Use of caudatosic acid in combination with polymyxin b in inhibiting growth of mcr-1 positive escherichia coli

Abstract

The application discloses application of Caesalpinia Sappanin (CSA) combined with polymyxin B in inhibition of growth of mcr-1 positive escherichia coli. Overuse of antibiotics has caused spread and prevalence of typical'superbacteria', which leads to almost all antibiotics being ineffective, so that bacterial drug resistance has become one of important problems of human public health safety. The application screens and identifies a small molecule inhibitor Caesalpinia Sappanin of polymyxin drug resistance key protein MCR-1 from natural products. Research finds that CSA combined with polymyxin B produces a significant synergistic effect in treatment of mcr-1 positive escherichia coli, and CSA can reduce drug resistance of mcr-1 positive bacteria to polymyxin B, and then enhances the antibacterial activity of polymyxin B. The application provides a train of thought for further research and development of a higher-activity MCR-1 inhibitor, and provides a new technical means for treatment of diseases caused by escherichia coli infection.

Description

Technical Field

[0001] This invention relates to a novel use of styracidin, particularly the application of styracidin combined with polymyxin B in inhibiting the growth of mcr-1 positive Escherichia coli. This invention belongs to the field of biomedical technology. Background Technology

[0002] Antibiotics have long been a cornerstone of modern medicine, playing a crucial role in treating and preventing common bacterial infections, enabling the treatment of many complex diseases and saving millions of lives. However, due to evolution, natural selection, and the overuse of antibiotics, the rate of bacterial resistance development worldwide has been alarming, resulting in a dwindling number of available antibiotics in clinical practice. Over the past two decades, "ESKAPE" pathogens (including Pseudomonas aeruginosa, Enterococcus faecalis, Klebsiella pneumoniae, Staphylococcus aureus, Acinetobacter baumannii, and Enterobacter Hormaeche and Edwards) have been a major cause of healthcare-associated infections globally, posing a significant threat to global public health. Most of these bacteria are multidrug-resistant (MDR) "superbugs," often causing difficult-to-treat infections and even life-threatening ones. According to reports from various countries, Gram-negative "superbugs" have developed resistance to most currently available antibiotics. The rapid development and spread of antibiotic resistance in pathogenic bacteria has long outpaced the development of new antibiotics, thus posing a huge threat to human health worldwide.

[0003] Escherichia coli (E. coli) holds a unique position in the microbial world. It can cause serious infections in humans and animals and is also a major reservoir of drug-resistant genes. Many drug-resistant genes have been subsequently discovered in E. coli isolates, which may be one reason for the failure of treatments for E. coli infections in humans and veterinarians. In the gut bacterial gene pool, drug-resistant genes are generally believed to be acquired or transferred horizontally. E. coli can acquire drug-resistant genes from other bacteria and can also transfer them to other bacteria. In conclusion, drug resistance in E. coli is considered a major challenge facing humans and animals globally and a public health issue that requires serious attention.

[0004] Over the past few decades, drug resistance in clinical isolates of *E. coli* has increased significantly globally, with variations across countries and regions. A 2016 study in New Delhi, India, on neonatal sepsis showed a prevalence of 47% for clinical isolates of extended-spectrum β-lactamase (ESBL)-producing *E. coli*. Data from the Asia-Pacific Antibiotic Resistance Trends Monitoring Project in 2007 showed intraperitoneal infection rates of ESBL-producing *E. coli* at 79% and 55% in India and China, respectively, compared to lower rates in Australia (8%) and the Philippines (17%). From 2013 to 2014, the prevalence of ESBL-producing *E. coli* pyelonephritis in the United States ranged from 3% to 12%. Fluoroquinolone resistance rates detected in *E. coli* urinary tract infections also exhibit considerable regional differences, ranging from 2% in Greece to nearly 70% in India. Resistance to other antibiotics, such as ampicillin and trimethoprim-sulfamethoxazole / trimethoprim, also varies by region.

[0005] Polymyxins are cationic polypeptide antibiotics with lipophilic fatty acyl side chains, synthesized by Bacillus species using non-ribosomal peptide synthases. They possess broad-spectrum antibacterial activity against Gram-negative bacteria and were successfully developed in the 1940s. There are five types of polymyxins (polymyxins A and E), all with similar decapeptide structures (composed of a heptapeptide ring and a tripeptide side chain, with the tripeptide side chain acylated by a fatty acid at the amino terminus). Currently, only polymyxin B and polymyxin E are used clinically. Polymyxin B and E differ by only one amino acid: polymyxin B has D-phenylalanine at position 6, while polymyxin E has D-leucine at position 6. Due to their similar chemical structures and comparable biological activities, they were initially considered equivalent.

[0006] In the early 1970s, the potential nephrotoxicity and neurotoxicity of polymyxins, along with the development and use of new-generation broad-spectrum antibiotics, hindered their widespread clinical application. By the late 1990s, the increasing incidence of infections caused by multidrug-resistant Gram-negative bacteria, particularly carbapenem-resistant Enterobacteriaceae, rendered many existing antibiotics ineffective against these resistant strains. Furthermore, the limited number of newly developed antimicrobial agents and the further deterioration of resistance necessitated the re-emergence of polymyxins in clinical practice for Gram-negative bacterial infections. Currently, due to its high efficacy and low resistance rate, polymyxin is considered a last resort for treating serious infections caused by Gram-negative bacteria. However, given the widespread and continued use of polymyxins, particularly in livestock farming, there are international concerns about the potential rapid spread of polymyxin resistance.

[0007] Some Enterobacteriaceae have shown significant resistance to polymyxins. Previously, it was generally believed that polymyxin resistance was mediated by chromosomal mutations, not by horizontal gene transfer. However, in 2015, the team of Academician Shen Jianzhong of the Chinese Academy of Engineering and Professor Liu Jianhua of South China Agricultural University discovered for the first time a mechanism for polymyxin resistance mediated by a plasmid carrying the mcr-1 gene, and confirmed through conjugation experiments that this gene can be transmitted between bacteria via conjugation plasmids.

[0008] The mcr-1 gene is the first horizontally transferable, plasmid-mediated polymyxin resistance gene discovered internationally. This 1626 bp gene, with a GC content of 49%, encodes the 541-amino acid MCR-1 protein located on a separate genetic element plasmid in bacteria. Within months of its discovery, the mcr-1 gene has been detected in multiple countries worldwide (in food, animals and humans in Southeast Asia, Europe, and Africa, and travelers returning to Europe from Southeast Asia, South America, and Africa). This indicates that this resistance gene element is highly transmissible. Worryingly, plasmids carrying the mcr-1 gene can mediate the cross-species transfer of polymyxin resistance between Gram-negative bacteria, posing a significant challenge to the use of polymyxins as a last-line defense for treating Gram-negative bacterial infections. In nature, the mcr-1 gene can be traced back to at least five bacterial species (Escherichia coli, Salmonella enteritidis, Klebsiella pneumoniae, Enterobacter aerogenes, and Enterobacter cloacae), and can also be transmitted from Escherichia coli to Pseudomonas aeruginosa via conjugation experiments. Furthermore, the host range of gut bacteria carrying the mcr-1 gene may have expanded from poultry to humans. Data released from January to April 2016 showed that the mcr-1 gene had spread to no fewer than 18 countries, and to some extent, this spread may be related to food chain transportation. The mcr-1 gene was detected in 20% of E. coli isolated from pigs in Chinese slaughterhouses and 15% of E. coli isolated from retail meat. This gene has also been detected in clinical isolates of various Gram-negative bacteria (including E. coli and Klebsiella pneumoniae) cultured from hospitalized patients in Chinese hospitals. mcr-1 is a plasmid-mediated cause of polymyxin resistance, and this gene has now been found in highly resistant Gram-negative bacteria. Amino acid sequence alignment revealed that the MCR-1 protein shares high homology with phosphoethanolamine transferases from different species. The MCR-1 protein product is predicted to be a complete membrane protein with phosphoethanolamine transferase catalytic activity, belonging to the phosphoethanolamine transferase family and the YhjW / YjdB / yijP superfamily. It alters the chemical structure of the 1' or 4' phosphate group on the lipid A moiety of bacterial LPS by adding a phosphate ethanolamine group (PEtN), resulting in a higher positive charge on the LPS and a reduced affinity of the bacterial surface for the cationic antibiotic polymyxin, thus leading to polymyxin resistance.

[0009] 3-hydroxy-4-prenyl-5-methoxystilbene-2-carboxylicacid (CSA) is one of the most important active ingredients isolated from pigeon pea leaves, possessing a variety of biological activities. CSA plays an increasingly widespread role in pharmaceutical applications. This invention conducted a series of experiments targeting the mechanism of action of CSA in inhibiting the key polymyxin resistance protein MCR-1, verifying that CSA can indeed inhibit the function of the MCR-1 protein, acting as a small molecule inhibitor of MCR-1. Furthermore, it was found that the combined use of pigeon pea stilbene acid (CSA) and polymyxin B can effectively inhibit the growth of MCR-1-positive Escherichia coli.

[0010] Structure of bismuth substantiate Summary of the Invention

[0011] One of the objectives of this invention is to provide the application of the combination of cuscuta acid and polymyxin B in inhibiting the growth of mcr-1 positive Escherichia coli.

[0012] The second objective of this invention is to provide a pharmaceutical composition consisting of cuscuta acid and polymyxin B and its application.

[0013] To achieve the above objectives, the present invention employs the following technical means: To elucidate the exact effects and mechanisms of action of the combined use of cuspidatine and polymyxin B, this invention first employed the checkerboard dilution method to conduct a combined drug susceptibility test on mgr-1 positive *Escherichia coli* using CSA and polymyxin. The results showed that when CSA and polymyxin were used in combination, the MIC value of polymyxin decreased from 8 μg / mL to 1 μg / mL, and the FIC index was less than 0.5, indicating a synergistic effect. Based on this, plate counting and transmission electron microscopy were used to evaluate the combined antibacterial effect of CSA (final concentration 32 μg / mL) and polymyxin (final concentration 10 μg / mL). The results showed that when CSA and polymyxin were used in combination, all *E. coli* died within 1-4 hours, with the most severe bacterial cell damage; however, neither 32 μg / mL CSA nor 10 μg / mL polymyxin alone could completely kill *E. coli*. Experiments using 80 mg / kg CSA and 5 mg / kg polymyxin in combination to treat E. coli-infected mice showed that, compared with the positive control group, the mortality rate of mice was reduced, the bacterial load in the liver was reduced by approximately 55-fold, and the bacterial load in the spleen was reduced by approximately 1056-fold. Furthermore, the pathological changes in the liver and spleen of the mice in the combined treatment group were significantly reduced, indicating that the combined use of CSA and polymyxin has a significant therapeutic effect on mcr-1-positive E. coli. Based on the molecular cloning, induced expression, and purification of the mcr-1 gene and MCR-1 protein, the interaction between CSA and MCR-1 protein was verified using a Biacore macromolecular interaction instrument. The results showed that the affinity between CSA and MCR-1 protein was 1.47 μmol / L, which is less than 1 mmol / L, indicating direct binding. Therefore, CSA is a small molecule inhibitor of MCR-1 protein.

[0014] Based on the above research, this invention proposes the application of 3-hydroxy-4-prenyl-5-methoxystilbene-2-carboxylicacid (CSA) in combination with polymyxin B in the preparation of drugs that inhibit the growth of mcr-1 positive Escherichia coli.

[0015] Preferably, the mass ratio of cuscuta acid to polymyxin B is 3-20:1.

[0016] Furthermore, the present invention also proposes a pharmaceutical composition for inhibiting the growth of mcr-1 positive Escherichia coli, wherein the pharmaceutical composition comprises cuspidatic acid and polymyxin B.

[0017] Preferably, the mass ratio of cuscuta acid to polymyxin B is 3-20:1.

[0018] Furthermore, the present invention also proposes the use of the pharmaceutical composition in the preparation of a drug for inhibiting the growth of mcr-1 positive Escherichia coli.

[0019] Compared with the prior art, the beneficial effects of the present invention are: The overuse of antibiotics has led to the spread and prevalence of typical "superbugs," rendering almost all antibiotics ineffective. Therefore, bacterial resistance has become a significant public health issue. Currently, the prevalence of the mcr-1 gene shows that mcr-1-positive strains often carry other resistance genes such as β-lactamase, florfenicol, fosfomycin, and quinolones. Under the selective pressure of various drugs, these resistant strains survive and are selected. With the mutation and spread of the mcr-1 gene, outbreaks and epidemics of multidrug-resistant bacteria are possible, and the problem of polymyxin resistance is becoming increasingly serious. Therefore, there is an urgent need for novel antibacterial agents to overcome the growing problem of drug resistance. Natural products are an important source of new drugs, and screening for novel antibacterial agents from natural products and their derivatives is a crucial approach to overcoming drug-resistant bacteria.

[0020] This invention screened and identified bismuth subsalicylate (CSA), a small-molecule inhibitor of the key polymyxin resistance protein MCR-1, from natural products. Studies revealed that CSA, in combination with polymyxin B, produced a significant synergistic effect in the treatment of MCR-1-positive Escherichia coli. CSA may have reduced the resistance of MCR-1-positive bacteria to polymyxin B, thereby enhancing the antibacterial activity of polymyxin B. This invention provides insights for further research and development of more active MCR-1 inhibitors and offers a new technical approach for the treatment of diseases related to Escherichia coli infection. Attached Figure Description

[0021] Figure 1 CSA combined with polymyxin B mcr-1 Bactericidal curves of positive Escherichia coli; Figure 2 To observe the morphology of mcr-1 positive Escherichia coli JD08 using transmission electron microscopy; Among them, A: JD08 strain; B: JD08 strain affected by 10 μg / mL polymyxin; C: JD08 strain combined with 10 μg / mL polymyxin and 32 μg / mL CSA; Figure 3 To detect changes in lipid A in strain JD08 by mass spectrometry; in, Figure 3 A represents the change in size of lipid A compared to normal lipids without modification; Figure 3 B represents the proportion of modified lipid A in the JD08 strain compared to strains without CSA treatment; Figure 4 Survival rate (A) and bacterial load in liver (B) and spleen (C) of mice; Figure 5 Pathological sections of mouse liver (X200); in, Figure 5 A represents the liver of the blank control group; Figure 5 B represents the liver of the positive control group; Figure 5 C represents the liver of the polymyxin control group; Figure 5 D represents the liver of the polymyxin and CSA combined treatment group; Figure 6 Pathological sections of mouse spleen (X200). in, Figure 6 A represents the spleen of the blank control group; Figure 6 B represents the spleen of the positive control group; Figure 6 C represents the spleen in the polymyxin control group; Figure 6 D represents the spleen of the polymyxin and CSA combined treatment group; Figure 7 for mcr-1 PCR amplification results of the gene; Wherein, M: DL2000 Maker; 1-4: PCR products of the mcr-1 gene; 5: negative control; Figure 8 Double enzyme digestion identification of recombinant plasmids; Wherein, M: marker; 1-3: double enzyme digestion products of recombinant plasmid; 4: negative control; Figure 9 SDS-PAGE analysis of MCR-1 protein expression; Wherein, M: protein marker; 1: bacterial precipitate; 2: bacterial supernatant; 3: pET-28a supernatant; 4: pET-28a precipitate; Figure 10 The purification results of MCR-1 protein with different imidazole concentrations; Wherein, M: protein marker; 1: 5mM imidazole elution result; 2: 10mM imidazole elution result; 3: 20mM imidazole elution result; 4: 40mM imidazole elution result; 5: 60mM imidazole elution result; 6: 80mM imidazole elution result; 7: 100mM imidazole elution result; 8: 250mM imidazole elution result; Figure 11 The interaction force between CSA and MCR-1 protein was measured in Biacore. Wherein, A: Binding response curves of CSA to MCR-1 protein at 1.56 μm, 3.125 μm, 6.25 μm, 12.5 μm, 25 μm, and 50 μm (the curves from bottom to top correspond to 1.56 μm, 3.125 μm, 6.25 μm, 12.5 μm, 25 μm, and 50 μm respectively); B: Affinity fitting curves of CSA to MCR-1 protein. Detailed Implementation

[0022] The invention will be further described below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and do not limit the scope of protection of the invention.

[0023] Example 1: The combination of CSA and polymyxin in inhibiting mcr-1 Application in positive Escherichia coli 1.1 Materials 1.1.1 Strains and Laboratory Animals mcr-1 Positive Escherichia coli JD01-JD12 were isolated from a chicken farm in Heilongjiang Province. mcr-1 Positive Escherichia coli strains ZD01-ZD12 were isolated from a pig farm in Heilongjiang Province, while the reference strain ATCC25922 was preserved in our laboratory. Female BABL / c mice aged 6-8 weeks were purchased from Beijing Vital River Laboratory Animal Co., Ltd.

[0024] 1.1.2 Main Reagents Table 1 Main Reagents reagents company Polymyxin B (purity 98%) Sigma-Aldrich CSA (98% purity) Extracted by this laboratory PBS buffer Beijing Coolabe Company DMSO Sigma-Aldrich PEG From Beijing Solarbio LB agar medium BD Company, USA LB Broth Culture Medium BD Company, USA MH Broth BD Company, USA 1.2 Methods 1.2.1 Combined drug sensitivity testing The experiment used 24 strains from different sources mcr-1Positive Escherichia coli strains, namely JD01-JD012 and ZD01-ZD12 isolates, were used to determine the minimum inhibitory concentrations (MICs) of CSA (10240 μg / mL) and polymyxin (10240 μg / mL) by the broth microdilution checkerboard method published by CLSI [Jones, R. N. NCCLS guidelines: revised performance standards for antimicrobial disk susceptibility tests[J]. Antimicrobic Newsletter, 1984, 1(8):64-65.]. Then, according to the standard method published by CLSI for determining the inhibitory effects of different drug combinations on the isolated bacteria, the drugs were diluted in a 96-well plate to reach 100 μL per well. That is, based on adding 100 μL of culture medium to each well of the 96-well plate, 100 μL of the original concentration of polymyxin was added to the first row, and then serially diluted 2-fold to the 8th row, and 100 μL of the liquid in the 8th row was discarded; 100 μL of the original concentration of CSA was added to the first column, and then serially diluted 2-fold to the 12th column, and 100 μL of the liquid in the 12th column was discarded. A total of 24 96-well plates were prepared with the same above operations. Subsequently, 100 μL of the bacterial suspension of 24 mcr-1 positive Escherichia coli isolates (final concentration of 5×10 5 cfu / mL) was added to each plate and cultured at 37 °C for 14 h - 16 h. The MICs of polymyxin and CSA when used in combination were determined according to the growth of the bacterial suspension, and the FIC index was obtained based on the MIC values of CSA and polymyxin. When FIC = (MIC of drug A in combination / MIC of drug A) + (MIC of drug B in combination / MIC of drug B), FIC < 0.5 indicates synergistic effect, that is, the antibacterial effect of the two drugs in combination is greater than the sum of the antibacterial effects of the two drugs at the same concentration; 0.5 < FIC < 1 indicates additive effect, that is, the activity of the two drugs in combination is equal to the sum of the antibacterial effects of the two drugs; 1 < FIC < 2 indicates no interaction, that is, the activity of the combined drugs is the same as the antibacterial effect of the individual drugs. FIC > 2 indicates antagonistic effect, that is, the antibacterial activity of the two drugs in combination is less than the antibacterial effect of a single drug.

[0025] 1.2.2 Detection of bactericidal effect Since the MIC value of strain JD08 was relatively representative among the 24 isolates, we selected strain JD08 for all subsequent experiments. The JD08 bacterial culture was revived in 2 mL of LB liquid medium and cultured at 37°C and 220 rpm for 1 h. Then, the JD08 bacterial culture was divided into three portions and the following were added respectively: (1) polymyxin with a final concentration of 10 μg / mL; (2) CSA with a final concentration of 32 μg / mL; (3) polymyxin with a final concentration of 10 μg / mL and CSA with a final concentration of 32 μg / mL. The three bacterial cultures were placed in a 37°C incubator for constant temperature culture. After 1 h, 2 h, 4 h, 6 h, 8 h, 10 h and 12 h, 100 μL of the bacterial culture was taken from each portion and evenly spread onto LB solid agar medium. The plates were inverted and cultured overnight at 37°C. Bacterial counts were performed the next day. A time-viable count curve was plotted based on the viable count, with the normally cultured JD08 strain serving as a positive control.

[0026] 1.2.3 Transmission electron microscopy observation We observed the cell morphology of normally cultured JD08 strain, JD08 strain treated with polymyxin B, and JD08 strain treated with a combination of polymyxin B and CSA using transmission electron microscopy. JD08 strain was cultured to OD... 650nm The concentration was 0.6, and the culture was divided into three 2 mL portions. Two portions were transferred to LB broth containing 10 μg / mL polymyxin B and one to LB broth containing 10 μg / mL polymyxin B + 32 μg / mL CSA. The remaining portion, JD08 bacterial culture without any drugs, served as a positive control. All three bacterial cultures were incubated at 37°C for 4 h, washed three times with PBS, and fixed overnight at 4°C with 2-3 drops of 0.15% glutaraldehyde solution. The next day, the cultures were fixed with 1% osmotic acid solution for 1-2 hours; decolorized with ethanol of different concentrations; treated with acetone for 20 minutes; infiltrated with embedding medium for 3 hours; and heated overnight at 70°C. The following day, sections were prepared using a microtome and sent to the electron microscopy laboratory of the Harbin Veterinary Research Institute for transmission electron microscopy observation.

[0027] 1.2.4 Mass spectrometry detection of lipid A structure 10 μL of JD08 bacterial culture was inoculated into 10 mL of LB liquid medium and LB liquid medium containing 16 μg / mL CSA, respectively, and cultured at 37℃ and 220 rpm for 8 h. Lipid A was then extracted using the following method: (1) The cultured JD08 bacterial culture was centrifuged at 8,000 rpm for 20 min to harvest the bacterial cells, and washed three times with deionized water.

[0028] (2) The precipitate was resuspended in 3.8 mL of a mixture of chloroform / methanol / water in a volume ratio of 1:2:0.8 and stirred at room temperature for 1 h. The bacterial precipitate was collected by centrifugation at 2,000 rpm for 20 min and cell membrane lysis was performed.

[0029] (3) Add 5 mL of a mixture of chloroform / methanol / water (volume ratio of 1:2:0.8) to the precipitate, wash the precipitate, centrifuge at 2,000 rpm for 10 min to collect the bacterial precipitate, and repeat this step 3 times.

[0030] (4) Add 1.35 mL of NaAC (12.5 mM, pH 4.5) to the precipitate, resuspend the precipitate using an ultrasonic cell disruptor, and heat at 100 °C for 30 minutes to release lipid A from LPS and cleave the glycans.

[0031] (5) Separation of lipid A: After cooling to room temperature, add 1.5 mL of 100% chloroform and 1.5 mL of 100% methanol, shake the mixture vigorously for 5-10 seconds, and centrifuge at 2,000 rpm for 10 minutes.

[0032] (6) Remove the lower phase and evaporate to dryness. Store the powder at -20°C.

[0033] (7) Lipid A was dissolved in 50 μL of a mixture of chloroform and methanol in a volume ratio of 4:1, and its structure was determined by mass spectrometry.

[0034] 1.2.5 Study on the combined effect of CSA and polymyxin B in mice Thirty 6-8 week old BAL B / C mice, weighing approximately 18-20g, were randomly divided into six groups: a blank control group, a positive control group, a solvent control group, a polymyxin control group, a CSA control group, and a combined CSA and polymyxin administration group. Five mice were assigned to each group. Mice were kept at room temperature with free access to food and water. Except for the blank control group and the solvent control group, each mouse in the other four groups was intraperitoneally injected with 0.2 mL of JD08 bacteria (5 × 10⁻⁶). 8 Mice were then divided into groups and administered the drug (Table 2). CSA and polymyxin were dissolved in a solvent prepared with a ratio of 10% DMSO + 50% polyethylene glycol 400 + 40% water. Each mouse was given 0.2 mL of the solvent. After 7 days of continuous administration, all mice were sacrificed and dissected to observe organ changes. Liver, spleen, and intestines were collected for pathological examination to observe tissue lesions. The bacterial count and changes in the liver and spleen were detected. Data are the average of three independent experiments.

[0035] 1.3 Results 1.3.1 Combined drug susceptibility test results 24 plants were selected mcr-1 Antimicrobial susceptibility testing was performed on positive Escherichia coli strains JD01-JD12 and ZD01-ZD12. Results from both combination and single-drug trials showed that when CSA was used alone... mcr-1 All positive Escherichia coli strains were resistant to CSA. When polymyxin B was used alone, the MIC values ​​were mostly 8 μg / mL (13 strains), with the remainder being 4 μg / mL (7 strains) and 16 μg / mL (4 strains). When CSA was used in combination with polymyxin B, the MIC values ​​of polymyxin B decreased to 1 μg / mL (14 strains) and 2 μg / mL (10 strains). In this experiment, the MIC values ​​of polymyxin B and CSA used in combination were significantly lower than those of polymyxin B used alone. The FIC indices of 22 strains were all less than 0.5 (0.07 (1 strain), 0.133 (14 strains), and 0.258 (7 strains)), indicating a synergistic effect. Only 2 strains showed resistance. mcr-1 The FIC index of positive E. coli was 0.508, indicating an additive effect (Table 3), suggesting that the combined use of CSA and polymyxin B has a positive effect on the control of E. coli. mcr-1 Positive Escherichia coli exhibited a synergistic effect, and the combined use of the two had a significantly higher antibacterial effect than the use of polymyxin B or CSA alone.

[0036] Table 3. Different Sources mcr-1 Combined drug susceptibility test of polymyxin B and CSA in positive Escherichia coli 1.3.2 Sterilization effect test Polymyxin at a final concentration of 10 μg / mL, CSA at a final concentration of 32 μg / mL, and a combination of polymyxin and CSA at a final concentration of 10 μg / mL were added to strain JD08. Viable cell counts showed that using 32 μg / mL CSA alone was less effective in... mcr-1 Positive Escherichia coli JD08 showed no bactericidal effect, with viable bacterial counts similar to those of normally cultured JD08 strains; 10 μg / mL polymyxin had extremely weak bactericidal effect on JD08 strains; when 32 μg / mL CSA and 10 μg / mL polymyxin were used in combination, there was a better bactericidal effect on JD08 strains, with a significant decrease in viable bacterial count after 1 hour, and all bacteria died after 4 hours, with no viable bacteria detected. Figure 1 This indicates that the combined use of CSA and polymyxin is effective against... mcr-1 Positive Escherichia coli have a good bactericidal effect.

[0037] 1.3.3 Transmission electron microscopy observation Electron microscopy revealed that the normally cultured JD08 cells had good morphology and intact outer membranes with only slight deformation, which was likely due to damage during the sectioning process. Figure 2 A); JD08 bacterial cells treated with 10 μg / mL polymyxin B experienced a slight loss of contents and a decrease in electron density. Figure 2 B); JD08 cells treated with 10 μg / mL polymyxin B and 32 μg / mL CSA showed significant morphological changes and severe loss of contents, with most cells remaining only as the outer membrane structure. Protein-like substances were also observed. Figure 2 C), indicating that the combined use of CSA and polymyxin B is effective. mcr-1 The outer membrane of positive E. coli cells was significantly damaged, and CSA exacerbated the effects of polymyxin B on... mcr-1 The extent of damage to positive E. coli leads to the death of the bacteria.

[0038] 1.2.4 Mass spectrometry detection of lipid A structure Lipid A was extracted using a chloroform / methanol / water mixed-phase extraction method. The lipid size isolated from strain JD08 was 1920.3 u, which was approximately 123 u larger than the size of normal lipid A without modification (1797.1 u). Figure 3 A). In the presence of 16 μg / mL CSA, the function of MCR-1 protein was inhibited, and the amount of acyl bonds involved in the transfer was significantly reduced. Figure 3 B) Compared to the proportion of modified lipid A in the JD08 strain without CSA treatment, the proportion of unmodified lipid A in the JD08 strain treated with CSA was significantly altered, indicating that CSA inhibited the phosphoethanolamine transferase catalytic activity of the MCR-1 protein, resulting in a significant reduction in the formation of lipid A complexes.

[0039] 1.3.5 Validation of the combined effect of CSA and polymyxin B in mice Infecting 5×10 8 Mice with CFU / g JD08 strain were treated with different drugs. The liver, spleen, and intestines of the mice were isolated and prepared as pathological sections, and the bacterial load in the liver and spleen was calculated. The mice in the CSA and polymyxin combined treatment group had the lowest mortality rate, the polymyxin treatment group had a moderate mortality rate, while the CSA treatment group showed almost no protective effect, with a mortality rate similar to the positive control group. Figure 4 A). The mean bacterial load in the livers of mice in the positive control group was 2.25 × 10⁻⁶. 8 CFUs / g; CSA has been proven non-toxic, and when used alone, the average bacterial load on the liver is 2.39 × 10⁻⁶. 8 CFUs / g, no decrease in bacterial load; when polymyxin B was used alone, the bacterial load in mouse livers was reduced by approximately 5 times (2.25 × 10⁻⁶) compared to the positive control group. 8 CFUs / g -4.55×10 7CFUs / g); When mice were treated with a combination of CSA and polymyxin B, the bacterial load in the mouse liver decreased by approximately 55-fold (2.25 × 10⁻⁶ CFUs / g); 8 CFUs / g 4.06×10 6 CFUs / g) Figure 4 B). Based on the pathological section results, the liver of the blank control group (…). Figure 5 A) Normal appearance; in the positive control group, extensive degeneration of hepatocytes was observed in the liver, and rod-shaped bacteria were visible in the sinusoids. Figure 5 B); In the polymyxin control group, extensive degeneration of hepatocytes was observed in the liver, and a small number of rod-shaped bacteria were visible in the sinusoids. Figure 5 C); Extensive hepatocellular degeneration in the polymyxin and CSA combined treatment group ( Figure 5 D). The mean bacterial load in the spleen of mice in the positive control group was 3.03 × 10⁻⁶. 7 CFUs / g. The mean bacterial load in the spleen when CSA was used alone was 2.88 × 10⁻⁶. 7 CFUs / g, bacterial load did not decrease. The bacterial load in the spleen decreased by approximately 16-fold (3.03 × 10⁻⁶). 7 CFUs / g - 1.84×10 6 CFUs / g). Concurrent use of CSA and polymyxin B reduced the bacterial load in the spleen by approximately 1056-fold (3.03 × 10⁻⁶). 7 CFUs / g - 2.87×10 4 CFUs / g) Figure 4 C). Based on the pathological section results, the spleen of the blank control group (… Figure 6 A) Normal findings; in the positive control group, there was a slight decrease in splenic white pulp lymphocytes, and extramedullary hematopoiesis was observed in the red pulp. Figure 6 B); In the polymyxin control group, the number of white pulp lymphocytes in the spleen was significantly reduced, and macrophages were hyperplastic (B); Figure 6 C); In the polymyxin and CSA combined treatment group, there was decreased splenic lymphocytes and increased macrophages (C); Figure 6 D). Based on the bacterial load and pathological sections of the liver and spleen, compared to the positive control group and the polymyxin control group, the combined treatment group showed lower bacterial loads and less pathological damage in the liver and spleen. This indicates that the combined treatment of CSA and polymyxin B... mcr-1 Positive E. coli produced a significant synergistic effect, and CSA may have reduced... mcr-1 The resistance of positive bacteria to polymyxin B enhances the antibacterial activity of polymyxin B.

[0040] 1.4 Conclusion This invention experimentally verified that CSA can significantly enhance the effect of polymyxin B on... mcr-1The inhibitory effect on positive Escherichia coli decreased from 8 μg / mL or 16 μg / mL to 1 μg / mL or 2 μg / mL, and neither polymyxin B nor CSA alone could completely kill them. mcr-1 While CSA was found to be effective against positive Escherichia coli, its combined use demonstrated a significant bactericidal effect, proving it to be a small-molecule inhibitor of MCR-1. CSA inhibits the phosphoethanolamine transferase activity of the MCR-1 protein. In mice treated with a combination of CSA and polymyxin B, the bacterial load in the liver was reduced by approximately 55-fold compared to the positive control group, and the bacterial load in the spleen was reduced by approximately 1056-fold, with a significant decrease in mortality. The combined treatment of CSA and polymyxin B also alleviated organ pathological damage in mice.

[0041] Example 2: Interaction study between MCR-1 protein and CSA 2.1 Materials 2.1.1 Carrier The pET-28a vector is preserved in our laboratory.

[0042] 2.1.2 Main Reagents 2.2 Methods 2.2.1 Includes mcr-1 Gene plasmid extraction 5 mL of strain JD08 was transferred to LB broth and cultured overnight at 37°C and 220 rpm in a shaker. Plasmid extraction was performed the following day. The specific method is as follows: (1) Collect the bacterial cells by centrifuging 5 mL of bacterial solution at 8,000 g for 2 min in a centrifuge.

[0043] (2) Add 250 μL of Resuspension Buffer to the EP tube to resuspend the bacterial cells.

[0044] (3) Add 250 μL of Lysis Buffer to the EP tube and gently invert the EP tube 4-6 times.

[0045] (4) Add 350 μL of Neutralization Buffer to the EP tube and immediately gently invert the EP tube up and down 4-6 times.

[0046] (5) Centrifuge the EP tube in a centrifuge at a speed of at least 14,000g for 10 minutes.

[0047] (6) Transfer the supernatant obtained in step (5) into a spin column and centrifuge at 6,000g for 1 min in a centrifuge, then discard the liquid in the tube.

[0048] (7) Add 500 μL of PD Buffer to the Spin column, centrifuge at a speed of at least 13,000 g for 1 min, and discard the liquid in the tube.

[0049] (8) Add 650 μL of Wash Buffer to the Spin column, centrifuge at a speed of at least 13,000 g for 1 min, and discard the liquid in the tube.

[0050] (9) Repeat step (8) (10) Centrifuge the spin column at a speed of at least 13,000 g for 2 min and transfer it to a clean new 1.5 mL EP tube. Open the cap of the spin column and let it stand at room temperature for 2 min to allow the membrane to dry, so as to reduce the impact of the Wash Buffer on the recovery efficiency.

[0051] (11) Add 30-50 μL of ddH2O to the Spin column, let stand at room temperature for 2 min, centrifuge at a speed of at least 13,000 g for 1 min, collect the liquid in the EP tube, and store at -20℃.

[0052] 2.2.2 Primer Design According to information already published on Genbank mcr-1 The gene sequence is KP347127.1. Specific primers were designed using Premier 5.0 software (Table 5) and restriction enzyme sites were introduced. The upstream primer restriction enzyme site is... BamH I, The downstream primer restriction site is Xho I.

[0053] Table 5 mcr-1 Gene amplification primer sequences Primer name Primer sequences (5ʹ-3ʹ) Enzyme cleavage sites -F <![CDATA[AT GGATCC AGTGCGCCAAAAGATACCATTT]]> I -R <![CDATA[GAT CTCGAG TCAGCGGATGAATGCGGT]]> I 2.2.3 mcr-1 PCR amplification of genes Using the JD08 strain plasmid as a template, mcr-1 -F is the upstream primer. mcr-1 -R is the downstream primer, used for PCR amplification with PremixTaq™ (Ex Taq™) polymerase. mcr-1 The target gene fragment, with a product size of 987 bp, and the PCR reaction system are shown in Tables 6 and 7.

[0054] Table 6 PCR Reaction System reagents Dosage Premix Taq™ (Ex Taq™) polymerase 25μL -F 2μL -R 2μL plasmid 2μL <![CDATA[ddH2O]]> 19μL 2.2.4 pET28a- mcr-1 Construction of recombinant plasmids 2.2.4.1 mcr-1 Purification of gene PCR products Pick mcr-1 The PCR products were identified by 1% agarose gel electrophoresis. The remaining PCR products, after correct identification, were purified using a PCR purification kit. The specific method is as follows; (1) Transfer 100 μL of PCR product to a 1.5 mL EP tube, add 400 μL of CP Buffer, mix well and transfer to a Spin column.

[0055] (2) Centrifuge the spin column in a centrifuge at a speed of at least 13,000 g for 1 min and discard the liquid in the tube.

[0056] (3) Add 700 μL of DNA Wash Buffer to the Spin column, centrifuge at a speed of at least 13,000 g for 1 min, and discard the liquid in the tube.

[0057] (4) Repeat step (3).

[0058] (5) Centrifuge the Spin column at a speed of at least 13,000 g for 2 min and transfer it to a clean new 1.5 mL EP tube. Open the cap of the Spin column and let it stand at room temperature for 2 min to allow the membrane to dry, so as to reduce the impact of DNAWash Buffer on recovery efficiency.

[0059] (6) Add 30-50 μL of ddH2O to the Spin column, let stand at room temperature for 2 min, centrifuge at a speed of at least 13,000 g for 1 min, collect the liquid in the EP tube, and store at -20℃.

[0060] 2.2.4.2 Double digestion of PCR products and vectors The purified PCR product and pET-28a vector were respectively used... BamH I, Xho Double digestion with restriction endonuclease I, resulting in... mcr-1 The gene and the pET-28a vector obtained the same sticky ends. The reaction system is shown in Table 8.

[0061] Table 8. Double enzyme digestion of PCR products reagents Dosage Gene / pET-28a vector 10μL I 3μL I 3μL 10×Buffer 5μL <![CDATA[ddH2O]]> 29μL Water bath at 37℃ for 30 minutes.

[0062] 2.2.4.3 Gel recovery of double enzyme digestion products Will pass BamH I, Xho After double digestion with restriction endonuclease I mcr-1 After identification of the gene and pET-28a vector by 1% agarose gel electrophoresis, the target fragment was recovered using a gel recovery kit, as follows: (1) Use a clean scalpel to cut the target fragment and place it into a 2 mL clean EP tube.

[0063] (2) Add extraction buffer at a ratio of 1:3 (gel mass in milligrams to sol volume in microliters). Note that the gel mass should not exceed 400 mg.

[0064] (3) Place the EP tube in a 58°C water bath until the gel melts.

[0065] (4) Transfer all the liquid in the EP tube to the Spin column, centrifuge at a speed of at least 6,000g for 1 minute, and discard the liquid in the tube.

[0066] (5) Add 500 μL of Extraction Buffer to the Spin column, centrifuge at a speed of at least 12,000 g for 1 min, and discard the liquid in the tube.

[0067] (6) Add 750 μL of Wash Buffer to the Spin column, centrifuge at a speed of at least 12,000 g for 1 min, and discard the liquid in the tube.

[0068] (7) Repeat step (6) (8) Centrifuge the spin column at a speed of at least 12,000 g for 2 min and transfer it to a clean new 1.5 mL EP tube. Open the cap of the spin column and let it stand at room temperature for 2 min to allow the membrane to dry, so as to reduce the impact of Wash Buffer on recovery efficiency.

[0069] (9) Add 50 μL of ddH2O to the Spin column, let stand at room temperature for 2 min, centrifuge at a speed of at least 12,000 g for 1 min, collect the liquid in the EP tube, and store at -20℃.

[0070] 2.2.4.4 Connection between the target fragment and the vector The target fragment recovered from the gel was ligated to the vector in a 20 μL reaction system using T4 DNA ligase to construct the recombinant expression vector plasmid pET28a- mcr-1 The connection system is shown in Table 9.

[0071] Table 9. Connection between target fragment and vector reagents Dosage Gene 10μL pET-28a carrier 2μL 10×Buffer 2μL T4 DNA Ligase 1μL <![CDATA[dd H2O]]> 5μL Water bath at 37℃ for 30 minutes.

[0072] 2.2.4.5 Recombinant plasmid pET28a- mcr-1 transformation The recombinant vector pET28a- mcr-1 The cells were transferred into E. coli DH5α competent cells via chemical transformation, as follows: (1) Melt Escherichia coli DH5α competent cells on ice.

[0073] (2) Take 10 μL of the ligation product and add it to 100 μL of Escherichia coli DH5α competent cells. Mix gently and incubate on ice for 30 min to allow the recombinant vector to fully adhere to the surface of the competent cells.

[0074] (3) Place the EP tube in a 42°C water bath and heat shock it for 1 min to cause the competent cells to swell and the pores on the membrane surface to open, allowing the recombinant vector to enter the competent cells. Then immediately remove it and place it on an ice bath for 2 min to close the pores on the membrane surface and prevent other genes from entering the competent cells.

[0075] (4) Add 900 μL of LB liquid culture medium to the EP tube and incubate at 37°C and 180 rpm for 45 min with shaking.

[0076] (5) Centrifuge at 4,000 rpm for 4 min, discard the supernatant, add 100 μL of LB liquid medium to resuspend the cells, spread on LB solid plates containing kanamycin (50 μg / mL), and incubate overnight at 37°C.

[0077] 2.2.4.6 Recombinant plasmid pET28a- mcr-1 Extraction and double enzyme digestion identification Single colonies from LB solid medium were picked and cultured overnight in 5 mL of LB liquid medium containing 50 μg / mL kanamycin. The next day, plasmids were extracted using a plasmid mini-prep kit, following the procedure outlined in section 2.2.1. The extracted plasmids were then subjected to PCR and restriction endonuclease assays. BamH I, Xho The recombinant plasmid was digested with enzyme I, and the product was identified by 1% agarose gel electrophoresis. The recombinant plasmids that were correctly identified by double enzyme digestion and PCR were sent to Harbin Qingke Biotechnology Co., Ltd. for sequencing identification.

[0078] 2.2.5 Induced expression of MCR-1 protein 2.2.5.1 Low-level expression of MCR-1 protein The correctly sequenced recombinant vector plasmid pET28a- mcr-1 Transfer E. coli BL21(DE3) competent cells were plated on LB agar plates containing 50 μg / mL kanamycin and incubated at 37°C. Then, low-level expression of MCR-1 protein was performed using the following method: (1) Pick a single colony and place it in 10 mL of LB liquid medium containing 50 μg / mL kanamycin, and incubate at 37°C to allow OD to rise. 600nm To achieve a pH between 0.6 and 0.8, add 1 mM IPTG and induce overnight at 16°C.

[0079] (2) Centrifuge the induced bacterial culture at 4,000 rpm for 10 min and resuspend it in 700 μL PBS.

[0080] (3) Use a cell sonicator at 35-38 Hz, sonicate for 3 seconds, then pause for 3 seconds, for 2 min 30 s. Centrifuge at 15,000 rpm for 20 min, then add the supernatant and precipitate to a denaturing agent and boil in boiling water for 5-10 min.

[0081] (4) SDS-PAGE, 140V, 1h10min, Coomassie brilliant blue staining to observe the expression of the target protein in the supernatant or precipitate, and to determine the expression level of the target protein.

[0082] 2.2.5.2 Optimization of MCR-1 protein expression conditions After determining the expression level of MCR-1 protein, the expression conditions were optimized, including expression temperature (16℃, 25℃, 37℃), expression time (4h, 6h, 12h, 20h), and IPTG concentration (0.05mM, 0.1mM, 0.2mM, 0.4mM, 0.6mM, 0.8mM, 1mM). The optimal conditions for MCR-1 protein expression were selected. Through condition optimization and screening, it was determined that MCR-1 protein is expressed in the supernatant, and the optimal expression conditions are 16℃, 12h, and an IPTG concentration of 1mM.

[0083] 2.2.5.3 High expression of MCR-1 protein Pick a single colony and place it in 10 mL of LB broth containing 50 μg / mL kanamycin. Incubate overnight at 37°C. The next day, transfer the colony to 1 L of LB broth containing 50 μg / mL kanamycin and incubate at 37°C until OD500. 600nm Add 1 mM IPTG to a concentration of approximately 0.6-0.8 and incubate overnight at 16°C to induce large-scale MCR-1 protein expression. After induction, centrifuge the protein at 10,000 r / min for 10 min at 4°C, collect the cell pellet, and store at -20°C.

[0084] 2.2.6 Purification of MCR-1 protein (1) Resuspend the bacterial pellet in Lysis Buffer (50mM NaH2PO4, 300mM NaCl, 10mM imidazole, 1L ddH2O, pH 8.0) at a ratio of 15-20mL per gram of wet bacterial pellet, and then sonicate it using an ultrasonic cell disruptor (3s sonication, 3s pause, 40min).

[0085] (2) Centrifuge the sonicated liquid at 15,000 rpm for 30 min, and leave the supernatant for nickel column affinity chromatography.

[0086] (3) Add 1 mL of nickel resin to the column. After the liquid has dried, rinse twice with 10 mL of deionized water. Then equilibrate the nickel column with 20 mM imidazole solution and incubate overnight at 4°C or for 2 hours at 37°C.

[0087] (4) Before purification, use Binding Buffer to equilibrate 3 times, 20 mL each time.

[0088] (5) Add the supernatant to the nickel column and control the flow rate at 1 mL / min. Repeat the process 6-8 times. Alternatively, add 20 mL of protein supernatant to a rotary mixer and incubate overnight at 4°C.

[0089] (6) Wash the nickel column three times with Binding Buffer, 15-25 mL each time, gently blow the nickel column to mix, and collect the sample.

[0090] (7) Proteins were eluted using imidazole solutions of different concentrations (5mM, 10mM, 20mM, 40mM, 60mM, 80mM, 100mM, 250mM) and samples were retained.

[0091] (8) SDS-PAGE was used to observe the protein elution, and the imidazole eluent containing the most and purest target protein was concentrated and desalted using a desalting column.

[0092] (9) Regeneration of nickel column: Add 5 mL of EDTA and let stand for 10-20 min before releasing; add 5 min of 8 M urea and let stand for 10-20 min before releasing; add 20 mL of anhydrous ethanol, 20 mL of 75% ethanol, 20 mL of 50% ethanol, and 20 mL of 20% ethanol; add 40 mL of deionized water to rinse; add 2 mL of NaCl, mix well, and let stand for 10-20 min; rinse with 20-40 mL of deionized water; store in 20% ethanol solution for long-term storage.

[0093] 2.2.7 Biacore molecular interaction detection of MCR-1 protein and CSA The Biacore T200 system and CM5 chip were used to detect the kinetics and affinity of small molecules binding to proteins. Biacore technology, developed in 1990, is a novel biosensing and analytical technique based on the physical optical phenomenon of surface plasmon resonance (SPR). Biacore technology can detect interactions between proteins and macromolecules (such as proteins themselves), proteins and small molecules (such as monomers of traditional Chinese medicine and nucleic acids), and cells and viruses.

[56] In recent years, Biacore technology has been widely applied in fields such as biology and medicine to determine kinetic constants and sample concentrations, analyze complex functions, and study interaction patterns between biomolecules. It mainly consists of three parts: a sensor chip, a microfluidic chuck, and auxiliary analysis software. The sensor chip is the primary site for biomolecule coupling in Biacore; the microfluidic chuck is a computer-controlled liquid transfer system that offers precision and repeatability; and the auxiliary analysis software is used to analyze the obtained sensor data.

[57] .

[0094] Biacore technology's detection principle primarily relies on light polarization. When incident light undergoes total emission at a medium surface, the intensity of the reflected light is the same at all angles. By depositing a thin metal film on the medium surface, the incident light induces resonance in the free electrons within the metal, causing the reflected light to weaken within a certain angle. The angle at which the reflected light completely disappears is called the resonance angle. The resonance angle changes with the refractive index of the liquid phase passing through the gold film surface, and this change in refractive index is proportional to the mass of the biomolecules bound to the metal film surface. When proteins are immobilized on the surface of the sensing chip, and the sample flows through the detection chip via a liquid microfluidic channel, if the analyte binds to the protein, the mass on the chip surface changes, the resonance angle changes, and the recorded response value (Response, Ru) also changes. Similarly, when the buffer solution flows through the chip surface, if the analyte dissociates from the protein, the corresponding response value also changes. By performing fitting analysis on these changes in response value, information such as the affinity and specificity between biomolecules can be obtained. [58-61] .

[0095] 2.2.7.1 Ligand pre-enrichment (1) Install the CM5 chip in the Biacore T200 and first rinse the system with coupling buffer (1.05×PBS-p+).

[0096] (2) Use 2 channels for ligand pre-enrichment experiments. Select appropriate pH sodium acetate solution according to the isoelectric point of the protein. Generally, pH 4.0, pH 4.5, pH 5.0, and pH 5.5 are used.

[0097] (3) Use manual mode, set the flow rate to 10 μL / min, and set the channel to Flow path 2.

[0098] (4) Prepare four 1.5ml EP tubes. Take 2μl of ligand and add 98μl of sodium acetate buffer at different pH (10mM, pH 4.0, 4.5, 5.0, 5.5). Mix thoroughly. The final concentration of the ligand is about 20μg / ml. Take another 1.5ml EP tube and add 200ul of sodium hydroxide (50mM).

[0099] (5) Install the test tube rack into the Biacore T200, record the positions of several EP tubes, click the injection command, and click the position of the pH 5.5 sodium acetate solution in the sample position diagram. Set the injection time to 120 seconds. Then click the regeneration command and select the position of NaOH, with an injection time of 30 seconds. Repeat this command to inject sodium acetate solutions of other pH values.

[0100] (6) Based on the generated signal graph, determine the highest and lowest values ​​that sodium acetate can couple at different pH values, and then determine the optimal pH value to conduct the formal experiment based on the difference between the two values.

[0101] 2.2.7.2 Ligand Coupling The target protein was coupled to the CM5 chip using the amino-coupled method, according to formula R. max =(analyte MW / ligand MW)×R L ×S m Calculate the coupling quantity. The specific method is as follows: (1) The amino coupling was performed using the automatic immobilization method. The ligand name, coupling amount / coupling time were input into the two channels according to the program requirements, and EHC, NHS and NaOH were placed in the corresponding positions. The program was then started.

[0102] (2) The amino coupling was performed using the manual run method. First, the Flow Path 1 channel was treated with a flow rate of 10 μL / min. The EP tube containing EDC / NHS was placed at position R1D1, and the ethanolamine was placed at position R1D3.

[0103] (3) First, perform activation by clicking the injection command and clicking the R1D1 position in the sample location diagram. Set the injection time to 420 seconds. Then, perform blocking by clicking the injection command and clicking the R1D1 position in the sample location diagram. Set the injection time to 300 seconds.

[0104] (4) Process the Flow Path 1 channel, Flow rate: 10 μL / min, place the EP tube with EDC / NHS mixture in position R1D1, place the protein with pH 4.0 (diluted at least 20 times) in position R1D2, and place ethanolamine in position R1D3.

[0105] (5) First, activate the sample by clicking the injection command and then clicking the R1D1 position in the sample location map. Set the injection time to 420 seconds.

[0106] (6) Perform coupling again. Click the injection command and click position R1D1 in the sample location map. Set the injection time to 300 seconds. If the target coupling amount is reached, perform closure; if not, repeat this command until the target coupling amount is reached.

[0107] (7) Finally, perform the sealing. Click the injection command and click the R1D1 position in the sample location map. Set the injection time to 300 seconds.

[0108] (8) After all commands are completed, click End Command to exit manual run mode.

[0109] 2.2.7.3 Sample Testing (1) The running buffer for small molecule samples is PBS-P+ containing 5% DMSO. First, prepare 200 mL of running buffer containing 5% DMSO, and prepare PBS-P+ containing 4.5% and 5.8% DMSO to prepare solvent calibration curves. The calibration curve preparation method is shown in Table 10 below: (2) Use a running buffer containing 5% DMSO to prepare analytes of different concentration gradients, with at least 5 consecutive concentrations and one 0 concentration and a repeat concentration.

[0110] (3) Use Wizard→Assay→kinetics / Affinity to perform sample cycling detection. Flow path channel selection: 2-1, Chip type selection: CM5. Cancel the regeneration command and add the solvent correction command.

[0111] (4) Injection time: 60s, flow rate: 30μL / min, dissociation time: 60s. Enter the analyte concentration from low to high and then enter the repeat concentration after the highest concentration. 5. Place the EP tubes in the test tube rack according to the location diagram. Save the settings and results, and start the detection.

[0112] 2.3 Results 2.3.1 mcr-1 Gene amplification and recombinant plasmid pET28a- mcr-1 Construction Using plasmids extracted from strain JD08 as DNA templates, specific primers were designed, and PCR amplification was performed. mcr-1 The gene and its product were identified by 1% agarose gel electrophoresis and were found to be related to the target gene. mcr-1 Same size Figure 7 The product was purified and ligated into the vector pET-28a to construct the recombinant plasmid pET28a- mcr-1 The recombinant vector plasmid was transformed into DH5 competent cells, and single colonies were picked and processed... BamH I, Xho I. Identification by double restriction endonuclease digestion and detection by 1% agarose gel electrophoresis; the bands were consistent in size with the target band. Figure 8 ).

[0113] 2.3.2 Induced expression of MCR-1 protein pET28a- mcr-1 The recombinant vector plasmid was transformed into BL21(DE3) competent cells. SDS-PAGE analysis showed that MCR-1 protein was expressed in the supernatant. The optimal expression conditions were 16℃ for 12 h and IPTG concentration of 1 mM. Therefore, protein expression was induced under these conditions, and the results are shown in the figure. Figure 9 .

[0114] 2.3.3 Purification of MCR-1 protein The bacterial culture was purified by nickel column chromatography after sonication, and eluted with imidazole solutions of 5 mM, 10 mM, 20 mM, 40 mM, 60 mM, 80 mM, 100 mM, and 250 mM, respectively. SDS-PAGE showed expression of the target protein at 38 kDa, consistent with expectations. Elution with 80 mM imidazole yielded a large amount of protein with high purity and no other protein contaminants. Figure 10 ).

[0115] 2.3.4 Detection of Biacore molecular interaction between MCR-1 protein and CSA The CM5 chip conjugated to MCR-1 protein was reacted with different concentrations of CSA to detect the affinity between MCR-1 protein and CSA. Biacore analysis showed that CSA interacts with MCR-1 protein, and the response value continuously increases with increasing CSA concentration. Based on the fitting results... Figure 11 Analysis showed that the affinity constant between MCR-1 protein and its small molecule inhibitor CSA was 13.7 μmol / L, which is less than 1 mmol / L, indicating that there is a direct binding between the two. CSA is a small molecule inhibitor of MCR-1 protein.

[0116] 2.4 Conclusion This invention is based on mcr-1The plasmid extracted from the positive Escherichia coli JD08 strain was used as a DNA template for amplification. mcr-1 The gene was ligated into the pET-28a vector to construct the recombinant expression vector plasmid pET28a- mcr-1 ,use E. coli BL21(DE3) was used for induced expression. Preliminary screening of induction temperature, time, and inducer concentration revealed that MCR-1 protein was expressed in both the supernatant and precipitate. Since this experiment aimed to verify whether CSA could bind to MCR-1 protein in vitro, active MCR-1 protein was required. If inclusion bodies were used for purification, the inclusion body protein would need to be treated to restore its activity, which was complex and the purified protein was prone to losing its activity. Therefore, we determined the optimal expression conditions to be 16℃ for 12 h with an IPTG concentration of 1 mM. Under these conditions, the protein was extensively induced and purified.

[0117] MCR-1 protein belongs to the phosphoethanolamine transferase family, and its substrates are phosphoethanolamine and lipid A. We initially designed two methods to verify the in vitro inhibitory effect of MCR-1 protein. The first method involved reacting different concentrations of MCR-1 protein, different concentrations of CSA, and sufficient amounts of standard substrates phosphoethanolamine and lipid A in vitro, simulating the in vivo bacterial environment. The reactants were then analyzed by TLC and mass spectrometry. The second method used a Biacore macromolecular interaction analyzer for verification. Considering the complexity of selecting reaction time, temperature, and sample concentration in the in vitro simulated reaction, and that TLC and mass spectrometry can only indicate whether binding occurs, but not the specific binding affinity, we chose Biacore to verify the affinity between the two. The results demonstrated that CSA interacts with MCR-1 protein.

Claims

1. Application of the combination of cuscuta acid and polymyxin B in the preparation of drugs that inhibit the growth of mcr-1 positive Escherichia coli.

2. The application as described in claim 1, characterized in that, The mass ratio of cuscuta acid to polymyxin B is 3-20:

1.

3. A pharmaceutical composition for inhibiting the growth of mcr-1 positive Escherichia coli, characterized in that, The pharmaceutical composition consists of cuscuta acid and polymyxin B.

4. The pharmaceutical composition according to claim 3, characterized in that, The mass ratio of cuscuta acid to polymyxin B is 3-20:

1.

5. The use of the pharmaceutical composition according to claim 3 or 4 in the preparation of a drug for inhibiting the growth of mcr-1 positive Escherichia coli.

Images