Mutant plasmid combination for preventing and treating tomato yellow leaf curl virus disease and application thereof

Abstract

The application discloses a mutant plasmid combination for preventing and treating tomato yellow leaf curl virus disease and application thereof, and belongs to the technical field of plant virology and molecular biology. F R2-2b PTI-TYC1C4-1, pCC F R2-2b PTI-TYC1C4-2, pCC F R2-2b PTII-TYV1V2, pCC F R2-2b PTII-TYC1C2, pCC F R2-2b PTII-TYC1C4-1, pCC F R2-2b PTII-TYC1C4-2, pCC F R2-2b PTII-TYC2C3-1, pCC F R2-2b PTII-TYC2C3-2, pCC F R2-2b PTIII-TYRep, pCC F R2-2b PTIII-TYR-Rep at least one mutant plasmid. The mutant plasmid combination of the application has a prevention and treatment effect on TYLCV infection after being mixed with wild type CMV RNA1 and RNA3 and being inoculated in advance; moreover, the skeleton structure of the CMV RNA2 mutant plasmid is stable, the safety is high, a vaccine material and an effective prevention and treatment measure are provided for preventing and treating plant diseases caused by TYLCV in a field.

Description

Technical Field

[0001] This invention relates to the fields of plant virology and molecular biology, specifically to mutant plasmid combinations for controlling tomato yellow leaf curl virus disease and their applications. Background Technology

[0002] Plant viral diseases, often referred to as "plant cancer," are among the most significant crop diseases. They cause severe losses to crop production worldwide each year, with direct losses exceeding $30 billion annually. Controlling viral diseases remains a global challenge in agricultural production.

[0003] Cross-protection based on attenuated strains is a relatively effective control measure. Cross-protection refers to the protection of plants infected by an attenuated strain of a virus from subsequent infection by a virulent strain of the same virus. Currently, the most widely accepted cross-protection mechanisms are "gene silencing - RNA interference" and "superinfection exclusion." "Gene silencing - RNA interference" refers to the process where double-stranded RNA (dsRNA) produced during viral replication is recognized and cleaved into siRNAs by Dicer-like (DCL) enzymes. These siRNAs then bind to substances such as AGO proteins in the plant to form an RNA-induced silencing complex (RISC). This complex, guided by one strand of the siRNA, specifically degrades its homologous mRNA, thereby silencing the relevant gene. "Superinfection exclusion" refers to the spatial separation between strains of the same virus commonly observed in double-infected plant tissues. This mechanism is of great significance for cross-protection.

[0004] As early as the mid-20th century, there were cases of using cross-protection to control plant viral diseases. In recent years, with the rapid development of molecular biology technology, people have gained a deeper understanding of cross-protection mechanisms, and the application of cross-protection technology to control plant viral diseases has gradually become a mainstream method for the prevention and control of viral diseases.

[0005] For example, cross-protection against RNA viruses using attenuated RNA viruses: (1) In the mid-20th century, Citrus Decay Virus (CTV) spread widely in Brazil. Grant and Costa (1951) were the first to isolate a mild CTV strain. By the end of the 20th century, 80 million sweet orange trees in Brazil were cross-protected using mild strains. (2) In 1991, Lecoq and his colleagues described a mild zucchini yellow mosaic virus strain (ZYMV-WK), which was used for cross-protection of zucchini under field conditions in France. Compared with unprotected control plants subsequently infected with a severe ZYMV strain, the protected plants produced a higher yield of marketable fruit. Many other RNA viruses are controlled by attenuated RNA vaccines, such as Tomato Mosaic Virus (ToMV), Tomato Spotted Wilt Virus (TSWV), Tobacco Mosaic Virus (TMV), etc.

[0006] Using attenuated DNA viruses to control cross-protection against DNA viruses: (1) Recovered plants inoculated with Pepper Golden Mosaic Virus (PepGMV) for 24 days followed by inoculation with the same virus did not show any symptoms in new tissues (Carrillo-Tripp et al., 2006). (2) African cassava mosaic virus (ACMV) DNA-A induced resistance to both African cassava mosaic virus (ACMV) and East African cassava mosaic virus Cameroon virus (EACMCV), which enabled plants to recover from severe symptoms caused by EACMCV (Fondong et al., 2020). Related research is limited and is currently still in the laboratory research stage.

[0007] Currently, attenuated RNA virus vaccines are widely used to prevent and treat RNA virus diseases, while there are fewer cases of attenuated DNA virus vaccines being used to prevent and treat DNA viruses. There are no reports of attenuated RNA virus vaccines being used to prevent and treat DNA viruses.

[0008] Tomato yellow leaf curl virus (TYLCV) belongs to the genus Begomovirus in the family Geminiviridae. It is a type of plant DNA virus with twinned particle morphology. TYLCV has a diverse host range and has been detected in 49 plant species across 16 families. Infection with TYLCV in tomatoes manifests as stunted growth, curling and yellowing of leaves, reduced yield, and can lead to total crop failure if infected during the seedling stage.

[0009] Regarding the cross-protective effect against Tomato Yellow Leaf Curl Virus (TYLCCNV), Ye Jian et al. found that the βC1 gene deletion mutant of the satellite DNAβ molecule associated with the Y10 isolate of TYLCCNV can mediate the cross-protective effect between homologous and heterologous DNAβ (“Preliminary Study on Cross-Protection Mediated by βC1 Deletion Mutant of DNAβ Molecule Associated with TYLCCNV”, Journal of Zhejiang University (Agricultural and Life Sciences Edition), 2006). However, due to the low nucleotide sequence homology of DNAβ molecules from different viruses, the protective effect against heterologous wild-type DNAβ is far less than that against homologous DNAβ. Summary of the Invention

[0010] In view of the above-mentioned prior art, the purpose of this invention is to provide a mutant plasmid combination for the control of tomato yellow leaf curl virus (TYLCV) and its application. This invention uses a mutant plasmid of cucumber mosaic virus RNA2 as a vector, inserting different coding frame fragments of TYLCV into its multiple cloning site (MCS) to obtain a mutant plasmid combination. Pre-inoculation with a mixture of the mutant plasmid combination of this invention and wild-type CMV RNA1 and RNA3 shows a control effect against TYLCV infection; moreover, the CMV RNA2 mutant plasmid has a stable backbone structure and high safety in use, providing vaccine material and an effective control measure for the field control of plant diseases caused by TYLCV.

[0011] To achieve the above objectives, the present invention adopts the following technical solution:

[0012] A first aspect of the present invention provides a combination of mutant plasmids for controlling tomato yellow leaf curl virus disease, comprising at least one of the following mutant plasmids:

[0013] (1) pCC F R2-2bPTI-TYC1C4-1 contains CMV Fny The mutant RNA2 isolated from the isolate, the nucleotide sequence of which is shown in SEQ ID NO.1;

[0014] (2) pCC F R2-2bPTI-TYC1C4-2 contains CMV Fny The mutant RNA2 isolated, the nucleotide sequence of which is shown in SEQ ID NO.2;

[0015] (3) pCC F R2-2bPTII-TYV1V2 contains CMV Fny The mutant RNA2 isolated, the nucleotide sequence of which is shown in SEQ ID NO.3;

[0016] (4) pCC F R2-2bPTII-TYC1C2 contains CMV Fny The mutant RNA2 isolated, the nucleotide sequence of which is shown in SEQ ID NO.4;

[0017] (5) pCC F R2-2bPTII-TYC1C4-1 contains CMV Fny The mutant RNA2 isolated, the nucleotide sequence of which is shown in SEQ ID NO.5;

[0018] (6) pCC F R2-2bPTII-TYC1C4-2 contains CMV Fny The mutant RNA2 isolated from the isolate, the nucleotide sequence of which is shown in SEQ ID NO.6;

[0019] (7) pCC F R2-2bPTII-TYC2C3-1 contains CMV Fny The mutant RNA2 isolated from the isolate, the nucleotide sequence of which is shown in SEQ ID NO.7;

[0020] (8) pCC F R2-2bPTII-TYC2C3-2 contains CMV Fny The mutant RNA2 isolated from the sample, the nucleotide sequence of which is shown in SEQ ID NO.8;

[0021] (9) pCC F R2-2bPTⅢ-TYRep contains CMV Fny The mutant RNA2 isolated from the isolate, the nucleotide sequence of which is shown in SEQ ID NO.9;

[0022] (10) pCC F R2-2bPTⅢ-TYR-Rep contains CMV Fny The mutant RNA2 isolated from the sample, the nucleotide sequence of which is shown in SEQ ID NO.10.

[0023] Preferably, the mutant plasmid combination is any of the following (1)-(3):

[0024] (1) Mutant plasmid pCC F R2-2bPTⅢ-TYRep and pCC FR2-2bPTⅢ-TYR-Rep is composed of equal volume ratios;

[0025] (2) The mutant plasmids pCCFR2-2bPTI-C1C4-1 and pCCFR2-2bPTI-C1C4-2 were composed of equal volume ratios;

[0026] (3) The mutant plasmids pCCFR2-2bPTII-C1C4-1 and pCCFR2-2bPTII-C1C4-2 are composed of equal volume ratios.

[0027] A second aspect of the present invention provides the application of the above-described mutant plasmid combination in (1) or (2) below:

[0028] (1) Prevention and control of tomato yellow leaf curl virus disease;

[0029] (2) Prepare a vaccine to prevent and control tomato yellow leaf curl virus disease.

[0030] Preferably, in the above applications, the vaccine is a live attenuated vaccine.

[0031] In a third aspect, the present invention provides an attenuated vaccine for the prevention and treatment of tomato yellow leaf curl virus disease, wherein the attenuated vaccine uses a combination of mutant plasmids as its active ingredient.

[0032] The mutant plasmid combinations are any of the following (1)-(3):

[0033] (1) Mutant plasmid pCC F R2-2bPTⅢ-TYRep and pCC F R2-2bPTⅢ-TYR-Rep is composed of equal volume ratios;

[0034] (2) The mutant plasmids pCCFR2-2bPTI-C1C4-1 and pCCFR2-2bPTI-C1C4-2 were composed of equal volume ratios;

[0035] (3) The mutant plasmids pCCFR2-2bPTII-C1C4-1 and pCCFR2-2bPTII-C1C4-2 are composed of equal volume ratios.

[0036] Furthermore, the attenuated vaccine also includes: CMV-containing... Fny RNA1 plasmids and CMV-containing Fny RNA3 plasmid.

[0037] A fourth aspect of the present invention provides a method for preventing and controlling tomato yellow leaf curl virus disease, comprising the following steps:

[0038] Combine the above mutant plasmids with CMV-containing plasmids FnyThe RNA1 and RNA3 plasmids of the isolates were mixed and inoculated.

[0039] The beneficial effects of this invention are:

[0040] The previously constructed mutant vector pCC for the 2b protein of cucumber mosaic virus RNA2 F R2-2bPTI, pCC F R2-2bPTII and pCC F Based on R2-2bPTIII, this invention further inserts different coding frame fragments of TYLCV into the multiple cloning site (MCS) to obtain 10 mutants of cucumber mosaic virus RNA2 containing TYLCV gene fragments. After transforming Agrobacterium tumefaciens, these plasmids were compared with those containing CMV. Fny Pre-inoculation with Agrobacterium tumefaciens containing wild-type RNA1 and wild-type RNA3 plasmids can prevent infection by virulent strains of TYLCV and can be used as a CMV attenuated vaccine against TYLCV. Attached Figure Description

[0041] Figure 1 CMV Fny pCC, a wild-type RNA2 and 2b protein premature termination mutant F R2-2bPTI, pCC F R2-2bPTII and pCC F Schematic diagram of RNA2 mutants with different fragment insertions from R2-2bPTIII and TYLCV. Note: CMV, Cucumber Mosaic Virus; TYLCV, Tomato Yellow Leaf Curl Virus; Base vector pCB301-CMV Fny -R2 contains CMV Fny Wild-type RNA2, whose transcript is CMV Fny -R2; intermediate carrier pCC F R2-2bPTI contains newly inserted polyclonal restriction sites BamHI, SpeI, and SmaI, and a subsequently inserted TAATAG double stop codon; its transcript is R2-2bPTI; the intermediate vector pCC F R2-2bPTII contains a premature termination mutation in the 2b protein, with TAATA inserted first, followed by the polyclonal restriction sites BamHI, SpeI, and SmaI. Its transcript is R2-2bPTII; the intermediate vector is pCC. F R2-2bPTⅢ contains a 2b protein deletion mutation and newly inserted TAATAG, as well as multiple clonal restriction enzyme sites BamHI, SpeI, and SmaI. Its transcript is R2-2bPTⅢ; pCC F R2-2bPTI-TYC1C4-1、pCC FR2-2bPTI-TYC1C4-2、pCC F R2-2bPTII-TYV1V2, pCC F R2-2bPTII-TYC1C2, pCC F R2-2bPTII-TYC1C4-1、pCC F R2-2bP TII-TYC1C4-2、pCC F R2-2bPTII-TYC2C3-1、pCC F R2-2bPTII-TYC2C3-2、pCC F R2-2bPTIII-TYRep and pCC F The transcripts of R2-2bPTIII-TYR-Rep are R2-2bPTI-C1C4-1, R2-2bPTI-C1C4-2, R2-2bPTII-V1V2, R2-2bPTII-C1C2, R2-2bPTII-C1C4-1, R2-2bPTII-C1C4-2, and R2-2bPTII-C1C4-2. II-C2C3-1, R2-2bPTII-C2C3-2, R2-2bPTIII-TYRep, R2-2bPTIII-TYR-Rep, where V1V2 represents TYLCV segments 308-457, C1C2 represents TYLCV segments 1484-1633, C1C4-1 represents TYLCV segments 2171-2320, C1C4-2 represents TYLCV segments 2321-2470, C2C3-1 represents TYLCV segments 1186-1335, C2C3-2 represents TYLCV segments 1336-1485, Rep represents TYLCV segments 1542-1841, and R-Rep represents reverse insertion of TYLCV segments 1542-1841.

[0042] Figure 2 TYLCV different segment insertion type CMV Fny Pathogenicity analysis of RNA2 mutants. Mock, Agrobacterium tumefaciens culture without plasmid; R1, CMV. Fny RNA1; R2, CMV Fny RNA2; R3, CMV Fny RNA3; R2-2bPTI-C1C4-1, R2-2bPTI-C1C4-2, R2-2bPTII-V1V2, R2-2bPTII-C1C2, R2-2bPTII-C1C4

[0043] -1, R2-2bPTII-C1C4-2, R2-2bPTII-C2C3-1, R2-2bPTII-C2C3-2, R2-2bPTIII-TYRep, and R2-2bPTIII-TYR-Rep are mutant CMVs. Fny RNA2.

[0044] Figure 3 Pre-inoculation with mutant pCC F R2-2bPTI-C1C4-2, pCC F R2-2bPTII-C1C4-2, pCC F R2-2bPTI-C1C4-1, pCC F R2-2bPTI-C1C4-2 mixture, pCC F R2-2bPTII-C1C4-1, pCC F R2-2bPTII-C1C4-2 mixture, R2-2bPTII-5 mixture (pCC) F R2-2bPTII-C1C2, pCC F R2-2bPTII-C1C4-1, pCC F R2-2bP TII-C1C4-2, pCC F R2-2bPTII-C2C3-1, pCC F R2-2bPTII-C2C3-2 mixture), R2-2bPTII-6 mixture (pCC) F R2-2bPTII-V1V2, pCC F R2-2bPTII-C1C2, pCC F R2-2bPTII-C1C4-1, pCC F R2-2bPTII-C1C4-2, pCC F R2-2bPTII-C2C3-1, pCC F R2-2bPTII-C2C3-2 mixture), pCC F R2-2bPTIII-TYRe p,pCC F R2-2bPTIII-TYR-Rep, R2-2bPTIII-TYRep+R-Rep mixture (pCC) F R2-2bPTIII-TYRep, pCC F Cross-protection effect of R2-2bPTIII-TYR-Rep mixture against TYLCV infection was analyzed. Mock consisted of Agrobacterium-containing bacterial suspension without plasmids; R1 consisted of CMV. Fny RNA1; R2, CMV FnyRNA2; R3, CMV Fny RNA3; TY, TYLCV. R2-2bPTI-C1C4-1, R2-2bPTI-C1C4-2, R2-2bPTII-V1V2, R2-2bPTII-C1C2, R2-2bPTII-C1C4-1, R2-2bPTII-C1C4-2, R2-2bPTII-C2C3-1, R2-2bPTII-C2C3-2, R2-2bPT III-TYRep, and R2-2bPTIII-TYR-Rep are pCC F R2-2bPTI-C1C4-1, pCC F R2-2bPTII-C1C4-2, pCC F R2-2bPTII-V1V2, pCC F R2-2bPTII-C1C2, pCC F R2-2bPTII-C1C4-1, pCC F R2-2bPTII-C1C4-2, pCC F R2-2bPTII-C2C3-1, pCC F R2-2bPTII-C2C3-2、pCC F R2-2bPTIII-TYRep, pC C F Transcript of R2-2bPTIII-TYR-Rep; dpi, days post-inoculation.

[0045] Figure 4 Pre-inoculation with mutant pCC F R2-2bPTI-C1C4-2, pCC F R2-2bPTII-C1C4-2, analysis of cross-protection against TYLCV infection. Mock represents Agrobacterium tumefaciens culture without plasmids; R1 represents CMV. Fny RNA1; R2, CMV Fny RNA2; R3, CMV Fny RNA3; TY, TYLCV. dpi, days post-inoculation. The first MOCK was a blank control, receiving nothing. The second MOCK underwent TYLCV challenge inoculation, simultaneously with pre-vaccinated tomatoes, serving as a positive control for TYLCV infection. The CMV Fny-R2-2bPTI vector can express amino acids, while the Fny-R2-2bPTII vector cannot. Inserting the same TYLCV fragment into both type I and type II vectors allows for comparison of whether the "SIE" mechanism is functioning.

[0046] Figure 5 Pre-inoculation with mutants, pCC F R2-2bPTIII-TYRep, pCC F R2-2bPTIII-TYR-Rep, R2-2bPTIII-TYRep+R-Rep mixture (pCC) F R2-2bPTIII-TYRep, pCC F Cross-protection effect of R2-2bPTIII-TYR-Rep mixture against TYLCV infection was analyzed. Mock consisted of Agrobacterium-containing bacterial suspension without plasmids; R1 consisted of CMV. Fny RN A1; R2, CMV Fny RNA2; R3, CMV Fny RNA3; TY, TYLCV. dpi, number of days after vaccination. The cross-protective effect of PTII I-Rep + PTIII-R-Rep mixed vaccination is better than that of each vaccine alone, indicating that mixed vaccination has better efficacy; compare the difference in cross-protective effect of PTIII-Rep and PTIII-R-Rep (i.e., TYLCV same fragment forward and reverse insertion vaccines) on tomatoes. Detailed Implementation

[0047] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0048] As mentioned earlier, plant viral diseases cause enormous damage to crops worldwide, and cross-protection is one of the effective methods for controlling them. Currently, the mainstream view on cross-protection is to use attenuated RNA viruses to control RNA viruses, or attenuated DNA viruses to control DNA viruses, but there are no reports of using attenuated RNA viruses to control DNA viruses.

[0049] Tomato yellow leaf curl virus (TYLCV) is a highly dangerous plant DNA virus, and currently there are no effective control measures for this disease.

[0050] Based on this, the present invention considers whether it is possible to achieve the purpose of preventing and controlling TYLCV by inserting TYLCV fragments into attenuated RNA viruses? Does the insertion of different coding region fragments of TYLCV affect the prevention and control effect? ​​Can the mixed inoculation of different attenuated mutants improve the prevention and control effect? ​​In order to answer these questions, we conducted a series of experiments to verify them.

[0051] The inventor of this patent has been deeply involved in the field of plant viral disease control for many years. In previous research, the inventor developed and designed a series of mutant plasmid vectors pCC containing RNA2 isolated from cucumber mosaic virus (CMV) Fny. F R2-2bPTI(CN108486148A), pCC F R2-2bPTII (CN 112961839A) and pCC F R2-2bPTⅢ (CN113388637A). To investigate the cross-protective effect of different vaccine strategies (different CMV vectors inserting the same TYLCV fragment, the same CMV vector inserting different TYLCV fragments, the same TYLCV fragment inserted into the same CMV vector in both forward and reverse directions, and a mixture of vaccines with different TYLCV insertion sequences in the same vector) on TYLCV infection in tomatoes, this invention attempts to use pCC... F R2-2bPTI, pCC F R2-2bPTII and pCC F Using R2-2bPTⅢ as the base vector, different coding region fragments of exogenous TYLCV were inserted to construct different mutant plasmids, namely:

[0052] pCC F Based on R2-2bPTI, the mutant plasmid pCC was constructed. F R2-2bPTI-TYC1C4-1 and mutant plasmid pCC F R2-2bPTI-TYC1C4-2.

[0053] pCC F R2-2bPTI is based on the full-length RNA2 sequence of the CMVFny isolate, with the insertion of a multiple cloning site containing BamHI, SpeI, and SmaI, and a TAATA sequence between positions 2661 and 2662 immediately following the stop codon of the 2a protein. The mutant plasmid pCC... F Taking R2-2bPTI-TYC1C4-1 as an example, it is in pCC F A fragment of the exogenous TYLCV C1C4-1 (2171-2320) coding region was inserted into the multiple cloning site of R2-2bPTI. The resulting mutant plasmid pCC was constructed. F R2-2bPTI-TYC1C4-1 contains CMV Fny The mutant RNA2 isolated from the isolate, the specific nucleotide sequence of which is as follows:

[0054]

[0055]

[0056] The lowercase letters are CMV. Fny RNA2 sequence, the italicized uppercase bases are partial fragments of TYLCV (MN432609.1 2171-2320), and the uppercase underlined bases are polyclonal restriction sites.

[0057] Correspondingly, the mutant plasmid pCC F R2-2bPTI-TYC1C4-2 is a mutant plasmid pCC. F The TYLCV fragment inserted in R2-2bPTI-TYC1C4-1 is replaced by C1C4-2 (2321-2470), which is the nucleotide fragment from position 2321 to 2470 of MN432609.1.

[0058] pCC F Based on R2-2bPTII, the mutant plasmid pCC was constructed. F R2-2bPTII-TYV1V2, pCC F R2-2bPTII-TYC1C2, pCC F R2-2bPTII-TYC1C4-1、pCC F R2-2bPTII-TYC1C4-2、pCC F R2-2bPTII-TYC2C3-1 and pCC F R2-2bPTII-TYC2C3-2.

[0059] pCC F R2-2bPTII is based on the full-length RNA2 sequence of the CMVFny isolate, with TAATAG inserted after position 2661, followed by the sequential introduction of BamHI, SpeI, and SmaI restriction sites. The mutant plasmid pCC... F Taking R2-2bPTII-TYC1C4-1 as an example, it is in pCC F A fragment of the exogenous TYLCV C1C4-1 (2171-2320) coding region was inserted into the multiple cloning site of R2-2bPTII. The resulting mutant plasmid pCC was constructed. F R2-2bPTII-TYC1C4-1 contains CMV Fny The mutant RNA2 isolated from the isolate, the specific nucleotide sequence of which is as follows:

[0060]

[0061]

[0062] The lowercase letters are CMV. FnyRNA2 sequence, the italicized uppercase bases are partial fragments of TYLCV (MN432609.1 2171-2320), and the uppercase underlined bases are polyclonal restriction sites.

[0063] Correspondingly, the mutant plasmid pCC F R2-2bPTII-TYC1C4-2 is a mutant plasmid pCC F The TYLCV fragment inserted in R2-2bPTII-TYC1C4-1 is replaced by C1C4-2 (2321-2470), which is the nucleotide fragment from position 2321 to 2470 of MN432609.1.

[0064] mutant plasmid pCC F R2-2bPTII-TYV1V2 is a mutant plasmid pCC. F The TYLCV fragment inserted in R2-2bPTII-TYC1C4-1 is replaced with V1V2 (308-457), which is the nucleotide fragment at positions 308-457 of MN432609.1.

[0065] mutant plasmid pCC F R2-2bPTII-TYC1C2 is a mutant plasmid pCC F The TYLCV fragment inserted in R2-2bPTII-TYC1C4-1 is replaced by C1C2(1484-1633), which is the nucleotide fragment at positions 1484-1633 of MN432609.1.

[0066] mutant plasmid pCC F R2-2bPTII-TYC2C3-1 is a mutant plasmid pCC. F The TYLCV fragment inserted in R2-2bPTII-TYC1C4-1 is replaced by C2C3-1(1186-1335), which is the nucleotide fragment at positions 1186-1335 of MN432609.1.

[0067] mutant plasmid pCC F R2-2bPTII-TYC2C3-2 is a mutant plasmid pCC. F The TYLCV fragment inserted in R2-2bPTII-TYC1C4-1 is replaced by C2C3-2 (1336-1485), which is the nucleotide fragment from position 1336 to 1485 of MN432609.1.

[0068] pCC F Based on R2-2bPTⅢ, the mutant plasmid pCC was constructed. F R2-2bPTⅢ-TYRep and mutant plasmid pCCF R2-2bPTⅢ-R-TYRep.

[0069] pCC F R2-2bPTⅢ is a deletion of the non-overlapping region (positions 2662-2751) of the 2a and 2b proteins, followed by the insertion of a double-stop codon TAATAG after position 2661, and then the insertion of BamHI, SpeI, and SmaI restriction sites. The mutant plasmid pCC... F Taking R2-2bPTⅢ-TYRep as an example, it involves inserting a foreign TYLCV Rep(1542-1841) coding region fragment into the multiple cloning restriction site. The resulting mutant plasmid pCC... F R2-2bPTⅢ-TYRep contains CMV Fny The mutant RNA2 isolated from the isolate, the specific nucleotide sequence of which is as follows:

[0070]

[0071]

[0072] The lowercase letters are CMV. Fny RNA2 sequence, the italicized uppercase bases are partial fragments of TYLCV (MN432609.1 1542-1841), and the uppercase underlined bases are polyclonal restriction sites.

[0073] Correspondingly, the mutant plasmid pCC F R2-2bPTⅢ-R-TYRep is a mutant plasmid pCC. F The TYLCV fragment inserted in R2-2bPTⅢ-TYRep is replaced with an inverse complementary sequence. The specific inverse complementary sequence is as follows:

[0074] gatgacgtagacccgcattatttaaagcacttcaaggaattcatgggggcccagagggactggcaaagcaacacaaagtacgggaagcccattcaaattaaagggggaattcccactatcttcctatgcaatccaggacctacctcctca tatagggaatatctagacgaagaaaaaaaacatatccttgaaaaattgggctctcaagaatgcaaccttcatcaccctctacgagccactgttcgcaagtatcaatcaaggtccaacacaagatagccaagaagaaaccaataaggcgtaa

[0075] The 10 mutant plasmids constructed above were transformed into Agrobacterium and then respectively combined with plasmids containing CMV. Fny Wild-type RNA1 and wild-type RNA3 plasmids were mixed and pre-inoculated with Agrobacterium to investigate their effectiveness in controlling Tomato Yellow Leaf Curl Virus (TYLCV) infection. The results showed that tomato plants pre-inoculated with these attenuated mutants exhibited good protection against subsequent TYLCV infection. This is the innovation of this study. The results demonstrate that inserting exogenous TYLCV fragments into attenuated CMV mutants can indeed provide cross-protection against TYLCV infection. This is a novel strategy for controlling DNA viral diseases, hence this invention.

[0076] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0077] The experimental materials used in the embodiments of this invention, unless otherwise specified, are all conventional experimental materials in the art and can be purchased through commercial channels. Where specific experimental conditions and methods are not specified in the embodiments of this invention, they are generally performed under conventional conditions, such as those described in J. Sambrook et al., eds., *Molecular Cloning: A Laboratory Manual (3rd Edition)*, Science Press, 2002; D.L. Spector et al., eds., *Cellular Laboratory Manual*, Science Press, 2001; or according to the conditions recommended by the manufacturer.

[0078] Example 1: CMV containing TYLCV fragment insertion type Fny Construction of plasmid vector for RNA2 mutant

[0079] Cloning of different coding region fragments of TYLCV: Using Agrobacterium tylcivina as a template, fragments of different coding regions of TYLCV were cloned: V1V2 (308-457), C1C2 (1484-1633), C1C4-1 (2171-2320), C1C4-2 (2321-2470), C2C3-1 (1186-1335), C2C3-2 (1336-1485), Rep (1542-1841), and R-Rep (1542-1841). These fragments were further digested with enzymes and ligated into pCC. F R2-2bPTI, pCC F R2-2bPTII and pCC F On the R2-2bPTⅢ vector ( Figure 1The primer pairs used are shown in Table 1. PCR was performed using 2×Taq Master Mix (Vazyme) under the following conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 47℃ annealing for 15 s, 72℃ extension for 12 s, 30 cycles; 72℃ extension for 5 min; storage at 4℃; PCR products were recovered using a DNA recovery kit for later use.

[0080] intermediate carrier pCC F R2-2bPTI, pCC F R2-2bPTII and pCC F R2-2bPTⅢ was double-digested with BamHI and SmaI, and the digestion products were recovered using a DNA recovery kit. The PCR-amplified TYLCV fragments were also double-digested with BamHI and SmaI, and the digestion products were recovered using a DNA recovery kit. The intermediate vector pCC, which was also double-digested, was then... F R2-2bPTI, pCC F R2-2bPTII, pCC F R2-2bPTⅢ and the double-digested TYLCV fragment were ligated overnight at 16°C using T4 DNA ligase. The ligation products were transformed into competent E. coli DH5α cells, plated on LB agar plates containing 100 μg / mL kanamycin, and positive clones were obtained by colony PCR screening.

[0081] pCC F R2-2bPTI-TYC1C4-1、pCC F R2-2bPTI-TYC1C4-2、pCC F R2-2bPTII-TYV1V2, pCC F R2-2bPTII-TYC1C2, pCC F R2-2bPTII-TYC1C4-1、pCC F R2-2bPTII-TYC1C4-2、pCC F R2-2bPTII-TYC2C3-1、pCC F R2-2bPTII-TYC2C3-2、pCC F R2-2bPTIII-TYRep and pCC F R2-2bPTIII-TYR-Rep.

[0082] After plasmid extraction, DNA sequencing was performed for verification, and the RNA2 sequences contained therein are shown in SEQ ID NO.1-SEQ ID NO.10, respectively.

[0083] Table 1: Primers used in this embodiment

[0084] TYBJ-V1V2-308-325-F <![CDATA[AT GGATCC ATGTCGAAGCGACCAGGC]]> SEQ ID No.12 TYBJ-V1V2-439-457-R <![CDATA[AT CCCGGG CATGGGCCTGTACGTCCAT]]> SEQ ID No.13 TYBJ-C1C2-1484-1507-F <![CDATA[AT GGATCC ATGATTGTTGCAGTTGATGTGGAG]]> SEQ ID No.14 TYBJ-C1C2-1612-1633-R <![CDATA[AT CCCGGG ATGCAACCTTCATCACCCTCTA]]> SEQ ID No.15 TYBJ-C1C4-1-2171-2195-F <![CDATA[AT GGATCC TTAATATATTGAGGGCCTCGGATTT]]> SEQ ID No.16 TYBJ-C1C4-1-2300-2320-R <![CDATA[AT CCCGGG AGACCTACGTGGAGAAGACG]]> SEQ ID No.17 TYBJ-C1C4-2-2321-2343-F <![CDATA[AT GGATCC TGACATCTGTTGAGCTCTTAGCT]]> SEQ ID No.18 TYBJ-C1C4-2-2449-2470-R <![CDATA[AT CCCGG GACGAGAATGGGGAACCACATCT]]> SEQ ID No.19 TYBJ-C2C3-1-1186-1210-F <![CDATA[AT GGATCC AATTACACCAAGACTATCTAAATAC]]> SEQ ID No.20 TYBJ-C2C3-1-1311-1335-R <![CDATA[AT CCCGGG AGATTCAACCACAACATCAGGAAGA]]> SEQ ID No.21 TYBJ-C2C3-2-1336-1360-F <![CDATA[AT GGATCC TATCTGAATGGAAATGATGTCGTGG]]> SEQ ID No.22 TYBJ-C2C3-2-1465-1485-R <![CDATA[AT CCCGG GATGGATTCACGCACAGGGGAA]]> SEQ ID No.23 TYBJRep-1-25-F <![CDATA[AT GGATCC TTACGCCTTATTGGTTTCTTCTTGG]]> SEQ ID No.24 TYBJRep-276-300-R <![CDATA[AT CCCGGG GATGACGTAGACCCGCATTATTTAA]]> SEQ ID No.25 TYBJR-Rep-1-25-F <![CDATA[AT CCCGGG TTACGCCTTATTGGTTTCTTCTTGG]]> SEQ ID No.26 TYBJR-Rep-276-300-R <![CDATA[AT GGATCC GATGACGTAGACCCGCATTATTTAA]]> SEQ ID No.27

[0085] Example 2: CMV containing TYLCV fragment insertion Fny Pathogenicity analysis of RNA2 mutant plasmids

[0086] Plasmid transformation of Agrobacterium: plasmid pCB301-CMV Fny -R1 (including CMV) Fny (wild-type RNA1 genome sequence), pCB301-CMV Fny -R2 (including CMV) Fny (wild-type RNA2 genome sequence), pCC F R2-2bPTI-TYC1C4-1、pCC F R2-2bPTI-TYC1C4-2、pCC F R2-2bPTII-TYV1V2, pCC F R2-2bPTII-TYC1C2, pCC F R2-2bPTII-TYC1C4-1、pCC F R2-2bPTII-TYC1C4-2、pCC F R2-2bPTII-TYC2C3-1、pCC F R2-2bP TII-TYC2C3-2、pCC F R2-2bPTIII-TYRep, pCC F R2-2bPTIII-TYR-Rep and pCB301-CMV Fny -R3 (including CMV) Fny The wild-type RNA3 genome sequence was transformed into competent Agrobacterium GV3101 cells, plated on LB plates (containing 50 μg / ml kanamycin and 100 μg / ml rifampin), and incubated at 28°C for 48 h. Single spots were then picked for colony PCR verification.

[0087] Induction: Positive plaques were picked and cultured in 2 ml of LB medium (50 μg / ml kanamycin and 100 μg / ml rifampin) at 28°C with shaking at 200 rpm for 24 h. 200 μL of each Agrobacterium culture containing different plasmids was added to 5 ml of LB medium (containing 50 μg / ml kanamycin and 100 μg / ml rifampin) and cultured at 28°C with shaking at 200 rpm for 12 h.

[0088] Resuspension: Add the induced bacterial culture to a 10ml centrifuge tube and centrifuge at 6000rpm for 10min at room temperature; collect the bacterial cells, add 1ml of Agrobacterium resuspension (10mM MgCl2, 10mM MES, 0.1mM AS) and mix well by pipetting. Take 50ul of the bacterial culture and add it to 1ml of resuspension, and measure its OD. 600 Value, based on the OD of the diluent 600 Adjust the concentration of the original solution to OD 600 The value was 1.2. Agrobacterium bacterial suspensions containing different plasmids were all adjusted to an OD value of 1.2. 600 =1.2.

[0089] Agrobacterium mixture: containing pCC F R2-2bPTI-C1C4-1 (mutant CMV RNA2, transcript is R2-2bPTI-C1C4-1), containing pCC F R2-2bPTI-C1C4-2 (mutant CMV RNA2, transcript is R2-2bPTI-C1C4-2), containing pCC F R2-2bPTII-TYV1V2 (mutant CMV RNA2, transcript is R2-2bPTII-V1V2), containing pCC F R2-2bPTII-TYC1C2 (mutant CMV RNA2, transcript is R2-2bPTII-C1C2), containing pCC F R2-2bPTII-C1C4-1 (mutant CMV RNA2, transcript is R2-2bPTII-C1C4-1), containing pCC F R2-2bPTII-C1C4-2 (mutant CMV RNA2, transcript is R2-2bPTII-C1C4-2), containing pCC F R2-2bPTII-C2C3-1 (mutant CMV RNA2, transcript is R2-2bPTII-C2C3-1), containing pCC F R2-2bPTII-C2C3-2 (mutant CMV RNA2, transcript is R2-2bPTII-C2C3-2), pCC F R2-2bPTIII-TYRep (mutant CMV RNA2, transcript is R2-2bPTIII-TYRep), pCC F R2-2bPTIII-TYR-Rep (mutant CMV RNA2, transcript is R2-2bPTIII-TYR-Rep) and pCB301-CMV Fny -R2 (Wild-type CMV) Fny Agrobacterium tumefaciens culture containing RNA2 (transcriptional product is R2) was compared with pCB301-CMV.Fny -R1 (Wild Type CMV) Fny RNA1 (transcription is R1), pCB301-CMV Fny -R3 (Wild Type CMV) Fny Mix equal parts of Agrobacterium tumefaciens culture (RNA3, transcript is R3) and incubate at 28°C for 3 hours.

[0090] Agrobacterium-mediated infection of tomatoes: Using a 1ml disposable syringe (with the needle removed), draw up the prepared Agrobacterium solution. Select tomatoes at the 4-leaf stage and inject the solution from the syringe between the veins on the underside of the leaves using pressure. Inject two leaves per plant, ensuring each leaf is at least 2 / 3 covered by the injection. Incubate the inoculated plants at 25℃ with a 16-hour light / 8-hour dark cycle.

[0091] Results analysis: 39 days after Agrobacterium infiltration inoculation, wild-type CMV was inoculated. Fny Tomatoes infected with RNA1 / RNA2 / RNA3 showed needle-like leaf wrinkling and stunted growth, with a disease index of 100; while those inoculated with CMV showed... Fny RNA1 / RNA2-2bPTI-C1C4-1 / RNA3, CMV Fny RNA1 / RNA2-2bPTI-C1C4-2 / RNA3, CMV Fny RNA1 / RNA2-2bPTII-V1V2 / RNA3, CMV Fny RNA1 / RNA2-2bPTII-C1C2 / RNA3, CMV Fny RNA1 / RNA2-2bPTII-C1C4-1 / RNA3, CMV Fny RNA1 / RNA2-2bPTII-C1C4-2 / RNA3, CMV Fny RNA1 / RNA2-2bPTII-C2C3-1 / RNA3, CMV Fny RNA1 / RNA2-2bPTII-C2C3-2 / RNA3, CMV Fny RNA1 / RNA2-2bPTIII-Re p / RNA3, CMV Fny RNA1 / RNA2-2bPTIII-R-Rep / RNA3 were all basically the same in plant height and leaf spread as healthy controls, and no viral disease symptoms were observed. Figure 2 The results showed that plasmid pCC F R2-2bPTI-TYC1C4-1、pCC F R2-2bPTI-TYC1C4-2、pCC F R2-2bPTII-TYV1V2, pCC FR2-2bPTII-TYC1C2, pCC F R2-2bPTII-TYC1C4-1、pCC F R2-2bPTII-TYC1C4-2、pCC F R2-2bPTII-TYC2C3-1、pCC F R2-2bPTII-TY C2C3-2、pCC F R2-2bPTIII-TYRep, pCC F R2-2bPTIII-TYR-Rep all contain different types of CMV. F ny A virulent mutant of RNA2.

[0092] Example 3: Analysis of cross-protection and stability of tomatoes inoculated with TYLCV fragment-inserted attenuated CMV mutants alone or in combination with different strategies.

[0093] 1. Test method:

[0094] Based on the results of Example 2, CMV was further tested. Fny The cross-protection effect of single inoculation or different strategies using RNA2 attenuated mutants in tomatoes was investigated. The following inoculation treatments were performed:

[0095] Treatment 1: Inoculation with pCB301-CMV Fny -R1 / pCC F R2-2bPTI-C1C4-2 / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTI-C1C4-2 / R3).

[0096] Treatment 2: Inoculation with pCB301-CMV Fny -R1 / pCC F R2-2bPTII-C1C4-2 / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTII-C1C4-2 / R3).

[0097] Process 3: pCB301-CMV Fny -R1 / pCC F R2-2bPTI-C1C4-1 / pCB301-CMV Fny -R3 (transcriptional form: R1 / R2-2bPTI-C1C4-1 / R3) and pCB301-CMV Fny -R1 / pCC F R2-2bPTI-C1C4-2 / pCB301-CMV Fny-R3 (transcription is R1 / R2-2bPTI-C1C4-2 / R3) mixed inoculation.

[0098] Process 4: pCB301-CMV Fny -R1 / pCC F R2-2bPTII-C1C4-1 / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTII-C1C4-1 / R3) and pCB301-CMV Fny -R1 / pCC F R2-2bPTII-C1C4-2 / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTII-C1C4-2 / R3) mixed inoculation.

[0099] Process 5: pCB301CMV Fny -R1 / pCC F R2-2bPTII-C1C2 / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTII-C1C2 / R3), pCB301-CMV Fny -R1 / pCC F R2-2bPTII-C1C4-1 / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTII-C1C4-1 / R3), pCB301-CMV Fny -R1 / pCC F R2-2bPTII-C1C4-2 / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTII-C1C4-2 / R3), pCB301-CMV Fny -R1 / pCC F R2-2bPT II-C2C3-1 / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTII-C2C3-1 / R3), pCB301-CMV Fny -R1 / pCC F R2-2bPTII-C2C3-2 / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTII-C2C3-2 / R3); the above 5 mutants were mixed and inoculated.

[0100] Process 6: pCB301-CMV Fny -R1 / pCC FR2-2bPTII-V1V2 / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTII-V1V2 / R3), pCB301-CMV Fny -R1 / pCC F R2-2bPTII-C1C2 / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTII-C1C2 / R3), pCB301-CMV Fny -R1 / pCC F R2-2bPTII-C1C4-1 / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTII-C1C4-1 / R3), pCB301-CMV Fny -R1 / pCC F R2-2bPTII-C1C4-2 / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTII-C1C4-2 / R3), pCB301-CMV Fny -R1 / pC C F R2-2bPTII-C2C3-1 / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTII-C2C3-1 / R3), pCB301-CMV Fny -R1 / pCC F R2-2bPTII-C2C3-2 / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTII-C2C3-2 / R3); the above six mutants were mixed and inoculated.

[0101] Treatment 7: Inoculation with pCB301-CMV Fny -R1 / pCC F R2-2bPTⅢ-TYRep / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTⅢ-TYRep / R3).

[0102] Treatment 8: Inoculation with pCB301-CMV Fny -R1 / pCC F R2-2bPTⅢ-TYR-Rep / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTⅢ-TYR-Rep / R3).

[0103] Process 9: pCB301-CMV Fny-R1 / pCC F R2-2bPTⅢ-TYRep / pCB301-CMV Fny -R3 (transcriptions are R1 / R2-2bPTⅢ-TYRep / R3) and pCB301-CMV Fny -R1 / pCC F R2-2bPTⅢ-TYR-Rep / pCB301-CM V Fny -R3 (transcription is R1 / R2-2bPTⅢ-TYR-Rep / R3) mixed inoculation.

[0104] For mixed inoculation, each vaccine bacterial suspension is mixed in equal volume ratio. 1 ml of bacterial suspension is inoculated per tomato plant. Each treatment is performed in at least 3 replicates, inoculated with CMV. Fny TYLCV (OD) was performed 5 days after RNA2 attenuated mutant. 600 Challenge inoculation was performed with a concentration of 0.006. Plant symptoms were observed 34 days after challenge inoculation. The disease index was calculated based on plant height and leaf wrinkling to determine the relative efficacy of pre-inoculation with the attenuated mutant.

[0105] Disease index: 100 × ∑(number of diseased plants at each level × disease level) / (total number of plants investigated × highest level).

[0106] Relative efficacy (%): 100% × (disease index of control group - disease index of treatment group) / disease index of control group.

[0107] Disease classification is based on the nine-level disease classification method for tobacco viral diseases in the "National Standard of the People's Republic of China - Classification and Investigation Methods of Tobacco Diseases and Pests".

[0108] Disease severity is graded based on the plant's height.

[0109] The 2bPTI-C1C4-2 vaccine showed excellent cross-protection against cross-infection in tomatoes, with plant height significantly higher than the MOCK control, and was therefore classified as a level 1 disease.

[0110] After TYLCV infection, the plants infected with the 2bPTII-C1C4-2 vaccine showed a significant recovery in plant height, consistent with MOCK. According to the nine-level disease grading system, the disease was classified as Level 1.

[0111] Any plants whose height is not significantly shorter than that of MOCK plants are classified as having a level 1 disease.

[0112] Although the 2bPTI-C1C4-2 vaccine provides significantly better cross-protection against tomatoes than the 2bPTII-C1C4-2 vaccine, the disease severity of tomatoes vaccinated with the 2bPTI-C1C4-2 vaccine cannot be classified as grade 0 due to the significant wrinkling of tomato leaves.

[0113] 2. Test Results:

[0114] (1) After inoculating tomatoes with the virulent TYLCV virus, the plants were significantly stunted 34 days after inoculation, and the leaves were yellowed, curled, wrinkled and smaller, with a disease index of 100.

[0115] (2) Pre-vaccination with pCB301-CMV Fny -R1 / pCC F R2-2bPTI-C1C4-2 / pCB301-CMV Fny Tomato plants with the R3 variant (transcription R1 / R2-2bPTI-C1C4-2 / R3) showed a significant recovery in plant height at 34 days post-inoculation (dpi) compared to tomatoes inoculated with TYLCV alone, even exceeding that of the healthy control. Leaf wrinkling was less pronounced in the R3 variant compared to the TYLCV-inoculated control. The disease index was 11, and the relative efficacy was 89%, indicating that pre-inoculation with this attenuated mutant provided excellent cross-protection against TYLCV.

[0116] (3) Pre-vaccination with pCB301-CMV Fny -R1 / pCC F R2-2bPTII-C1C4-2 / pCB301-CMV Fny Tomato plants with the R3 variant (transcription R1 / R2-2bPTII-C1C4-2 / R3) showed a significant recovery in plant height on day 34 after challenge inoculation with TYLCV, compared to tomatoes inoculated with TYLCV alone, and were consistent with the height of the healthy control. The degree of leaf wrinkling was less than that of the TYLCV-inoculated control. The disease index was 11, and the relative efficacy was 89%, indicating that pre-inoculation with this attenuated mutant provided excellent cross-protection against TYLCV.

[0117] (4) Premixed inoculation with pCB301-CMV Fny -R1 / pCC F R2-2bPTI-C1C4-1 / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTI-C1C4-1 / R3), pCB301-CMV Fny -R1 / pCC F R2-2bPTI-C1C4-2 / pCB301-CMV FnyTomato plants with two mutant strains, R1 / R2-2bPTI-C1C4-2 / R3 (transcript R1 / R2-2bPTI-C1C4-2 / R3), showed a significant recovery in plant height on day 34 after challenge inoculation with TYLCV, compared to tomatoes inoculated with TYLCV alone, and were consistent with the height of the healthy control. The degree of leaf wrinkling was less than that of the control inoculated with TYLCV alone. The disease index was 11, and the relative control efficacy was 89%, indicating that pre-inoculation with this attenuated mutant provided excellent cross-protection against TYLCV.

[0118] (5) Premixed inoculation with pCB301-CMV Fny -R1 / pCC F R2-2bPTII-C1C4-1 / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTII-C1C4-1 / R3), pCB301-CMV Fny -R1 / pCC F R2-2bPTII-C1C4-2 / pCB301-CMV Fny Tomato plants with two mutant strains, R1 / R2-2bPTII-C1C4-2 / R3 (transcript R1 / R2-2bPTII-C1C4-2 / R3), showed a significant recovery in plant height on day 34 after challenge inoculation with TYLCV, compared to tomatoes inoculated with TYLCV alone, and were consistent with the height of the healthy control. The degree of leaf wrinkling was less than that of the TYLCV-inoculated control. The disease index was 11, and the relative control efficacy was 89%, indicating that pre-inoculation with this attenuated mutant provided excellent cross-protection against TYLCV.

[0119] (6) Premixed inoculation with pCB301CMV Fny -R1 / pCC F R2-2bPTII-C1C2 / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTII-C1C2-2 / R3), pCB301-CMV Fny -R1 / pCC F R2-2bPTII-C1C4-1 / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTII-C1C4-1 / R3), pCB301-CMV Fny -R1 / pCC F R2-2bPTII-C1C4-2 / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTII-C1C4-2 / R3), pCB301-CMV Fny -R1 / pC C FR2-2bPTII-C2C3-1 / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTII-C2C3-1 / R3) and pCB301-CMV Fny -R1 / pCC F R2-2bPTII-C2C3-2 / pCB301-CMV Fny Tomato plants with five mutant strains of R3 (transcript R1 / R2-2bPTII-C2C3-2 / R3) showed significant recovery in plant height at 34 days post-inoculation with TYLCV compared to tomatoes inoculated with TYLCV alone, although slightly shorter than the healthy control. Leaf wrinkling was less pronounced in the TYLCV-inoculated control. The disease index was 26, and the relative control efficacy was 74%, indicating that pre-inoculation with this attenuated mutant provided good cross-protection against TYLCV.

[0120] (7) Premixed inoculation with pCB301-CMV Fny -R1 / pCC F R2-2bPTII-V1V2 / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTII-V1V2 / R3), pCB301CMV Fny -R1 / pCC F R2-2bPTII-C1C2 / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTII-C1C2-2 / R3), pCB301-CMV Fny -R1 / pCC F R2-2bPTII-C1C4-1 / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTII-C1C4-1 / R3), pCB301-CMV Fny -R1 / pCC F R2-2bPTII-C1C4-2 / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTII-C1C4-2 / R3), pCB301-CMV Fny -R1 / pCC F R2-2bPTII-C2C3-1 / pCB301-CMV Fny -R3 (transcription is R1 / R2-2bPTII-C2C3-1 / R3) and pCB301-CMV Fny -R1 / pCC F R2-2bPTII-C2C3-2 / pCB301-CMVFny Tomato plants with six mutant strains of R3 (transcript R1 / R2-2bPTII-C2C3-2 / R3) showed a significant recovery in plant height on day 34 after challenge inoculation with TYLCV, compared to tomatoes inoculated with TYLCV alone, and were consistent with the height of the healthy control. The degree of leaf wrinkling was less than that of the control inoculated with TYLCV alone. The disease index was 11, and the relative control efficacy was 89%, indicating that pre-inoculation with this attenuated mutant provided excellent cross-protection against TYLCV.

[0121] (8) Pre-vaccination with pCB301-CMV Fny -R1 / pCC F R2-2bPTⅢ-TYRep / pCB301-CMV Fny Tomato plants with the R3 variant (transcription R1 / R2-2bPTⅢ-TYRep / R3) showed a significant recovery in plant height on day 34 after challenge inoculation with TYLCV, although they were slightly shorter than the healthy control. The degree of leaf wrinkling was less than in the TYLCV-inoculated control. The disease index was 26, and the relative control efficacy was 74%, indicating that pre-inoculation with this attenuated mutant provided good cross-protection against TYLCV.

[0122] (9) Pre-vaccination with pCB301-CMV Fny -R1 / pCC F R2-2bPTⅢ-TYR-Rep / pCB301-CMV Fny Tomato plants with the R3 variant (transcription R1 / R2-2bPTⅢ-TYR-Rep / R3) showed a significant recovery in plant height on day 34 after challenge inoculation with TYLCV, although slightly shorter than the healthy control. Leaf wrinkling was less pronounced in the R3 mutant compared to the TYLCV-inoculated control. The disease index was 33, and the relative control efficacy was 67%, indicating that pre-inoculation with this attenuated mutant provided good cross-protection against TYLCV.

[0123] (10) Premixed inoculation with pCB301-CMV Fny -R1 / pCC F R2-2bPTⅢ-TYRep / pCB301-CMV Fny -R3 (transcriptions are R1 / R2-2bPTⅢ-TYRep / R3) and pCB301-CMV Fny -R1 / pCC F R2-2bPTⅢ-TYR-Rep / pCB301-CMV FnyTomato plants with two mutant strains, R1 / R2-2bPTⅢ-TYR-Rep / R3 (transcription of R1 / R2-2bPTⅢ-TYR-Rep / R3), showed a significant recovery in plant height on day 34 after challenge inoculation with TYLCV, even exceeding that of the healthy control. Leaf wrinkling was less pronounced in the TYLCV-inoculated control. The disease index was 11, and the relative control efficacy was 89%, indicating that pre-inoculation with this attenuated mutant provided excellent cross-protection against TYLCV.

[0124] Table 2: Relative protective efficacy of mutant combinations using different strategies against target viruses in this invention.

[0125]

[0126] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. A live attenuated RNA vaccine for the prevention and control of tomato yellow leaf curl virus disease, characterized in that, The attenuated vaccine consists of a combination of mutant plasmids and CMV. Fny It is a mixture of plasmids containing RNA1 and RNA3 from the isolates; The mutant plasmid combination consists of the mutant plasmid pCC. F R2-2bPTⅢ-TYRep and pCC F R2-2bPTⅢ-TYR-Rep is composed of equal volume ratios; The mutant plasmid pCC F R2-2bPTⅢ-TYRep contains CMV Fny The mutant RNA2 isolated from the isolate, the nucleotide sequence of which is shown in SEQ ID NO.9; The mutant plasmid pCC F R2-2bPTⅢ-TYR-Rep contains CMV Fny The mutant RNA2 isolated from the sample, the nucleotide sequence of which is shown in SEQ ID NO.

10.

2. A method for preventing and controlling tomato yellow leaf curl virus disease, characterized in that, Includes the following steps: Combine mutant plasmids with CMV-containing plasmids Fny The RNA1 and RNA3 plasmids of the isolates were mixed and inoculated; The mutant plasmid combination consists of the mutant plasmid pCC. F R2-2bPTⅢ-TYRep and pCC F R2-2bPTⅢ-TYR-Rep is composed of equal volume ratios; The mutant plasmid pCC F R2-2bPTⅢ-TYRep contains CMV Fny The mutant RNA2 isolated from the isolate, the nucleotide sequence of which is shown in SEQ ID NO.9; The mutant plasmid pCCFR2-2bPTⅢ-TYR-Rep contains mutant RNA2 of CMVFny isolate, and the nucleotide sequence of the mutant RNA2 is shown in SEQ ID NO.10.

Images