Staphylococcus aureus rapid detection primer / probe combination, kit and detection method

Abstract

The application provides a primer / probe combination, a kit and a detection method for rapidly detecting Staphylococcus aureus, the primer / probe combination is used for amplifying the thermostable nuclease Nuc gene of Staphylococcus aureus, the nucleotide sequence of the forward primer is shown as SEQ ID NO:1, the nucleotide sequence of the reverse primer is shown as SEQ ID NO:2, and the nucleotide sequence of the probe is shown as SEQ ID NO:3. The application selects the Nuc gene of Staphylococcus aureus as a specific target, and adopts the LFD-MIRA method to visually detect Staphylococcus aureus, and the method has the advantages of simple operation, simple and portable equipment, short time consumption, and easy-to-read results. The detection kit has good sensitivity and specificity for clinical blood simulation samples, can effectively detect Staphylococcus aureus, and provides a usable rapid detection method for the in-vitro diagnosis of Staphylococcus aureus. In addition, the detection method can also be used for the rapid detection of other pathogenic microorganisms, such as other pathogenic bacteria, fungi, viruses, mycoplasma, chlamydia, rickettsia, spirochetes and parasites.

Description

Technical Field

[0001] This invention relates to the field of molecular diagnostics technology, specifically to primer / probe combinations, kits, and detection methods for rapid detection of Staphylococcus aureus. Background Technology

[0002] Bloodstream infections caused by bacteria are highly pathogenic and lethal, easily developing into a systemic inflammatory state, manifesting as clinical symptoms such as chills, high fever, tachycardia, and even shock, posing a serious threat to human health. Currently, blood culture remains the gold standard for clinical diagnosis of bloodstream infections. However, this method is time-consuming and has a low positive rate, hindering timely diagnosis and medication decisions. Clinically, medication is often prescribed based on physicians' empirical diagnoses, increasing both the financial burden on patients and the risk of antibiotic resistance due to overuse. Therefore, accurate and rapid identification of the pathogens causing bloodstream infections is the current trend in clinical diagnosis.

[0003] Staphylococcus aureus is widely distributed in nature and can cause various infections in humans and animals, such as respiratory, skin and soft tissue, and urinary tract infections in humans, as well as bloodstream infections, and mastitis in animals like dairy cows. In recent years, the isolation rate of Staphylococcus aureus has increased significantly, and it has spread rapidly globally, becoming one of the important pathogens causing hospital-acquired infections. Bloodstream infections caused by Staphylococcus aureus have a high morbidity and mortality rate and spread rapidly, making them a significant cause of hospital-acquired infections. The Staphylococcus aureus thermostable nuclease Nuc gene is its specific detection target gene, and studies have reported its use in PCR methods for detecting Staphylococcus aureus. When patients present with bloodstream infections, the ability of microbiologists to quickly and accurately detect Staphylococcus aureus in blood samples is crucial for early diagnosis and the development of targeted treatment plans.

[0004] Multienzyme isothermal rapid nucleic acid amplification (MIRA) is an isothermal amplification technique that has emerged in recent years. It relies on three core enzymes—DNA polymerase, single-stranded DNA-binding protein, and recombinase—to assist in DNA amplification. MIRA does not require complex temperature amplification equipment, has a short amplification reaction time, and by designing primers and probes with modified groups, combined with sandwich-style nucleic acid detection strips, it can simultaneously detect different targets in a sample. Therefore, this technology can be used to simultaneously detect multiple pathogen targets in blood samples, providing timely and effective etiological evidence. Summary of the Invention

[0005] This invention provides an LFD-MIRA primer / probe combination for rapid, on-site, constant-temperature, and visualized detection of Staphylococcus aureus.

[0006] The primer / probe combination of the present invention is used to amplify the Staphylococcus aureus Nuc gene. The nucleotide sequence of the forward primer is shown in SEQ ID NO:1, the nucleotide sequence of the reverse primer is shown in SEQ ID NO:2, and the nucleotide sequence of the probe is shown in SEQ ID NO:3.

[0007] SEQ ID NO: 1 is LFD-Sau-F:AATTACATAAAGAACCTGCGACTTTAATTA;

[0008] SEQ ID NO:2 is LFD-Sau-R:[biotin]ATGCACTTGCTTCAGGACCATATTTCTCTA;

[0009] SEQ ID NO: 3 is NFO-Sau:[FAM]GCGATTGATGGTGATACGGTTAAATTAATG[THF]ACAAAGGTCAACCA[C3spacer].

[0010] This invention also provides an LFD-MIRA detection kit for detecting Staphylococcus aureus infection, the kit comprising a dissolution buffer, lyophilized enzyme powder, magnesium acetate solution, buffer, lateral flow test strip, and the amplification primer / probe combination as described in claim 1; the dissolution buffer comprises 30-50 mM Tris buffer and 50-150 mM potassium acetate; the lyophilized enzyme powder comprises 100-500 ng / μL recombinase, 100-400 ng / μL recombinase cofactor, 400-900 ng / μL single-stranded DNA binding protein, 50-200 ng / μL DNA polymerase, 50-100 ng / μL reverse transcriptase, 1-3 mM ATP, 30-100 mM creatine phosphate, 200-300 ng / μL creatine kinase, 200-500 μM dNTPs, 5%-10% w / v polyethylene glycol 20000, and 1-5 mM dithiothreitol.

[0011] The present invention also provides a method for rapid detection of Staphylococcus aureus in blood, the method comprising:

[0012] 1) Extract total DNA from the blood sample of the bacteria to be tested;

[0013] 2) Using the extracted total DNA as a template, perform MIRA amplification of the bacteria to be tested;

[0014] 3) The MIRA amplification results were visualized using lateral flow test strips (LFD);

[0015] 4) Analyze the test results by visually observing the appearance of purplish-red stripes on the lateral flow test strip.

[0016] Step 1) prepares 6×10 5 Blood samples containing Staphylococcus aureus at concentrations of CFU / mL to 6 CFU / mL were used to extract total DNA from the samples using a DNA extraction kit.

[0017] In step 2), the extracted genomic DNA is used as a template. Primers, probes, dissolving buffer, and sterile double-distilled water are added and mixed thoroughly before being added to MIRA lyophilized enzyme powder. Then, magnesium acetate solution is added and mixed by inversion before being added to an integrated thermostatic amplification and detection device for reaction. The device is placed in a thermostatic heating module, with an amplification temperature of 40°C and an amplification time of 10 min.

[0018] After the reaction in step 2) is completed, press the sealing film of the detection device firmly to mix the amplification product and the buffer in a certain proportion and immerse the test strip. Observe the results after standing at room temperature for 5 minutes.

[0019] Step 4) Analyze the test results by visually observing the appearance of purple-red bands on the lateral flow test strip: If two purple-red bands appear on the test strip, one in the control area and one in the detection area, the result is positive, indicating that the sample contains the pathogen to be tested; if only one purple-red band appears in the control area and no band appears in the detection area, the result is negative, indicating that the sample does not contain the pathogen to be tested.

[0020] The MIRA amplification reaction system in step 2) includes: 29.5 μL of dissolution buffer, 2.1 μL each of 10 μM upstream and downstream primers, 0.6 μL of 10 μM probe, 2.0 μL of template DNA to be tested, 11.2 μL of sterile double-distilled water, 50 mg of MIRA lyophilized enzyme powder, and 2.5 μL of 280 mM magnesium acetate.

[0021] This invention uses gDNA from seven specified non-detection bacteria as templates for LFD-MIRA reactions. All seven non-detection bacteria tested negative, indicating no cross-reaction with the detection bacteria.

[0022] To verify the practicality of the LFD-MIRA detection method for bloodstream infectious pathogens, this invention incorporates the target bacteria into human blood and detects simulated clinical samples using LFD-MIRA and mass spectrometry identification methods. The ability of the LFD-MIRA detection method to detect Staphylococcus aureus in simulated blood samples is completely consistent with the positive results of mass spectrometry identification. The 95% detection limit of the LFD-MIRA detection method for Staphylococcus aureus in simulated blood samples is 9.178 CFU / mL, which is superior to the 95% detection limit of 14.013 CFU / mL of quantitative real-time PCR.

[0023] The isothermal amplification integrated detection system provided by this invention integrates multi-enzyme isothermal rapid nucleic acid amplification technology (MIRA) and lateral flow test strip (LFD) detection, and helps to avoid aerosol contamination. The LFD-MIRA visualization detection method of this invention is time-efficient, highly sensitive, and highly specific, making it suitable for rapid on-site screening of pathogenic microorganisms.

[0024] To avoid amplicon aerosol contamination caused by opening the lid during lateral flow test strip detection, this invention develops a sealed, portable, and contamination-proof isothermal amplification integrated detection device. After nucleic acid amplification, a simple pressing operation is used to uniformly mix the amplification product and buffer in a certain proportion to immerse the test strip, thereby completing the detection of the amplification product.

[0025] The isothermal amplification integrated detection system provided by this invention is particularly suitable for rapid on-site screening of pathogenic microorganisms, providing diagnostic and treatment evidence at the earliest possible time, improving the cure rate of infections, and reducing the incidence and mortality of severe infections and secondary severe infections. The primer and probe set and detection method for detecting Staphylococcus aureus provided by this invention enable rapid and accurate identification of Staphylococcus aureus in blood, with advantages such as simple operation, short detection time, high sensitivity, and strong specificity. It is particularly suitable for grassroots and on-site detection and has broad application prospects.

[0026] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0027] 1. This invention achieves rapid detection of common bloodstream infections caused by Staphylococcus aureus through optimized specific detection primers, probes, and an integrated isothermal amplification method. It can identify Staphylococcus aureus in the bloodstream in the first instance, which will help to develop targeted treatment plans for bloodstream infectious diseases caused by Staphylococcus aureus, improve the cure rate of bloodstream infections, reduce the incidence and mortality of severe infections and secondary severe infections, and improve the level of treatment.

[0028] 2. This invention, through comparative analysis of the specificity of the Staphylococcus aureus Nuc gene, selects an optimal primer / probe combination for subsequent LFD-MIRA detection.

[0029] 3. This invention optimizes the detection process by integrating the MIRA reaction and LFD detection into a single device, effectively avoiding aerosol contamination caused during the opening process.

[0030] 4. The LFD-MIRA isothermal amplification integrated detection system of the present invention has a rapid reaction, simple operation, simple required instruments and equipment, short processing time, and easy interpretation of results. It can effectively amplify target genes under isothermal conditions. It can not only be used for rapid on-site detection of Staphylococcus aureus nucleic acid, but also provides an optional rapid detection method for clinical sample screening of pathogens. Attached image description:

[0031] Figure 1 Photos of the lateral flow test strip and the LFD-MIRA isothermal amplification integrated detection device of this invention, along with photos of their operation process;

[0032] The process includes: A. An overall photo of the integrated isothermal amplification and detection device; B. Injecting the MIRA amplification reaction system into the integrated isothermal amplification and detection device; C. Injecting buffer into the integrated isothermal amplification and detection device; D. Inserting a lateral flow test strip into the integrated isothermal amplification and detection device and closing the lid; E. Placing the integrated isothermal amplification and detection device on the isothermal heating module for amplification reaction; F. Pressing the lid firmly after the amplification reaction is complete; G. Piercing the sealing film with the piercing needle on the lid to allow the amplification product and buffer to mix evenly in a certain proportion and immerse the test strip; H. Observing the detection results visually after standing at room temperature for 5 minutes.

[0033] Figure 2 This is a schematic diagram of the overall structure of the test strip detection device housing of the present invention;

[0034] Figure 3 This is a schematic diagram of the test strip detection device in a punctured state.

[0035] Figure 2 , 3 In the middle: 1-box body, 2-buffer solution storage chamber, 3-isothermal amplification reaction chamber, 4-sealing film, 5-test strip detection chamber, 6-test strip placement chamber, 7-transparent window, 8-piercing needle, 9-box lid;

[0036] Figure 4 Target gene sequence alignment results;

[0037] Figure 5 Electrophoresis screening of primer sets;

[0038] Figure 6 The specificity detection results of the method of the present invention;

[0039] Figure 7 To evaluate the clinical validation results of the LFD-MIRA method for detecting simulated blood samples. Detailed Implementation

[0040] Example 1: LFD-MIRA primer screening

[0041] Based on literature reports on the isolation of bloodstream pathogens, this invention selected the *Staphylococcus aureus* Nuc gene for primer design. Primers of 30-35 bp were designed with varying lengths to prevent false positives and avoid the influence of card structure and primer dimers. Primers that are too long or too short can affect amplification speed and detection sensitivity. Primer sequence requirements: 1. High randomness in base arrangement, GC content between 30% and 70%; 2. Avoidance of secondary structures in the amplified fragment, which could affect amplification; 3. Recommended amplified fragment length of 150-300 bp, generally not exceeding 500 bp. To screen for the optimal primers, a multi-region design was performed, resulting in 6 pairs of specific primers for optimal selection. The 6 primer pairs were tested using 1.0 × 10⁻⁶ primers. 3 Using CFU / mL Staphylococcus aureus standard strain ATCC29213 DNA as a template, MIRA agarose gel electrophoresis was performed to evaluate the designed primer pairs. The primer combination with the highest amplification efficiency and the most singular amplification product was screened for subsequent LFD-MIRA detection. After this round of screening, the primer combination that met the requirements for Staphylococcus aureus was finally determined.

[0042] Table 1. Candidate Primer Sequences

[0043]

[0044] Target gene sequence alignment results (see) Figure 4 ), results of primer screening by electrophoresis (see Figure 5 ).

[0045] Example 2: LFD-MIRA Probe Design

[0046] After determining the primers, probes for the Staphylococcus aureus Nuc gene were designed according to the LFD-MIRA probe design principles, which are as follows: A 46-52 nt complementary sequence to the target fragment was designed between the upstream and downstream primers; the probe sequence did not overlap with the specific primer recognition site, was 46-52 nt in length, and avoided palindromic sequences, internal secondary structures, and consecutive repetitive bases. The probe had three modification sites: 1. An antigen marker (FAM) was modified at the 5' end; 2. A dSpacer (tetrahydrofuran, THF) was labeled approximately 30 nt from the 5' end as the nfo recognition site; 3. The THF was located approximately 15 nt from the 3' end, and a modification group (C3-spacer) was labeled at the 3' end. Based on these design requirements, the probe positions were determined, and one probe sequence was preferentially designed for the Nuc gene. The primer and probe sequences for LFD-MIRA were finally determined.

[0047] NFO-Sau:[FAM]GCGATTGATGGTGATACGGTTAAATTAATG[THF]ACAAAGGTCAACCA[C3spacer].

[0048] Table 2. Final primer and probe sequences determined for LFD-MIRA and Real-time PCR

[0049]

[0050]

[0051] Example 3: Specificity of the LFD-MIRA detection method

[0052] For the specificity test, samples were selected from common clinical pathogens, mainly Staphylococcus hemolyticus, Staphylococcus epidermidis, Staphylococcus hominis, Staphylococcus capitis, Staphylococcus capitis, Enterococcus faecalis, and Enterococcus faecium. gDNA from seven designated non-detection bacteria was used as templates for the LFD-MIRA reaction. All seven non-detection bacteria tested negative, showing no cross-reactivity with the detection bacteria.

[0053] Table 3. Pathogens used in specific experiments

[0054]

[0055] Specific test results (participants) Figure 6 )

[0056] Example 4: Detection Limit Evaluation of LFD-MIRA Detection Method

[0057] To evaluate the detection limit of Staphylococcus aureus in blood, a 6×10⁻⁶ mmol / L scale was selected. 2 3×10 2 1.5×10 2 7.5×10 1 3.75×10 1 The bacterial suspension was analyzed by LFD-MIRA and Real-time PCR, respectively. The detection limit of LFD-MIRA was better than that of Real-time PCR, as shown in the following results. The detection sensitivity of LFD-MIRA was significantly better than that of Real-time PCR.

[0058] Table 4. Evaluation of the detection limit for Staphylococcus aureus in blood

[0059]

[0060] Example 5: The LFD-MIRA detection kit of the present invention for detecting Staphylococcus aureus infection

[0061] The kit includes nucleic acid extraction reagents, dissolution buffer, lyophilized enzyme powder, magnesium acetate solution, buffer, lateral flow test strips, and amplification primer / probe combination (the nucleotide sequence of the forward primer is shown in SEQ ID NO:1, the nucleotide sequence of the reverse primer is shown in SEQ ID NO:2, and the nucleotide sequence of the probe is shown in SEQ ID NO:3).

[0062] The dissolution buffer consists of 50 mM Tris buffer and 150 mM potassium acetate.

[0063] The lyophilized enzyme powder contains 500 ng / μL recombinase, 400 ng / μL recombinase cofactor, 900 ng / μL single-stranded DNA binding protein, 200 ng / μL DNA polymerase, 100 ng / μL reverse transcriptase, 3 mM ATP, 100 mM creatine phosphate, 300 ng / μL creatine kinase, 500 μM dNTPs, 10% w / v polyethylene glycol 20000, and 5 mM dithiothreitol.

[0064] Example 6: The present invention provides a rapid detection method for Staphylococcus aureus infection in blood.

[0065] Including the following steps:

[0066] 1) Extract total DNA from blood samples containing Staphylococcus aureus using a nucleic acid extraction kit;

[0067] 2) Using the extracted total DNA as a template, MIRA amplification of Staphylococcus aureus was performed;

[0068] 3) The MIRA amplification results were visualized using lateral flow test strips (LFD);

[0069] 4) Analyze the test results by visually observing the appearance of purplish-red stripes on the lateral flow test strip.

[0070] Step 1) prepares 6×10 5 Blood samples containing Staphylococcus aureus at concentrations of CFU / mL to 6 CFU / mL were used to extract total DNA from the blood samples containing the bacteria to be tested using a DNA extraction kit.

[0071] In step 2), the extracted genomic DNA is used as a template. Primers, probes, dissolving buffer, and sterile double-distilled water are added and mixed thoroughly before being added to MIRA lyophilized enzyme powder. Then, magnesium acetate solution is added and mixed by inversion before being added to an integrated thermostatic amplification and detection device for reaction. The device is placed in a thermostatic heating module, with an amplification temperature of 40°C and an amplification time of 10 min.

[0072] The MIRA amplification reaction system includes: 29.5 μL of dissolution buffer, 2.1 μL each of 10 μM upstream and downstream primers, 0.6 μL of 10 μM probe, 2.0 μL of template DNA to be tested, 11.2 μL of sterile double-distilled water, 50 mg of MIRA lyophilized enzyme powder, and 2.5 μL of 280 mM magnesium acetate.

[0073] After the reaction in step 2) is completed, press the sealing film of the detection device firmly to mix the amplification product and the buffer in a certain proportion and immerse the test strip. Observe the results after standing at room temperature for 5 minutes.

[0074] Step 4) Analyze the test results by visually observing the appearance of purple-red bands on the lateral flow test strip: If two purple-red bands appear on the test strip, one in the quality control area and one in the detection area, the result is positive, indicating that the sample contains the pathogen to be tested.

[0075] Example 7 verifies the practicality of the LFD-MIRA detection method for bloodstream infectious pathogens.

[0076] To verify the practicality of the LFD-MIRA detection method for bloodstream infectious pathogens, this invention involves incorporating the target bacteria into human blood and then detecting simulated clinical samples using LFD-MIRA and mass spectrometry identification methods. The ability of the LFD-MIRA detection method to detect Staphylococcus aureus in simulated blood samples is completely consistent with the positive results obtained from mass spectrometry identification. Figure 7 (As shown)

[0077] Example 8: The LFD-MIRA isothermal amplification integrated detection device of the present invention

[0078] Please see Figure 1-3 The LFD-MIRA isothermal amplification integrated detection device provided by the present invention includes a MIRA amplification device (shown in Figure 1E) and several lateral chromatography test strip detection devices (shown in Figure 1A). The MIRA amplification device is equipped with an isothermal heating module and several slots on it into which the test strip detection devices can be inserted (shown in Figure 1E). The test strip detection device includes a box body 1 and a box cover 9. The box body 1 is provided with an isothermal amplification reaction chamber 3, a buffer storage chamber 2, a test strip detection chamber 5, and a test strip placement chamber 6. A sealing film 4 is respectively provided between the isothermal amplification reaction chamber 3, the buffer storage chamber 2, and the test strip detection chamber 5. The box cover 9 is provided with a piercing needle 8 that can be inserted into the reaction chamber 3 and the buffer storage chamber 2 with the needle tip facing the sealing film. The transparent window 7 on the side of the box body facilitates visual observation of the test strip detection line.

[0079] More detailed information about the LFD-MIRA isothermal amplification integrated detection device ( Figure 2As shown), the device includes a box body 1 and a lid 9. The box body 1 contains a test strip detection chamber 5 and a test strip placement chamber 6, with 5 and 6 connected. The box body 1 also contains two liquid chambers for holding liquid, which are connected to the test strip detection chamber 5. A sealing membrane 4 separates the liquid chambers from the test strip detection chambers 5. An opening is provided at the end of each liquid chamber away from the sealing membrane 4. The lid 9 is detachably connected to the end of the box body 1 with the opening. A piercing needle 8 is provided on the side of the lid 9 near the opening, with the tip of the needle 8 pointing towards the sealing membrane 4. The extension dimension of the piercing needle 8 is greater than the distance between the opening and the sealing membrane 4. There are two liquid chambers and two piercing needles 8, all oriented in the same direction. (As shown) Figure 2 (As shown)

[0080] The two liquid chambers are the isothermal amplification reaction chamber 3 and the buffer storage chamber 2, respectively. The volume of the buffer storage chamber 2 is larger than that of the isothermal amplification reaction chamber 3. The test strip placement chamber 6 is arranged parallel to the liquid chambers, and a test strip opening for filling the test strip is provided through the side of the test strip placement chamber 6 near the lid 9. The lid 9 is sealed to the box body 1, and the openings of the two liquid chambers and the test strip opening are all located within the sealed area of ​​the lid 9. The volume of the buffer storage chamber 2 is greater than 190 μL, and the volume of the isothermal amplification reaction chamber 3 is greater than 50 μL. The box body 1 is transparent. An observation window 7 is provided on the box body 1 at the position corresponding to the test strip placement chamber 6. The wall thickness of the box body 1 at the observation window 7 is less than the wall thickness of other positions on the box body 1, which facilitates the observation of color changes of the test strip.

[0081] In field use, the isothermal amplification reaction chamber 3 contains the isothermal amplification reaction system solution, the buffer storage chamber 2 contains the buffer solution, and the test strip chamber 6 contains the test strip. After injecting the isothermal amplification reaction system of the sample template into the reaction chamber 3, the lid 9 is fastened onto the box body 1, and the box body 1 is inserted into the slot of the MIRA amplification device. After the isothermal amplification is completed, the box body 1 is removed, and the lid 9 is pressed. During the fastening process, the piercing needle 8 punctures the sealing film 4, and the isothermal amplification reaction system solution and buffer solution enter the test strip detection chamber 5, mix, and then enter the test strip placement chamber 6, immersing the test strip in the test strip placement chamber 6. The color of the test strip changes. Figure 3 As shown, staff observe the color change of the test strip through observation window 7 to complete the test.

[0082] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made to it in form and detail without departing from the scope defined by the claims of the present invention.

Claims

1. The LFD-MIRA detection system for detecting Staphylococcus aureus infection, characterized in that, The product includes nucleic acid extraction reagents, dissolution buffer, lyophilized enzyme powder, magnesium acetate solution, buffer, and lateral flow test strips; the dissolution buffer comprises 30-50 mM Tris buffer and 50-150 mM potassium acetate; the lyophilized enzyme powder comprises 100-500 ng / μL recombinase, 100-400 ng / μL recombinase cofactor, 400-900 ng / μL single-stranded DNA binding protein, 50-200 ng / μL DNA polymerase, 50-100 ng / μL reverse transcriptase, 1-3 mM ATP, 30-100 mM creatine phosphate, 200-300 ng / μL creatine kinase, 200-500 μM dNTPs, 5%-10% w / v polyethylene glycol 20000, and 1-5 mM dithiothreitol; The detection system includes a primer-probe combination for amplifying the Staphylococcus aureus Nuc gene. The nucleotide sequence of the forward primer is shown in SEQ ID NO:1, the nucleotide sequence of the reverse primer is shown in SEQ ID NO:2, and the nucleotide sequence of the probe is shown in SEQ ID NO:

3. The detection system also includes an isothermal amplification integrated detection device, which includes a box body (1) and a box cover (9). The box body (1) is provided with an isothermal amplification reaction chamber (3), a buffer storage chamber (2), a test strip detection chamber (5), and a test strip placement chamber (6), wherein (5) and (6) are connected. A sealing film (4) is provided between the isothermal amplification reaction chamber (3), the buffer storage chamber (2), and the test strip detection chamber (5). A piercing needle (8) is provided on the box cover (9), which can be inserted into the reaction chamber (3) and the buffer storage chamber (2) with the needle tip facing the sealing film (4). The dimension of the piercing needle (8) in the extension direction is greater than the distance between the opening and the sealing film (4). A transparent window (7) is provided on the side of the box body.

2. The non-clinical diagnostic detection method of the LFD-MIRA detection system for detecting Staphylococcus aureus infection according to claim 1, characterized in that: The detection method includes the following steps: 1) Extract total DNA from the sample to be tested using nucleic acid extraction reagents; 2) Using the extracted total DNA as a template, perform MIRA amplification to detect the bacteria to be tested; 3) The MIRA amplification results were visualized using lateral flow test strips (LFD); 4) Analyze the test results by visually observing the appearance of purplish-red bands on the lateral flow test strip; Step 1) involves extracting total DNA from the sample using a DNA extraction reagent; In step 2), the extracted genomic DNA is used as a template. Primers, probes, dissolving buffer, and sterile double-distilled water are added and mixed thoroughly before being added to MIRA lyophilized enzyme powder. Then, magnesium acetate solution is added and mixed by inversion before being added to the isothermal amplification reaction chamber (3) of the isothermal amplification integrated detection device for reaction. The device is placed in the isothermal heating module, the amplification temperature is 40℃, and the amplification time is 10 min. Step 3) is to press the sealing film (4) of the detection device with force after the reaction in step 2) is completed, so that the amplification product and the buffer are mixed evenly in a certain proportion and immersed in the test strip, and the results are observed after standing at room temperature for 5 minutes. Step 4) Analyze the test results by visually observing the appearance of purple-red bands on the lateral flow test strip: If two purple-red bands appear on the test strip, one in the control area and one in the detection area, the result is positive, indicating that the sample contains the pathogen to be tested; if only one purple-red band appears in the control area and no band appears in the detection area, the result is negative, indicating that the sample does not contain the pathogen to be tested.

3. The non-clinical diagnostic testing method according to claim 2, characterized in that, The MIRA amplification reaction system in step 2) includes: 29.5 μL of dissolution buffer, 2.1 μL each of 10 μM upstream and downstream primers, 0.6 μL of 10 μM probe, 2.0 μL of template DNA to be tested, 11.2 μL of sterile double-distilled water, 50 mg of MIRA lyophilized enzyme powder, and 2.5 μL of 280 mM magnesium acetate.

Images