Goat antibody against mouse igg2a and use thereof

Abstract

The application relates to a goat antibody against mouse IgG2a and application thereof. The antibody has at least one of a heavy chain CDR1, a heavy chain CDR2, a heavy chain CDR3, a light chain CDR1, a light chain CDR2 and a light chain CDR3. The antibody can be used for preparing a mouse IgG2a secondary antibody. The goat antibody targeting mouse IgG2a is obtained through phage display technology, the antibody can specifically recognize mouse IgG2a with high affinity, has weak binding with mouse IgG1 and IgG3, has no cross reaction with human IgG, and has important application value.

Description

Technical Field

[0001] This invention relates to a goat antibody against mouse IgG2a and its application, belonging to the field of biotechnology. Technical Background

[0002] Antibodies derived primarily from mice are called primary antibodies. Secondary antibodies are antibodies that bind to primary antibodies, primarily detecting their presence and amplifying the primary antibody signal. Secondary antibodies play a crucial role in experiments such as indirect enzyme-linked immunosorbent assay (ELISA) and immunochromatography. Traditional secondary antibody preparation utilizes the antigenic properties of antibodies (large protein molecules) to immunize a foreign animal, producing immunoglobulins against that antibody from the animal's immune system. This method is time-consuming and cumbersome. Antibody library technology involves cloning all antibody variable region genes of a specific animal in plasmids or phages and expressing them. Clones carrying specific antibody genes are then selected using different antigens or antibodies to obtain the corresponding specific antibodies. Antibody library technology not only mimics the antibody production process of the animal's immune system but also offers many unique advantages. The antibody library technology does not require immunization; theoretically, 10 ～10 The library's capacity could potentially encompass all antibodies. Specific antibodies can be directly screened from non-immune animal antibody libraries using antigens or antibodies, and antibodies targeting the species' own antigens can also be screened. Summary of the Invention

[0003] The main objective of this invention is to provide a goat antibody that is anti-mouse IgG2a and does not cross-convert with human IgG, and to provide the application of this antibody.

[0004] The technical solution of this invention to solve its technical problem is as follows:

[0005] A goat antibody against mouse IgG2a, said antibody being selected from any of the following:

[0006] i) The amino acid sequences of the CDR1, CDR2, and CDR3 regions of the heavy chain variable region of the goat antibody against mouse IgG2a are shown as amino acid sequences at positions 31-35, 50-64, and 98-107 of SEQ ID NO:2, respectively, and the amino acid sequences of the CDR1, CDR2, and CDR3 regions of the light chain variable region are shown as amino acid sequences at positions 24-34, 50-56, and 89-97 of SEQ ID NO:4, respectively;

[0007] Or ii) The amino acid sequences of the CDR1, CDR2 and CDR3 regions of the heavy chain variable region of the goat antibody against mouse IgG2a are shown as amino acid sequences at positions 31-35, 50-64 and 98-113 of SEQ ID NO:6, respectively, and the amino acid sequences of the CDR1, CDR2 and CDR3 regions of the light chain variable region are shown as amino acid sequences at positions 24-39, 55-61 and 94-102 of SEQ ID NO:8, respectively.

[0008] As a preferred embodiment of the present invention, the heavy chain amino acid sequence of the anti-mouse IgG2a goat antibody is shown in SEQ ID NO: 2, and the light chain amino acid sequence is shown in SEQ ID NO: 4; or the heavy chain amino acid sequence is shown in SEQ ID NO: 6, and the light chain amino acid sequence is shown in SEQ ID NO: 8.

[0009] The nucleic acid encoding the goat antibody against mouse IgG2a described in this invention.

[0010] As a preferred embodiment of the present invention, the heavy chain DNA sequence of the anti-mouse IgG2a goat antibody is shown in SEQ ID NO: 1, and the light chain DNA sequence is shown in SEQ ID NO: 3; or the heavy chain DNA sequence is shown in SEQ ID NO: 5, and the light chain DNA sequence is shown in SEQ ID NO: 7.

[0011] Those skilled in the art can readily mutate the nucleotide sequence of the antibody of the present invention using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides that have 75% or more identity with the nucleotide sequence of the antibody of the present invention are derived from and are equivalent to the nucleotide sequence of the present invention.

[0012] As used herein, the term "identity" refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that share 75% or higher identity with the nucleotide sequence encoding the protein shown in SEQ ID No. 1 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences. The aforementioned 75% or higher identity can be 75%, 80%, 85%, 90%, or 95% or higher.

[0013] An expression vector containing the said nucleic acid. Various vectors known in the art can be used. For example, an expression vector can be formed by using a commercially available vector and then operatively linking the nucleotide sequence encoding the antibody of the present invention to an expression regulatory sequence.

[0014] As a preferred embodiment of the present invention, the expression vector is pcDNA3.4.

[0015] A host cell containing the expression vector described in this invention. Host cells that can be used in this invention include prokaryotic cells and eukaryotic cells. Commonly used examples of prokaryotic host cells include *Escherichia coli* and *Bacillus subtilis*. Host cells used for antibody expression include *Escherichia coli*, yeast cells, insect cells, COS cells, and CHO cells.

[0016] As a preferred embodiment of the present invention, the host cell is a eukaryotic cell, specifically a HEK-293 cell or a CHO cell.

[0017] A labeled goat antibody against mouse IgG2a, wherein the antibody is the goat antibody against mouse IgG2a described in this invention, and the label is horseradish peroxidase.

[0018] The application of the goat antibody against mouse IgG2a described in this invention in the preparation of mouse IgG2a secondary antibody.

[0019] The beneficial effects of this invention are as follows:

[0020] This invention utilizes phage display technology to obtain a goat antibody targeting mouse IgG2a. This antibody can specifically recognize mouse IgG2a with high affinity and shows no cross-reactivity with human IgG. This antibody can be used to prepare mouse IgG2a secondary antibodies and has significant application value. Attached Figure Description

[0021] Figure 1 This is a graph showing the enrichment rate of monoclonal antibodies in Example 1.

[0022] Figure 2 This is a schematic diagram of the expression plasmid for the lactation system in Example 2.

[0023] Among them, plasmids Unique1-H and Unique1-L are the heavy chain and light chain plasmids required for expressing the goat antibody Unique1 in the mammalian system, respectively, and plasmids Unique7-H and Unique7-L are the heavy chain and light chain plasmids required for expressing the goat antibody Unique7 in the mammalian system, respectively.

[0024] Figure 3 This is a polyacrylamide gel electrophoresis image of the goat antibody expressed in the mammalian system in Example 2.

[0025] 1: Unique1 mammalian system expressed antibody

[0026] 2: Unique7 mammalian system expressed antibody

[0027] Figure 4This is a graph showing the binding ELISA results of the goat antibody Unique1 expressed in the mammalian system in Example 3.

[0028] Figure 5 This is a graph showing the binding ELISA results of the goat antibody Unique7 expressed in the mammalian system in Example 3.

[0029] Figure 6 This is a graph showing the results of ELISA detection of HRP-labeled mouse IgG2a (Unique1) secondary antibody expressed by the mammalian system in Example 4.

[0030] Among them, the E1isa curves of Mouse IgG1, Mouse IgG3 and Human IgG overlapped.

[0031] Figure 7 This is a graph showing the results of ELISA detection of HRP-labeled mouse IgG2a (Unique7) secondary antibody expressed by the mammalian system in Example 4.

[0032] Among them, the E1isa curves of Mouse IgG1, Mouse IgG3 and Human IgG overlapped. Detailed Implementation

[0033] The present invention will be further described in detail below with reference to the embodiments. However, the present invention is not limited to the examples given. Unless otherwise specified, all methods used are conventional methods, and all reagents and materials used are commercially available unless otherwise specified.

[0034] Example 1: Screening for goat antibodies against mouse IgG2a

[0035] Using Mouse IgG2a as the positive screening antigen and Human IgG as the negative screening antigen, phage display technology was applied to extract antibodies from a goat antibody phage library (library size 1.3 x 10⁻⁶). 10 The screening process identified goat antibodies against mouse IgG2a that did not cross-link with human IgG.

[0036] Human IgG was coated onto ELISA strips using a solid-phase panning method, 100 μL per well, and incubated overnight at 4°C. After washing three times with PBST, 200 μL of casein was added to each well, and the strips were blocked at 37°C for 2 hours. Following three washes with PBST, a phage display library (approximately 1 x 10⁻⁶ cells / well) was added. 12CFU), incubate at 37°C for 1 hour, collect unbound phages, and repeat negative screening three times to remove phages bound to Human IgG. Add the negatively screened phages to blocked ELISA strips coated with Mouse IgG2a and incubate at 37°C for 1 hour. Aspirate unbound phages and wash 10 times with PBST. Add 100 μL of glycine-hydrochloric acid solution to each well, react at 37°C for 7 minutes, gently pipette the wells to elute the adsorbed phages, and then add Tris-HCl solution to neutralize. Infect logarithmically growing TG1 cells with the eluted phages, amplify and recover the phages for the next round of panning.

[0037] After three rounds of panning, specific enrichment was verified using Phage-ELISA. Mouse IgG2a was coated onto ELISA strips and incubated overnight at 4°C. After washing three times with PBST, the strips were blocked with 3% casein at 37°C for 2 hours. After washing five times with PBST, the phage display library selected from the three rounds of panning was added, with approximately 1x10⁻⁶ cells per well. 12 CFU, serially diluted 4-fold, with blank at the end of each well, incubated at 37°C for 1 hour. After washing 5 times with PBST, add HRP-labeled mouse anti-M13 secondary antibody and incubate at 37°C for 1 hour. After washing 5 times with PBST, add TMB chromogenic buffer and incubate at room temperature in the dark for 5-10 minutes. Finally, stop the chromogenic process with 2M sulfuric acid. Read the absorbance at 450 nm using a microplate reader and plot the Phage-ELISA binding curve.

[0038] ELISA results showed that, with helper phages as a negative control, the affinity of the phage population for mouse IgG2a increased sequentially after three rounds of enrichment, while the affinity of the phage population for Human IgG decreased sequentially after three rounds of enrichment.

[0039] Antigen binding analysis was performed on the third round of enriched phage monoclonal samples. The specific procedure was as follows:

[0040] TG1 cells were infected with the third-round enriched phage library, and 792 single clones were randomly selected, amplified, and recovered. Mouse IgG2a was coated onto ELISA strips and incubated overnight at 4°C. After washing three times with PBST, the strips were blocked with 3% casein at 37°C for 2 hours. The 792 amplified single-clone phages were incubated at a 1:1 ratio with PBST solution containing 3% casein at room temperature for 1 hour. The incubated phages were then added to the blocked ELISA plate and incubated at 37°C for 1 hour. After washing five times with PBST, HRP-labeled mouse anti-M13 secondary antibody was added, and the plate was incubated at 37°C for 1 hour. After washing five times with PBST, TMB was added for color development at room temperature in the dark for 5-10 minutes. Finally, the color development was stopped with 2M sulfuric acid. The absorbance was read at 450 nm using an ELISA reader. Clones with absorbance values ​​more than twice that of the negative control (helper phage) were considered positive. The binding ability of 792 monoclonal phages to Mouse IgG2a and Human IgG was analyzed. Among the 792 monoclonal phages, 25 clones bound to Mouse IgG2a but not to Human IgG.

[0041] Sequencing analysis of these 25 positive clones yielded 7 unique sequences, among which Unique1 and Unique7 were dominant enriched clones (e.g., ...). Figure 1 (As shown).

[0042] The antibody heavy chain DNA sequence of Unique1 is SEQ ID NO.1, and the amino acid sequence is SEQ ID NO.2.

[0043] In the amino acid sequence, amino acid residues 31-35 (i.e., NYGVG) are the heavy chain CDR1, amino acid residues 50-64 (i.e., TIRRGGGTVYNPALQ) are the heavy chain CDR2, and amino acid residues 98-107 (i.e., LRVDWFSIDA) are the heavy chain CDR3.

[0044] The antibody light chain DNA sequence of Unique1 is SEQ ID NO.3, and the amino acid sequence is SEQ ID NO.4.

[0045] In the amino acid sequence, amino acid residues 24-34 (i.e., RTSQSVRNYLN) are the heavy chain CDR1, amino acid residues 50-56 (i.e., YATRLYT) are the heavy chain CDR2, and amino acid residues 89-97 (i.e., LQDYSIPLA) are the heavy chain CDR3.

[0046] The antibody heavy chain DNA sequence of Unique7 is SEQ ID NO.5, and the amino acid sequence is SEQ ID NO.6.

[0047] In the amino acid sequence, amino acid residues 31-35 (i.e., DYGVG) are the heavy chain CDR1, amino acid residues 50-64 (i.e., VIWSSGNTDYKSALK) are the heavy chain CDR2, and amino acid residues 98-113 (i.e., ISGWDYGSGSGYYINR) are the heavy chain CDR3.

[0048] The antibody light chain DNA sequence of Unique7 is SEQ ID NO.7, and the amino acid sequence is SEQ ID NO.8.

[0049] In the amino acid sequence, amino acid residues 24-39 (i.e., KSSQSLVHSDGKTYLN) are the heavy chain CDR1, amino acid residues 55-61 (i.e., EVSKRYS) are the heavy chain CDR2, and amino acid residues 94-102 (i.e., FQGTELPYA) are the heavy chain CDR3.

[0050] Example 2: Expression and purification of goat antibody against mouse IgG2a in a mammalian system

[0051] Using the positive clones Unique1 and Unique7 obtained in Example 1 as templates, polymerase chain reaction (PCR) was used to amplify the heavy chain variable region DNA fragment and the light chain variable region DNA fragment in large quantities. The upstream and downstream primer sequences for amplifying the Unique1 heavy chain variable region DNA fragment were Unique1-HF: GTCCTCCTGACTGGGGTGAGGGCCCAGGTGAGACTGCAGGAAAGCGGC and Unique1-HR: GACCGATGGGCCCTTGGTGCTAGCGGAGGACACTGTCACCAGCAGGCC. The upstream and downstream primer sequences for amplifying the Unique1 light chain variable region DNA fragment were Unique1-LF: GTCCTCCTGACTGGGGTGAGGGCCGACATTCAGGTGACCCAGAGCCCC and Unique1-LR: GACAGAGTGGTGC The primer sequences for amplifying the Unique7 heavy chain variable region DNA fragment are: Unique7-HF: GTCCTCCTGACTGGGGTGAGGGCCCAGGTGCAGCTGCAGGAGTCGGGA and Unique7-HR: GACCGATGGGCCCTTGGTGCTAGCTGAGGAGACTGTGACCAGGAGCCC. The primer sequences for amplifying the Unique7 light chain variable region DNA fragment are: Unique7-LF: GTCCTCCTGACTGGGGTGAGGGCCGATGTTGTGCTGACCCAAACTCCA and Unique7-LR: GACAGAGTGGTGCAGCCACCGTACGTTTGATCTCCACTCTGGTCCCACC. Using recombination technology, the heavy chain and light chain variable region DNA fragments amplified from the positive clone Unique1 were recombined into PCDNA3.4, with HindIII / BamHI restriction sites. Figure 2 Medium plasmids Unique1-H and Unique1-L were used to recombinantly insert the heavy chain variable region DNA fragment and the light chain variable region DNA fragment amplified from the positive clone Unique7 into PCDNA3.4. The restriction enzyme sites were HindIII / BamHI. Figure 2 Medium plasmids Unique7-H and Unique7-L were used. The successfully constructed recombinant vectors were transfected into HEK-293 cells using liposome transfection. Logarithmically growing HEK-293 cells were seeded into 6-well plates at a cell density of 1.5 × 10⁻⁶ cells / well. 6Cells were cultured at 37°C in a CO2 incubator using a microplate shaker at 1-3 hours. Transfection was performed after 1-3 hours. A liposome-carrier mixture was added to the cell wells, and cultured for 2, 4, and 6 days with top-up feeding. Samples were collected and purified on day 7. The column was equilibrated with 20 mL of 1xPBS at a flow rate of 1 mL / min, and the sample was loaded at a flow rate of 1 mL / min. The cells were washed with 20 mL of 1xPBS at a flow rate of 1 mL / min, followed by elution with citrate buffer (pH 3.4) at a flow rate of 1 mL / min. Samples were collected in aliquots of approximately 500 μL each, for a total of 10 tubes. The absorbance at 280 nm was read using a NanoDrop instrument. High-concentration protein was transferred to a dialysis bag and dialyzed in a beaker containing 1xPBS. The purified antibody was collected, and the SDS-PAGE results under reducing conditions are shown below. Figure 3 .

[0052] Example 3: Binding of goat antibodies expressed in the mammalian system to ELSIA

[0053] The goat antibodies expressed in the mammalian system were validated using ELISA. The goat antibodies expressing anti-mouse IgG2a in the mammalian system from Example 2 were diluted and coated onto ELISA strips, incubated overnight at 4°C, and blocked with 3% casein at 37°C for 1 hour. Biotin-labeled Mouse IgG1, Mouse IgG2a, and Mouse IgG3 were diluted as the initial concentration, serially diluted 4-fold, with the last well being blank. The plates were incubated at 37°C for 1 hour, washed 5 times with PBST, and then dried. Secondary antibody was prepared with SA-HRP, and the plates were incubated at 37°C for 1 hour, washed 5 times with PBST, and then dried. 100 μL of TMB was added to each well, and the reaction was carried out at room temperature in the dark for 5-10 minutes. The color development was stopped with 2M sulfuric acid, and the absorbance was read at 450 nm using a microplate reader.

[0054] The results are as follows Figure 4 , Figure 5 As shown, the goat antibodies Unique1 and Unique7 expressed by the mammalian system both showed high affinity binding to Mouse IgG2a, weak binding to Mouse IgG1 and Mouse IgG3, and no binding to Human IgG.

[0055] Example 4: Preparation of HRP-labeled mouse IgG2a secondary antibody using anti-mouse IgG2a goat antibody expressed in the mammalian system.

[0056] The anti-mouse IgG2a goat antibody expressed in the lactating system was labeled according to the instructions of the antibody-HRP labeling kit (manufacturer: Guangzhou Huayin Pharmaceutical Technology Co., Ltd.). Specifically, the kit was removed from the refrigerator 30 minutes before the experiment and allowed to equilibrate to room temperature (18-25℃). Prepare 1500 mL each of CB (50 mM carbonate buffer, pH 9.6, 25℃) and PBS (10 mM phosphate, 0.9% NaCl buffer, pH 7.2, 25℃). Dialyze the 5 mg / mL solution of the anti-mouse IgG2a goat antibody expressed in the lactating system to 50 mM CB (pH 9.6) at 4℃ overnight, changing the medium 2-3 times. Under light-protected conditions, add 0.4 mL of ultrapure water to an HRP tube and mix thoroughly. Add 1 mL of ultrapure water to a sodium periodate (NaIO3) tube and mix thoroughly. Add 45 μL of the dissolved NaIO3 solution to the dissolved HRP solution while mixing, and incubate in the dark at room temperature for 20 min. Add 40 μL of ethylene glycol to the above solution, mix thoroughly, and incubate in the dark at room temperature for 30 min. Add the oxidized HRP solution to the mammalian system-expressed anti-mouse IgG2a goat antibody solution, mix thoroughly, and dialyze for crosslinking at room temperature for 2.5 hours. The crosslinking dialysate is 50 mM CB (pH 9.6) buffer. Add 0.5 mL of ultrapure water to a sodium borohydride (NaBH4) tube and mix by inverting several times. Remove the crosslinked antibody-HRP solution from the dialysis bag and place it in a brown glass bottle. Add 80 μL of NaBH4 solution and incubate at 4°C in the dark for 2 hours, gently shaking every 30 minutes. Place the reduced antibody-HRP solution in 10 mM PBS (pH 7.2) and dialyze overnight (or more than 18 hours) at 4°C. Change the medium 3-4 times, with the first medium change occurring at 2-hour intervals. Harvest the labeled antibody-HRP solution for later use (an equal amount of glycerol or other protein protectant can be added).

[0057] Coat microplates with Mouse IgG1, Mouse IgG2a, Mouse IgG3, and Human-IgG, respectively. The first well contains 2.5 μg / mL, serially diluted fourfold, with the last well blank. Incubate overnight at 4°C. The next day, wash 3-5 times with PBST, blot dry, add 200 μL of 3% casein to each well, block at 37°C for 1 hour, wash 3-5 times with PBST, blot dry, add 100 μL of HRP-labeled goat antibody (1 mg / mL, 1:2000 dilution) to each well, incubate at 37°C for 1 hour, wash 3-5 times with PBST, blot dry, add 100 μL of TMB to each well, incubate at 37°C in the dark for 5-10 minutes, and finally add 50 μL of 2M sulfuric acid to each well to stop the color development. Read the absorbance at 450 nm.

[0058] The results are as follows Figure 6 and Figure 7As shown, the HRP-labeled anti-mouse IgG2a goat antibody expressed by the mammalian system binds to Mouse IgG2a but not to Mouse IgG1, Mouse IgG3, or Human IgG, and can be used as a secondary antibody against mouse IgG2a.

Claims

1. A goat antibody against mouse IgG2a, characterized in that, The antibody is selected from any of the following: i) The amino acid sequences of the CDR1, CDR2 and CDR3 regions of the heavy chain variable region of the goat antibody against mouse IgG2a are shown as amino acid sequences at positions 31-35, 50-64 and 98-107 of SEQ ID NO:2, respectively, and the amino acid sequences of the CDR1, CDR2 and CDR3 regions of the light chain variable region are shown as amino acid sequences at positions 24-34, 50-56 and 89-97 of SEQ ID NO:4, respectively; Or ii) The amino acid sequences of the CDR1, CDR2 and CDR3 regions of the heavy chain variable region of the goat antibody against mouse IgG2a are shown as amino acid sequences at positions 31-35, 50-64 and 98-113 of SEQ ID NO:6, respectively, and the amino acid sequences of the CDR1, CDR2 and CDR3 regions of the light chain variable region are shown as amino acid sequences at positions 24-39, 55-61 and 94-102 of SEQ ID NO:8, respectively.

2. The goat antibody against mouse IgG2a according to claim 1, characterized in that, The amino acid sequence of the heavy chain variable region of the goat antibody against mouse IgG2a is shown in SEQ ID NO: 2, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO: 4; or the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO: 6, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO:

8.

3. The nucleic acid encoding the goat antibody against mouse IgG2a as described in claim 1 or 2.

4. The nucleic acid according to claim 3, characterized in that, The heavy chain DNA sequence of the goat antibody against mouse IgG2a is shown in SEQ ID NO: 1, and the light chain DNA sequence is shown in SEQ ID NO: 3; or the heavy chain DNA sequence is shown in SEQ ID NO: 5, and the light chain DNA sequence is shown in SEQ ID NO:

7.

5. An expression vector containing the nucleic acid of claim 3 or 4.

6. The carrier according to claim 5, characterized in that... The expression vector was pcDNA3.

4.

7. A host cell containing the expression vector of claim 6.

8. The host cell according to claim 7, characterized in that, The host cells for expression are 293 cells or CHO cells.

9. A labeled goat antibody against mouse IgG2a, characterized in that, The antibody is the goat antibody against mouse IgG2a as described in claim 1 or 2, and the label is horseradish peroxidase.

10. The use of the goat antibody against mouse IgG2a as described in claim 1 or 2 in the preparation of a labeled mouse IgG2a secondary antibody reagent.

Images