Construction method and application of sgRNA for knocking out prmt1 gene and prmt1 gene knockout cell line

Abstract

The application belongs to the technical field of genetic engineering, and particularly relates to sgRNA for knocking out PRMT1 gene and a construction method and application of a PRMT1 gene knockout cell line. The application provides sgDNA for knocking out PRMT1 gene based on CRISPR / Cas9 technology. The sgRNA can be specifically targeted to the PRMT1 gene and combined with CRISPR-Cas9 technology to realize complete knockout of the PRMT1 gene in a host cell, obtain a DF-1 cell strain stably knocking out the PRMT1 gene, and significantly improve the interferon induction capacity of the knockout cell strain. Moreover, the knockout cell strain can significantly inhibit the replication of IBDV, provides a powerful tool for carrying out basic research on IBDV, and provides a scientific basis for breeding chickens with knocked-out PRMT1.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the sgRNA of PRMT1 gene knockout and the construction method and application of PRMT1 gene knockout cell lines. Background Technology

[0002] Genome manipulation technology, developed based on genomics and gene information technology, is a cutting-edge technology that allows for precise editing of specific genes or genomic target sites through artificial design. It has become a research hotspot in fields such as biomedicine, agricultural animal breeding, and model organisms. Genome editing technology, which involves the artificial manipulation of specific base insertions, deletions, or substitutions to precisely modify and target the genome, has brought new advancements to various fields of life sciences and is widely used in basic research and clinical treatment. Early gene editing technologies caused significant damage to cell viability and had low insertion efficiency, thus limiting their application. CRISPR-Cas9 gene editing technology, a derivative third-generation gene editing technology, consists of the Cas9 nuclease and specific guide RNA (sgRNA). This technology has a wide range of applications, is highly manipulative, and has broad application prospects.

[0003] CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is a unique immune system evolved by bacteria to eliminate invading viral genes. Using this system, bacteria can remove viral genes from their chromosomes. CRISPR-Cas9 originated from an acquired immune mechanism in bacteria / archaea and was artificially modified and developed. It is a specific targeted genome editing technology mediated by single-stranded guide RNA (sgRNA). An sgRNA targeting a specific genome is artificially designed, transfected into cells, and diffuses freely into the cell nucleus. The Cas9 nuclease, carrying the nuclear insertion sequence, enters the nucleus, binds directionally to the sgRNA-targeted PAM sequence of the genome, and performs efficient cleavage. The resulting genome breaks trigger the cell's inherent homologous recombination repair mechanism and non-homologous end self-repair process, achieving precise editing and modification of specific sites on the genome. Compared to first- and second-generation gene editing technologies, CRISPR-Cas9 gene editing technology can achieve large-scale precise gene editing. It is convenient to use, highly efficient, easy to operate, low in cost, and widely applicable, bringing huge application prospects for targeted genome modification, regulation, and application. Therefore, this technology won the 2021 Nobel Prize in Chemistry and is currently deeply applied in precision medicine, embryo gene editing, and other fields.

[0004] Protein Arginine Methyl Transferase 1 (PRMT1) is a member of the protein arginine methyltransferase family. All members of this family catalyze monomethylarginine modification of substrate proteins, adding a second methyl group to produce an asymmetric dimethylarginine modification. PRMT1 belongs to type I PRMTs and catalyzes asymmetric dimethylarginine modification of substrate proteins. Currently, most arginine methylation sites are believed to conform to RGG, RG, and RXR repeat sequences. PRMT1 has been reported to exert methylase activity to regulate numerous substrates, such as histones, PIAS1, and hnRNPA1, thereby regulating cell signaling pathways, transcriptional regulation, and RNA metabolism. Chicken-derived PRMTs include five members: PRMT1, PRMT3, PRMT4, PRMT5, and PRMT7; PRMT2, PRMT6, PRMT8, and PRMT9 are absent. Although CRISPR-Cas9 gene editing is widely used in mammalian and plant cells, its application in lower organisms and non-mammalian cells has not been widespread. To date, a chicken-derived DF-1 cell line with the PRMT1 gene knocked out has not been constructed.

[0005] Infectious bursal disease virus (IBDV) is the only member of the avian diRNAviridae family. It mainly attacks chicks aged 3-5 weeks, damaging the bursa of Fabricius, the central immune organ, and disrupting the chicks' immune function, leading to weakened immune function, secondary infections, and a significantly increased chick mortality rate. It is commonly known as "chicken AIDS." Basic research on IBDV is crucial for its prevention and control. Therefore, constructing cell lines that inhibit IBDV replication using CRISPR-Cas9 gene editing technology is of great significance for studying the characteristics of IBDV. Summary of the Invention

[0006] The biological functions of the chicken-derived PRMT1 protein, including its role in interferon regulation and viral replication, remain unknown. To address these issues, this invention provides a highly efficient sgRNA (nucleotide sequence: 5'-GGGAATCGGGTCGGATCCAT-3') targeting the PRMT1 gene. This sgRNA specifically targets PRMT1 and mediates CRSIPR-Cas9 technology to completely knock out the PRMT1 gene in DF-1 cells, resulting in a stable PRMT1 knockout DF-1 cell line. This knockout cell line exhibits significantly enhanced interferon induction and significantly inhibits IBDV replication. It can be applied in the fields of regulating interferon levels and inhibiting infectious bursal disease virus replication (e.g., in the form of drugs, compositions, regulators, etc.).

[0007] Another object of the present invention is to provide the use of a reagent for inhibiting PRMT1 gene / protein expression in the preparation of drugs for the prevention or treatment of infectious bursal disease virus infection, said reagent comprising the above-mentioned sgRNA and Cas9 protein mRNA sequences.

[0008] Another objective of this invention is to provide a method for constructing a PRMT1 gene knockout cell line based on CRSIPR technology, comprising the following steps:

[0009] (1) Based on the sgRNA of the above-mentioned knockout of PRMT1 gene, two anti-complementary nucleotide chains were designed as follows: F: 5'-CACCGGGGAATCGGGTCGGATCCAT-3' and R: 5'-AAACATGGATCCGACCCGATTCCCC-3'; the acid chains of the above two anti-complementary nucleotide chains were denatured and annealed to form double strands.

[0010] (2) The double strands obtained in step (1) are ligated with the enzyme-digested Cas9 vector to obtain a recombinant knockout expression vector;

[0011] (3) The recombinant expression vector obtained in step (2) was transfected into chicken fibroblast cell line DF-1 using Exfet2000 transfection reagent. After further culture, puromycin screening and monoclonal screening, PRMT1 gene knockout cell line was obtained.

[0012] Preferably, in step (2) of the above method, the Cas9 vector is the lentiCRISPRv2 vector.

[0013] Preferably, in step (3) of the above method, the DF-1 cells are cells in the logarithmic growth phase.

[0014] Preferably, in step (3) of the above method, the concentration of puromycin in the puromycin screening is 2 μg / mL. More preferably, the puromycin screening operation is as follows: after transfection for 24 h, culture in MEM cell culture medium containing 10% FBS with 2 μg / mL puromycin for 24 h, then replace with 10% FBS containing 2 μg / mL puromycin and continue culturing for 24 h, then replace with 10% FBS containing 2 μg / mL puromycin and continue culturing for 24 h, thereby achieving puromycin screening.

[0015] The beneficial effects of this invention are as follows: This invention provides an sgDNA that targets and knocks out the PRMT1 gene based on CRISPR / Cas9 technology. This sgRNA can specifically target the PRMT1 gene and, combined with CRISPR-Cas9 technology, achieve complete knockout of the PRMT1 gene in host cells, obtaining a stable DF-1 cell line with the PRMT1 gene knocked out. This knockout cell line has significantly improved interferon induction ability and can significantly inhibit IBDV replication, providing a powerful tool for conducting basic research on IBDV and providing a scientific basis for chicken breeding work with PRMT1 knockout. Attached Figure Description

[0016] Figure 1 The image shows the sequencing diagram of PRMT1 sgRNA construction into the lentiCRISPR / Cas9 vector;

[0017] Figure 2 The image shown is a graph illustrating the PRMT1 sgRNA digestion efficiency.

[0018] Figure 3 The image shows the results of Western blotting analysis of PRMT1 protein in PRMT1 gene knockout monoclonal cells.

[0019] Figure 4 The image shown is a sequence of PRMT1 gene sequencing results from the knockout cell line.

[0020] Figure 5 The image shows the growth morphology of PRMT1 knockout cell lines and normal cell lines.

[0021] Figure 6 The diagram shows the proliferation activity of PRMT1 knockout cell lines and normal cell lines.

[0022] Figure 7 The image shows the interferon detection qPCR results of the PRMT1 knockout cell line.

[0023] Figure 8 The figure shown is a qPCR detection result of IBDV replication level in PRMT1 knockout cell lines;

[0024] Figure 9 The figure shown is a Western blotting result of IBDV replication level in PRMT1 knockout cell lines;

[0025] Figure 10 The figure shown is a graph of TCID50 detection results for IBDV replication level in PRMT1 knockout cell lines. Detailed Implementation

[0026] The following will provide a clear and complete description of the concept and technical effects of the present invention in conjunction with the embodiments and accompanying drawings, so as to fully understand the purpose, solution and effects of the present invention.

[0027] Example 1: Construction of chicken-derived PRMT1 gene knockout cell line based on CRISPR / Cas9 technology

[0028] 1. sgRNA design and synthesis

[0029] Download the corresponding nucleotide sequence of the chicken-derived PRMT1 gene (101750306) published by NCBI-Genbank and design primers. The primer sequences are as follows:

[0030] Upstream primer sgRNA-F: 5'-CACCGGGGAATCGGGTCGGATCCAT-3';

[0031] Downstream primer sgRNA-R: 5'-AAACATGGATCCGACCCGATTCCCC-3'.

[0032] 2. Construction of the recombinant gene knockout expression plasmid lentiCRISPRv2-PRMT1 / sgRNA

[0033] (1) Annealing: Mix equal amounts of upstream and downstream primers and anneal them by natural cooling in a boiling water bath.

[0034] (2) Enzyme digestion: Fresh vector lentiCRISPRv2 (plasmid map available at addgene:#52961, https: / / www.addgene.org / ) was extracted and digested with BsmBI restriction endonuclease at 37°C for 2 hours. The digestion system is as follows:

[0035]

[0036] (3) Gel purification: After electrophoresis of the enzyme digestion products on a 1% agarose gel, gel purification was performed using a gel purification kit. The specific steps are as follows:

[0037] (A) After 1% agarose gel electrophoresis, the gel was cut under UV light, and the cut gel pieces were collected in 2.0 mL centrifuge tubes.

[0038] (B) Weigh the gel block, add 200 μL of Buffer A to each 0.1 g gel block, place it in a 55°C water bath for 20 min, and shake it appropriately during the process to accelerate melting until the gel block is completely melted;

[0039] (C) Add an equal volume of Buffer B to (B) and mix thoroughly;

[0040] (D) Transfer the mixed solution from step (C) to a centrifugal column fitted with a sleeve, centrifuge at 10,000 r / min at room temperature for 30 s, discard the substrate waste liquid, centrifuge 3 times until all the mixed solution is completely bound to the centrifugal column.

[0041] (E) Add 500 μL Wash Buffer A to the centrifuge tube of the binding column, centrifuge at 10,000 r / min at room temperature for 30 s, and discard the waste liquid in the collection tube;

[0042] (F) Add 500 μL Wash Buffer B to the centrifuge tube containing the binding column, centrifuge at 10,000 r / min at room temperature for 30 s, and discard the waste liquid;

[0043] (G) Centrifuge the column from step (F) at 10,000 r / min for 2 min, and let it stand at room temperature with the lid off for 2 min.

[0044] (H) Place the centrifuge column into a sterile 1.5 mL centrifuge tube, add 50 μL of elution buffer to the centrifuge column, centrifuge at 10,000 r / min at room temperature for 1 min to obtain the purified DNA solution, and store at -80℃ for later use.

[0045] (4) Ligation: The sgRNA was ligated to the recovered vector using T4 DNA ligase at 4°C for 12 h. The specific reaction volume (10 μL) is as follows:

[0046] 0.5 μL of lentiCRISPRv2 enzyme digestion and recovery vector (50 ng / μL)

[0047] 5 μL of sgRNA annealed double strand

[0048] 1 μL of T4 DNA ligase

[0049] T4 DNA ligase buffer 1μL

[0050] DdH2O 2.5μL

[0051] (5) Transformation: Remove DH5α competent cells from the -80℃ freezer and thaw them on ice. Add the ligation product to the DH5α competent cells, mix well, and place on ice for 10 min. Heat shock the mixture in a 42℃ water bath for 90 s. Remove the mixture and quickly place it on ice for 5 min. Add 1 mL of antibiotic-free LB medium to the mixture and place it on a shaking incubator at 37℃ for 45 min. Centrifuge the mixture in the centrifuge tube at low speed, discard the upper LB medium layer, retain some liquid, resuspend the competent cells at the bottom of the tube with a pipette, and add them to a pre-prepared ampicillin solid LB medium plate for overnight incubation at 37℃. Pick single colonies for shake culture expansion and send for sequencing (e.g., Figure 1 (As shown).

[0052] (6) Plasmid extraction: Select the bacterial culture with correct sequencing results based on the sequencing results returned by the sequencing company, and perform plasmid extraction. The specific steps are as follows:

[0053] (A) Transfer 100 μL of the original bacteria to a 100 mL sterile Erlenmeyer flask, add 20 mL of ampicillin liquid LB medium to the Erlenmeyer flask and incubate overnight;

[0054] (B) Take 10 mL of bacterial culture into a 15 mL centrifuge tube, centrifuge at 1,000 r / min for 5 min at room temperature, and centrifuge all the bacterial culture to the bottom of the tube and discard the supernatant.

[0055] (C) Add 500 μL of Buffer P1 containing RNase A to the centrifuge tube, fully resuspend the cells, and let stand for 5 min;

[0056] (D) Add 500 μL of Buffer P2 to the centrifuge tube, gently invert the centrifuge tube 6 times until the liquid becomes clear and transparent, and let it stand at room temperature for 5 minutes.

[0057] (E) Add 700 μL of Buffer P3 to the centrifuge tube, gently invert the centrifuge tube 8 times until white flocculent matter appears, let it stand at room temperature for 5 min, then centrifuge at room temperature at 12,000 r / min for 10 min until all the flocculent matter settles to the bottom of the tube.

[0058] (F) Take the supernatant from (E) into an adsorption column equipped with a bottom tube, centrifuge at 12,000 r / min for 30 s at room temperature, repeat 3 times until all the supernatant has passed through the adsorption column.

[0059] (G) Add 500 μL of wash buffer to the adsorption column, centrifuge at 12,000 r / min for 30 s at room temperature, discard the waste liquid, and repeat the washing once more.

[0060] (H) Centrifuge the adsorption column at 12,000 r / min at room temperature for 1 min, then open the cap and let it stand at room temperature for 1 min;

[0061] (I) Insert the adsorption column into a new sterile 1.5 mL centrifuge tube, add 100 μL EB (Elution Buffer), and let it stand at room temperature for 1 min;

[0062] (J) The adsorption column was centrifuged at 12,000 r / min for 1 min at room temperature, and the plasmid on the adsorption column was obtained by elution. After the concentration was determined, it was stored at -40℃ for later use.

[0063] (7) Transfection: The lentiCRISPRv2-PRMT1-sgRNA recombinant plasmid was transfected into chicken fibroblasts (DF-1 cells) using the Perfect transfection reagent produced by Nanjing Novizan Biotechnology Co., Ltd. The specific operation steps are as follows:

[0064] (A) DF-1 cells are cultured in six-well cell culture plates until the density reaches about 70%, at which point they can be transfected.

[0065] (B) Discard the original culture medium and add 1.6 mL of fresh MEM culture medium containing 2% serum;

[0066] (C) Prepare two sterile EP tubes. Add 10 μL of Exfect transfection reagent to 200 μL of serum-free MEM medium in one tube. At the same time, add 4 μg of recombinant plasmid (1,000 ng / μL) to 200 μL of serum-free MEM medium in the other tube. Let both tubes stand at room temperature for 5 min.

[0067] (D) Mix the two solutions thoroughly and let stand at room temperature for 15 minutes;

[0068] (E) Add the mixed solution to the cells in the 6-well plate and continue culturing for 4 hours;

[0069] (F) After 4 hours, discard the original culture medium and add MEM medium containing 10% serum again for continued culture.

[0070] (8) Screening of puromycin drugs, the specific operation steps are as follows:

[0071] (A) First, culture DF-1 cells that have not been transfected with plasmids in 12-well plates, and then add complete culture medium containing 0.5, 1, 1.5, 2, 2.5, and 3 μg / mL puromycin respectively and continue culturing for 48 h. The lowest puromycin concentration that kills all DF-1 cells within 48 h is 2 μg / mL.

[0072] (B) After culturing the transfected cells for 48 hours, the medium was replaced with a complete medium containing 2 μg / mL puromycin and cultured for another 24 hours. The cell status was observed, and some cells were found to have died. The original medium was discarded, and the medium was replaced with a complete medium containing 2 μg / mL puromycin and cultured for another 24 hours. The cell status was observed, and some cells were found to be surviving. The medium was then replaced with a complete medium without puromycin and cultured for another 24 hours to restore the cell status.

[0073] (9) T7E1 method for identifying PRMT1 sgRNA cleavage efficiency: Since the T7E1 enzyme can specifically recognize the cross structure produced by genome cleavage repair, the T7E1 enzyme digestion method is commonly used to identify the cleavage efficiency of sgRNA. The specific method is as follows:

[0074] (A) Genomic DNA was extracted from normal DF-1 cells and DF-1 cells selected by puromycin using the boiling method. A 430bp identification PCR primer was designed near the PRMT1 cleavage site. The primer sequences are as follows:

[0075] PRMT1F:GACACCATAAGACCCCCCAGAGGAC

[0076] PRMT1R:CCAAATCCTCCCTTTTCACCCCA

[0077] (B) The genomes of normal DF-1 cells and DF-1 cells selected after puromycin screening were amplified separately. The amplification systems are as follows:

[0078] 2*Rapid Fast Green Mix 25μL

[0079] 2 μL DNA template

[0080] PRMT1F 2μL

[0081] PRMT1R 2μL

[0082] ddH2O 19μL

[0083] PCR amplification was performed using a 50 μL system, with the following amplification program: 95℃ for 5 min, 95℃ for 30 s, 56℃ for 30 s, and 72℃ for 20 s; 35 cycles were performed, followed by a final extension at 72℃ for 10 min. After PCR, the results were identified using a 1% agarose gel electrophoresis, and the PCR products were cleaned, recovered, and purified.

[0084] (C) PCR products from normal DF-1 cells and selected DF-1 cells were subjected to T7E1 restriction enzyme digestion for identification. The system is as follows:

[0085] PCR product 200ng

[0086] 10*T7E1 buffer 2μL

[0087] T7E1 1μL

[0088] ddH2O up to 20μL

[0089] The above reaction system was subjected to touch-down PCR digestion at 95℃. After digestion, a portion of the product was analyzed by 1% agarose gel electrophoresis, and the digestion efficiency was assessed by scanning the band grayscale (e.g., ...). Figure 2 (as shown in Table 1).

[0090] Table 1. Statistics on PRMT1 sgRNA digestion efficiency

[0091]

[0092] (10) Monoclonal cells were screened using the limiting dilution method. DF-1 cells screened with puromycin were digested with trypsin containing EDTA. After complete digestion, cells were collected by low-speed centrifugation in MEM cell culture medium containing 10% FBS. The supernatant was discarded, and the cells were resuspended in 2 mL of MEM cell culture medium. 2 μL of the cell suspension was added to one well of a new 6-well plate, and 2 mL of MEM culture medium containing 10% FBS was added. A total of one 6-well plate was seeded. Excess cells were cultured until the density reached approximately 70% for cryopreservation. The diluted 6-well plate cells were cultured, and the MEM culture medium containing 10% FBS was changed every five days. When the cells grew to visible cell islands, each cell island was observed under a microscope and labeled. The cells were then digested with trypsin and pipetteted into 24-well plates for further culture. After confluence, further identification was performed.

[0093] (11) Western blot identification of monoclonal cells: After the cells aspirated from the 24-well plate have grown into a monolayer, they are digested with trypsin, collected with PBS into EP tubes, and centrifuged at low speed to collect the cells. The supernatant is discarded, and the cells are resuspended in a small amount of MEM medium. Half of the cells are left in the original wells for further culture, and the other half are collected. 50 μL of NP40 cell lysis buffer is added, and the cells are lysed at 4°C for 30 min. After centrifugation at high speed for 10 min, the precipitate is discarded, and the supernatant is retained. 20 μL of 4* protein loading buffer is added, and the mixture is thoroughly mixed and boiled in a water bath for 10 min. The prepared protein sample is temporarily stored in a 4°C refrigerator for subsequent WB detection.

[0094] (A) First, prepare a polyacrylamide gel containing 8% separating gel and 5% stacking gel, as follows:

[0095] <![CDATA[H2O]]> 1.21mL 2.6mL 40% Acrylamide 250 μL 1mL Tris8.8 0μL 1.25mL Tris6.8 0.5mL 0μL 10% SDS 20μL 50μL 10% APS 20μL 50μL TEMED 2μL 2μL

[0096] Prepare the lower layer gel according to the above formula, pour the lower layer separating gel first, add isopropanol to the upper layer and press the line, let it stand at room temperature until the lower layer gel solidifies, discard the upper layer isopropanol and wash three times with double distilled water, prepare the upper layer stacking gel and pour it, quickly insert the sample comb, let it stand at room temperature for 1 hour until the upper layer gel solidifies, gently remove the comb and perform subsequent SDA-PAGE experiments;

[0097] (B) Sample loading: Add 2 μL of prestained protein marker to the first well; add normal DF-1 cell protein sample to the second well; add the cell protein sample to be identified to the following wells in sequence;

[0098] (C) Electrophoresis: The electrophoresis equipment used is the Bio-Rad mini vertical electrophoresis system. First, use low voltage (80V) for about 30 minutes for electrophoresis. After the bromophenol blue enters the separating gel, increase the voltage to 120V and continue electrophoresis until the bromophenol blue indicator reaches the bottom of the glass plate. Then stop the electrophoresis.

[0099] (D) Transfer: After electrophoresis, trim off any excess gel and soak the remaining gel in transfer buffer. Prepare two thick transfer filter papers and a nitrocellulose membrane (NC membrane) that is close in size to the original membrane. Soak the NC membrane and transfer filter paper in transfer buffer for a few minutes to fully wet them. Stack the filter paper, NC membrane, gel, and filter paper in the following order from bottom to top, arrange them neatly on the semi-dry transfer apparatus, gently press to remove internal air, close the transfer apparatus lid, and transfer for 35 minutes at a limited voltage of 25V and a constant current of 0.2mA. After the transfer is complete, remove the NC membrane.

[0100] (E) Blocking: Immerse the transferred NC membrane in PBS buffer containing 5% skim milk and let it stand at room temperature for 20 minutes. Then wash it 5 times with PBS buffer for 10 minutes each time.

[0101] (F) Primary antibody incubation: Dilute the PRMT1 antibody 1:1000 according to the instructions and incubate overnight at 4°C with shaking.

[0102] (G) Secondary antibody incubation: On the second day, wash the NC membrane with PBST five times with shaking for 5 minutes each time, dilute the secondary antibody at 1:10,000, incubate at room temperature with shaking for 1 hour, and then wash with PBST five times with shaking for 5 minutes each time.

[0103] (H) Protein imaging and preservation; Western blot results showed that PRMT1 protein was not detected in the C5 clone, indicating that the PRMT1 gene had been completely knocked out (e.g., Figure 3 (As shown).

[0104] (12) PRMT1- / -DF-1 cell gene sequencing: The PRMT1 genome target sequence was amplified using conventional PCR and sequenced to confirm whether the PRMT1 gene has been deleted or inserted, resulting in a frameshift mutation. The specific operation steps are as follows:

[0105] (A) Genomic DNA of PRMT1- / -DF-1 cells was extracted by boiling in water, and specific bands were amplified by conventional PCR. The PCR products were then cleaned and recovered.

[0106] (B) Perform TA cloning ligation on the recovered PCR products. Refer to the TAKARA pMD18T kit instructions for the ligation system and reaction process.

[0107] (C) Transform the ligation product, following the procedure in step (5). The next day, select a single colony for sequencing. Sequencing results show that PRMT1- / -DF-1 has a deletion of 11 bases near the PRMT1 gene target site (e.g., ...). Figure 4 As shown in the figure, this demonstrates that the DF-1 cell line with a stable knockout of the PRMT1 gene was successfully screened.

[0108] (13) Assay of PRMT1- / -DF-1 cell line viability: The morphology of normal DF-1 cells and PRMT1- / -DF-1 cells at different passages was observed under a microscope. The results showed no significant difference in cell morphology between the two (e.g., Figure 5 As shown in the figure), the activity differences between the two cell types at different time points were measured using the CCK8 assay kit. The results showed no significant difference in activity between PRMT1- / -DF-1 cells and normal DF-1 cells (as shown in the figure). Figure 6 (As shown in the image). After continuous passage, the expression of PRMT1 protein in this cell line was detected, and the PRMT1 genome was sequenced. It was found that the PRMT1 gene knockout in this cell line was very stable, and no recovery phenomenon was observed. It is evident that this cell line has great application potential.

[0109] In summary, this invention successfully constructed the PRMT1 gene knockout DF-1 cell line using CRISPR / Cas9 technology, providing a powerful tool for the study of chicken-derived PRMT1 gene and protein function.

[0110] Example 2: Effect of PRMT1 gene knockout DF-1 cell line on MDA5-induced interferon production

[0111] PRMT1 gene knockout DF-1 cell lines and wild-type DF-1 cells were cultured normally and then transferred to 6-well plates. The cells were transfected with the Flag-chMDA5 plasmid. After 48 hours, total RNA was extracted and reverse transcribed. The mRNA level of IFN-β was detected using qPCR. The results showed that compared to normal DF-1 cells, the mRNA level of IFN-β in PRMT1- / -DF-1 cell lines increased approximately 300-fold (e.g., ...). Figure 7 (As shown).

[0112] Example 3: Effect of PRMT1 gene knockout DF-1 cell line on IBDV replication

[0113] PRMT1 gene knockout DF-1 cell lines and wild-type DF-1 cells were passaged normally and then cultured in 6-well plates. When the cell density reached approximately 80%, they were simultaneously infected with 1 MOI of IBDV. Samples were collected at 6 h and 12 h post-infection, and qPCR results were analyzed (e.g., ...). Figure 8As shown in the figure), the IBDV gene copy number in PRMT1- / -DF-1 cells was significantly lower than that in normal DF-1 cells at both 6 h and 12 h, indicating that knocking out the PRMT1 gene inhibited IBDV replication; simultaneously, Western blotting results showed (as shown in the figure) Figure 9 As shown in the figure, in the PRMT1- / -DF-1 cell line, the VP1 / VP2 / VP3 proteins produced by IBDV were significantly lower than those in normal DF-1 cells; TCID 50 The results show (e.g.) Figure 10 As shown in the figure, the replication capacity of IBDV in PRMT1- / -DF-1 cell lines was significantly lower than that in normal DF-1 cells. These results indicate that PRMT1 gene knockout DF-1 cells obtained through gene editing technology can significantly inhibit IBDV replication and possess anti-IBDV replication properties.

[0114] The above description is merely a preferred embodiment of the present invention. The present invention is not limited to the above-described embodiments. Any embodiment that achieves the technical effects of the present invention using the same means should fall within the protection scope of the present invention. Within the protection scope of the present invention, various modifications and variations can be made to the technical solutions and / or implementation methods.

Claims

1. An sgRNA that knocks out the PRMT1 gene, characterized in that, Its nucleotide sequence is: 5'-GGGAATCGGGTCGGATCCAT-3'.

2. The application of reagents that inhibit PRMT1 gene expression in the preparation of drugs for the prevention or treatment of infectious bursal disease virus infection, characterized in that, The reagent comprises the mRNA sequences of the sgRNA and Cas9 protein as described in claim 1.

3. A method for constructing a PRMT1 gene knockout cell line based on CRISPR-Cas9 technology, characterized in that, Includes the following steps: (1) According to the sgRNA of the PRMT1 gene knockout as described in claim 1, two anti-complementary nucleotide chains are designed as follows: F: 5'-CACCGGGGAATCGGGTCGGATCCAT-3' and R: 5'-AAACATGGATCCGACCCGATTCCCC-3'; the above two anti-complementary nucleotide chains are denatured and annealed to form a double strand; (2) The double strands obtained in step (1) are ligated with the enzyme-digested Cas9 vector to obtain a recombinant knockout expression vector; (3) The recombinant expression vector obtained in step (2) was transfected into chicken fibroblast cell line DF-1 cells using a transfection reagent. After further culture, puromycin screening and monoclonal screening, PRMT1 gene knockout cell line was obtained.

4. The method according to claim 3, characterized in that, The Cas9 vector in step (2) is the lentiCRISPRv2 vector.

5. The method according to claim 3, characterized in that, In step (3), DF-1 cells are cells in the logarithmic growth phase.

6. The method according to claim 3, characterized in that, In step (3), the concentration of puromycin in the puromycin screening is 2 μg / mL.

7. The method according to claim 6, characterized in that, In step (3), the puromycin screening operation is as follows: 24 h after transfection, culture the cells in MEM cell culture medium containing 2 μg / mL puromycin and 10% FBS for 24 h, then replace the medium with 10% FBS containing 2 μg / mL puromycin and continue culturing for 24 h, and then replace the medium with 10% FBS containing 2 μg / mL puromycin and continue culturing for 24 h to achieve puromycin screening.

Images