Duchenne muscular dystrophy-associated exon splicing enhancers, sgRNAs, and uses

Abstract

The application discloses a Duchenne muscular dystrophy related exon splicing enhancer, sgRNA and application, and provides sgRNA which can induce skipping of some exons in a human DMD hotspot region (exons 2-20 and exons 45-55). The application is based on a gene editing tool designed by a mutant of cytosine deaminase AID and a Cas9 mutant, and the PAM sequence corresponding to the Cas9 is used for editing G:C base pairs at the 3' splicing site (AG) or the 5' splicing site (GT) of the target exon or editing the splicing enhancer in the exon, so that the G:C to A:T mutation is realized, and the splicing site and other splicing related cis elements are destroyed. Skipping of the target exon is successfully detected in myocardial cells differentiated from IPS cells, and a certain foundation is laid for individualized treatment of DMD.

Description

Technical Field

[0001] This invention belongs to the field of gene therapy and relates to the modification and treatment of Duchenne muscular dystrophy-related sgRNA in human iPS cells targeting pathogenic mutations in the genetic disease DMD. Background Technology

[0002] Duchenne muscular dystrophy (DMD) is an X-linked recessive genetic disorder with an incidence of 1 in 5000 male newborns. It is characterized by muscle damage and necrosis, leading to wheelchair dependence and eventual death from respiratory and cardiac dysfunction, with an average lifespan of approximately 20 years. DMD occurs due to mutations in the gene encoding dystrophin, causing a frameshift in the open reading frame of the encoded mRNA or the creation of a premature stop codon, resulting in the complete deletion of dystrophin and the DMD phenotype. Traditional treatments typically involve anti-inflammatory drugs (such as corticosteroids) to reduce inflammation around the muscles, thus delaying muscle necrosis; or angiotensin inhibitors to alleviate the discomfort caused by myocardial degeneration, including drugs like indopril and various beta-blockers. However, these treatments cannot fundamentally cure DMD or prolong the lifespan of DMD patients. With advancements in molecular biology and analysis of clinical data, a new group of patients with mutations in the gene encoding the Dystrophin protein has been identified. These patients do not exhibit the same severe pathological progression as those with DMD. This group is known as Benson's muscular dystrophy (BMD). Their Dystrophin gene mutations do not disrupt the intact open reading frames of the protein, allowing them to produce Dystrophin protein with certain biological functions without severe cardiac dysfunction or other muscle defects. Compared to the severe pathological progression of DMD, the lifespan of BMD patients is not significantly affected, and they can almost fully recover their daily lives. Therefore, a treatment strategy to convert DMD into BMD has been proposed. Currently, many effective drugs for DMD are available on the market, including Eteplirsen (targeting Exon 51 skipping) and Golodirsen (targeting Exon 53 skipping) developed by Sarepta. These are essentially antisense oligonucleotides (ASOs) that act on the pre-mRNA of the target exon, inducing skipping. These two drugs can treat 13% and 8% of DMD patients, respectively. However, these currently available drugs often suffer from low efficacy, require continuous administration, and are extremely expensive. Gene editing therapy, on the other hand, can directly target and modify the pathogenic mutations in gene mutation-related genetic diseases. Once edited, it can fundamentally cure the disease, offering significant advantages. Furthermore, treatments for other types of DMD are still in the early stages of research. To better meet the treatment needs of different DMD patients, research into other exon skipping regions (exons 2-20 and 45-55) is urgently needed.Studies have shown that inducing exon 53 and exon 45 skipping in DMD alone can treat 8.1% and 7.7% of DMD patients, respectively. Inducing skipping in other exons of DMD mutation hotspots, such as exons 4, 5, 46, 47, 49, and 52, can treat 0.2%, 0.3%, 4.3%, 0.3%, 0.02%, and 4.1% of DMD patients, respectively (Theoretic Applicability of Antisense-Mediated Exon Skipping for Duchenne Muscular Dystrophy Mutations, 2009; Correction of diverse muscular dystrophy mutations in human engineered heart muscle by single-site genome editing, 2017). Summary of the Invention

[0003] The purpose of this invention is to provide a class of Duchenne muscular dystrophy-related exon splicing enhancers, sgRNAs, as drugs for gene editing therapy in mammals (disease animal models and human patients) for the treatment of Duchenne muscular dystrophy.

[0004] In a first aspect, the present invention provides an exon splicing enhancer associated with Duchenne muscular dystrophy, wherein the exon splicing enhancer is an exon splicing enhancer element targeting the human DMD gene Exon53, and its nucleotide sequence includes:

[0005] 1) The sequence shown in SEQ ID NO.14 and its inverse complementary sequence.

[0006] 2) The sequence shown in SEQ ID NO.15 and its inverse complementary sequence.

[0007] By altering or blocking elements such as the exon splicing enhancer (ESE), skip reading of the DMD gene Exon51 can be induced, thereby enabling gene editing therapy in mammals.

[0008] Secondly, the present invention provides a single-stranded guide RNA (sgRNA) associated with Duchenne muscular dystrophy that can target a specific genome, the sequence of which includes:

[0009] The sgRNA (Sg E4-5'SS) targeting the human DMD gene Exon4 has the following nucleotide sequence: CATTATGTTCTGCAAAACC (SEQ ID NO.1);

[0010] The nucleotide sequence of sgRNA-1 (Sg E5-3'SS) targeting Exon5 of the human DMD gene is: TAAATCAACCTGTTAAAGAA (SEQ ID NO.2);

[0011] The nucleotide sequence of sgRNA-2 (Sg E5-5'SS) targeting Exon5 of the human DMD gene is: CCTGCCAGTGGAGGATTATATT (SEQ ID NO.3);

[0012] The sgRNA (Sg E45-3'SS) targeting the human DMD gene Exon45 has the following nucleotide sequence: GTTCCTGTAAGATACCAAAA (SEQ ID NO.4);

[0013] The sgRNA (Sg E46-3'SS) targeting the human DMD gene Exon46 has the following nucleotide sequence: TTCTTCTAGCCTGGAGAAAG (SEQ ID NO.5);

[0014] The nucleotide sequence of the sgRNA (Sg E47-3'SS) targeting the human DMD gene Exon47 is: TCCACCAGTAACTGAAACAG (SEQ ID NO.6);

[0015] The nucleotide sequence of sgRNA-1 (Sg E49-3'SS) targeting the human DMD gene Exon49 is: TTCCTGGGGAAAAGAACCCA (SEQ ID NO.7);

[0016] The nucleotide sequence of sgRNA-2 (Sg E49-5'SS) targeting the human DMD gene Exon49 is: TTACCTTCACTGGCTGAGTG (SEQ ID NO.8);

[0017] The nucleotide sequence of sgRNA-1 (Sg E52-3'SS) targeting the human DMD gene Exon52 is: GCCTGTAAGAACAAATATCC (SEQ ID NO.9);

[0018] The nucleotide sequence of sgRNA-1 (Sg E53-#11) targeting the human DMD gene Exon53 is: ACACCTTCAGAACCGGAGGC (SEQ ID NO.10);

[0019] The nucleotide sequence of sgRNA-2 (Sg E53-#18) targeting the human DMD gene Exon53 is: AGACAGGCCAGAGCCAAGC (SEQ ID NO.11);

[0020] Thirdly, the present invention provides the application of the sgRNA in the preparation of a medicament for treating Duchenne muscular dystrophy, wherein the sgRNA, when combined with a gene editing tool, can be used in the preparation of a medicament for treating Duchenne muscular dystrophy.

[0021] This invention relates to a gene-editing tool designed based on mutants of cytosine deaminase AID and Cas9. Using the PAM sequence corresponding to Cas9, it edits the G:C base pairs at the 3' splice site (AG) or 5' splice site (GT) of the target exon, or edits the splice enhancers within the exon, achieving a G:C→A:T mutation and disrupting splice-related cis-elements such as splice sites. Skipping of the target exon was successfully detected in cardiomyocytes differentiated from iPS cells, laying a foundation for personalized treatment of DMD. Attached Figure Description

[0022] Figure 1 (A) An sgRNA designed based on the 5'SS region of exon 4 of the human DMD gene, and the sgRNA (nucleotide sequence shown in SEQ ID NO.1) and LentiV2-AID. * Sanger sequencing results of -SaCas9n(KKH)-UGI (nucleotide sequence shown in SEQ ID NO. 12) inducing a 5'SS mutation in exon 4 in 293T cells. Mock is the blank control group. The unshaded area in the figure is the PAM sequence (NNNRRT), the shaded area is the sgRNA target region, and the bases marked in the boxes are G bases at the splice sites.

[0023] (B).Sg E4-5'SS and LentiV2-AID * The high-throughput sequencing results of -SaCas9n(KKH)-UGI inducing the 5'SS mutation in exon 4 in BJ-RIPS cells are shown. Mock is the blank control, and the bases marked by the dashed boxes are the G bases at the splice sites.

[0024] (C). Passed or not passed through Sg E4-5'SS with LentiV2-AID *The image shows the electrophoresis results of RNA extracted from -SaCas9n(KKH)-UGI-edited iPS cells after differentiation into cardiomyocytes, followed by RT-PCR and Sanger sequencing of the PCR products.

[0025] (D). Results of quantification of RT-PCR products in (C) using a Fragment Analyzer. P-value: ****p<0.0001.

[0026] (E).Sg E4-5'SS was used to detect off-target effects at 10 predicted off-target sites. Bases marked in gray are mismatched with the target region sequence, and sites marked with numbers are sites with a mutation frequency >0.1%.

[0027] Figure 2 (A) An sgRNA designed based on the 3'SS and 5'SS sites of exon 5 of the human DMD gene, and the nucleotide sequence of the sgRNA as shown in SEQ ID NO.2 and SEQ ID NO.3) and LentiV2-AID * Sanger sequencing results of -SaCas9n(KKH)-UGI (SEQ ID NO.12) inducing mutations in exon 5 3'SS and 5'SS in 293T cells.

[0028] (B). Sg E5-3'SS or Sg E5-5'SS with LentiV2-AID * The high-throughput sequencing results of -SaCas9n(KKH)-UGI inducing 3'SS or 5'SS mutations in exon 5 in BJ-RIPS cells. Mock is the blank control, and the bases marked by the dashed boxes are G bases at the splice sites.

[0029] (C). Passed or not passed with Sg E5-3'SS or Sg E5-5'SS and LentiV2-AID * The image shows the electrophoresis results of RNA extracted from -SaCas9n(KKH)-UGI-edited iPS cells after differentiation into cardiomyocytes, followed by RT-PCR and Sanger sequencing of the PCR products.

[0030] The results of quantification of the RT-PCR products in (D) and (C) using a Fragment Analyzer. P-value: **p<0.01****p<0.0001.

[0031] (E) and (F) show the detection of off-target effects of Sg E5-3'SS or Sg E5-5'SS at the predicted 10 off-target sites, respectively. The bases marked in gray are the bases that mismatch with the target region sequence, and the sites marked with numbers are the sites with a mutation frequency >0.1%. Figure 3 :(A).Sg E45-3'SS (shown as SEQ ID NO.4) and AID x The high-throughput sequencing results of SpCas9-UGI (SEQ ID NO. 13) inducing the 3'SS mutation in exon 45 in BJ-RIPS cells are shown. The Mock is a blank control, and the bases marked by the dashed boxes are G bases at the splice sites.

[0032] (B). Passed or not passed with Sg E45-3'SS and LentiV2-AID x -Image of the electrophoresis results of RT-PCR after RNA was extracted from SpCas9-UGI edited iPS cells after differentiation into cardiomyocytes, and Sanger sequencing results of the skip read products.

[0033] (C) Results of quantification of RT-PCR products in (B) using a Fragment Analyzer. P-value: ****p<0.0001.

[0034] (D).Sg E45-3'SS was used to detect off-target effects at 10 predicted off-target sites. Bases marked in gray are mismatched with the target region sequence, and sites marked with numbers are sites with a mutation frequency >0.1%.

[0035] Figure 4 (A) An sgRNA designed based on the 3' splice site of exon 46 of the human DMD gene, and the sgRNA (shown in SEQ ID NO.5) and LentiV2-AID. * Sanger sequencing results of -SaCas9n(KKH)-UGI (shown in SEQ ID NO.12) inducing a 3'SS mutation in exon 46 in 293T cells.

[0036] (B).Sg E46-3'SS and LentiV2-AID * The high-throughput sequencing results of -SaCas9n(KKH)-UGI inducing the 3'SS mutation in exon 46 in BJ-RIPS cells are shown. Mock is the blank control, and the bases marked by the dashed boxes are the G bases at the splice sites.

[0037] (C). Passed or not passed through Sg E46-3'SS and LentiV2-AID *The electrophoresis results of RT-PCR after RNA extraction from -SaCas9n(KKH)-UGI-edited iPS cells differentiated into cardiomyocytes, and the Sanger sequencing results of the skip-read products. (D). Results of quantification of RT-PCR products in (C) using a fragment analyzer. ****p<0.0001.

[0038] (E).Sg E46-3'SS was used to detect off-target effects at 10 predicted off-target sites. Bases marked in gray are mismatched with the target region sequence, and sites marked with numbers are sites with a mutation frequency >0.1%.

[0039] Figure 5 (A) An sgRNA designed based on the 3' splice site of exon 47 of the human DMD gene, and the sgRNA (shown in SEQ ID NO. 6) and LentiV2-AID. * Sanger sequencing results of the induction of the 3'SS mutation in exon 47 by -SaCas9n(KKH)-UGI (SEQ ID NO.12) in 293T cells.

[0040] (B).Sg E47-3'SS and LentiV2-AID * The high-throughput sequencing results of -SaCas9n(KKH)-UGI inducing the 3'SS mutation in exon 47 in BJ-RIPS cells are shown. Mock is the blank control, and the bases marked by the dashed boxes are the G bases at the splice sites.

[0041] (C). Passed or not passed with Sg E47-3'SS and LentiV2-AID * The electrophoresis results of RT-PCR after RNA extraction from -SaCas9n(KKH)-UGI-edited iPS cells differentiated into cardiomyocytes, and the Sanger sequencing results of the skip-read products. (D). Results of quantification of RT-PCR products in (C) using a fragment analyzer. ****p<0.0001.

[0042] (E).Sg E47-3'SS was used to detect off-target effects at 10 predicted off-target sites. Bases marked in gray are mismatched with the target region sequence, and sites marked with numbers are sites with a mutation frequency >0.1%.

[0043] Figure 6(A) sgRNA designed based on the 3' and 5' splice sites of exon 49 of the human DMD gene, and the relationship between this sgRNA (shown in SEQ ID NO.7 and SEQ ID NO.8) and LentiV2-AID. * Sanger sequencing results of -SaCas9n(KKH)-UGI (shown in SEQ ID NO.12) inducing mutations in exon 49 3'SS and 5'SS in 293T cells.

[0044] (B). Sg E49-3'SS or Sg E49-5'SS with LentiV2-AID * The high-throughput sequencing results of -SaCas9n(KKH)-UGI inducing mutations in exon 49 3'SS or 5'SS in BJ-RIPS cells. Mock is the blank control, and the bases marked with dashed boxes are G bases at splice sites.

[0045] (C). With or without Sg E49-3'SS or Sg E49-5'SS and LentiV2-AID * The image shows the electrophoresis results of RT-PCR after RNA was extracted from IPS cells edited with -SaCas9n(KKH)-UGI and differentiated into cardiomyocytes, as well as the Sanger sequencing results of the skip read products.

[0046] Results of quantification of RT-PCR products in (D) and (C) using a Fragment Analyzer. P-value: **p<0.01****p<0.0001.

[0047] (E) and (F) show the detection of off-target effects of Sg E49-3'SS or Sg E49-5'SS at the predicted 10 off-target sites, respectively. The bases marked in gray are the bases that mismatch with the target region sequence, and the sites marked with numbers are the sites with a mutation frequency >0.1%. Figure 7 (A). A high-throughput sequencing result of sgRNA designed based on the 3' splice site of exon 52 of the human DMD gene, and the sgRNA (SEQ ID NO.9) and LentiV2-AID*-SaCas9n(KKH)-UGI (SEQ ID NO.12) induced SS mutations in exon 52 of BJ-RIPS cells. Mock is a blank control, and the bases marked by the dashed box are G bases at the splice site.

[0048] (B).Sg E52-3'SS and LentiV2-AID *High-throughput sequencing results of -SaCas9n(KKH)-UGI inducing the 3'SS mutation in exon 52 in BJ-RIPS cells. Mock is the blank control, and the bases marked in the boxes are G bases at the splice sites. (C). With or without Sg E52-3'SS and LentiV2-AID * The image shows the electrophoresis results of RT-PCR after RNA was extracted from -SaCas9n(KKH)-UGI-edited iPS cells that differentiated into cardiomyocytes, and the Sanger sequencing results of the skip read products.

[0049] Results of quantification of RT-PCR products in (D) and (C) using a fragment analyzer. P-value: **p<0.01

[0050] (E).Sg E52-3'SS was used to detect off-target effects at 10 predicted off-target sites. Bases marked in gray are mismatched with the target region sequence, and sites marked with numbers are sites with a mutation frequency >0.1%.

[0051] Figure 8 (A) Sg E53-#11 (shown in SEQ ID NO.10) and Sg E53-#18 (shown in SEQ ID NO.11) with LentiV2-AID * The high-throughput sequencing results of -SaCas9n(KKH)-UGI (shown in SEQ ID NO.12) inducing ESE mutation in exon 53 in WT-K562 cells. Mock is the blank control. The bases pointed to by the arrows and labeled with frequencies are the bases with the highest mutation frequency.

[0052] (B). Passed or not passed through Sg E53-#11 / Sg E53-#18 with LentiV2-AID * Electrophoresis results of RNA extracted from WT-K562 cells edited with -SaCas9n(KKH)-UGI or edited with both of the above sgRNAs simultaneously, followed by RT-PCR, and Sanger sequencing results of the skip read products.

[0053] (C) Results of quantification of RT-PCR products in (B) using a Fragment Analyzer. P-value: ****p<0.0001.

[0054] (D).Sg E53-#11 Detection of off-target effects at 9 predicted off-target sites. Bases marked in gray are mismatched with the target region sequence, and sites marked with numbers are sites with a mutation frequency >0.1%.

[0055] (E).Sg E53-#18 was used to detect off-target effects at nine predicted off-target sites. Bases marked in gray are mismatched with the target region sequence, and sites marked with numbers are those with a mutation frequency >0.1%. (The OT1 site, with the highest off-target effect, is located in a non-coding region of the genome, 7.5 kb away from the nearest CNR2 gene). Detailed Implementation

[0056] The present invention will be further described below with reference to specific embodiments and accompanying drawings. Unless otherwise stated, the reagents and cells used in this specific embodiment are all commercially available products.

[0057] Example 1: Therapeutic effect against sgRNA of Exon4 in human DMD gene

[0058] First, 293T cells were used as experimental cells to verify whether each of the above sgRNAs could successfully edit the 3'SS or 5'SS of the corresponding exon. Transfection was performed using Lipo2000 transfection reagent. The day before transfection, 293T cells were digested and seeded in 12-well plates at a density of 3 × 10^5 cells / well. On the day of transfection, each transfection system was prepared as follows: 125 μL Opti-Mem + 2 μg plasmid (TAM(LentiV2-AID*-SaCas9n(KKH)-UGI) plasmid: sgRNA plasmid (sgRNA nucleotide sequence as shown in SEQ ID NO.1) = 2:1) + 500 ng Ugi plasmid and 125 μL Opti-Mem + 5 μL Lipo2000. After mixing, the mixture was incubated at room temperature for 15 min. The transfection system was then gently added dropwise to the 293T cell culture system. After incubation for 24 h, 2 μg / ml Puromycin and 20 μg / ml Puromycin were added. After 72 hours of Blasticidin selection, cells were cultured for another 2 days, and gDNA was extracted. This gDNA was then amplified using specific primers and sent to the company for Sanger sequencing to analyze mutations at corresponding splice sites in the sequencing data. The study aimed to determine whether sgRNA could successfully edit the corresponding exon 3'SS or 5'SS in 293T cells.

[0059] Construction of the TAM-all-in-one plasmid: The vector LentiV2-AID*-SaCas9n(KKH)-UGI was double-digested with PacI and EcoRI, and the digested vector fragments were recovered by gel extraction. PCR amplification of the U6 promoter-sgRNA-Scaffold was performed using specific primers. Similarly, the amplified insert fragment was digested with PacI and EcoRI, and the vector and insert fragment were ligated using T4 ligase at room temperature for 2 hours. The resulting cells were then transformed into DH5α competent cells. This constructed a TAM-all-in-one plasmid system containing both sgRNA and AID*-SaCas9n(KKH)-UGI on the same plasmid.

[0060] Splice sites were edited in BJ-RIPS (purchased from NTCC) cells, and the edited IPS cells were differentiated into cardiomyocytes to express DMD. RT-PCR was then used to confirm whether the splice site mutation caused target exon skipping and to statistically analyze its efficiency. Specifically, transfection was performed using Lipo3000 transfection reagent. One day before transfection, BJ-RIPS cells at 70% density were digested and seeded in 6-well plates pre-coated with matrix gel at a 1:3 ratio. On the day of transfection, each transfection system was prepared as follows: 150 μL Opti-Mem + 2.5 μg plasmid (TAM-all-in-one plasmid) + 500 ng Ugi plasmid + 5 μL P3000. TM Reagent and 150 μL Opti-Mem + 7.5 μL Lipofectamine TM After mixing 3000 Reagent, the mixture was incubated at room temperature for 15 minutes. The transfection system was then gently added to the culture system of BJ-RIPS cells and incubated for 48 hours. 2 μg / ml Puromycin was then added for selection for 72 hours. After culturing for another 2 weeks, a portion of the cells was collected for gDNA extraction. Primers were used to construct PCR libraries at specific sites in the control and experimental groups. The libraries were then sent to the company for high-throughput sequencing. The high-throughput sequencing results were then analyzed to obtain the mutation types and efficiencies caused by TAM and sgRNA at specific splicing sites.

[0061] The control and experimental groups of iPS cells, with a cell density of 75%, were digested and seeded at a 1:3 ratio in 6-well plates pre-coated with matrix gel. The cells were cultured for 2-3 days, with fresh mTesR medium (purchased from Stemcell) changed daily. Differentiation began when the cell density reached approximately 90%: on day 1, CDM3 + 3-5 μM CHIR99021 was added, and incubation was performed for 48 hours; on day 3, the medium was changed to CDM3 + 2 μM C59, and culture continued for 24 hours; on day 4, the medium was changed back to CDM3, with medium changes every 2 days. Beating cardiomyocytes were observed on days 8-10 of differentiation. On day 15, cells were collected, and RNA was extracted. RT-PCR was performed on both the control and experimental groups, and agarose gel electrophoresis was used to detect bands matching the exon skipping size.

[0062] To detect the efficiency of target exon skipping, capillary electrophoresis was used: 2-5 μL of the above RT-PCR product was added to the capillary electrophoresis system and analyzed using a Fragment Analyzer-12 / 96. The exon skipping efficiency was calculated and statistically analyzed using the formula: Exon skipping efficiency = Concentration of target exon skipping splice isomer / (Concentration of splice isomers contained in the target exon + Concentration of target exon skipping splice isomer) * 100.

[0063] To detect the off-target effects of each sgRNA, the off-target sites of each sgRNA were predicted using Cas-OFFinder. The top 10 off-target sites were selected, and each site was amplified and library constructed using specific primers. The libraries were then sent to a sequencing company for high-throughput sequencing. The high-throughput sequencing results were then analyzed to determine whether the sgRNA had an off-target effect at each predicted off-target site.

[0064] The results are as follows Figure 1 As shown, preliminary results from experiments in 293T cells indicate that Sg E4-5'SS and TAM can edit the G base at the GT splice site of exon 4 in DMD, with the main mutation type being G to A (G>A). In IPS cell experiments, it was verified that this sgRNA can effectively induce mutations in the G base at the splice site, with an average mutation frequency of 93.72%. RT-PCR and sequencing results showed that after mutation at the splice site, a splicing pattern of exon 4 skipping was generated, with an exon skipping efficiency as high as 99%. Furthermore, no significant off-target effects were detected at any of the 10 predicted off-target sites.

[0065] Example 2: Therapeutic effect against sgRNA of Exon5 in human DMD gene

[0066] The sgRNA was replaced with the sgRNAs in SEQ ID NO.2 and SEQ ID NO.3, and preliminary verification was performed in 293T cells using the same method as in Example 1. The results are as follows: Figure 2 As shown, SgE5-3'SS and SgE5-5'SS can mutate the G bases in the 3'SS and 5'SS of exon 5 of DMD, with the main mutation type being G>A. Subsequently, in IPS cells, the mutation efficiencies of the splicing sites caused by these two sgRNAs were verified to be 73.63% and 16.14%, respectively, and the proportions of splice isoforms that induced exon 5 skipping were 99.45% and 28.9%, respectively. No obvious off-target effects were detected at their respective 10 predicted off-target sites.

[0067] Example 3: Therapeutic effect against sgRNA targeting Exon45 of the human DMD gene.

[0068] The sgRNA was replaced with the sgRNA of SEQ ID NO.4, and the iPS cell experiments were performed using the same method as in Example 1. The results are as follows. Figure 3 As shown, the average editing efficiency of Sg E45-3'SS at the splice site reached 98.7%. After mutation at the splice site (the main mutation type was G>A), it could lead to skipping of exon 45, with an average skipping efficiency of 98.15%. Apart from this, no obvious off-target effects were detected at its predicted off-target sites.

[0069] Example 4: Therapeutic effect against sgRNA targeting Exon46 of the human DMD gene

[0070] The sgRNA was replaced with the sgRNA of SEQ ID NO. 5, and the experiment was performed using the same method as in Example 1. The results are as follows. Figure 4 As shown, in the 293T experiment, Sg E46-3'SS was found to induce a mutation in the G base at the 3'SS site of exon 46 in DMD, with the main mutation type being G>A. In iPS cells, the efficiency of inducing mutations at this site reached 75.17%, resulting in an average efficiency of 79% for skipping exon 46. The average indel generation rate of this sgRNA at the OT-1 site was 1.02%, and no significant off-target effects were found at other sites.

[0071] Example 5: Therapeutic effect against sgRNA targeting Exon47 of the human DMD gene.

[0072] The sgRNA was replaced with the sgRNA of SEQ ID NO. 6, and the experiment was performed using the same method as in Example 1. The results are as follows. Figure 5As shown, the 293T cell experiments preliminarily verified that Sg E47-3'SS can induce a mutation in the G base at the 3'SS position of exon 47 in DMD, with the main mutation type being G>A. In IPS cells, the mutation frequency was 76.31%, and the frequency of complete skipping of exon 47 after editing with Sg E47-3'SS and TAM reached an average of 60%. This sgRNA showed a 0.78% off-target effect at the OT-9 site, while no significant off-target effects were detected at other off-target sites.

[0073] Example 6: Therapeutic effect against sgRNA targeting human DMD gene Exon49

[0074] The sgRNA was replaced with the sgRNAs in SEQ ID NO. 7 and SEQ ID NO. 8, and the experiment was performed using the same method as in Example 1. The results are as follows. Figure 6 As shown, both Sg E49-3'SS and Sg E49-5'SS-1 were found to induce mutations in exon 49, 3'SS and 5'SS, in 293T experiments, with the main mutation type being G>A. In IPS experiments, the mutation efficiencies of the splice sites induced by Sg E49-3'SS and Sg E49-5'SS-1 were verified to be 89.86% and 65.73%, respectively, and the efficiencies of exon 49 skipping were 97.0% and 96.2%, respectively. Sg E49-3'SS showed an off-target effect of no more than 1.5% on OT-5 and OT-9, while Sg E49-5'SS-1 showed an off-target effect of no more than 0.6% on OT-10.

[0075] Example 7: Therapeutic effect against sgRNA targeting Exon52 of the human DMD gene.

[0076] The sgRNA was replaced with the sgRNA of SEQ ID NO.9, and the experiment was performed using the same method as in Example 1. The results are as follows. Figure 7 As shown, Sg E52-3'SS was verified to edit the 3'SS of exon 52 in DMD in 293T experiments, and it was also verified in IPS experiments to cause an average of 74.21% mutations at this splice site (the main mutation type was G>A). The exon 52 skipping efficiency after editing reached 33.9%. No obvious off-target effects were detected at its predicted off-target sites.

[0077] Example 8: Therapeutic effect against sgRNA targeting Exon53 of the human DMD gene

[0078] Using the K562 cell line as experimental cells, the efficiency of sgRNA (SEQ ID NO.10) and (SEQ ID NO.11) in inducing exon 53 skipping was verified. One day before transfection, the K562 cell culture medium was replaced with fresh 1640 (+10% FBS). The next day, 1 μg of plasmid (TAM plasmid: sgRNA plasmid = 2:1) was electroporated into 1.51 x 10⁻⁶ cells using a Neon electroporator. 5 In the cells, the electroporated cells were added to the culture medium and incubated in an incubator for 24 hours. Then, 2 μg / ml Puromycin and 50 μg / ml Blasticidin were added for selection for 5 days. Cells were collected, and gDNA and RNA were extracted from the cells. The cells were amplified using specific primers and sent to the company for Sanger sequencing. The base editing at the corresponding splicing elements in the sequencing data was analyzed, and the skipping of the target exon was detected by RT-PCR.

[0079] Simultaneously, using the same method as in Example 1, a skipping experiment was performed using WT-K562 cells, and the results were as follows: Figure 8 As shown, Sg E53-#11 and Sg E53-#18 were verified in K562 cell line experiments to edit two ESE (Exonic Splicing Enhancer) sites in exon 53 of DMD, respectively. Subsequent experiments also demonstrated that they could induce an average of 20.81% and 43.65% mutations (the main mutation type being C>T) in this region. The resulting exon 53 skipping efficiencies were 91.48% and 49.79%, respectively. Furthermore, the combined use of the two sgRNAs increased the exon 53 skipping efficiency to an average of 98.52%. No significant off-target effects were detected at any of the nine off-target sites predicted by Sg E53-#11. A strong off-target effect was detected at OT1 predicted by Sg E53-#18, but this site is located in a non-coding region of the genome, with the nearest gene being the CNR2 gene, approximately 7.5 kb away.

[0080] In summary, all of the above sgRNAs can successfully edit the 3'SS, 5'SS or ESE on the exons corresponding to DMD, and cause effective exon skipping. Their efficiency in inducing exon skipping can reach at least 30% and at most 99%. Of the sgRNAs mentioned above, Sg E4-5'SS / Sg E5-3'SS / Sg E5-5'SS / Sg E45-3'SS / Sg E52-3'SS showed no off-target effects at their predicted off-target sites. Sg E46-3'SS / Sg E47-3'SS / Sg E49-5'SS-1 showed an off-target effect of no more than 1.1% at only one off-target site. Sg E49-3'SS showed an off-target effect of no more than 1.5% at two predicted off-target sites. Sg E53-#18 showed a strong off-target effect at one off-target site, but this off-target site was located in a non-coding region, 7.5 kb away from the nearest CNR2 gene. In summary, the efficacy and safety of the above sgRNAs can be demonstrated.

[0081] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. The application of an sgRNA targeting the exon splicing enhancer element of the human DMD gene Exon53 in the preparation of a drug for treating Duchenne muscular dystrophy, characterized in that, The sequences of sgRNAs targeting exon splicing enhancer elements of the human DMD gene Exon53 include: The nucleotide sequence of sgRNA-1 targeting the human DMD gene Exon53 is shown in SEQ ID NO.10; The nucleotide sequence of sgRNA-2 targeting the human DMD gene Exon53 is shown in SEQ ID NO.

11.

2. The application according to claim 1, characterized in that, The nucleotide sequence of the exon splicing enhancer element targeting the human DMD gene Exon53 includes: 1) the sequence shown in SEQ ID NO.14 and its reverse complementary sequence.

Images