A method for increasing 1,3-propanediol production using a glycerol dehydratase gene that is resistant to oxygen and glycerol

CN115772530BActive Publication Date: 2026-09-04JIANGSU QINGDA ZHIXING BIOTECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202111049855.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-09-08
Publication Date
2026-09-04
Estimated Expiration
2041-09-08

AI Technical Summary

Technical Problem

氧的存在也会显著降低甘油脱水酶的酶活

Benefits of technology

[0023](1)本发明的过表达甘油脱水酶基因dhaB1B2的耐甘油性和耐氧性强,甘油及氧对该甘油脱水酶酶活的抑制作用远远低于目前已知的其它包含三个亚基的B12-依赖型甘油脱水酶;

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The application discloses a glycerol dehydratase gene with overexpression, and the gene with overexpression is derived from Vibrio denitrificans, and comprises two subunits, namely, an alpha subunit and a beta subunit. The nucleotide sequence of the alpha subunit contains a nucleotide sequence as shown in SEQ ID NO. 1 or a nucleotide sequence shown in SEQ ID NO. 1 with substitution, deletion and / or addition of one or more nucleotides. The nucleotide sequence of the beta subunit contains a nucleotide sequence as shown in SEQ ID NO. 2 or a nucleotide sequence shown in SEQ ID NO. 2 with substitution, deletion and / or addition of one or more nucleotides. The application further discloses a glycerol dehydratase gene with overexpression, a biological material and application. The glycerol dehydratase gene with overexpression has strong glycerol tolerance and oxygen tolerance, and the inhibition of glycerol and oxygen on the enzyme activity of the glycerol dehydratase is far lower than that of other B12-dependent glycerol dehydratases with three subunits known at present.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and bio-fermentation, and specifically to a method for increasing the yield of 1,3-propanediol using a glycerol dehydrating enzyme gene that is tolerant to oxygen and glycerol. Background Technology

[0002] Glyceryl dehydrating enzymes are a class of enzymes that specifically catalyze the dehydration of glycerol or 1,2-propanediol to produce 3-hydroxypropanal or propanal. They are also the first key enzymes in the synthesis of 1,3-propanediol and 3-hydroxypropionic acid from glycerol. Glycerol is first converted to 3-hydroxypropanal by glyceryl dehydrating enzymes. 3-hydroxypropanal is then reduced to 1,3-propanediol by alcohol dehydrogenases, or oxidized to 3-hydroxypropionic acid by aldehyde dehydrogenases. 1,3-Propanediol is an important diol, mainly used as a monomer in the polymerization of terephthalic acid to produce the novel polyester material poly(propylene terephthalate) (PTT). 3-Hydroxypropionic acid is an important platform compound used in the production of acrylic acid, malonic acid, 1,3-propanediol, acrylamide, etc.

[0003] Currently known glycerol dehydratases mainly fall into two categories: coenzyme B12-dependent glycerol dehydratases and non-coenzyme B12-dependent glycerol dehydratases. Non-coenzyme B12-dependent glycerol dehydratases are extremely sensitive to oxygen; even small amounts of oxygen can inactivate them, thus limiting their widespread application. Coenzyme B12-dependent glycerol dehydratases are found in bacteria such as *Klebsiella pneumoniae*, *Citrobacter freundii*, and *Salmonella typhimurium*. All known coenzyme B12-dependent glycerol dehydratases consist of three subunits: a large α subunit, a medium β subunit, and a small γ subunit, forming an α²β²γ² complex. This type of coenzyme B12-dependent glycerol dehydratase is inhibited by both glycerol and oxygen. Glycerol exhibits a self-inhibitory effect on glycerol dehydratases, rapidly inactivating them. The presence of oxygen also significantly reduces the enzyme activity of glycerol dehydratases. In microaerobic and aerobic fermentation processes, the inhibition of glycerol dehydrating enzyme activity by glycerol and oxygen is one of the key factors limiting the high yield of 1,3-propanediol or 3-hydroxypropionic acid. Improving the tolerance of glycerol dehydrating enzymes to glycerol and oxygen, and thus increasing the yield of 1,3-propanediol or 3-hydroxypropionic acid, is a problem urgently needing to be solved in this field. Summary of the Invention

[0004] To overcome the above-mentioned technical problems, this invention discloses an overexpression of a glycerol dehydratase gene, its encoded protein, and a biological material; it also discloses an application of the overexpression of the glycerol dehydratase gene, its encoded protein, or the biological material.

[0005] The technical solution adopted by the present invention to achieve the above objectives is as follows:

[0006] A B12-dependent overexpression of a glycerol dehydratase gene dhaB1B2, wherein the overexpression of the glycerol dehydratase gene dhaB1B2 is derived from Vibrio diazotrophicus, and the gene includes only two subunits, namely an α subunit and a β subunit;

[0007] The nucleotide sequence of the α subunit contains the nucleotide sequence shown in SEQ ID NO.1 or the nucleotide sequence shown in SEQ ID NO.1 with one or more nucleotides substituted, deleted and / or added;

[0008] The nucleotide sequence of the β subunit contains the nucleotide sequence shown in SEQ ID NO.2 or the nucleotide sequence shown in SEQ ID NO.2 with one or more nucleotides substituted, deleted and / or added.

[0009] The B12-dependent overexpression of the glycerol dehydratase gene dhaB1B2 described above, wherein the nucleotide sequence of the overexpression of the glycerol dehydratase gene dhaB1B2 is shown in SEQ ID NO.12, and the gene includes only two subunits, namely the α subunit and the β subunit.

[0010] A protein encoded by a B12-dependent overexpression glycerol dehydratase gene dhaB1B2, wherein the encoded protein is encoded by the aforementioned B12-dependent overexpression glycerol dehydratase gene dhaB1B2;

[0011] The amino acid sequence of the protein encoded by the α subunit contains the amino acid sequence shown in SEQ ID NO. 10 or the amino acid sequence shown in SEQ ID NO. 10 with one or more amino acids substituted, deleted and / or added;

[0012] The amino acid sequence of the protein encoded by the β subunit contains the amino acid sequence shown in SEQ ID NO. 11 or the amino acid sequence shown in SEQ ID NO. 11 with one or more amino acids substituted, deleted and / or added.

[0013] A biological material containing the B12-dependent overexpression of the glycerol dehydratase gene dhaB1B2, wherein the biological material comprises the aforementioned B12-dependent overexpression of the glycerol dehydratase gene dhaB1B2, and the biological material is a vector, recombinant bacteria, cell line, or expression cassette.

[0014] An application of the B12-dependent overexpression of the glycerol dehydratase gene dhaB1B2 and its encoded protein in catalytic glycerol dehydration, wherein the overexpressed glycerol dehydratase gene is the aforementioned B12-dependent overexpressed glycerol dehydratase gene dhaB1B2, and the overexpressed glycerol dehydratase gene encoded protein is the aforementioned B12-dependent overexpressed glycerol dehydratase gene dhaB1B2 encoded protein.

[0015] An application of a biomaterial containing a B12-dependent overexpression of the glycerol dehydratase gene dhaB1B2 in catalytic glycerol dehydration, wherein the biomaterial is the aforementioned biomaterial containing the B12-dependent overexpression of the glycerol dehydratase gene dhaB1B2.

[0016] An application of B12-dependent overexpression of the glycerol dehydratase gene dhaB1B2 and its encoded protein in increasing the yield of 1,3-propanediol, wherein the overexpressed glycerol dehydratase gene is the aforementioned B12-dependent overexpressed glycerol dehydratase gene dhaB1B2, and the overexpressed glycerol dehydratase gene encoded protein is the aforementioned B12-dependent overexpressed glycerol dehydratase gene dhaB1B2 encoded protein.

[0017] An application of a biomaterial containing the B12-dependent overexpression of the glycerol dehydratase gene dhaB1B2 in increasing the yield of 1,3-propanediol, wherein the biomaterial is the aforementioned biomaterial containing the B12-dependent overexpression of the glycerol dehydratase gene dhaB1B2.

[0018] Specifically, in the application of increasing 1,3-propanediol production, the overexpression of the glycerol dehydratase gene is achieved by overexpressing the glycerol dehydratase gene dhaB1B2 in a recombinant bacterium, which is Klebsiella pneumoniae, Citrobacter freundii, Salmonella typhimurium, or Escherichia coli.

[0019] An application of B12-dependent overexpression of the glycerol dehydratase gene dhaB1B2 and its encoded protein in the preparation of 1,3-propanediol, wherein the overexpressed glycerol dehydratase gene is the aforementioned B12-dependent overexpressed glycerol dehydratase gene dhaB1B2, and the overexpressed glycerol dehydratase gene encoded protein is the aforementioned B12-dependent overexpressed glycerol dehydratase gene dhaB1B2 encoded protein.

[0020] An application of glycerol tolerance in biofermentation using B12-dependent overexpression of the glycerol dehydratase gene dhaB1B2 and its encoded protein, wherein the overexpressed glycerol dehydratase gene is the aforementioned B12-dependent overexpressed glycerol dehydratase gene dhaB1B2, and the overexpressed glycerol dehydratase gene encoded protein is the aforementioned B12-dependent overexpressed glycerol dehydratase gene dhaB1B2 encoded protein.

[0021] An application of the B12-dependent overexpression of the glycerol dehydratase gene dhaB1B2 in oxygen tolerance during bio-fermentation, wherein the overexpressed glycerol dehydratase gene is the aforementioned B12-dependent overexpression of the glycerol dehydratase gene dhaB1B2.

[0022] The beneficial effects of this invention are as follows:

[0023] (1) The overexpression of the glycerol dehydratase gene dhaB1B2 in this invention has strong glycerol and oxygen resistance. The inhibitory effect of glycerol and oxygen on the activity of this glycerol dehydratase is much lower than that of other known B12-dependent glycerol dehydratases containing three subunits.

[0024] (2) The overexpression of the glycerol dehydratase gene in this invention has high catalytic activity. Overexpression of the glycerol dehydratase gene in recombinant bacteria can greatly increase the yield of 1,3-propanediol. Detailed Implementation

[0025] The following embodiments are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention.

[0026] Unless otherwise specified, the chemical reagents used in the examples are all commercially available conventional reagents, and the technical means used in the examples are conventional means well known to those skilled in the art.

[0027] Example 1: Expression of the glycerol dehydratase gene dhaB1B2 derived from Vibrio diazotrophicus and verification of its catalytic performance.

[0028] Using the genome of *Vibrio diazotrophicus* as a template, PCR was performed using primers dhaB-F (AAGCTTGTCGACGGAGCTCGAATTCTCAGAAGCAGGGTGGAAT) and dhaB-R (CTGGTGCCGCGCGGCAGCCATATGatgACGCCGAAACCAGTAT) to obtain the approximately 3.6 kb dhaB1B2 gene, and the PCR product was purified. The dhaB1B2 gene contains only two subunits, an α subunit and a β subunit. The dhaB1 gene is the α subunit, and its nucleotide sequence is shown in SEQ ID NO. 1. The dhaB2 gene is the β subunit, and its nucleotide sequence is shown in SEQ ID NO. 2.

[0029] Using the genome of Klebsiella pneumoniae HR526 as a template, PCR was performed using primers gld-F (AAGCTTGTCGACGGAGCTCGAATTCTTAGCTTCCTTTACGCAGCTTATGC) and gld-R (CTGGTGCCGCGCGGCAGCCATATGatgAAAAGATCAAAACGATTTGCAGTACTGG) to obtain the gldABC gene of approximately 2.7 kb, and the PCR product was purified.

[0030] The expression plasmid pET-28a was double-digested with NdeI and EcoRI. Then, the dhaB1B2 and gldABC fragments were ligated into pET-28a using the Gibson Assembly kit (NEB), resulting in recombinant plasmids named pET-dhaB1B2 and pET-gldABC, respectively. These two plasmids were then chemically transformed into *E. coli* BL21(DE3). Recombinant bacteria were obtained by screening on LB agar plates containing 50 mg / L kanamycin and named BL21 / pET-dhaB1B2 and BL21 / pET-gldABC, respectively.

[0031] BL21 / pET-dhaB1B2 and BL21 / pET-gldABC were cultured in LB liquid medium containing 50 mg / L kanamycin until the OD600 reached 0.6 (37°C, 150 rpm). 0.5 mM IPTG was added, and the culture was continued for 12 h to induce protein expression. The bacterial cells were centrifuged and washed twice with 100 ml of 100 mM Tris-HCl (pH 8.0). The bacterial cells were then resuspended in 5 ml of 100 mM HEPES-KOH buffer (pH 8.2, containing 2 mM DTT). The resuspension was sonicated and centrifuged to obtain the supernatant (12000 rpm, 30 min). The glycerol dehydratase was purified using a HisTrap (GE) protein purification kit.

[0032] Enzyme kinetics were analyzed using the purified glycerol dehydratase. The glycerol dehydratase was detected using the MBTH-aldehyde method. The reaction system (1 mL) included: 100 mM HEPES-KOH (pH 8.2), 20 μM coenzyme B12, 10 mM glycerol, 0.05 M KCl, and an appropriate amount of enzyme. After reacting at 37℃ for a certain time, 1 mL of 0.1 M potassium citrate (pH 3) was added to terminate the reaction, followed by the addition of 0.5 mL of 0.1% MBTH. After incubation at 37℃ for 15 min, the absorbance at 305 nm was measured. To detect the inhibitory effect of glycerol on glycerol dehydratase, the initial enzyme activity (first 3 minutes) and the average enzyme activity after 40 minutes were measured. To detect the inhibitory effect of oxygen on glycerol dehydratase, the purified glycerol dehydratase was exposed to air for two hours before its activity was measured. The experimental results are shown in Table 1.

[0033] Table 1. Comparison of enzyme activities of glycerol dehydrating enzymes from different sources (unit: U / mg)

[0034] Chongqiu arc fungus 38.2 29.2 27.5 Bacillus leucocephalus pneumoniae 28.4 5.1 6.8

[0035] As shown in Table 1, the glycerol dehydratase (dhaB1B2) derived from *Vibrio diazotrophicus* exhibits a high specific activity, reaching 38.2 U / mg (initial activity), which is greater than the specific activity (28.4 U / mg) of the glycerol dehydratase (gldABC) derived from *Klebsiella pneumoniae*. Glycerol significantly inhibits the glycerol dehydratase (gldABC) of *Klebsiella pneumoniae*, with its average activity at 40 minutes being 82% lower than that at 3 minutes. In contrast, the average activity of the glycerol dehydratase from *Vibrio diazotrophicus* at 40 minutes was only 24% lower than that at 3 minutes, indicating that it has a higher tolerance to glycerol. Under aerobic conditions, the activity of the glycerol dehydratase from *Klebsiella pneumoniae* decreased by 76%, while the activity of the glycerol dehydratase from *Rhizobium loureirii* decreased by only 28%, indicating that the glycerol dehydratase from *Vibrio diazotrophicus* has higher oxygen tolerance.

[0036] Example 2: Overexpression of a glycerol dehydratase gene derived from Vibrio diazotrophus in Klebsiella pneumoniae increases the yield of 1,3-propanediol.

[0037] The pET-dhaB1B2 and pET-gldABC from Example 1 were double-digested with NdeI and EcoRI, respectively, and then ligated into plasmid pEC-K18 (purchased from Addgene). The resulting plasmids were named pEC-dhaB1B2 and pEC-gldABC. pEC-dhaB1B2 and pEC-gldABC were electroporated into Klebsiella pneumoniae HR526 (electroplation conditions: 1.8 kV, 1 mm electroporation cuvette), and recombinant bacteria were screened on LB agar plates containing 50 mg / L kanamycin to obtain the recombinant bacteria, named Kp / pEC-dhaB1B2 and Kp / pEC-gldABC, respectively.

[0038] Wild-type Klebsiella pneumoniae HR526 and two recombinant strains were cultured in fermentation medium for 48 hours (37℃, 150 rpm), and the yield of 1,3-propanediol was determined. The fermentation medium consisted of (g / L): glycerol 30, (NH4)2SO4 4.0, K2HPO4 0.85, MgSO4 0.2, FeSO4 0.005, yeast extract 1.5, kanamycin 0.05, and trace elements 1 ml. The trace elements consisted of (mg / L): MnSO4·4H2O 100, CoCl2·6H2O 200, ZnCl2 70, NaMoO4·2H2O 35, H2BO3 60, CuSO4·5H2O 29, NiCl2·6H2O 25, and concentrated hydrochloric acid 0.9 mL. The fermentation results are as follows: the yield of 1,3-propanediol from wild-type Klebsiella pneumoniae HR526 was 12.4 g / L, from recombinant strain Kp / pEC-gldABC was 12.1 g / L, and from recombinant strain Kp / pEC-dhaB1B2 was 16.2 g / L. This indicates that overexpression of the glycerol dehydratase derived from *Vibrio diazotrophus* can significantly increase the yield of 1,3-propanediol. This glycerol dehydratase from *Vibrio diazotrophus* contains only two subunits, a large α subunit and a small β subunit. The nucleotide sequence of the α subunit is shown in SEQ ID NO. 1, and the nucleotide sequence of the β subunit is shown in SEQ ID NO. 2.

[0039] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any person skilled in the art can make many possible variations and modifications to the technical solution of the present invention, or modify it into equivalent embodiments, without departing from the scope of the present invention, using the disclosed technical means and content. Therefore, all equivalent changes made based on the shape, structure, and principle of the present invention without departing from the scope of the present invention should be covered within the protection scope of the present invention. sequence list <110> Jiangsu Tsinghua Zhixing Biotechnology Co., Ltd. <120> A method for increasing 1,3-propanediol production using a glycerol dehydratase gene tolerant to oxygen and glycerol. <160> 11 <170> SIPOSequenceListing 1.0 <210> 1 <211> 2544 <212> DNA <213> dhaB1(2 Ambystoma laterale x Ambystoma jeffersonianum) <400> 1 atgagccaat tatcacaggc ttttggtgaa ccaactgacc gaattcgtgc cttacgggaa 60 caaatccttg atacgacccc ctgcattgag acggatcgtg cccgcctgat caccgagtcc 120 tataaggaaa cggaatccct gcccatgatc atccgtcgcg ccaaagcgct tgagaagatc 180 cttgcggaat tgccggtcac catccgggaa ggtgaactaa tcgttggtag tctgacagtc 240 actcctcatt ccacacaaat ttacccggag tactcaaatc gctggcttca ggatgaattc 300 gatcgtctga atctgcgtaa aggcgaccgt tttaccataa ccgatgaagc gaaacagcag 360 ctggatagcg tatttggcta ctgggaaggg aaaacaacga atgaactggc tacatcctat 420 atgttgcctg aaacgcttga ttgcatggca gaaaatgtct tcactgtcgg caactattac 480 tttaatggcg tcggtcatat agccgtggac tacgcgcgtg ttctcgctcg tggatacaaa 540 ggcatcatcc aggatgttgt tgcagcaatg gccagcgctg ataaaaaga ccccgctttt 600. ctgaaaaag aatcgttcta caaggcggtc attattctt gtaacgcagc aatcaatttt gctcatcgtt acgcggttaa agctcgtact ctcgcggac aggcctcacc agtccgtaaa 720 aaagagctgc tgaaaattgc tgaaatctgt gacaaagtac ctgaaaatgg tgcaagtaat ttctatgaag cctgccagtc attctggttt gcccatgcca ttattcaact tgaatccaac gggcattcta tctccccggc gcgtttcgat cagtacatgt acccttacct ggaaaaggac 900 agctccctga gcgaggaaca ggcgcaggaa ttgctggatt gtctgtggct caagttcaac gacgttaaca aggttcgtga tgaaggctcg accaaaggtt ttggtggcta tccgatgttc cagaacctga tcgttggcgg tcaaaccagc ggcggacagg acgccactaa cagactgtcc tttatggcca tgacggctac cgcccatgtt cgtctgcatg aaccttcact gtcagtacgt 1140 gtctggtcaa aatctccgga cgatttttta ctgaaagcct gtgaagtcag tcgtcttggt atggggatcc cggcctatta caacgatgaa gttgttatcc ctgcattgat taaccgcggc 1260 ctgaccctgg aagatgcgcg ggaatacggc atcatcggct gcgtcgaacc tcaacgtccg 1320 ggaaaaacag aaggctggca cgacgccgcg ttctataaca tgagtaaggt actggaaata 1380 accctgaaca acggacgctg cggggataaa caactcggcc ccaaaactgg tgagctggat 1440 tcattccaga gtattgaaga catcattgaa gcttatcgta aacagaacga atattttgtc 1500 tatcatctgg caatggccgt taacagtgtt gaccttgctc atatggaacg ggcccccctg 1560 ccgttcctgt cctgtatggt ggatgactgt atcagtcgcg gtaaaagcgt tcaggaaggc 1620 ggtgcccatt ataacttcac gggtccgcaa ggtgtcggcg ttgccaatgt gggcgactcg 1680 ctgatggcta tcaaacgtct ggtatttgaa gaaggccaat tatcgctggg tcatctgaaa 1740 gaagcactgg atgccaattt cggtgtatct ggcgggatag agaaacctga cactatagcc 1800 actgaaagta cgccgaaaca ggatgcaacc tatgaactag tccttgaggc cgtgaagaaa 1860 gtgctgggcg aaagcggcgc acttgcactc acctcactca atagcaaccc accggagcct 1920 gtcaaagggg ctaatgccgg gctgacagca gtgcgtcagt tactcattaa tggcgccccc 1980 aagttcggta atgacattga cgaagtggat atgctggccc gtaccggtgc tgaaatttac 2040 tgtcgcgagg tagaaaata caccaaccca cgtggcggtt tattccaggc tggcttatat 2100 ccggtatccg ctaatgtggc tctcggtgag agcgtcgggg caactccaga tggacgtctg 2160 gccggccagc cgcttcccga tggggtgtcg cccagcaggg gcatggatac aaaaggtcca 2220 accgctgccg ccaactcagt agccaagctg gatcacttcc tggcctcaaa tggcacgctg 2280 tttaatcaga aattccatcc ggcagctctg aaaggcgatg agggattata ccatctggcg 2340 gccttactgc gtggttattt cgatcagaaa ggcatgcatg ttcagttcaa tgtgatcgac 2400 cgtaatacac tgctggcagc acaaaaagaa ccagaaaaat atcgtgatct ggttgtgcgt 2460 gtggcgggtt acagtgcgca atttgtctca ctggataaaa gcgtacagga cgatattatc 2520 ctgcgaaccg aacatgtctt ttaa 2544 <210> 2 <211> 921 <212> DNA <213> dhaB2(2 Ambystoma laterale x Ambystoma jeffersonianum) <400> 2 atggcggaaa ttgattacgc gcagactggc accgtattta atatacaaaa attctcctta 60 catgatggtc cgggcatacg cacaattgta ttcctgaaag gctgttatct ggcatgtaaa 120 tggtgcagta atccggaatc acagcacact gaaccggaaa tattttacta cgaacgcaat 180 tgtatccatt gcggacgctg cgtatccgcc tgccccgttg gggctatcga tgcctcacgt 240 caagggctta ttgaccggaa tgcctgtatt cattgtggag cttgcgctga ggtctgcccg 300 gctggcgcga tggttcagtc aggtaagaga atgtcggtgg tggaggttat agacgaactg 360 cgtaaagatg agacgcatta tcgccgctcc ggtggaggta ttacattgtc cggtggcgaa 420 gcactggctc agcctgcatt tgcagcagca ttgctggccg cctgcaaagc cagaggatgg 480 catacagcga tggaaaccac cggaatagcc tcccgggccg tgctggaaaa ggttatccca 540 ttgcttgata tcgtattgct cgacatcaaa accttttata gtgaacggca taaggaattt 600 acgggacatc cgaatgagac ggttttacgt aatgcactga caatttcaga actggcaaag 660 aatgtcgccg ttcggatccc ggtaattcct ggatttaatg atgatgaaca aagtatcgaa 720 gctattgcca gatttgttac gcacatgaaa aatgtatcgc gattacattt attgccctat 780 cacaactatg gccataataa atataacctg cttggcagaa cgtacgacat gattgaaata 840 aaaccaccgg aagaaagtcg tatgcataaa tataaagata ttgtgacatc ccttggaatc 900 gactgcgtca tcggtgggta a 921 <210> 3 <211> 49 <212> DNA <213> Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum) <400> 3 aagcttgtcg acggagctcg aattctcaga agcggaatgt gaaaaggcc 49 <210> 4 <211> 44 <212> DNA <213> Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum) <400> 4 ctggtgccgc gcggcagcca tatgatgacg ccgaaactga accg 44 <210> 5 <211> 50 <212> DNA <213> Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum) <400> 5 aagcttgtcg acggagctcg aattcttagc ttcctttacg cagcttatgc 50 <210> 6 <211> 55 <212> DNA <213> Artificial Sequence (2 Ambystoma laterale x Ambystoma jeffersonianum) <400> 6 ctggtgccgc gcggcagcca tatgatgaaa agatcaaaac gatttgcagt actgg 55 <210> 7 <211> 53 <212> DNA <213> Artificial Sequence (2 Ambystoma laterale x Ambystoma jeffersonianum) <400> 7 tgcatgcctg caggtcgact ctgacgttca caaactgcat atatctgata gac 53 <210> 8 <211> 32 <212> DNA <213> Artificial Sequence (2 Ambystoma laterale x Ambystoma jeffersonianum) <400> 8 tatatctcct ttcaggcctc caggcttatc ca 32 <210> 9 <211> 0 <212> PRT <213> dhaB1(2 Ambystoma laterale x Ambystoma jeffersonianum) <400> 9 <210> 10 <211> 0 <212> PRT <213> dhaB2(2 Ambystoma laterale x Ambystoma jeffersonianum) <400> 10 <210> 11 <211> 3620 <212> DNA <213> dhaB1B2(2 Ambystoma laterale x Ambystoma jeffersonianum) <400> 11 gtagtggaga acaagaaatg agccaattat cacaggcttt tggtgaacca actgaccgaa 60 ttcgtgcctt acggggaacaa atccttgata cgaccccctg cattgagacg gatcgtgccc 120 gcctgatcac cgagtcctat aaggaaacgg aatccctgcc catgatcatc cgtcgcgcca 180 aagcgcttga gaagatcctt gcggaattgc cggtcaccat ccgggaaggt gaactaatcg 240 ttggtagtct gacagtcact cctcattcca cacaaattta cccggagtac tcaaatcgct 300 ggcttcagga tgaattcgat cgtctgaatc tgcgtaaagg cgaccgtttt accataaccg 360 atgaagcgaa acagcagctg gatagcgtat ttggctactg ggaagggaaa acaacgaatg 420 aactggctac atcctatatg ttgcctgaaa cgcttgattg catggcagaa aatgtcttca 480 ctgtcggcaa ctattacttt aatggcgtcg gtcatatagc cgtggactac gcgcgtgttc 540 tcgctcgtgg atacaaaggc atcatccagg atgttgttgc agcaatggcc agcgctgata 600 aaaaagacccc cgcttttg aaaaagaat cgttctacaa ggcggtcatt atttcttgta 660 acgcagcaat caattttgct catcgttacg cggttaaagc tcgtactctc gcggaacagg 720 cctcaccagt ccgtaaaaaa gagctgctga aaattgctga aatctgtgac aaagtacctg 780 aaaatggtgc aagtaatttc tatgaagcct gccagtcatt ctggtttgcc catgccatta 840 ttcaacttga atccaacggg cattctatct ccccggcgcg tttcgatcag tacatgtacc 900 cttacctgga aaaggacagc tccctgagcg aggaacaggc gcaggaattg ctggattgtc 960 tgtggctcaa gttcaacgac gttaacaagg ttcgtgatga aggctcgacc aaaggttttg 1020 gtggctatcc gatgttccag aacctgatcg ttggcggtca aaccagcggc ggacaggacg 1080 ccactaacag actgtccttt atggccatga cggctaccgc ccatgttcgt ctgcatgaac 1140 cttcactgtc agtacgtgtc tggtcaaaat ctccggacga ttttttactg aaagcctgtg 1200 aagtcagtcg tcttggtatg gggatcccgg cctattacaa cgatgaagtt gttatccctg 1260 cattgattaa ccgcggcctg accctggaag atgcgcggga atacggcatc atcggctgcg 1320 tcgaacctca acgtccggga aaaacagaag gctggcacga cgccgcgttc tataacatga 1380 gtaaggtact ggaataacc ctgaacaacg gacgctgcgg ggataaaaca ctcggcccca 1440 aaactggtga gctggattca ttccagagta ttgaagacat cattgaagct tatcgtaaac 1500 agaagaata ttttgtctat catctggcaa tggccgttaa cagtgttgac cttgctcata 1560 tggaacgggc ccccctgccg ttcctgtcct gtatggtgga tgactgtatc agtcgcggta 1620 aaagcgttca ggaagcggt gcccattata acttcacggg tccgcaaggt gtcggcgttg 1680 ccaatgtggg cgactcgctg atggctatca aacgtctggt atttgaagaa ggccaattat 1740 cgctgggtca tctgaaagaa gcactggatg ccaatttcgg tgtatctggc gggatagaga 1800 1860 ttgaggccgt gaaaagtg ctgggcgaaa gcggcgcact tgcactcacc tcactcaata 1920 gcaacccacc ggagcctgtc aaaggggcta atgccgggct gacagcagtg cgtcagttac 1980 tcattaatgg cgcccccaag ttcggtaatg acattgacga agtggatatg ctggccccgta 2040 ccggtgctga aatttactgt cgcgaggtag aaaaatacac caacccacgt ggcggtttat 2100 tccaggctgg cttatatccg gtatccgcta atgtggctct cggtgagagc gtcggggcaa 2160 ctccagatgg acgtctggcc ggccagccgc ttcccgatgg ggtgtcgccc agcaggggca 2220 tggatacaaa aggtccaacc gctgccgcca actcagtagc caagctggat cacttcctgg 2280 cctcaaatgg cacgctgttt aatcagaaat tccatccggc agctctgaaa ggcgatgagg 2340 gattatacca tctggcggcc ttactgcgtg gttatttcga tcagaaaggc atgcatgttc 2400 agttcaatgt gatcgaccgt aatacactgc tggcagcaca aaaagaacca gaaaaatatc 2460 gtgatctggt tgtgcgtgtg gcgggttaca gtgcgcaatt tgtctcactg gataaaagcg 2520 tacaggacga tattatcctg cgaaccgaac atgtctttta attgacagtc ggccggattt 2580 ctcaacataa ggatattatc ttctgatgat tgttttcctt gtttttacag acaaggaaaa 2640 cacatccggc caataacatg ctgaatatca gcatgaagaa aagaaataaa ggtattgaca 2700 tggcggaaat tgattacgcg cagactggca ccgtatttaa tatacaaaaa ttctccttac 2760 atgatggtcc gggcatacgc acaattgtat tcctgaaagg ctgttatctg gcatgtaaat 2820 ggtgcagtaa tccggaatca cagcacactg aaccggaat attttac gaacgcaatt 2880 gtatccattg cggacgctgc gtatccgcct gccccgttgg gggtacgat gcctcacgtc 2940 aagggcttat tgaccggaat gcctgtattc attgtggagc tgcgctgag gtctgcccgg 3000 ctggcgcgat ggttcagtca ggtaagagaa tgtcggtggt ggaggttata gacgaactgc 3060 gtaaagatga gacgcattat cgccgctccg gtggaggtat tacattgtcc ggtggcgaag 3120 cactggctca gcctgcattt gcagcagcat tgctggccgc ctgcaaagcc agaggatggc 3180 atacagcgat ggaaaccacc ggaatagcct cccggggccgt gctggaaag gttatcccat 3240 tgcttgatat cgtattgctc gatacaaa cctttag tgaacggcat aaggaattta 3300 cgggacatcc gatgagacg gttttacgta atgcactgac aatttcagaa ctggcaaaga 3360 atgtcgccgt tcggatcccg gtaattcctg gatttaatga tgatgaaca agtatcgaag 3420 ctattgccag atttgttacg cacatgaaaa atgtatcgcg attacattta ttgcctatc 3480 acaactatgg ccataataa tataacctgc ttggcagac gtacgacatg attgaataa 3540 aaccaccgga agaaagtcgt atgcataaat ataaagatat tgtgacatcc cttggaatcg 3600 actgcgtcat cggtgggtaa 3620

Claims

1. An application of overexpression of a glycerol dehydratase gene or its encoded protein in increasing the 1,3-propanediol yield of Klebsiella pneumoniae HR526, characterized in that, The glycerol dehydratase gene is derived from Vibriodiazotrophicus, and the gene includes two subunits, namely the α subunit and the β subunit. The nucleotide sequence of the α subunit is shown in SEQ ID NO.1; The nucleotide sequence of the β subunit is shown in SEQ ID NO.2; The encoded protein is obtained from the overexpressed glycerol dehydratase gene.

2. An application of biomaterials containing an overexpressed glycerol dehydratase gene in increasing the 1,3-propanediol yield of Klebsiella pneumoniae HR526, characterized in that, The biological material is a biological material containing the glycerol dehydratase gene described in the application of claim 1; the biological material is a vector, recombinant bacteria, cell line or expression cassette.

Citation Information

Patent Citations

  • Glycerol dehydratase gene independent of coenzyme B12 and application thereof

    CN109207500A

  • Engineering bacterium for improving performance of 1, 3-propylene glycol production strain and application of engineering bacterium

    CN113881614A