Method for preparing oligopeptide by using RNA circularization technology and expression DNA of oligopeptide
The preparation of oligopeptides using RNA cyclization technology has solved the problems of low yield and low purity in oligopeptide synthesis, and has enabled efficient and low-cost large-scale production of oligopeptides.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SHANDONG QIANPEPTIDE BIOTECHNOLOGY CO LTD
- Filing Date
- 2022-12-20
- Publication Date
- 2026-07-10
Smart Images
Figure CN115820703B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a method for preparing oligopeptides using RNA cyclization technology and the DNA expression of the oligopeptides, belonging to the field of protein expression technology. Background Technology
[0002] Oligopeptides, also known as small peptides, oligopeptides, or small molecule bioactive peptides, are compounds formed by the condensation of 2 to 10 amino acids and are a type of polypeptide. In the 1960s, Newey and Smyth (1959, 1960) first provided data on the complete absorption of peptides. Proteins are digested into amino acids and oligopeptides in the small intestine, and oligopeptides can enter the intestinal mucosal cells intact and be hydrolyzed into amino acids, entering the bloodstream. Oligopeptides are characterized by direct absorption without digestion, no energy consumption during absorption, no burden on gastrointestinal function, and 100% absorption by the human body.
[0003] Traditional oligopeptide synthesis is mainly divided into chemical synthesis and biosynthesis. Chemical synthesis utilizes solid or liquid media to add peptide chains sequentially to synthetic intermediates. This method is suitable for the synthesis of dipeptides or tripeptides, but for longer oligopeptides, it suffers from numerous reaction steps, many byproducts and intermediates, low yield, and purification difficulties. Biosynthesis utilizes protein expression technology in biological systems to express oligopeptide fusion proteins within the host, followed by protein purification and oligopeptide release to obtain the target oligopeptide. This method is advantageous because it is unaffected by oligopeptide length and amino acid sequence, allowing for simple and efficient oligopeptide synthesis with fewer byproducts, making it an important method for industrial oligopeptide synthesis. However, this method is difficult to apply to shorter oligopeptides, as shorter oligopeptides such as dipeptides or tripeptides constitute a very small proportion of the fusion protein, often resulting in low oligopeptide yields through fusion protein expression, hindering large-scale production. Circular RNA (RNA) is a covalently closed circular RNA molecule with good stability, high translation efficiency, and low immunogenicity, making it an important vector tool for gene expression, nucleic acid drugs, and vaccines. However, whether it can be used for the expression and purification of oligopeptides is currently unknown. Summary of the Invention
[0004] The purpose of this invention is to provide a method for preparing oligopeptides using RNA cyclization technology, which has low production cost, simple process, and is easy to scale up.
[0005] The technical solution adopted in this invention is as follows:
[0006] A method for preparing oligopeptides using RNA cyclization technology, comprising the following steps:
[0007] (1) Construct an expression DNA for oligopeptides, which includes a self-circularized sequence 1-start codon-tandem repeat oligopeptide-encoding DNA-RBS sequence-self-circularized sequence 2;
[0008] (2) The expression DNA of the oligopeptide constructed above was constructed into an expression vector, and then transformed into a host cell for expression to obtain the fusion oligopeptide;
[0009] (3) The expressed fusion oligopeptide was purified;
[0010] (4) The purified fusion oligopeptides were separated by protease cleavage;
[0011] (5) Purify and separate the oligopeptides.
[0012] Preferably, the expressed DNA comprises a self-circularized sequence 1 - start codon - affinity tag / secretion tag / self-aggregation tag - tandem repeat oligopeptide encoding DNA - RBS sequence - self-circularized sequence 2.
[0013] Preferably, the sequence of the self-circularized sequence 1 is shown in SEQ ID No. 1, and the sequence of the self-circularized sequence 2 is shown in SEQ ID No. 2.
[0014] Preferably, the oligopeptide refers to a small molecule peptide of 2-50 amino acids.
[0015] Preferably, the oligopeptide is dipeptide-1, dipeptide-2, AP dipeptide, tripeptide-1, tripeptide-5, tripeptide-8, glutathione, tetrapeptide-5, tetrapeptide-7, tetrapeptide-9, tetrapeptide-11, pentapeptide-4, hexapeptide-2, hexapeptide-3, hexapeptide-8, hexapeptide-9, nonapeptide-1, decapeptide-4, blue copper peptide, rhythmic wave peptide, or collagen peptide.
[0016] Preferably, the protease is a protease whose cleavage site is the last amino acid of the oligopeptide, used to cleave the fused oligopeptide into individual oligopeptides.
[0017] Preferably, the protease is chymotrypsin, pepsin, trypsin, serine protease, endopeptidase, collagenase, or thrombin.
[0018] Preferably, the number of tandem repeats of DNA encoded by the oligopeptide is 5-500.
[0019] The present invention also discloses an oligopeptide expression DNA comprising a self-circularized sequence 1, a start codon, a tandemly repeated oligopeptide-encoding DNA, an RBS sequence, and a self-circularized sequence 2.
[0020] Preferably, the expressed DNA comprises a self-circularized sequence 1 - start codon - affinity tag / secretion tag / self-aggregation tag - tandem repeat oligopeptide encoding DNA - RBS sequence - self-circularized sequence 2.
[0021] Preferably, the sequence of the self-circularized sequence 1 is shown in SEQ ID No. 1, and the sequence of the self-circularized sequence 2 is shown in SEQ ID No. 2.
[0022] Preferably, the expressed DNA is a self-circularized sequence 1-ATGCATCATCATCATCATCAT-(oligopeptide encoding DNA)n-GGAGGAGGA-self-circularized sequence 2.
[0023] Preferably, n is a natural number between 5 and 500.
[0024] Preferably, the expressed DNA is a self-circularized sequence 1-ATGCATCATCATCATCATCAT-(GGTCACAAA). n -GGAGGAGGA- Self-circularized sequence 2.
[0025] Preferably, the expressed DNA is a self-circularized sequence 1-ATGCATCATCATCATCATCAT-(CACTTCCGT). n -GGAGGAGGA- Self-circularized sequence 2.
[0026] Preferably, the expressed DNA is a self-circularized sequence 1-ATGCATCATCATCATCATCAT-(GGCCAGCCGCGT). n -GGAGGAGGA- Self-circularized sequence 2.
[0027] The present invention also discloses an expression vector for oligopeptides, which is constructed by inserting the expression DNA of the above-mentioned oligopeptides into the expression vector.
[0028] Preferably, the expression vector is pET28a.
[0029] The present invention also discloses an expression host for oligopeptides, comprising an expression vector containing the aforementioned oligopeptides.
[0030] Preferably, the host is Escherichia coli, Bacillus subtilis, Glucosamine oxidase, yeast, plant protoplasts, or animal cells.
[0031] The principle of this invention is to tandemly repeat oligopeptides, resulting in an ORF (Organizational Frame of Reference) that does not contain a stop codon. When the mRNA is circularized with a self-circularized sequence, the circularized ORF lacks a stop codon, allowing for continuous rolling circle translation, ultimately producing a fusion protein containing numerous tandemly repeated sequences. After protein purification, the repeated oligopeptides are cleaved into individual oligopeptides using a protease, and the target oligopeptide fragment is purified using conventional methods such as HPLC. This method allows for the rapid and low-cost synthesis of oligopeptides in large quantities, yielding high-purity products. Attached Figure Description
[0032] Figure 1 A schematic diagram of the process of this invention. Detailed Implementation
[0033] The present invention will be further described below with reference to the embodiments, but the description of the embodiments does not limit the scope of protection of the present invention in any way.
[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of this invention is for the purpose of describing particular embodiments only and is not intended to limit the invention.
[0035] Unless otherwise specified, all substances or instruments used in the following examples can be obtained from conventional commercial sources.
[0036] Example 1: Introduction to the principle of the RNA cyclization technique for preparing oligopeptides.
[0037] See the principle Figure 1 We tandemly repeated the DNA encoding the oligopeptide multiple times to form an open reading frame (ORF) for expressing the oligopeptide fusion protein. In the last tandem repeat, we modified the codons to be biased towards the RBS sequence of the expression host. This ensures that the circular RNA can be recognized by ribosomes and translated into the protein encoded by the ORF. Downstream of the oligopeptide tandem ORF, there is no stop codon. This ensures that translation can continue indefinitely, performing rolling circle translation on the circular RNA without termination. Upstream of the oligopeptide tandem ORF, we added a start codon (ATG) and an affinity tag (6 histidine H residues) to ensure translation initiation and the expression and purification of the translation product.
[0038] like Figure 1 After RNA is transcribed, two self-circularization sequences circularize the internal RNA, forming circular mRNA. The circular mRNA contains a start codon ATG (methionine M), six histidine tags, a tandem repeat oligopeptide sequence, and the last tandem repeat sequence is optimized into an RBS sequence.
[0039] After the RNA is circularized, the ribosome recognizes the ATG start codon based on the RBS sequence, translating methionine to initiate translation. Subsequently, six histidine tags are translated, and the ribosome enters the oligopeptide repeat tandem, beginning the translation of the oligopeptide multimer. As the ribosome completes one revolution around the circular RNA, a large protein repeat unit is produced. Since there is no stop codon, the ribosome continues translation around the circular RNA for the next round. Ultimately, round after round of translation produces the large protein with the repeating structural unit.
[0040] After separating and purifying the large protein using protein purification technology, the purified protein is cleaved using a specific protease to release oligopeptide monomers. The released oligopeptide monomers are then separated and purified by HPLC to obtain the oligopeptide product.
[0041] Example 2: Preparation of Tripeptide-1 Copper using RNA Cyclation Technique
[0042] In this embodiment, we disclose the process for preparing tripeptide-1 copper using RNA cyclization technology:
[0043] Expression vector design: We first optimized the codons of tripeptide-1 (GHK) to GGTCACAAA. We performed tandem repeats of the codon 1, 10, 50, and 100 times, adding a start codon and a 6-histidine codon tag (MHHHHHH) before each repeat, followed by ATGCATCATCATCATCATCAT (SEQ ID No. 3). Finally, we added the codon AGGAGGAAAAAA to represent RBS. The final cDNA sequence is ATGCATCATCATCATCATCAT(GGTCACAAA). n The translated amino acid sequence of GGAGGAGGA is MHHHHHH (GHK). n GGG,n represents the number of tandem repeats. This amino acid sequence is the polypeptide sequence resulting from one revolution of the ribosome around the circular RNA. After m revolutions of translation around the circular RNA, the translated protein product is (MHHHHHH(GHK)). n GGG) mThe protein product contains m×n repeat copies of tripeptide-1 (GHK). We added self-circularization sequences SEQ ID NO: 1 and SEQ ID NO: 2 to both ends of the cDNA to form a self-circular mRNA. The final sequence was synthesized at Aiji Biotechnology, and the oligopeptide expression DNA was constructed downstream of the T7 promoter of the pET28a vector. The T7 promoter was used to initiate gene expression, and the RNA was transcribed into a segment of RNA by bacterial RNA polymerase. The T7 promoter transcribes a specific sequence into RNA. This transcribed RNA contains specific sequences at both ends, enabling RNA circularization. Circular RNA is more stable, and because no stop codon is added, the ribosomes bind to the RNA, initiating translation and producing a circularized product.
[0044] Obtaining the expression strain. The constructed expression vectors with different GHK repeats were transformed into Rossetta(DE3) competent cells from TransGold Biotechnology. The cells were incubated on ice for 30 min, heat-shocked at 42°C for 60 s, and then on ice for 5 min. The resulting plates were then plated onto solid LB agar plates containing 50 mg / L kanamycin and incubated statically at 37°C overnight. Single-clone clusters were picked and cultured in liquid LB agar plates containing 50 mg / L kanamycin at 200 rpm with shaking at 37°C until the OD600 value reached 0.6-0.8. The accuracy of the strain was verified by first-generation sequencing.
[0045] Fusion protein preparation. Incubate 1000 ml of the bacterial strain until the OD600 value reaches 0.6-0.8. Add 1 mM IPTG to a final concentration of 4 mM, and incubate overnight at 37°C and 200 rpm. Centrifuge at 10000 rpm and 4°C for 20 min, and collect the bacterial cells. Resuspend the bacterial cells in lysis buffer (20 mM Tris, 500 mM NaCl, 3 M guanidine hydrochloride, pH 8.0) and lyse the cells using pressure or sonication until the solution is clear. Centrifuge at 12000 rpm and 4°C for 20 min, and collect the supernatant. Equilibrate the Ni-NTA affinity chromatography column with 10 volumes of lysis buffer, add filtered bacterial lysis buffer, and wash thoroughly with lysis buffer containing 20 mM imidazole at a flow rate of 0.5 ml / min. Finally, recover the protein using 200 mM imidazole lysis buffer. The protein was placed in a 10 kDa ultrafiltration tube and concentrated by ultrafiltration at 4°C and 8000 rpm for 20 min. Then, 10 ml of 20 mM Tris (pH 8.0) was added, and the mixture was concentrated by ultrafiltration at 4°C and 8000 rpm for 20 min. This process was repeated three times. The protein was then quantified using a BCA quantitative assay kit.
[0046] Protease digestion and HPLC purification: 100 mg of purified total protein was added to 50 μg of trypsin and 0.05 MCuCl2 solution, and incubated overnight at room temperature. Using Taichuang Bio's tripeptide-1 copper as a standard, the elution time of tripeptide-1 copper was determined by HPLC. Tripeptide-1 copper was collected using a preparative HPLC system based on the elution time. The collected tripeptide-1 copper was freeze-dried to prepare the final product. The yield and purity of the final product are shown in Table 1.
[0047] Table 1. Yield and purity of tripeptide-1 copper
[0048] Tripeptide-1 Copper Yield (mg / L) purity(%) 1 duplicate 1.46 62.7 10 repetitions 43.4 89.1 50 repetitions 151.3 98.3 100 repetitions 192.4 99 .
[0049] Example 3: Preparation of tripeptide-8 using RNA cyclization technique
[0050] In this embodiment, we disclose the process for preparing tripeptide-8 using RNA cyclization technology:
[0051] (1) Expression vector design: We first optimized the codons of tripeptide-8 (HFR), resulting in CACTTCCGT. We performed tandem repeats of the codon 1, 10, 50, and 100 times, adding a start codon and a 6-histidine codon tag (MHHHHHH) and ATGCATCATCATCATCATCAT before each repeat. Finally, we added the codon AGGAGGAAAAAA to represent RBS. The final cDNA sequence is ATGCATCATCATCATCATCAT(CACTTCCGT). n GGAGGAGGA, translated into the amino acid sequence MHHHHHH (HFR). n GGG,n represents the number of tandem repeats. This amino acid sequence is the polypeptide sequence resulting from one revolution of the ribosome around the circular RNA. After m revolutions of translation around the circular RNA, the translated protein product is (MHHHHHH(HFR)). n GGG) m The protein product contains m×n repeat copies of tripeptide-8 (HFR). We added self-circularization sequences SEQ ID NO: 1 and SEQ ID NO: 2 to both ends of the cDNA to form a self-circularizable mRNA. The final sequence was synthesized at Aigi Biotechnology and constructed into the pET28a vector, where gene expression was initiated using the T7 promoter.
[0052] (2) Obtaining the expression strain. The constructed expression vectors with different GHK repeats were transformed into Rossetta(DE3) competent cells from AllGold Biotechnology. The cells were incubated on ice for 30 min, heat-shocked at 42℃ for 60 s, and then incubated on ice for 5 min. The cells were then plated onto solid LB agar plates containing 50 mg / L kanamycin and incubated statically at 37℃ overnight. Single-clone clusters were picked and cultured in liquid LB agar containing 50 mg / L kanamycin at 200 rpm with shaking at 37℃ until the OD600 value reached 0.6-0.8. The accuracy of the strain was verified by first-generation sequencing.
[0053] (3) Preparation of fusion protein. When the OD600 value of 1000 ml of the strain reaches 0.6-0.8, add 1 mM IPTG to a final concentration of 4 mM, and continue culturing overnight at 37°C and 200 rpm. Centrifuge at 10000 rpm and 4°C for 20 min, and collect the bacterial cells. Resuspend the bacterial cells in lysis buffer (20 mM Tris, 500 mM NaCl, 3 M guanidine hydrochloride, pH 8.0), and lyse the cells using pressure or sonication until the solution is clear. Centrifuge at 12000 rpm and 4°C for 20 min, and collect the supernatant. After equilibrating the Ni-NTA affinity chromatography column with 10 times its volume of lysis buffer, add the filtered bacterial lysis buffer at a flow rate of 0.5 ml / min, and then wash thoroughly with lysis buffer containing 20 mM imidazole. Finally, recover the protein using 200 mM imidazole lysis buffer. The protein was placed in a 10 kDa ultrafiltration tube and concentrated by ultrafiltration at 4°C and 8000 rpm for 20 min. Then, 10 ml of 20 mM Tris (pH 8.0) was added, and the mixture was concentrated by ultrafiltration at 4°C and 8000 rpm for 20 min. This process was repeated three times. The protein was then quantified using a BCA quantitative assay kit.
[0054] (4) Protease digestion and HPLC purification: 100 mg of purified total protein was mixed with 50 μg of trypsin and incubated overnight at room temperature. Using Taichuang Bio's tripeptide-8 as a standard, the elution time of tripeptide-8 was determined by HPLC. Tripeptide-8 was collected using a preparative HPLC system based on the elution time. The collected tripeptide-8 was freeze-dried to prepare the final product. The yield and purity of the final product are shown in Table 2.
[0055] Table 2. Yield and purity of the tripeptide-8 product
[0056] Tripeptide-8 Yield (mg / L) purity(%) 1 duplicate 1.13 54.8 10 repetitions 15.9 83.3 50 repetitions 89.1 96.2 100 repetitions 128.3 98.5 .
[0057] Example 4: Preparation of tetrapeptide-7 using RNA cyclization technique
[0058] In this embodiment, we disclose the process for preparing tetrapeptide-7 using RNA cyclization technology:
[0059] (1) Expression vector design: We first optimized the tetrapeptide-7 (GQPR) codons, resulting in the sequence GGCCAGCCGCGT. We performed tandem repeats of the codons 1, 10, 50, and 100 times, adding a start codon and a 6-histidine codon tag (MHHHHHH) before each repeat, followed by ATGCATCATCATCATCATCAT. Finally, we added the codon ATGAGGAAAAAA to represent RBS. The final cDNA sequence was ATGCATCATCATCATCATCAT(GGCCAGCCGCGT). n GGAGGAGGA, translated into the amino acid sequence MHHHHHH(GQPR). n GGG,n represents the number of tandem repeats. This amino acid sequence is the polypeptide sequence resulting from one revolution of the ribosome around the circular RNA. After m revolutions of translation around the circular RNA, the translated protein product is (MHHHHHH(GQPR)). n GGG) m The protein product contains m×n copy numbers of the tetrapeptide-7 (GQPR) repeat. We added self-circularization sequences SEQ ID NO: 1 and SEQ ID NO: 2 to both ends of the cDNA to form a self-circularizable mRNA. The final sequence was synthesized at Aigi Biotechnology and constructed into the pET28a vector, where gene expression was initiated using the T7 promoter.
[0060] (2) Obtaining the expression strain. The constructed expression vectors with different GHK repeats were transformed into Rossetta(DE3) competent cells from AllGold Biotechnology. The cells were incubated on ice for 30 min, heat-shocked at 42℃ for 60 s, and then incubated on ice for 5 min. The cells were then plated onto solid LB agar plates containing 50 mg / L kanamycin and incubated statically at 37℃ overnight. Single-clone clusters were picked and cultured in liquid LB agar containing 50 mg / L kanamycin at 200 rpm with shaking at 37℃ until the OD600 value reached 0.6-0.8. The accuracy of the strain was verified by first-generation sequencing.
[0061] (3) Preparation of fusion protein. When the OD600 value of 1000 ml of the strain reaches 0.6-0.8, add 1 mM IPTG to a final concentration of 4 mM, and continue culturing overnight at 37°C and 200 rpm. Centrifuge at 10000 rpm and 4°C for 20 min, and collect the bacterial cells. Resuspend the bacterial cells in lysis buffer (20 mM Tris, 500 mM NaCl, 3 M guanidine hydrochloride, pH 8.0), and lyse the cells using pressure or sonication until the solution is clear. Centrifuge at 12000 rpm and 4°C for 20 min, and collect the supernatant. After equilibrating the Ni-NTA affinity chromatography column with 10 times its volume of lysis buffer, add the filtered bacterial lysis buffer at a flow rate of 0.5 ml / min, and then wash thoroughly with lysis buffer containing 20 mM imidazole. Finally, recover the protein using 200 mM imidazole lysis buffer. The protein was placed in a 10 kDa ultrafiltration tube and concentrated by ultrafiltration at 4°C and 8000 rpm for 20 min. Then, 10 ml of 20 mM Tris (pH 8.0) was added, and the mixture was concentrated by ultrafiltration at 4°C and 8000 rpm for 20 min. This process was repeated three times. The protein was then quantified using a BCA quantitative assay kit.
[0062] (4) Protease digestion and HPLC purification: 100 mg of purified total protein was mixed with 50 μg of trypsin and incubated overnight at room temperature. Using Taichuang Bio's tetrapeptide-7 as a standard, the elution time of tripeptide-8 was determined by HPLC. Tetrapeptide-7 was collected using a preparative HPLC system based on the elution time. The collected tetrapeptide-7 was freeze-dried to prepare the finished tetrapeptide-7 product. The yield and purity of the finished product are shown in Table 3.
[0063] Table 3. Yield and purity of the finished tripeptide-8 product
[0064] Tetrapeptide-7 Yield (mg / L) purity(%) 1 duplicate 0.95 45.3 10 repetitions 18.3 84.6 50 repetitions 54.2 97.2 100 repetitions 88.5 98.8 .
[0065] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. A method for preparing oligopeptides using RNA cyclization technology, characterized in that... The steps include: (1) Construct an expression DNA of oligopeptides, which includes a self-circularized sequence 1-start codon-tandem repeat oligopeptide encoding DNA-RBS sequence-self-circularized sequence 2; (2) The expression DNA of the oligopeptide constructed above is constructed into an expression vector, and then transformed into a host cell for expression to obtain the fusion oligopeptide; (3) The expressed fusion oligopeptide was purified; (4) The purified fusion oligopeptides were separated by protease cleavage; (5) Purification and separation of oligopeptides; In the DNA encoded by tandemly repeated oligopeptides, the number of tandem repeats is 50-100. The sequence of the self-circularized sequence 1 is shown in SEQ ID No. 1, and the sequence of the self-circularized sequence 2 is shown in SEQ ID No.
2.
2. The method for preparing oligopeptides using RNA cyclization technology according to claim 1, characterized in that: The expressed DNA includes a self-circularized sequence 1, a start codon, an affinity tag / secretion tag / self-aggregation tag, a tandem repeat oligopeptide encoding DNA, an RBS sequence, and a self-circularized sequence 2.
3. The method for preparing oligopeptides using RNA cyclization technology according to claim 1 or 2, characterized in that... The oligopeptide refers to a small molecule peptide consisting of 2-50 amino acids.
4. The method for preparing oligopeptides using RNA cyclization technology according to claim 1 or 2, characterized in that... The oligopeptides are dipeptide-1, dipeptide-2, AP dipeptide, tripeptide-1, tripeptide-5, tripeptide-8, glutathione, tetrapeptide-5, tetrapeptide-7, tetrapeptide-9, tetrapeptide-11, pentapeptide-4, hexapeptide-2, hexapeptide-3, hexapeptide-8, hexapeptide-9, nonapeptide-1, decapeptide-4, blue copper peptide, rhythmic wave peptide, or collagen peptide.
5. The method for preparing oligopeptides using RNA cyclization technology according to claim 1 or 2, characterized in that... The protease is selected to cleave the oligopeptide at the last amino acid at its terminal site, and is used to cleave the fused oligopeptide into individual oligopeptides.
6. The method for preparing oligopeptides using RNA cyclization technology according to claim 1 or 2, characterized in that... The proteases are chymotrypsin, pepsin, trypsin, serine proteases, endopeptidase, collagenase, and thrombin.
7. An oligopeptide expression DNA, characterized in that... The expressed DNA comprises a self-circularized sequence 1 - a start codon - a tandemly repeated oligopeptide-encoding DNA - an RBS sequence - a self-circularized sequence 2, wherein the tandemly repeated oligopeptide-encoding DNA is repeated 50-100 times. The sequence of the self-circularized sequence 1 is shown in SEQ ID No. 1, and the sequence of the self-circularized sequence 2 is shown in SEQ ID No.
2.
8. The expression DNA of the oligopeptide according to claim 7, characterized in that... The expressed DNA includes a self-circularized sequence 1, a start codon, an affinity tag / secretion tag / self-aggregation tag, a tandem repeat oligopeptide encoding DNA, an RBS sequence, and a self-circularized sequence 2.
9. The expression DNA of the oligopeptide according to claim 8, characterized in that... The expressed DNA is a self-circularized sequence 1-ATGCATCATCATCATCATCAT-(oligopeptide encoding DNA)n-GGAGGAGGA-self-circularized sequence 2.
10. The DNA expressing the oligopeptide according to claim 8, characterized in that... The expressed DNA is a self-circularized sequence 1-ATGCATCATCATCATCATCAT-(GGTCACAAA)n-GGAGGAGGA-self-circularized sequence 2.
11. The expression DNA of the oligopeptide according to claim 8, characterized in that... The expressed DNA is a self-circularized sequence 1-ATGCATCATCATCATCATCAT-(CACTTCCGT)n-GGAGGAGGA-self-circularized sequence 2.
12. The DNA expressing the oligopeptide according to claim 8, characterized in that... The expressed DNA is a self-circularized sequence 1-ATGCATCATCATCATCATCAT-(GGCCAGCCGCGT)n-GGAGGAGGA-self-circularized sequence 2.
13. An expression vector for oligopeptides, characterized in that... The oligopeptide expressed by any one of claims 7-12 is constructed into an expression vector.
14. The expression vector for the oligopeptide according to claim 13, characterized in that... The expression vector is pET28a.
15. An expression host for an oligopeptide, characterized in that... An expression vector containing the oligopeptide of claim 13 or 14.
16. The expression host of the oligopeptide according to claim 15, characterized in that... The host can be Escherichia coli, Bacillus subtilis, Glucosamine oxidase, yeast, plant protoplasts, or animal cells.