A recombinant coccidian vector expressing avian adenovirus type 4 fiber2 protein and a fluorescent tag and a detection method thereof

CN115806990BActive Publication Date: 2026-09-11FOSHAN STANDARD BIO TECH
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202211599323.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-12
Publication Date
2026-09-11
Estimated Expiration
2042-12-12

AI Technical Summary

Technical Problem

[0006]目前国内并无预防禽4型腺病毒的成熟疫苗,而国外发布的疫苗免疫效果并不理想,而亚单位疫苗无法实现批量化生产

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115806990B_ABST
    Figure CN115806990B_ABST
Patent Text Reader

Abstract

The application provides a recombinant coccidian vector expressing avian adenovirus type 4 fiber2 protein and a fluorescent label and a detection method thereof. The application also provides an sgRNA targeting an ETH_00026625 gene, wherein the nucleotide sequence of the sgRNA targeting the ETH_00026625 gene comprises a sequence shown in SEQ ID NO: 1. The sgRNA targeting the ETH_00026625 gene is specific and has a low off-target rate, cooperates with a Cas9 nuclease, and can realize insertion of a fiber2 gene on an ETH_00026625 gene of Eimeria tenella. The recombinant coccidian vector can express fiber2 protein and fluorescent label protein, and the recombinant coccidian vector is expected to be used for development of a coccidian vaccine for simultaneously preventing avian adenovirus type 4 and Eimeria tenella, and the immunization effect is more efficient and safe.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of gene editing technology, specifically relating to a recombinant coccidia vector expressing avian adenovirus type 4 fiber2 protein and a fluorescent tag, and its detection method. Background Technology

[0002] Avian adenovirus type 4 (Adenovirus type 4) causes a pale yellow, clear fluid to appear in the pericardium of poultry, a condition known as hepatitis-pericardial effusion syndrome (HHS). It also causes clinical symptoms such as liver swelling, kidney edema, and urate deposition, with a mortality rate exceeding 30%. Infected hosts experience loss of appetite and weakened immunity. Furthermore, adenoviruses often act as opportunistic pathogens in co-infections, synergistically exacerbating the damage to poultry and causing incalculable economic losses to farmers. Due to the lack of a mature vaccine in my country, controlling avian adenovirus type 4 has become a major challenge.

[0003] Currently, adenovirus control is quite difficult. While general control measures such as frequent ventilation and disinfection have some effect, their actual impact is limited. There is currently no specific drug for avian adenovirus type 4. The main treatments used are vitamin C and vitamin K, which do not damage organs and can reduce the damage caused by avian adenovirus type 4, but they cannot fundamentally cure adenovirus. Therefore, developing multiple effective preventative vaccines is of significant value for the protection of poultry.

[0004] CN107475296B discloses a recombinant fowlpox virus transfer vector expressing the fiber2 gene of chicken adenovirus type 4, its construction method, and its applications. The vector is based on the pMD19T-Simple vector, with the FADV4 fiber2 gene and lacz gene inserted at the TA cloning site, along with the LTYB and RTYB non-essential genome replication fragments of the fowlpox virus used for homologous recombination. The constructed recombinant fowlpox virus transfer vector lays the foundation for developing highly efficient recombinant fowlpox virus genetically engineered live vector vaccines expressing chicken adenovirus type 4.

[0005] CN112094824A discloses a recombinant Newcastle disease virus (NDV) heat-resistant vaccine strain expressing a truncated Fiber2 protein of avian adenovirus type 4, its preparation method, and its applications. Using reverse genetics techniques with RNA viruses, the NDVLaSota strain (Newcastle disease IV strain) is genetically modified at the transcription plasmid level. First, its HN gene is replaced with the HN gene of the heat-resistant TS09-C strain. Then, a truncated Fiber2 gene (961-1440 bp) of avian adenovirus type 4 is inserted between its P and M genes. The modified transcription plasmid is transfected into host cells to rescue and obtain the NDV rLS-tFib2-C strain. This vaccine strain exhibits significant heat resistance, greatly reducing reliance on cold chain systems, saving storage and transportation costs, and improving vaccine thermal stability. This vaccine strain does not express the complete Fiber2 protein, but only a portion of it, specifically enhancing the vaccine's immunoprotective effect. It can be used to prepare a bivalent heat-resistant live vaccine against avian ankara disease and Newcastle disease.

[0006] Currently, there is no mature vaccine for preventing avian adenovirus type 4 in China, while vaccines released abroad have unsatisfactory immunization effects, and subunit vaccines cannot be mass-produced. Therefore, developing a coccidiosis vaccine that can prevent and control adenovirus is of great significance for the prevention and control of avian adenovirus type 4. Summary of the Invention

[0007] To address the shortcomings of existing technologies, the present invention aims to provide a recombinant coccidia vector expressing fiber2 protein and a fluorescent tag, along with its detection method. The sgRNA targeting the ETH_00026625 gene exhibits high specificity and a low off-target rate. Combined with the Cas9 nuclease, it enables the insertion of the fiber2 gene into the ETH_00026625 gene of *Eimeria tenella*. The present invention also provides an ETH_00026625 gene editing system. This system boasts high gene editing efficiency, and the resulting recombinant coccidia vector exhibits stable genotypes, demonstrating high application value. The recombinant coccidia vector expresses both fiber2 protein and a fluorescent tag protein, and is expected to be used in the development of coccidia vaccines that simultaneously prevent avian adenovirus type 4 and *Eimeria tenella*, offering more efficient and safer immunization.

[0008] To achieve this objective, the present invention adopts the following technical solution:

[0009] In a first aspect, the present invention provides an sgRNA targeting the ETH_00026625 gene, wherein the nucleotide sequence of the sgRNA targeting the ETH_00026625 gene includes the sequence shown in SEQ ID NO:1.

[0010] The nucleotide sequence of the ETH_00026625 gene described in this invention is from NCBI.

[0011] SEQ ID NO: 1: gcgctaccggctattaaggg.

[0012] In this invention, the sgRNA targets the non-coding region sequence in the ETH_00026625 gene. The sgRNA has good specificity and targeting, low off-target rate, and high editing efficiency.

[0013] In a second aspect, the present invention provides an ETH_00026625 gene editing system, wherein the ETH_00026625 gene editing system includes the sgRNA targeting the ETH_00026625 gene as described in the first aspect.

[0014] Preferably, the ETH_00026625 gene editing system further includes the Cas9 nuclease.

[0015] Preferably, the sgRNA targeting the ETH_00026625 gene is linked to the coding sequence containing the Cas9 nuclease in the same gene editing plasmid.

[0016] Preferably, the ETH_00026625 gene editing system further includes a homologous recombination fragment, which includes the coding sequences of the fiber2 gene and the fluorescent tag gene.

[0017] In this invention, the full-length gene of the fiber2 protein is 1440 bp, encoding 479 amino acids, and has a size of 49.9 kDa. The fiber2 protein is formed by the hydrolysis of a precursor protein, and its structural regions from the N-terminus to the C-terminus are, in order, I (tail region), II (stalk region), and III (apical bulb region). Fiber2 is a potent immunogenic antigen; studies have reported that the absence of the fiber2 protein linearly reduces the virus's ability to infect the host. The amino acid sequence of the fiber2 protein is shown in SEQ ID NO:2.

[0018] In this invention, the ETH_00026625 gene editing system, in conjunction with homologous recombination fragments, achieves site-specific insertion of the fiber2 gene into the ETH_00026625 gene of Eimeria tenella, avoiding non-specific gene editing, and achieving high editing efficiency and low off-target rate.

[0019] The homologous recombination fragment constructed in this invention contains a His tag. The His tag has a small molecular weight and low immunogenicity, facilitating subsequent protein detection. In this invention, a spacer sequence is inserted between the fiber2 gene and the fluorescent tag gene. This spacer sequence prevents the formation of a fusion protein between the fiber2 protein and the fluorescent tag protein, thus promoting the immunological activity of the fiber2 protein.

[0020] The nucleotide sequence of the homologous recombination fragment described in this invention is shown in SEQ ID NO:3.

[0021] Thirdly, the present invention provides a recombinant coccidia vector containing the sgRNA targeting the ETH_00026625 gene as described in claim 1.

[0022] Preferably, the recombinant coccidia vector contains the ETH_00026625 gene editing system described in the second aspect.

[0023] In this invention, by editing the ETH_00026625 gene of coccidia, the recombinant coccidia vector transmits the mutated gene to the progeny coccidia, achieving the stability and heritability of gene editing, reducing the workload of screening, and making its application value more extensive.

[0024] Preferably, the recombinant coccidia vector is a coccidia vector that has been edited by the ETH_00026625 gene editing system described in the second aspect, and has integrated the coding sequences of the fiber2 gene and the fluorescent tag gene into the ETH_00026625 gene.

[0025] Fourthly, the present invention provides a method for constructing the recombinant coccidia vector described in the third aspect, the method comprising:

[0026] Constructing gene-editing plasmids;

[0027] Construct homologous recombination fragments;

[0028] The gene-editing plasmid and the homologous recombination fragment were introduced into coccidial sporozoites to infect animals;

[0029] Positive clones were screened to obtain the recombinant coccidia vector.

[0030] In this invention, the construction method is simple, highly operable, and has high editing efficiency, making it easy to obtain insect strains with stable trait inheritance.

[0031] Preferably, the method for constructing the gene editing plasmid includes: PCR amplification of the coding sequences of the sgRNA and Cas9 targeting the ETH_00026625 gene, and ligation of the coding sequences to obtain a gene editing plasmid containing the sgRNA and Cas9 targeting the ETH_00026625 gene.

[0032] Preferably, the method for constructing the homologous recombination fragment includes: sequentially connecting the fiber2 gene and the fluorescent tag gene to obtain a whole fragment, constructing the whole fragment into a cloning vector, and obtaining the homologous recombination plasmid;

[0033] Using the obtained homologous recombination plasmid as a template, homologous recombination fragments containing only a 5' homologous arm, promoter, MIC1 signal peptide sequence, fiber2 gene, 6×his, P2A, fluorescent tag gene, and 3' homologous arm were amplified by PCR.

[0034] Preferably, the fluorescent tag gene includes the mCherry fluorescent protein gene.

[0035] Preferably, the method for constructing the homologous recombination fragment further includes a sequencing verification step.

[0036] Preferably, the importation method is electroporation.

[0037] Preferably, the coccidia includes Eimeria tenella.

[0038] Preferably, the animal includes a chicken.

[0039] Preferably, the step of screening positive clones includes: screening based on fluorescent tag genes to obtain positive coccidia.

[0040] Preferably, the step of screening positive clones further includes orally inoculating the obtained positive coccidia, and repeating the inoculation to obtain a recombinant coccidia vector that stably expresses the fiber2 protein.

[0041] In this invention, positive offspring are detected by observing fluorescence under a fluorescence microscope, positive offspring are screened by flow cytometry, and then recombinant coccidia vectors that stably express fiber2 protein are obtained by oral inoculation and repeated for 4-5 generations.

[0042] As a preferred embodiment of the present invention, the method for constructing the recombinant coccidia vector includes the following steps:

[0043] (1) Construct gene editing plasmids containing sgRNA and Cas9 targeting the ETH_00026625 gene:

[0044] The coding sequences of the sgRNA and Cas9 targeting the ETH_00026625 gene were amplified by PCR, and the coding sequences were ligated to obtain the gene editing plasmid containing the sgRNA and Cas9 targeting the ETH_00026625 gene.

[0045] (2) Constructing homologous recombination fragments:

[0046] The fiber2 gene and the fluorescent tag gene were sequentially linked to obtain a whole fragment, which was then constructed into a cloning vector to obtain the homologous recombination plasmid.

[0047] Using the obtained homologous recombination plasmid as a template, a homologous recombination fragment containing only a 5' homologous arm, promoter, partial MIC1 sequence, fiber2 gene, 6×His, P2A, mCherry gene, terminator, and 3' homologous arm was obtained by PCR amplification.

[0048] (3) The gene editing plasmid containing the sgRNA and Cas9 targeting the ETH_00026625 gene and the homologous recombination fragment were introduced into the sporozoites of Eimeria tenella by electroporation, and chickens were infected with the sporozoites.

[0049] (4) Screening for positive clones:

[0050] Screening was performed based on fluorescent tag genes on homologous recombination fragments to obtain positive coccidia; the obtained positive coccidia were then screened by flow cytometry and orally inoculated, and after 4-5 generations, a recombinant coccidia vector stably expressing fiber2 protein was obtained.

[0051] The order of steps (1) and (2) is not restricted by numbering.

[0052] Fifthly, the present invention provides the use of the recombinant coccidia vector described in the third aspect in the preparation of vaccines against adenovirus type 4 and coccidia.

[0053] In a sixth aspect, the present invention provides a method for detecting the recombinant coccidia vector described in the third aspect, the detection method comprising PCR amplification detection and / or fluorescence detection.

[0054] Preferably, the target genes detected by the PCR amplification include the fiber2 gene and / or a fluorescent tag gene;

[0055] Preferably, the fluorescence detection includes detection based on the fluorescence of the recombinant coccidia vector.

[0056] As a preferred embodiment of the present invention, the method for detecting recombinant coccidia vectors in the present invention includes:

[0057] Genomic DNA was extracted from the obtained positive recombinant coccidia vector, and PCR detection and sequencing were performed using primers. The fiber2 gene and fluorescent tag gene were successfully recombined, proving that a recombinant coccidia vector expressing fiber2 protein and fluorescent tag gene was successfully constructed.

[0058] Compared with the prior art, the present invention has the following beneficial effects:

[0059] (1) The sgRNA targeting the ETH_00026625 gene and the ETH_00026625 gene editing system described in this invention have good specificity and extremely low off-target rate, resulting in high gene editing efficiency. Introducing the ETH_00026625 gene editing system into Eimeria tenella sporozoites allows for the targeted insertion of the fiber2 gene into the ETH_00026625 gene, avoiding non-specific gene editing, resulting in high editing efficiency and low off-target rate. The fiber2 protein may stimulate chickens to produce neutralizing antibodies against avian adenovirus type 4. The homologous recombinant plasmid contains a His tag, which has a small molecular weight and low immunogenicity, facilitating subsequent protein detection. An intervening sequence is inserted between the fiber2 gene and the fluorescent tag gene to prevent the formation of a fusion protein between the fiber2 protein and the fluorescent tag protein, thus promoting the immunological activity of the fiber2 protein.

[0060] (2) This invention obtains a recombinant coccidia vector that can be used to simultaneously prevent avian adenovirus type 4 and Eimeria tenella by inserting the fiber2 gene at a specific site into the ETH_00026625 gene. The technology is mature, simple to operate, has a high success rate, and good reproducibility. The constructed recombinant coccidia vector can transmit the edited gene to progeny coccidia by producing sporozoites, achieving the stability and heritability of gene editing and reducing the workload of screening.

[0061] The amino acid and nucleotide sequences in this invention are as follows:

[0062] SEQ ID NO: 1: gcgctaccggctattaaggg.

[0063] SEQ ID NO:2:

[0064] MLRAPKRRHSENGKPETEAGPSPAPIKRAKRMVRASQLDLVYPFDYVADPVGGLNPPFLGGSGPLVDQGGQLTLNVTDPIIIKNRSVDLAHDPSLDVNAQGQLAVAVDPEGALDITPDGLDVKVDGVTVMVNDDWELAVKVDPSGGLDSTAGGLGVSVDDTLLVDQGELGVHLNQQGPITADSSGIDLEINPNMFTVNTSTGSGVLELNLKAQGGIQADSSGVGVSVDESLQIVNNTLEVKPDPSGPLTVSANGLGLKYDTNTLAVTAGALTVVGGGSVSTPIATFVSGSPSLNTYNATTVNSSANAFSCAYYLQQWNIQGLLVTSLYLKLDSATMGNRPGDLNSANAKWFTFWVSAYLQQCNPSGIQAGTVSPSTATLTDFEPMANRSVTSPWTYSANGYYEPSIGEFQVFSPVVTGAWNPGNIGIRVLPVPVSASGERYTLLCYSLQCTNASIFNPNNSGTMIVGPVLYSCPAASLP。

[0065] SEQ ID NO:3:

[0066] Attached Figure Description

[0067] Figure 1 This is a map of the gene-editing plasmid pSAG1-CAS9-U6-sgACTIN3H from Example 3.

[0068] Figure 2 This is a map of the homologous recombination fragment in Example 3.

[0069] Figure 3 The image shown is a fluorescence microscope image of the first generation oocytes in Example 3 (magnification = 100x).

[0070] Figure 4 The image shown is a fluorescence microscope image of the third-generation oocytes in Example 3 (magnification = 100x).

[0071] Figure 5 The results are PCR detection results of the recombinant coccidia vector in Example 4.

[0072] Figure 6 The results of recombinant coccidia mRNA detection in test example 1.

[0073] Figure 7 This is the result of the Western Blot in test example 2. Detailed Implementation

[0074] The technical solution of the present invention will be further illustrated below through specific embodiments. Those skilled in the art should understand that the embodiments described are merely illustrative of the present invention and should not be construed as limiting the invention in any way.

[0075] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0076] Material:

[0077] PCR amplification reagents were purchased from Nanjing Novizan Biotechnology Co., Ltd.

[0078] The plasmid extraction kit was purchased from Thermo Fisher Scientific.

[0079] The Q5 point mutation kit was purchased from NEB (Beijing) Co., Ltd.

[0080] The KLD point mutation kit was purchased from NEB (Beijing) Co., Ltd.

[0081] The tender Eimeria coccidia comes from Foshan Zhengdian Biotechnology Co., Ltd.

[0082] Example 1

[0083] This embodiment provides an sgRNA targeting the ETH_00026625 gene, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0084] SEQ ID NO: 1: gcgctaccggctattaaggg.

[0085] In this invention, the sgRNA targets the non-coding region sequence of the ETH_00026625 gene. The sgRNA has good specificity and targeting, low off-target rate, and high editing efficiency.

[0086] Example 2

[0087] This embodiment provides an ETH_00026625 gene editing system, which includes sgRNA, Cas9, and homologous recombination fragments targeting the ETH_00026625 gene.

[0088] The sgRNA targeting the ETH_00026625 gene is linked to the coding sequence of the Cas9 nuclease in the same gene-editing plasmid.

[0089] The homologous recombination fragment includes the 5' homologous arm of the ETH_00026625 gene, the SAG13 promoter, the MIC1 signal peptide sequence, the fiber2 gene, mCherry red fluorescent protein, the SAG13 terminator, and the 3' homologous arm of the ETH_00026625 gene.

[0090] The ETH_00026625 gene editing system can precisely insert the fiber2 gene of avian adenovirus type 4 into the ETH_00026625 gene of Eimeria tenella, avoiding non-specific gene editing, with high editing efficiency and low off-target rate.

[0091] Example 3

[0092] This embodiment provides a recombinant coccidia vector, which is a *Eimeria tenella* strain that has been edited using the ETH_00026625 gene editing system in Example 2, with the fiber2 gene of avian adenovirus type 4 inserted at a specific site into the ETH_00026625 gene.

[0093] The recombinant coccidia vector was constructed using the following method:

[0094] (1) Construct gene editing plasmids containing sgRNA and Cas9 targeting the ETH_00026625 gene:

[0095] The non-coding region of the ETH_00026625 gene was selected as the insertion site, and the nucleotide sequence of this site is shown in SEQ ID NO:4.

[0096] SEQ ID NO:4:

[0097] tgtgggcagaaagagggcggcgtagagaggcatttagtggatgcttttgaggagttctgggaggtcatcagtagtg gggaggtctaccgcaccgtctggtcggcctattagttaatgcccacatgaggcgatcttttggtggtgcgtgacggggtc agtcattgga.

[0098] PCR was performed using the Q5 point mutation kit. The nucleotide sequence of the forward primer sgMIC2 F is shown in SEQ ID NO:5, and the nucleotide sequence of the reverse primer sgMIC2 R is shown in SEQ ID NO:6. The template was the pSAG1-CAS9-U6 plasmid. The PCR products were obtained, and the reaction system is shown in Table 1.

[0099] SEQ ID NO: 5: aataggccgaccagacggtggttttagagctagaaatagcaagtt.

[0100] SEQ ID NO:6: aacttgacatccccatttacc.

[0101] Table 1

[0102] <![CDATA[Enzyme, dNTP s and a mixture of buffer]]> 12.5 forward primer 1.25 reverse primer 1.25 pSAG1-CAS9-U6 plasmid 1 water Supplement to 25

[0103] PCR reaction conditions are shown in Table 2:

[0104] Table 2

[0105]

[0106] The PCR products were subjected to the KLD reaction, and the reaction system for the KLD reaction is shown in Table 3.

[0107] Table 3

[0108] reaction buffer 5 enzyme mixture 1 PCR products 1 water Supplement to 10

[0109] The obtained KLD mixture was transformed into DH5α competent cells, plasmids were extracted, positive clones were identified by SalI single enzyme digestion, and unidirectional sequencing was performed using primer M13, which was used for sequencing verification. The nucleotide sequence of primer M13 is shown in SEQ ID NO:7. The map of the gene editing plasmid is shown below. Figure 1 As shown, the nucleotide sequence of the gene editing plasmid pSAG1-CAS9-U6-sgMIC2 is shown in SEQ ID NO:3.

[0110] SEQ ID NO:7: caggaaacagctatgac.

[0111] (2) Constructing homologous recombination fragments:

[0112] The 5' homologous arm of the ETH_00026625 gene, the SAG13 promoter, a partial fragment of MIC1, the avian adenovirus type 4 fiber2 gene, 6×HIS, P2A, mCherry fluorescent protein gene, the SAG13 terminator, and the 3' homologous arm of the ETH_00026625 gene were sequentially ligated to obtain a whole fragment. This whole fragment was then constructed into a vector to obtain the homologous recombination plasmid. The gene sequence was sent to BGI Genomics Co., Ltd. in Shenzhen for plasmid synthesis. The map of the homologous recombination fragment is shown below. Figure 2 As shown.

[0113] The homologous recombination plasmid was used to transform competent DH5α cells, and the plasmid was extracted. The homologous recombination plasmid was amplified by PCR using linearized primers. The nucleotide sequence of the forward primer of the linearized primer is shown in SEQ ID NO:8, and the nucleotide sequence of the reverse primer of the linearized primer is shown in SEQ ID NO:9. The homologous recombination fragment was obtained, and the nucleotide sequence of the homologous recombination fragment is shown in SEQ ID NO:3.

[0114] SEQ ID NO: 8: aggaacaaatggagtgtgtttgaac.

[0115] SEQ ID NO:9: gctttcttcagctcttattaagcgat.

[0116] (3) Electroporation of sporozoites:

[0117] 730,000 extracted sporozoites were placed in a 4 mm electroporation cuvette, and 300 μL of electroporation buffer, 5 μL of 3000 ng / μL knockout plasmid, and 30 μL of 500 ng / μL homologous recombinant plasmid were added, for a total volume of 335 μL. The sample was gently mixed and incubated on ice for 20 min. Transfection was then performed at any time under the following conditions: voltage 2000 V, 0.4 ms, and 3 pulses. After electroporation, 500 μL of DMEN solution at 37°C was added, and the mixture was allowed to stand for 10 min before the sample was evenly inoculated into two 5-day-old Muscovy chickens.

[0118] The electro-hydraulic solution is High Performance Electroporation Solution, manufactured by BTX Corporation, USA.

[0119] (4) Screening for positive clones:

[0120] Feces were collected from days 7 to 11, purified to obtain oocysts, and after sporulation, fluorescent single oocysts were observed under a fluorescence microscope. Figure 3 These are fluorescence micrographs of first-generation oocytes. Figure 4 This is a fluorescence microscope image of the third-generation oocysts. Using the above construction method, this embodiment successfully inserted the avian adenovirus type 4 fiber2 gene and a fluorescent tag gene into the ETH_00026625 gene of *Eimeria tenella* at a specific site, constructing a recombinant coccidia vector expressing the avian adenovirus type 4 fiber2 protein and a fluorescent tag.

[0121] Example 4

[0122] This embodiment provides a method for detecting recombinant coccidia vectors. The method is used to detect the recombinant coccidia vector containing the fiber2 gene and fluorescent tag gene of avian adenovirus type 4 inserted at a specific site in Example 3. The detection steps are as follows:

[0123] The nucleotide sequence of the forward primer fiber2-1437F for the full-length Fiber2 genome is shown in SEQ ID NO:10, and the nucleotide sequence of the reverse primer fiber2R-1437R is shown in SEQ ID NO:11. The PCR template included the recombinant coccidia group, the parental strain, the homologous group plasmid (positive group), and the negative group, resulting in a PCR product with a band size of 1437 bp. The reaction system is shown in Table 4. Figure 5 The PCR results for recombinant coccidia are shown below: M represents a 2000 bp marker; lanes 1-4 represent successfully transfected coccidia; lane Q represents the parental control group; lane 'positive' represents the homologous recombinant plasmid as a positive control; and lane 'negative' represents the negative control group, using dd water instead of the corresponding DNA template. The PCR electrophoresis and sequencing results indicate that the fiber2 gene is completely inserted into the coccidia.

[0124] SEQ ID NO: 10: atgctccgggcccctaaaagaagac.

[0125] SEQ ID NO: 11: cgggagggaggccgctggacagctg.

[0126] Table 4

[0127] A mixture of enzymes, dNTPs, and buffer. 10 forward primer 1 reverse primer 1 template 2 water Supplement to 20

[0128] The construction method described in this invention can successfully construct and screen Eimeria tenella expressing the fiber2 protein of avian adenovirus type 4, and positive recombinant coccidia vectors can be observed by fluorescence microscopy and detected by PCR.

[0129] Test Example 1

[0130] To test whether coccidia transcribed mRNA, coccidia RNA was extracted using 5 million sporulated coccidia. After removing DNA from the extracted RNA sample, the sample was reverse transcribed into cDNA and tested using conventional PCR. The forward primer mRNA-testF nucleotide sequence of the fiber2-mRNA gene sequence is shown in SEQ ID NO:12 (tcccatcatcatcaagaaca), and the reverse primer mRNA-testR nucleotide sequence is shown in SEQ ID NO:13 (aatctgtaggctttcatcca). The cDNA template included recombinant coccidia, parental strain, homologous recombination fragment, and negative control. Figure 6 The results for recombinant coccidia mRNA detection are shown, with M representing a 500bp marker. Lanes labeled "recombinant" represent successfully transfected coccidia; lanes labeled "parent" represent parental strains of coccidia; lanes labeled "positive" represent positive controls using homologous fragments as templates; and lanes labeled "negative" represent negative controls using dd water as a template. PCR electrophoresis and sequencing results indicate that the fiber2 gene can be transcribed.

[0131] Test Example 2

[0132] To test whether coccidia can translate the fiber2 protein, recombinant strains with 20 million sporulations and parental strains were placed in 2 mL centrifuge tubes, and sufficient 1 mm glass beads were added. The samples were then homogenized in a homogenizer at 60 Hz for 30 seconds per cycle, for a total of three cycles. The homogenized samples were then transferred to new centrifuge tubes, and Western blotting was used to detect the presence of the fiber2 protein. Mouse anti-His antibody was used as the primary antibody, and goat anti-mouse antibody was used as the secondary antibody. Figure 7 The results of this experiment show that the recombinant strain produced obvious bands, while the parental strain did not produce any bands. This indicates that coccidia can produce fiber2 protein and can modify this protein to form a subprotein of fiber2 protein.

[0133] Example 5

[0134] An immunoprotection experiment was designed using SPF chickens. This experiment included recombinant strains, parental strains, positive groups, and negative groups. The recombinant strains and parental strains were immunized with 500, 1000, and 5000 doses of coccidia at 1 day, 10 days, and 20 days of age, respectively. The negative and positive groups were not treated in any way. Viral virulence was detected by cell culture, and the virus was diluted to the most suitable challenge concentration. At 30 days of age, each chicken was challenged with 1 mL of adenovirus type 4.

[0135] This embodiment evaluates the immunoprotective effect of the recombinant coccidia vector described in Example 3.

[0136] The methods for immune assessment are as follows:

[0137] (1) The coccidia vector vaccine was evaluated by the mortality rate. The survival rate was calculated as the number of surviving chickens ÷ the total number of chickens challenged with the virus × 100%.

[0138] The results of the immune assessment are shown in Table 5. The results include recombinant coccidia, parental strains, positive and negative groups.

[0139] Table 5

[0140] Recombinant coccidia 70~90 Parental plants 10~40 positive group 0 negative group 100

[0141] As shown in Table 5, the recombinant coccidia from Example 1 has a good immune effect.

[0142] In summary, the sgRNA targeting the ETH_00026625 gene described in this invention exhibits high specificity and a low off-target rate. When combined with the Cas9 nuclease, it enables the insertion of the fiber2 gene into the ETH_00026625 gene of *Eimeria tenella*. The ETH_00026625 gene editing system described in this invention demonstrates high gene editing efficiency, produces recombinant coccidia vectors with stable genotypes, exhibits good immunogenicity, and is highly efficient and safe.

[0143] The applicant declares that the above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention fall within the protection and disclosure scope of the present invention.

Claims

1. An ETH_00026625 gene editing system, characterized in that, The ETH_00026625 gene editing system includes sgRNA, Cas9 nuclease, and homologous recombination fragments targeting the ETH_00026625 gene, wherein the homologous recombination fragments include coding sequences for the fiber2 gene and a fluorescent tag gene. The nucleotide sequence of the sgRNA targeting the ETH_00026625 gene is shown in SEQ ID NO:1; the nucleotide sequence of the homologous recombination fragment is shown in SEQ ID NO:

3.

2. A recombinant coccidia vector, characterized in that, The recombinant coccidia vector is a coccidia vector that integrates the coding sequences of the fiber2 gene and the fluorescent tag gene into the ETH_00026625 gene after being edited by the ETH_00026625 gene editing system described in claim 1.

3. The use of the recombinant coccidia vector according to claim 2 in the preparation of a vaccine against adenovirus type 4 and coccidia.

4. A method for detecting the recombinant coccidia vector according to claim 2, characterized in that, The detection methods include PCR amplification detection and / or fluorescence detection.

5. The detection method for the recombinant coccidia vector according to claim 4, characterized in that, The target genes detected by the PCR amplification include the fiber2 gene and / or fluorescent tag genes.

6. The detection method for the recombinant coccidia vector according to claim 4, characterized in that, The fluorescence detection includes detection based on the fluorescence of the recombinant coccidia vector.

Citation Information

Patent Citations

  • A recombinant fowlpox virus transfer vector expressing the fiber2 gene of chicken adenovirus type 4, its construction method and application

    CN107475296B

  • Recombinant Newcastle disease virus heat-resistant vaccine strain for expressing fowl adenovirus type 4 truncated Fiber2 proteins as well as preparation method and application of recombinant Newcastle disease virus heat-resistant vaccine strain

    CN112094824A

  • Recombinant coccidiosis vector for expressing NA4 protein and fluorescent label and detection method of recombinant coccidiosis vector

    CN114181939A