Use of emp3 as a target for treating chronic kidney disease

Abstract

The present application provides an sgRNA targeting the mRNA of an EMP3 gene and a corresponding CRISPR-Cas13d system, the gene editing efficiency is high, and the expression of EMP3 in mouse TCMK1 cells and kidney tissues can be effectively inhibited, as an EMP3 inhibitor, the progress of chronic kidney disease renal fibrosis can be significantly delayed through gene editing, and a new target and treatment strategy is provided for the clinical treatment of chronic kidney disease renal fibrosis.

Description

Technical Field

[0001] This invention belongs to the field of gene editing, specifically relating to the use of EMP3 inhibition as a target for the treatment of chronic kidney disease. Background Technology

[0002] Chronic kidney disease (CKD) is a chronic disease characterized by structural damage and functional impairment of the kidneys, caused by various factors. CKD can progress to renal fibrosis. Renal fibrosis is a pathophysiological change characterized by the loss of normal nephrons, proliferation of numerous fibroblasts and myofibroblasts, and accumulation of extracellular matrix, leading to glomerular sclerosis and tubulointerstitial fibrosis. It is a major cause of end-stage renal failure. Currently, there are no effective treatments or methods to delay or treat renal fibrosis.

[0003] Epithelial membrane protein 3 (EMP3) is a member of the peripheral myelin-associated epithelial membrane protein (PMP22) gene family. The human EMP3 gene is located on chromosome 19q13.3 and encodes a 163-amino acid myelin-associated epithelial membrane protein 3. The function of the protein encoded by the EMP3 gene is related to the regulation of cell proliferation, differentiation, activation of apoptosis pathways, and cell-cell interactions. Studies have found that the EMP3 gene is overexpressed in oligodendrogliomas. Furthermore, differential expression of EMP3 has been reported in primary glioblastoma, breast tumors, prostate tumors, and T-cell tumors. Therefore, EMP3 is considered a potential target for cancer therapy. However, the relationship between the EMP3 gene and renal fibrosis has not yet been reported.

[0004] In recent years, with the maturity of gene editing technology, researchers have widely applied gene editing technology to the study of disease-related genes, the establishment of disease models, and the exploration of drug targets. The existing gene editing technology is based on CRISPR system gene editing as the research hotspot. Currently, there are three types that have received the most attention: (1) CRISPR-Cas9: It is a complex with endonuclease activity that recognizes specific DNA sequences and cuts double-stranded DNA at specific sites. In the absence of a template, non-homologous recombination occurs, causing frameshift mutations in the gene, thereby inhibiting gene expression. (2) CRISPR-Cas12: It is also an endonuclease that forms a semi-closed R-loop when recognizing DNA sequences. It can only form a closed R-loop when recognizing a specific target fragment, thus having higher targeting than Cas9. (3) CRISPR-Cas13d: It is a type of RNA-mediated targeted RNA cutting system, which is often used in the fields of RNA knockdown, single base editing, etc. Among these systems, Cas9 and Cas12 primarily target DNA, resulting in permanent gene cleavage that may affect gene function in normal tissues, and their gene knockdown efficiency is not high. In contrast, CRISPR-Cas13d mainly reduces the expression of the target gene by cutting RNA, making the results somewhat reversible, and the edited protein has the smallest molecular weight, making it easier for vector transfection.

[0005] However, although there are reports of knocking down AMPK and IGFBP4-1 genes in CHO suspension cells using the CRISPR-Cas13d system, further research is needed to explore the design of targeted sgRNAs for the EMP3 gene and the effects of inhibiting EMP3 on the development of diseases such as renal fibrosis in chronic kidney disease. Summary of the Invention

[0006] The purpose of this invention is to provide a CRISPR-Cas13d system for inhibiting EMP3 gene expression and the use of EMP3 inhibitors.

[0007] This invention provides an sgRNA that targets EMP3 gene mRNA, with the sequence shown in any one of SEQ ID NO. 1 to 4.

[0008] Furthermore, the sequence of the above-mentioned sgRNA is shown in SEQ ID NO.1.

[0009] The present invention also provides a recombinant vector that expresses the above-mentioned sgRNA.

[0010] The present invention also provides a CRISPR-Cas13d system, which is a combination of any item from group A and any item from group B, or any item from group C:

[0011] Group A: sgRNA, plasmids expressing sgRNA, and viruses expressing sgRNA;

[0012] Group B: Cas13d protein, plasmids expressing Cas13d protein, and viruses expressing Cas13d protein;

[0013] Group C: Recombinant plasmids expressing sgRNA and Cas13d protein, and recombinant viruses expressing sgRNA and Cas13d protein;

[0014] The sgRNA is the sgRNA described above.

[0015] Furthermore, it is a recombinant plasmid expressing sgRNA and Cas13d protein.

[0016] The present invention also provides a method for inhibiting the expression of the EMP3 gene in mouse kidney cells or tissues, comprising the step of transfecting the above-described CRISPR-Cas13d system into mouse kidney cells or tissues;

[0017] Preferably, the method for transfecting mouse kidney cells is in situ electrochemical conversion.

[0018] The present invention also provides the use of EMP3 inhibitors in the preparation of medicaments for the treatment of chronic kidney disease.

[0019] Furthermore, the aforementioned drugs are for the prevention or treatment of kidney damage or renal fibrosis in patients with chronic kidney disease.

[0020] Furthermore, the aforementioned EMP3 inhibitors include reagents that knock out or knock down the EMP3 gene, reagents that inhibit EMP3 gene expression, or reagents that reduce the body's EMP3 protein content.

[0021] Furthermore, the above-mentioned EMP3 inhibitor is a reagent that inhibits the expression of the EMP3 gene, preferably a reagent that knocks down the mRNA of the EMP3 gene; more preferably the above-mentioned CRISPR-Cas13d system.

[0022] The beneficial effects of this invention are as follows: This invention provides an sgRNA targeting EMP3 gene RNA and the corresponding CRISPR-Cas13d system, which has high gene editing efficiency and can effectively inhibit the expression of EMP3 in mouse TCMK1 cells and kidney tissue. As an EMP3 inhibitor, it can significantly delay the progression of renal fibrosis in chronic kidney disease, providing a new target and treatment strategy for the clinical treatment of renal fibrosis in chronic kidney disease.

[0023] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.

[0024] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description

[0025] Figure 1 The spectrum is for pSpCas9(BB)-2A-GFP(PX458).

[0026] Figure 2 This is a schematic diagram of the modified gene fragment after homologous recombination.

[0027] Figure 3 The image shows the modified Pro-cas13d-NLS carrier.

[0028] Figure 4 The gene editing efficiency of the CRISPR-Cas13d system constructed with four different sgRNA sequences was validated in TCMK1 cells.

[0029] Figure 5 Immunohistochemical detection of Emp3 protein expression (A) and Q-rtPCR and WB detection of EMP3 content (B).

[0030] Figure 6 Immunohistochemical staining of kidney tissue sections was used to detect Fn and Coli (A), Q-rtPCR was used to quantitatively analyze the expression of Fn and Coli in kidney tissue (BC), Western blotting was used to detect the protein content of Fn and Coli (D), and semi-quantitative analysis of Fn and Coli protein was performed (EF).

[0031] Figure 7 Results of HE staining (A) and Masson staining (B) of kidney tissue sections. Detailed Implementation

[0032] The raw materials and equipment used in this invention are all known products, obtained by purchasing commercially available products.

[0033] The four sgRNA sequences designed based on the target gene EMP3 in this invention are as follows:

[0034] sgRNA1(SEQ ID NO.1)(5'→3'):

[0035] AAGACAAGAATGAGGATGTGGAGGGCAGAG

[0036] sgRNA2(SEQ ID NO.2)(5'→3'):

[0037] ATACCACAGGTTCAGGGACTCTTTGTCTGG

[0038] sgRNA3(SEQ ID NO.3)(5'→3'):

[0039] TCACTGACGTTACTGCAGGCCCATGTTTGA

[0040] sgRNA4(SEQ ID NO.4)(5'→3'):

[0041] GACTTGTCCAAAGTGGCCACAAAAAGCAAG

[0042] Example 1: Construction of a CRISPR-Cas13d system targeting EMP3 gene mRNA

[0043] 1. Carrier modification

[0044] Step 1: Using pSpCas9(BB)-2A-GFP(PX458) (Addgene, #48138) as the vector template, primers were designed, and the basic elements for plasmid amplification were obtained by PCR (specific primer sequences are: Forward primer (SEQ ID NO.5): 5'-taactagagctcgctgatcagcc-3'; Reverse primer (SEQ ID NO.6): 5'-acatgtgagcaaaaggccagc-3'). After electrophoresis verification, the vector DNA was obtained by gel extraction; the amplified vector pattern is shown below. Figure 1 As shown.

[0045] Step 2: The company synthesized the sequence (U6-DR-CMV-NLS-Cas13d-NLS-FLAG). After synthesis, homologous recombination was performed using the seamless cloning method with the PCR and synthesized sequence obtained in Step 1. After bacterial transformation, the bacteria were cultured in a companion culture containing ampicillin for 12-16 hours. The modified gene fragment after homologous recombination is as follows: Figure 2 As shown.

[0046] Step 3: Select single clones for overnight culture, extract plasmids, and send them for sequencing identification to obtain the eukaryotic knockdown vector Pro-cas13d-NLS with the full-length sequence. The map is shown below. Figure 3 As shown.

[0047] 2. Construction of EMP3 knockdown vector

[0048] After the modified vector is digested with BbsI (the restriction site is at 3257-3283), the phosphorylated sgRNA oligos sticky ends (sgRNA1, sgRNA2, sgRNA3, or sgRNA4) are ligated to the sgRNA fragment using T4 DNA ligase, forming a complete plasmid expressing sgRNA. The sequence is as follows:

[0049]

[0050]

[0051]

[0052]

[0053] The CRISPR-Cas13d system that targets EMP3 gene mRNA was finally obtained.

[0054] The following experimental examples demonstrate the beneficial effects of the present invention.

[0055] Experimental Example 1: Knockdown of EMP3 gene RNA in mouse renal tubular epithelial cells (TCMK-1)

[0056] The plasmid constructed in Example 1 was transfected into mouse renal tubular epithelial cells (TCMK-1) using PEI transfection reagent. RNA was extracted from the cells using Trizol reagent. The expression level of EMP3 (primers: F(SEQ ID NO.11): 5'-GGTCTCTGCCCTCCACAT-3', R(SEQ ID NO.12): 5'-TGTTCCACGTGCAGTCATAC-3') was detected by Qrt-PCR. A control group (Control) without plasmid transfection and a control group (Vector) transfected with the empty vector were also included. The results are as follows: Figure 4 As shown.

[0057] It can be seen that sgRNA1, sgRNA2, sgRNA3 and sgRNA4 can all achieve effective EMP3 gene RNA targeting, among which the sgRNA1 / Cas13d system has the highest gene editing efficiency.

[0058] Experimental Example 2: Knockdown of EMP3 gene RNA in mouse kidney tissue

[0059] C57BL / 6 (8 weeks, 22-25g) male mice were intraperitoneally injected with 1% sodium pentobarbital. After anesthetizing the mice, the skin was cut open at the epidermis of the right kidney tissue structure to expose the right kidney. The renal vein, renal artery, and ureter were separated. The ureter was clamped with a surgical clamp, and about 100 μl of plasmid (plasmid concentration = 1 μg / μl, plasmid construction method is the same as in Example 1, using a plasmid expressing sgRNA1) was injected into the ureter using a 36G injection needle. The injection was considered successful when the kidney swelled and turned pale. Cut sterile paper into pieces approximately the size of the kidney, moisten with physiological saline, and place it on both sides of the kidney. Wait 5 minutes to allow the plasmids to fully penetrate the kidney surface. Then, gently clamp the kidney wrapped in the moist sterile paper with electrodes. When the resistance is <500Ω, electrospinning can begin (parameters: electrospinning voltage (Pd V) = 50V, electrospinning current (Pd A) = 300mA, instantaneous electrospinning duration (Pd on) = 50.0ms, instantaneous electrospinning rest duration (Pd off) = 1000ms, total number of electrospinning cycles (Pd...). N) = 4 times. After electroporation, ureteral ligation was performed on the kidney side to create a mouse model of renal fibrosis (modeling method: SPF-grade male C57BL / 6J mice, 8 weeks old, weighing 20-22g, were anesthetized with pentobarbital via intraperitoneal injection. The back hair was removed and the area disinfected. An incision was made on the left side of the spine, separating the fascia, muscle, and fat to expose the ureter. The ureter was double-ligated near both the hilum and bladder ends using No. 4 silk suture. The middle ureter was cut. After confirming no significant bleeding in the surgical field, the intestines were straightened, and the muscles and skin were sutured using a wound suture device. The mice were placed in an incubator post-surgery until they recovered, then transferred to a rearing cage. Seven days after modeling, the mice were sacrificed and specimens collected) (UUO&shEmp3 group).

[0060] Simultaneously, a sham operation group (Sham) without electroporation and renal fibrosis modeling treatment was set up, a renal fibrosis model group (UUO) without electroporation but with renal fibrosis modeling treatment was set up, and a control group (E&UUO) in which 100 μL of physiological saline was injected into the ureter, electroporated normally according to the corresponding electroporation parameters, and then the mice were subjected to renal fibrosis modeling treatment.

[0061] Seven days after the animal surgery, kidney tissue was harvested for further verification. The expression of Emp3 and fibrosis markers such as Fn and coli were detected by Q-rtPCR, WB, and immunohistochemistry. The progression of kidney injury and fibrosis in mice was verified by HE staining and Masson staining of kidney tissue sections.

[0062] The results are as follows Figures 5-7As shown, the CRISPR-Cas13d system targeting EMP3 gene RNA of this invention can effectively inhibit the expression of EMP3 gene in kidney tissue, reduce the expression of fibrosis markers Fn and coli, effectively inhibit vasodilation, and reduce the expression of collagen fibers, thereby effectively delaying the progression of kidney damage and fibrosis in chronic kidney disease.

[0063] In summary, this invention provides an sgRNA targeting EMP3 gene mRNA and the corresponding CRISPR-Cas13d system, which has high gene editing efficiency and can effectively inhibit the expression of EMP3 in mouse TCMK1 cells and kidney tissue. As an EMP3 inhibitor, it can significantly delay the progression of renal fibrosis in chronic kidney disease, providing a new target and treatment strategy for the clinical treatment of renal fibrosis in chronic kidney disease.

Claims

1. An sgRNA targeting EMP3 gene mRNA, characterized in that, The sequence is shown in SEQ ID NO.

1.

2. A recombinant vector, characterized in that, It is a recombinant vector expressing the sgRNA of claim 1.

3. A CRISPR-Cas13d system, characterized in that, It is a combination of any item from Group A and any item from Group B, or any item from Group C: Group A: sgRNA, plasmids expressing sgRNA, and viruses expressing sgRNA; Group B: Cas13d protein, plasmids expressing Cas13d protein, and viruses expressing Cas13d protein; Group C: Recombinant plasmids expressing sgRNA and Cas13d protein, and recombinant viruses expressing sgRNA and Cas13d protein; The sgRNA is the sgRNA described in claim 1.

4. The CRISPR-Cas13d system as described in claim 3, characterized in that, It is a recombinant plasmid expressing sgRNA and Cas13d protein.

5. Use of an EMP3 inhibitor in the preparation of a medicament for the prevention or treatment of chronic kidney disease in mice, wherein the EMP3 inhibitor is the CRISPR-Cas13d system of claim 3 or 4, and the chronic kidney disease is renal fibrosis.

Images