1 / O139 type of Vibrio cholerae is widely distributed in aquatic environments, especially in rivers, lakes, and marine aquaculture, causing diseases in aquatic animals such as fish and shrimp. Shrimp infected with Vibrio cholerae turn black in color, their compound eyes turn white, and they become lethargic. They tend to congregate in shallow areas around the edges of ponds. The gills of infected shrimp are red with black spots; in severe cases, the gill tissue turns completely black. In dying individuals, the gills are adhered and mushy, easily detaching. The stomach is transparent and filled with fluid. The hepatopancreas is reddish-yellow and brittle. The muscle tissue is poorly developed, leading to mass mortality and causing significant economic losses to aquaculture farmers. Currently, the prevention and control of Vibrio cholerae in my country mainly relies on antibiotics and some other drugs. The overuse of antibiotics has become very serious, leading to environmental pollution and the emergence of "superbugs." With the increasing awareness of environmental protection and the implementation of sustainable agricultural development strategies, the search for environmentally friendly, safe, and effective biological control measures is receiving more and more attention.

[0003] Aquatic bacteriophage microecological preparations possess advantages such as environmental friendliness, safety against non-target organisms, and specific bactericidal effects against aquatic diseases. Unlike antibiotics and chemical agents, they are entirely natural, green, and environmentally friendly products, widely used in aquaculture and food safety. Their role in replacing antibiotics for disease prevention and control in aquaculture, and overcoming the problem of antibiotic resistance in pathogens caused by excessive antibiotic use, has become a hot topic in current biotechnology research. Currently, antibiotics and other chemical agents are not very effective in controlling aquatic diseases, exhibiting short-lived effects, poor efficacy, and a tendency to lead to increased pathogen resistance. Bacteriophages are highly specific to their hosts, generally only capable of lysing one host; therefore, narrow-spectrum bacteriophages generally cannot solve the problem of multiple bacterial infections occurring in aquaculture. The bacteriophage 12VC501 of this invention has a broad phage spectrum, capable of simultaneously lysing six different hosts, including 44 strains of Vibrio cholerae, 23 strains of Vibrio harveyi, 16 strains of Vibrio parahaemolyticus, 15 strains of Vibrio alginolyticus, 10 strains of Vibrio kanseri, and 8 strains of Vibrio vulnificus. This allows for more effective solutions to various bacterial diseases occurring in aquaculture. Furthermore, the bacteriophage cannot grow and reproduce independently after leaving its host microorganisms, nor can it infect other organisms or humans, thus posing no biological hazard or environmental pollution. Therefore, the isolation and screening of novel bacteriophages with high lytic capacity for antibacterial and bactericidal purposes, as described in this invention, is not only effective but also highly safe, holding significant importance for aquatic biological control. Summary of the Invention

[0004] This invention aims to at least partially solve one of the technical problems in related technologies. To this end, this invention provides a Vibrio cholerae bacteriophage for the prevention and control of Vibrio diseases in aquatic animals and its application. This bacteriophage has a broad phage spectrum, capable of simultaneously lysing six different hosts, and can lyse 44 strains of Vibrio cholerae, 23 strains of Vibrio harveyi, and 16 strains of Vibrio parahaemolyticus. It can more effectively solve the problem of various bacterial diseases in aquaculture and has good application prospects.

[0005] Therefore, in a first aspect, this invention proposes a Vibrio cholerae bacteriophage for the prevention and control of Vibrio diseases in aquatic animals and its application. The bacteriophage was deposited on November 5, 2021, at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC M 20211375, classified as Vibrio cholerae Phage 12VC501, and located at Wuhan University, Wuhan, China. The bacteriophage 12VC501 isolated and screened according to this invention has a broad phage spectrum, capable of simultaneously lysing six different hosts, including 44 strains of Vibrio cholerae, 23 strains of Vibrio harveyi, and 16 strains of Vibrio parahaemolyticus. It can more effectively address the problem of various bacterial diseases in aquaculture and has promising application prospects.

[0006] Optionally, the bacteriophage is a new species of bacteriophage belonging to the class Tail Phages and the family Schitoviridae, whose complete genome is accessed in GeneBank on the NCBI website with the accession number OP313112.1.

[0007] Optionally, the bacteriophage has four specific gene fragments, the nucleic acid sequences of which are shown in Example 4. Therefore, these four specific gene fragments can serve as typical characteristics for identifying the bacteriophage.

[0008] Optionally, the bacteriophage has four specific PCR amplification primers, as shown in Example 4. Therefore, these four specific PCR amplification primers can serve as typical characteristics for identifying the bacteriophage.

[0009] In a second aspect, the present invention provides a microecological preparation comprising the novel bacteriophage described above for the prevention and control of Vibrio cholerae, Vibrio harveyi, and Vibrio parahaemolyticus diseases in aquatic organisms. According to embodiments of the present invention, this microecological preparation can be used to prevent and control Vibrio cholerae, Vibrio harveyi, and Vibrio parahaemolyticus diseases in aquatic organisms.

[0010] Optionally, the titer of the bacteriophage is 5.8 × 10⁻⁶. 11 pfu / mL.

[0011] Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. Attached Figure Description

[0012] Figure 1 A phage plaque pattern of phage 12VC501 according to an embodiment of the present invention;

[0013] Figure 2 A transmission electron microscope image of bacteriophage 12VC501 according to an embodiment of the present invention;

[0014] Figure 3 This is a phylogenetic tree diagram of phage 12VC501 according to an embodiment of the present invention;

[0015] Figure 4 The results of BLAST alignment of phage 12VC501 on NCBI according to an embodiment of the present invention;

[0016] Figure 5 This is an electrophoresis diagram of the PCR amplification products of four specific genes according to an embodiment of the present invention. Detailed Implementation

[0017] The technical solution of the present invention is illustrated below through specific examples. It should be understood that the one or more method steps mentioned in the present invention do not preclude the existence of other method steps before or after the combined steps, or the insertion of other method steps between these explicitly mentioned steps; it should also be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the present invention. Furthermore, unless otherwise stated, the numbering of each method step is merely a convenient tool for identifying each method step, and not for limiting the order of the method steps or defining the scope of the present invention. Changes or adjustments to their relative relationships, without substantially altering the technical content, should also be considered within the scope of the present invention.

[0018] To better understand the above technical solutions, exemplary embodiments of the present invention are described in more detail below. While exemplary embodiments of the present invention are shown, it should be understood that the present invention can be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided to enable a more thorough understanding of the present invention and to fully convey the scope of the invention to those skilled in the art.

[0019] The present invention will now be described with reference to specific embodiments. It should be noted that these embodiments are merely descriptive and do not limit the present invention in any way.

[0020] Example 1: Screening and purification of phage 12VC501

[0021] 1. Isolation of Vibrio cholerae, the pathogen of diseased shrimp

[0022] Diseased freshwater shrimp from Changtai, Fujian Province were collected. The heads of the diseased shrimp were cut off and placed in sterile culture dishes. The heads were rinsed thoroughly with 50 mL of 75% alcohol, ground in a mortar, and then dissolved and mixed with 4 mL of sterile water. After standing for 30 minutes, 100 μL of the supernatant was collected and evenly spread onto TCBS (Trametes Chloris Biotate) medium. The mixture was incubated at 32°C for 12 hours. Yellow colonies were picked and streaked for purification on the same selective medium. This purification process was repeated three times. Single colonies of morphologically consistent strains were picked using an inoculation loop and inoculated into LB broth with 3% NaCl concentration. The mixture was incubated at 32°C for 12 hours. 500 μL of the bacterial culture was mixed with 500 μL of 40% glycerol and stored at -80°C.

[0023] 2. Large-scale culture of Vibrio

[0024] For the expansion culture of the host bacteria, 3% NaCl was added to LB liquid medium, and the mixture was autoclaved at 121°C for 20 min. After cooling to room temperature, two inoculation methods were used: The first method was single-colony inoculation, where a single colony was picked from the preservation plate and inoculated under aseptic conditions. The fermentation temperature was 32°C, the rotation speed was 150 rpm, and the fermentation time was 12 h. The second method was liquid inoculation, where 10% of the culture medium volume was added to achieve a concentration of 10... 8 CFU / mL Vibrio cholerae culture was fermented in LB liquid medium with a concentration of 3% NaCl at a fermentation temperature of 32℃, a rotation speed of 150 rpm, and a fermentation time of 12 h.

[0025] 3. Screening of bacteriophage 12VC501

[0026] Water samples were collected from 25 freshwater shrimp farming ponds in Zhangzhou and Quanzhou, Fujian Province; Zhanjiang, Guangdong Province; and Haikou, Hainan Province. A bacterial culture-water sample enrichment method was used. 1L of cultured Vibrio cholerae and 1L of water sample were mixed together, and then 1L of fresh LB liquid medium with a 3% NaCl concentration was added for enrichment overnight. The enriched liquid was extracted, centrifuged at 12000 rpm for 10 min, and then filtered twice through a 0.22 μm filter membrane. Bacteriophages were obtained by screening using a spread sampling method. The bacteriophages of this invention were obtained from water samples from freshwater shrimp ponds in Changtai County, Zhangzhou City, Fujian Province.

[0027] 4. Purification of bacteriophage 12VC501

[0028] Select a single plaque, incubate it overnight in 1 mL of SM buffer (Scientific Phygene), then centrifuge at 12000 rpm for 10 min, filter twice through a 0.22 μm filter membrane, and perform serial dilutions to a final concentration of 10. -6 First, add 100 μL of a solution with a concentration of 5.6 × 10⁻⁶. 8 For control, a double-layer plate containing cfu / mL host bacteria was used. For each dilution gradient, 100 μL of host bacteria and phage were mixed in a double-layer plate, incubated overnight at 32°C, and the growth of phage plaques was observed. Single phage plaques were selected and purified three more times.

[0029] 5. Determination of the high-temperature resistance of bacteriophage 12VC501

[0030] Take 6 samples containing 200 mL of each sample, with a content of 8.3 × 10⁻⁶. 11Erlenmeyer flasks containing pfu / mL phage fluid were placed in water baths at 30℃, 40℃, 50℃, 60℃, 70℃, and 80℃ for 12 hours. The thermostability of phage 12VC501 was determined by calculating the phage content after double-layer plate mixing. The results showed that phage 12VC501 remained viable and at a high concentration after 12 hours of treatment at 70℃, while most phages would die significantly or even completely at 60℃. Therefore, phage 12VC501 exhibits strong thermostability.

[0031] Table 1: Determination of the high-temperature resistance of bacteriophage 12VC501

[0032]

[0033] 6. Determination of acid and alkali resistance of bacteriophage 12VC501

[0034] Take 7 containers, each containing 200 mL, with a content of 5.7 × 10⁻⁶. 11 The pH of bacteriophage 12VC501 was adjusted to 4, 5, 6, 7, 8, 9, and 10 respectively by adding concentrated sulfuric acid and sodium hydroxide solutions to Erlenmeyer flasks containing pfu / mL bacteriophage fluid. After 12 hours, the acid and alkali resistance of bacteriophage 12VC501 was determined by calculating the bacteriophage content after treatment using double-layer plates. The results showed that bacteriophage 12VC501 could still survive at pH values ​​of 4 and 10, and the content remained high. In contrast, most bacteriophages would die in large numbers or even completely at pH values ​​of 5 and 8, indicating that bacteriophage 12VC501 has strong acid and alkali resistance.

[0035] Table 2: Determination of acid and alkali resistance of bacteriophage 12VC501

[0036]

[0037] 7. Determination of UV tolerance of bacteriophage 12VC501

[0038] Inside the clean bench, take 12 containers of 10 mL each containing 9.3 × 10⁻⁶ mg / L. 11 Sterile 90mm culture dishes containing pfu / mL phage solution were irradiated under a 20W, 20cm UV lamp for 0, 1h, 2h, 3h, 4h, 5h, 6h, 7h, and 8h. The UV tolerance of phage 12VC501 was determined by calculating the phage content after UV irradiation using a double-layer plate mixing method. The results are shown in Table 3: Phage 12VC501 survived after 8h of UV irradiation and maintained a high content, while most phages would die in large numbers or even completely after 2h of UV irradiation, indicating that phage 12VC501 has a strong UV tolerance.

[0039] Table 3: UV resistance test of phage 12VC501

[0040]

[0041] 8. Morphological characteristics of bacteriophage 12VC501

[0042] 20 μL of phage 12VC501 enrichment solution was placed on a copper grid and allowed to stand for 10 min to adsorb. Excess bacterial solution was then blotted away with filter paper. A suitable amount of 3% phosphotungstic acid was then applied for staining for 5 min. After drying, the solution was observed under a transmission electron microscope. Results are as follows: Figure 2 As shown, the selected bacteriophage is a tailed bacteriophage with an icosahedral head, a head length of 71.3±1.6 nm, a head width of 62.9±2.3 nm, and a tail length of 68.2±1.7 nm.

[0043] Example 2

[0044] 1. Determination of the optimal multiple of infection (MOI) of bacteriophage 12VC501 against Vibrio cholerae.

[0045] Take eight 100 mL portions of fresh 3% LB liquid culture medium and treat them separately. Treatment 1 was treated with 1 mL of 10% LB liquid culture medium. 6 cfu / mL Vibrio cholerae suspension and 1 mL of 10 9 PFU / mL phage solution, treatment 2 simultaneously added 1 mL of solution containing 10 pfu / mL phage. 7 cfu / mL Vibrio cholerae suspension and 1 mL of 10 9 PFU / mL phage solution, treatment 3, simultaneously added 1mL of solution containing 10 pfu / mL phage. 8 cfu / mL Vibrio cholerae suspension and 1 mL of 10 9 PFU / mL phage solution, treatment 4, simultaneously added 1mL of solution containing 10 pfu / mL phage. 8 cfu / mL Vibrio cholerae suspension and 1 mL of 10 8 PFU / mL phage solution, treated for 5 days, with 1 mL of 10 pfu / mL phage solution added simultaneously. 8 cfu / mL Vibrio cholerae suspension and 1 mL of 10 7 PFU / mL phage solution, treated for 6 days, with 1 mL of 10 pfu / mL phage solution added simultaneously. 8 cfu / mL Vibrio cholerae suspension and 1 mL of 10 6 PFU / mL phage solution, treated for 7 days, with 1 mL of 10 pfu / mL phage solution added simultaneously. 8 cfu / mL Vibrio cholerae suspension and 1 mL of 10 5 PFU / mL phage solution was added during treatment 8, along with 1 mL of 10 pfu / mL phage solution. 8 cfu / mL Vibrio cholerae suspension and 1 mL of 10 4Phage solution containing pfu / mL was cultured at 32℃ and 150 rpm for 12 h before phage titer was measured. The results are shown in Table 4: the highest phage titer was achieved when the optimal multiplicity of infection was 0.1.

[0046] Table 4: Determination of the optimal multiple of infection (MOI) of phage 12VC501 against Vibrio cholerae

[0047]

[0048] 2. Scale-up culture of bacteriophage 12VC501

[0049] The isolated bacteriophages were amplified as follows: 1 L of 3% LB liquid medium was prepared, autoclaved at 121°C for 20 min, cooled to room temperature, and 1 mL of 10% LB liquid medium was added. 9 cfu / mL Vibrio cholerae suspension and 1 mL of 10 7 The pfu / mL phage fluid was placed in a shaker at 32℃ and 150 rpm for 12 h and then centrifuged at 8000 rpm for 10 min to allow the host bacteria to settle to the bottom. The clear upper layer was taken, and the resulting liquid was the expanded culture of phage 12VC501.

[0050] 3. Preparation of bacteriophage 12VC501 probiotic preparation

[0051] Prepare 1 L of 3% LB liquid culture medium, autoclave at 121°C for 20 min, cool to room temperature, and simultaneously add 1 mL of 10% LB liquid culture medium. 9 CFU / mL Vibrio cholerae bacterial suspension and 1 mL of 10 7 Pfu / mL phage fluid was cultured in a shaker at 32℃ and 150 rpm for 12 h as seed culture. This seed culture was first inoculated into a 50L fermenter and cultured at 32℃ and 150 rpm for 12 h. Then, it was inoculated into a 500L fermenter and cultured at 32℃ and 150 rpm for 12 h. The resulting fermentation broth was centrifuged at 8000 rpm for 10 min to allow the host bacteria to settle to the bottom. The clear upper layer was collected, and the supernatant was then filtered through 500 nm and 200 nm ceramic membranes to obtain the phage microecological preparation.

[0052] 4. Determination of phage 12VC501 content

[0053] The bacteriophages were serially diluted to 10-1. -10 First, add only 100 μL of a concentration of 9.1 × 10⁻⁶. 8 A double-layer plate of cfu / mL Vibrio cholerae was used as a control, starting from 10... -10Starting with different concentrations, 100 μL of phage dilution and 100 μL of Vibrio cholerae suspension were used to prepare double-layer plates for each concentration. The plates were incubated overnight at 32°C, and the phage content was calculated by observing the number of plaques. The results showed that the phage content was 5.8 × 10⁻⁶. 11 It has a high concentration of pfu / mL and strong ability to infect Vibrio cholerae.

[0054] Table 5: Determination of phage 12VC501 content

[0055]

[0056] 5. Detection test for deletion of virulence genes or adverse genes in phage 12VC501

[0057] Bioinformatics analysis of phage 12VC501 was performed, and the results are shown in Table 6. Phage 12VC501 does not contain virulence genes or harmful genes.

[0058] Table 6 Open reading frames of phage 12VC501

[0059]

[0060]

[0061] 6. Phage 12VC501 phylogenetic analysis

[0062] Phylogenetic tree constructed using the whole genome of bacteriophage 12VC501 (e.g.) Figure 3 As shown in the figure, phage 12VC501 belongs to the same branch as the Vibrio phage genomes with GeneBank accession numbers NC_028799, NC_049380, NC_049350, and NC_021540, but is not in the same branch as the genomes of other phages.

[0063] Example 3: Lytic ability and preventive effect of bacteriophage 12VC501

[0064] 1. Determination of the lytic ability of bacteriophage 12VC501 against Vibrio cholerae.

[0065] Phage 12VC501 was counted and diluted to 1×10⁻⁶. 8 1×10 7 1×10 6 1×10 5 1×10 4Five concentrations of Pfu / mL were used, with sterile water as a blank control, and each concentration was performed in triplicate. Six tubes of cultured Vibrio cholerae were taken. Before treatment, the Vibrio cholerae content was calculated using the dilution plate method. Then, 1 mL of the five concentrations of bacteriophage fluid and sterile water were added to each tube. The tubes were then incubated at 32℃ and 150 rpm for 12 h. The lytic activity of bacteriophage 12VC501 against Vibrio cholerae was determined by calculating the post-treatment Vibrio cholerae content using the dilution plate method. The results showed that bacteriophage 12VC501 had a good bactericidal effect against Vibrio cholerae, and the higher the concentration, the better the effect.

[0066] Table 7: Determination of the lytic activity of bacteriophage 12VC501 against Vibrio cholerae

[0067]

[0068] 2. Host profile determination of bacteriophage 12VC501

[0069] A total of 165 strains of bacteriophage host bacterium VC501 and other Vibrio species were cultured, including 58 strains of Vibrio cholerae, 32 strains of Vibrio harveyi, 25 strains of Vibrio parahaemolyticus, 21 strains of Vibrio alginolyticus, 16 strains of Vibrio kansui, and 13 strains of Vibrio vulnificus. After incubation at 32℃ and 150 rpm for 12 h, 100 μL of a 3.8 × 10⁻⁶ concentration was obtained by direct spotting. 8 A CFU / mL host bacterial culture was evenly spread on a 3% LB agar plate, and then 20 μL of a 5.3 × 10⁻⁶ concentration was taken. 10 Four drops of pfu / mL phage solution were placed on a plate and incubated overnight at 32°C. The presence of transparent phage plaques was observed, and the lysis ability of phage 12VC501 against 167 strains of Vibrio was determined.

[0070] The results are shown in Table 8: Phage 12VC501 could lyse 116 out of 165 Vibrio strains, including 44 Vibrio cholerae, 23 Vibrio harveyi, 16 Vibrio parahaemolyticus, 15 Vibrio alginolyticus, 10 Vibrio cannii, and 8 Vibrio vulnificus, with a lysis rate of 70.30%, demonstrating strong lysis ability against Vibrio. In Yang Jixia's study, "Screening of Broadly Lysogenic Vibrio Phages Using Vibrio cholerae SWBC-a as Target Bacteria," infection experiments were conducted on 26 Vibrio strains (Vibrio cholerae, Vibrio parahaemolyticus, and Vibrio alginolyticus), and it was found that phage SWBC-a-3 could only lyse 3 of them. In Wang Jingfeng's study, "Phage VB_VpP_BT-1011, Screening Methods, and Applications," phage VB_VpP_BT-1011 could only lyse 1 of 8 Vibrio parahaemolyticus and 16 other bacterial strains in lysis experiments. In Zheng Xiaoshuang's study, "Screening of Broad-Spectrum Lytic Phages of Vibrio parahaemolyticus and Their Application in Seafood Safety Control," infection experiments were conducted on 42 strains of Vibrio parahaemolyticus, and it was found that phage VppYZU68 could only lyse 5 of them. In Chen Yibao's study, "Isolation, Identification, and Biological Characteristics Study of Virulent Salmonella Phages," infection experiments were conducted on 15 strains of Salmonella, and only 2 of them could be lysed. In Zhang Zhihong's study, "Specificity of the Lysis Spectrum and Molecular Classification of a Staphylococcus aureus Phage," infection experiments were conducted on 37 strains of Staphylococcus aureus and 74 strains of other species, and it was found that phage vB_SauH_SAP1 could only lyse 10 strains of Staphylococcus aureus. Therefore, it can be seen that bacteriophages have strong specificity, generally only able to lyse one type of host. Furthermore, in practical applications, narrow-spectrum bacteriophages are difficult to be effective against the multiple bacterial diseases that occur in aquaculture. In contrast, the 12VC501 bacteriophage of this invention can simultaneously lyse six different host species, including 44 strains of Vibrio cholerae, 23 strains of Vibrio harveyi, 16 strains of Vibrio parahaemolyticus, 15 strains of Vibrio alginolyticus, 10 strains of Vibrio cannibalus, and 8 strains of Vibrio vulnificus. Therefore, compared to other bacteriophages, the 12VC501 bacteriophage of this invention has stronger lytic ability and a broader host spectrum, enabling it to more effectively solve the problem of multiple bacterial diseases in aquaculture in practical applications.

[0071] Table 8: Host spectrum of bacteriophage 12VC501

[0072]

[0073] 3. Determination of the control efficacy of broad-spectrum bacteriophage 12VC501 and narrow-spectrum bacteriophage against Vibrio prawnis

[0074] Cultures of Vibrio cholerae VC501, Vibrio harveyi VH513, and Vibrio parahaemolyticus VP508 were prepared, with 500 mL of each culture at a concentration of 3.8 × 10⁻⁶. 8The supernatant was prepared at a concentration of CFU / mL. Phages VC501B and VC501F, which can only lyse Vibrio cholerae VC501, were cultured, and 500 mL of each at a concentration of 4.9 × 10⁻⁶ CFU / mL was taken. 10 Phage fluid at pfu / mL.

[0075] Two hundred shrimp with an average weight of (24.0±2.2)g were divided into five treatment groups, with two replicates in each group and 20 shrimp in each replicate. They were placed in a glass aquarium (60L capacity) and 40L of water were added. Treatment A served as a blank control without any treatment. Treatment B included 100 mL each of the prepared supernatants of Vibrio cholerae, Vibrio harveyi, and Vibrio parahaemolyticus. Treatment C included 100 mL each of the prepared supernatants of Vibrio cholerae, Vibrio harveyi, and Vibrio parahaemolyticus, as well as 100 mL of VC501B phage fluid. Treatment D included 100 mL each of the prepared supernatants of Vibrio cholerae, Vibrio harveyi, and Vibrio parahaemolyticus, as well as 100 mL of VC501F phage fluid. Treatment E included 100 mL each of the prepared supernatants of Vibrio cholerae, Vibrio harveyi, and Vibrio parahaemolyticus, as well as 100 mL of phage 12VC501 preparation from Example 2. The growth of the shrimp was observed daily, and the number of dead shrimp in each treatment group was recorded.

[0076] The control efficacy of broad-spectrum bacteriophage 12VC501 and narrow-spectrum bacteriophages VC501B and VC501F against Vibrio prawnis is shown in Table 9. In treatment A, no shrimp died. In treatment B, 21 shrimp died after 3 days (52.50% mortality), and 39 shrimp died after 7 days (97.50% mortality). In treatment C, 13 shrimp died after 3 days (32.50% mortality), and 25 shrimp died after 7 days (62.50% mortality). In treatment D, 15 shrimp died after 3 days (37.50% mortality), and 26 shrimp died after 7 days (65.00% mortality). In treatment E, 3 shrimp died after 3 days (7.50% mortality), and 5 shrimp died after 7 days (12.5% ​​mortality). The comparison showed that after 7 days, the mortality rate of treatment E was 85% lower than that of treatment B, 50% lower than that of treatment C, and 52.50% lower than that of treatment D. The results showed that, in practical applications, the broad-spectrum phage 12VC501 microecological preparation had significant advantages over the narrow-spectrum phages VC501B and VC501F. It could significantly reduce the mortality rate of shrimp and reduce the harm caused by Vibrio cholerae, Vibrio harveyi, and Vibrio parahaemolyticus in aquaculture, and the therapeutic effect was obvious.

[0077] Table 9. Determination of the control efficacy of broad-spectrum bacteriophage 12VC501 and narrow-spectrum bacteriophage against Vibrio prawnis

[0078]

[0079] 4. Determination of the preventive and therapeutic effects of bacteriophage 12VC501 microecological preparation on Vibrio cholerae in freshwater shrimp.

[0080] Two hundred shrimp with an average weight of (24.0±2.2) g were divided into five treatment groups, with two replicates per group and 20 shrimp per replicate. They were placed in a 60L glass aquarium with 40L of water. Treatment A served as a blank control. Treatment B included 100mL of prepared Vibrio cholerae supernatant. Treatment C included both 100mL of prepared Vibrio cholerae supernatant and 100mL of phage 12VC501 from Example 2. Treatment D included 100mL of phage 12VC501 from Example 2 for 3 days, followed by 100mL of prepared Vibrio cholerae supernatant. Treatment E included 100mL of phage 12VC501. Shrimp growth was observed daily, and the number of dead shrimp in each treatment group was recorded.

[0081] Table 10 shows the control efficacy of bacteriophage 12VC501 against Vibrio cholerae disease in freshwater shrimp. No shrimp died in treatments A and E. In treatment B, 19 shrimp died after 3 days (mortality rate of 47.50%), and 38 shrimp died after 7 days (mortality rate as high as 95.00%). In treatment C, 2 shrimp died after 3 days (mortality rate of only 5.0%), and 3 shrimp died after 7 days (mortality rate of only 7.50%). In treatment D, 0 shrimp died after 3 days (mortality rate of 0%), and 1 shrimp died after 7 days (mortality rate of only 2.50%). Comparative analysis revealed that after 7 days, the mortality rate of shrimp in group C was 87.50% lower than that in group B, demonstrating the excellent therapeutic effect of the phage 12VC501 microecological preparation against Vibrio cholerae disease in shrimp. Furthermore, after 7 days, the mortality rate of shrimp in group D was 92.50% lower than that in group B, showing a significant preventative effect and confirming the excellent preventative effect of the phage 12VC501 microecological preparation against Vibrio cholerae disease in shrimp. No shrimp mortality was observed in group E, indicating that the phage 12VC501 microecological preparation had no impact on shrimp growth. Therefore, the results indicate that the phage 12VC501 microecological preparation has no effect on shrimp growth and exhibits significant preventative and therapeutic effects against Vibrio cholerae disease in shrimp.

[0082] Table 10: Efficacy of bacteriophage 12VC501 microecological preparation in the prevention and treatment of Vibrio cholerae disease in freshwater shrimp

[0083]

[0084] Example 4: Whole genome sequencing and analysis of bacteriophage 12VC501

[0085] 1. Purification of bacteriophage 12VC501

[0086] Take 2 mL of 12VC501 phage fluid, centrifuge at 8000 rpm for 10 min, take the supernatant and filter it twice through a 0.22 μm filter membrane, then store it in a refrigerator at 4℃.

[0087] 2. Extraction of genomic DNA from bacteriophage 12VC501

[0088] Phage genomic DNA / RNA extraction kits from isolated and purified phages were used to extract phage genomic DNA, which was then sent to Meiji Biotechnology (Shanghai) Co., Ltd. for sequencing.

[0089] 3. Whole genome sequence analysis of bacteriophage 12VC501

[0090] The full-length genome sequence of bacteriophage 12VC501, selected using third-generation genome sequencing on the PacBio platform, is 70732 bp and is linear double-stranded DNA. BLAST analysis of the genome sequence on the NCBI website showed an 80% alignment coverage and 94.82% homology with the closest Vibrio phage (GeneBank accession number: KC438282.1); followed by a 79% alignment coverage and 94.78% homology with the Vibrio phage (GeneBank accession number: NC_049350.1). Bacteriophage 12VC501 was identified as a new species of phage belonging to the class Tail Phages and family Schitoviridae through genome alignment, and its full genome has been uploaded to the NCBI website and obtained the GeneBank accession number OP313112.1. Phage 12VC501 was deposited at the China Center for Type Culture Collection in Wuhan on November 5, 2021, with accession number CCTCC M 20211375.

[0091] DNAMAN 7 software was used to identify differentially expressed sequences between the phage 12VC501 genome and two phage genomes with the highest homology, obtaining specific gene fragments VC1, VC2, VC3, and VC4. Specific PCR amplification primers were then designed using Primer Premier 6 software and synthesized at Boshan Biotechnology (Shanghai) Co., Ltd. The results are as follows: Figure 5 As shown.

[0092] The specific PCR amplification primers are:

[0093] VC1F:5'-CAGAACAAGGAACCAATGAC-3';

[0094] VC1R:5'-CCGTGAACCAAGAACAGTA-3';

[0095] VC2F:5'-ATTCCGCCGCAATAAGTC-3';

[0096] VC2R:5'-GCCATCGCCAATCACATA-3';

[0097] VC3F:5'-CACCGCTTACCTATCCATT-3';

[0098] VC3R:5'-ACACATCTCCTTACCAACAT-3';

[0099] VC4F:5'-TGAAGCAGGTGAGATTGTT-3';

[0100] VC4R:5'-CATTGGTTGATTGTGGTGAA-3';

[0101] The specific gene fragments are:

[0102] VC1:CAGAACAAGGAACCAATGACATTTCACCACCACGCCATTCACTATTCCATGA ATAACAATTACCACTAACTTTATGTTGGTAAAGCTTTGTGTAATTACCAATTTTAAATTTGAATTCAAAACCAAAATGTTCAATTGGGTTACTTGGTACATAAGCTTCAGATTTACAACCAAAGATAAATACAGATAGGAAAAGTAAAATAAACAAACTTAATTGTTTCATGAGTAATCACCTTTAAACGAATAACCGTCTACTGCTAGTAGGTTTAATACTGTTCTTGGTTCACGGVC2:ATTCCGCCGCAATAAGTCAGTTAGGTTGATGAACTTAATTTTAAAAAGAACT CCAGTTAACACTAGCGACACTGGTCAAATATTAGCTTTAGTGGATCAAGATAGAGCTCATATTTCTGGAGTGCAAATCGACGGCCTGTCTGGAACAGGGTCTGGGCTGATACTTTTTGCTGATGTAAATGACGCTGTGAAGTACGCTGTTCTCGAAAGCATTAATGTGAAGGGCGATTATAATAAAGTCCTTGAACATGAATGGCGTGCTCATTGTTGATGGGG AGATGTGCTCAATAGATAAGGTTGTGGCTGAGGGTATCAGGGAGTTTGCAGTTGAGCTAAAAAACAAGTCGCGCAGAAATACGATCTCAAACGCATTGGTGAAAGATTCCAGAATTGGTATCGGCTTAGGGCAGGACACGCCTGACGCTTTCGACGCATCTTACAACTCAATAATTAATGGTGTTCTTTTTAATGTTGAGCGAGGCTATGTGATTGGCGATGGC

[0103] VC3:CACCGCTTACCTATCCATTAAGGAGATGGCTCAACTCTCTAAGGAGGTTAAC GATGCTGCTGTAGTACTAATGACTTACTATTTCCGTAAGGTTAAGACACCTAAGTTCGACTTCTTCGATGATGAAGCTATTGCACTGGCGCTGGGTTGGACTGTTCGTAAGACCAAA GCCACTCGCCAGCTTCTGGTAAAGGCTGACTGGTTAAAACGAATTACATTTACCCAGCCAACTACTAAAGCAAAGATTACAGTGCTCTATGTTGGTAAGGAGATGTGT

[0104] VC4:TGAAGCAGGTGAGATTGTTGATTACCGTTATGTAATGAATGACAACACTAAG AATGACATCCTACAACGTGATACATCTTTTGATGATGTAATGGGTATTATGTTCTCTGGTTTAGCTGTTAAGAATGACATTAAAAGAGAGAACAAAGAACTGGTTAAAGTTCTAAAAGATATGTATACCAATACACTTAACAGAACTGAGTTGTAGAGATTTCACCACAATCAACCAATG

[0105] In summary, according to embodiments of the present invention, bacteriophage 12VC501 was isolated and screened from water samples of shrimp ponds in Changtai County, Zhangzhou City, Fujian Province. It exhibits high bactericidal activity against Vibrio cholerae, Vibrio harveyi, and Vibrio parahaemolyticus, and also possesses a broad phage spectrum. It can simultaneously lyse six different species of Vibrio, including 44 strains of Vibrio cholerae, 23 strains of Vibrio harveyi, 16 strains of Vibrio parahaemolyticus, 15 strains of Vibrio alginolyticus, 10 strains of Vibrio cannibalus, and 8 strains of Vibrio vulnificus. This allows for a more effective solution to various bacterial infections in aquaculture.

[0106] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the invention. The illustrative expressions of the above terms in this specification should not be construed as necessarily referring to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. In addition, those skilled in the art can combine and integrate the different embodiments or examples described in this specification.

[0107] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A Vibrio cholerae bacteriophage for preventing and controlling Vibrio diseases in aquatic animals, characterized in that, The phage was deposited at the China Center for Type Culture Collection on November 5, 2021, with accession number CCTCC M 20211375.

2. A microecological preparation, characterized in that, Including the Vibrio cholerae bacteriophage for the prevention and control of Vibrio diseases in aquatic animals as described in claim 1.

3. The microecological preparation as described in claim 2, characterized in that, The titer of the bacteriophage was 5.8 × 10⁻⁶. 11 pfu / mL.

Citation Information

Patent Citations

  • Bacteriophage for preventing and treating prawn vibrio parahaemolyticus disease and expanding culture method thereof

    CN106995803A

  • Wide-lytic-spectrum Vibrio alginolyticus phage, composition thereof, kit and application of kit

    CN110129280A