Kit for detecting micro rnas associated with methamphetamine addiction and use thereof

Abstract

The present application relates to a kind of kit for detecting micro RNA associated with methamphetamine addiction and its application, it is characterized in that: including for detecting hsa-miR-320a-3p, hsa-miR-320b and hsa-miR-320c of hsa-miR-320 in plasma and its exosome;Compared with prior art, the advantages of the present application are: the kit of the present application uses hsa-miR-320a-3p, hsa-miR-320b and hsa-miR-320c of hsa-miR-320 jointly as the marker for methamphetamine addiction auxiliary diagnosis, hsa-miR-320 can be expressed in plasma and exosome, only a small amount of sample is needed to quickly and accurately complete the detection of methamphetamine addiction, high sensitivity, high accuracy, detection is fast.

Description

Technical Field

[0001] This invention relates to a method for detecting hsa-miR-320 in plasma and its exosomes, and more particularly to a kit for detecting microRNA levels associated with methamphetamine addiction and its application. Background Technology

[0002] Methamphetamine, a type of amphetamine stimulant, is characterized by its rapid onset, long duration of action, ease of synthesis, and simple consumption. Compared to traditional drugs like heroin, methamphetamine abuse is more severe and harmful, making it the most prevalent drug of abuse in my country. Currently, the biological mechanisms of methamphetamine addiction are not fully understood, and clinical diagnosis relies primarily on subjective reports from the DSM-V questionnaire, lacking objective diagnostic indicators and effective treatments. This presents challenges for national drug control efforts and the diagnosis and treatment of methamphetamine addicts. Therefore, developing non-invasive, objective, sensitive, and specific biomarkers has significant scientific and clinical value.

[0003] Exosomes are an important component of extracellular vesicles (EVs). They are lipid bilayer vesicles secreted by cells, with a diameter of approximately 50–150 nm. They encapsulate nucleic acids, proteins, and lipids from the host cell and act as messengers, shuttling between cells and tissues to facilitate communication and interaction between them.

[0004] Exosomes (tiny membrane vesicles secreted by most cells) contain microRNAs (miRNAs). miRNAs are non-coding single-stranded small RNA molecules, approximately 22 nucleotides long, widely distributed in organisms and present in almost all eukaryotic cells. They primarily work by pairing complementary with the 3'UTR of target gene mRNAs, causing mRNA degradation or inhibiting their translation. Studies have confirmed the regulatory effects of miRNAs on the development, proliferation, differentiation, apoptosis, and synaptic plasticity of the central nervous system, suggesting they may play an important role in neuropsychiatric disorders, including methamphetamine addiction. The stable presence of exosomes and miRNAs in peripheral circulating fluids (plasma, saliva, cerebrospinal fluid, etc.) can objectively and specifically reflect biological processes and disease states, providing timely warnings of organismal damage and possessing significant clinical application value. Summary of the Invention

[0005] The first technical problem to be solved by the present invention is to provide a detection kit for the auxiliary diagnosis of methamphetamine, in view of the above-mentioned existing technology.

[0006] The second technical problem to be solved by the present invention is to provide a method for detecting the hsa-miR-320 molecular marker in plasma exosomes using the above-mentioned methamphetamine-assisted diagnostic test kit, in view of the current state of the prior art.

[0007] The third technical problem to be solved by the present invention is to provide a method for detecting the hsa-miR-320 molecular marker in plasma using the above-mentioned methamphetamine-assisted diagnostic test kit, in view of the current state of the prior art.

[0008] The technical solution adopted by the present invention to solve the first technical problem mentioned above is: the detection kit for auxiliary diagnosis of methamphetamine includes a combined reagent for detecting hsa-miR-320a-3p, hsa-miR-320b and hsa-miR-320c of hsa-miR-320 in plasma and its exosomes; The genomic location of hsa-miR-320a-3p is: chr8:22244966-22245037; The genomic location of hsa-miR-320b is as follows: chr1:224257040-224257110 / chr1:116671746-116671817; The genomic location of hsa-miR-320c is: chr18:21683518-21683589 / chr18:24321675-24321746; and, The nucleotide sequence of hsa-miR-320a-3p is shown in SEQ ID NO: 1: AAAAGCUGGGUUGAGAGGGCGA; hsa-miR-320a-3p is significantly upregulated in the plasma and exosomes of methamphetamine patients. The nucleotide sequence of hsa-miR-320b is shown in SEQ ID NO: 2: AAAAGCUGGGUUGAGAGGGCAA; hsa-miR-320b is significantly upregulated in the plasma and exosomes of methamphetamine patients; The nucleotide sequence of hsa-miR-320c is shown in SEQ ID NO: 3: AAAAGCUGGGUUGAGAGGGU; The hsa-miR-320c was significantly upregulated in the plasma and exosomes of methamphetamine patients; The primers used for the combined detection of hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c are: P1: 5'-GGGGGAAAGCTGGGTTG-3'; P2: 5'-GTGCGTGTCGTGGAGTCG-3'.

[0009] The reason why this primer can detect hsa-miR-320a-3p, hsa-miR-320b and hsa-miR-320c in combination is that the expression levels of hsa-miR-320a-3p, hsa-miR-320b and hsa-miR-320c are low in exosomes, and they are not easy to detect if detected individually.

[0010] Furthermore, the kit also includes reverse transcription primer sequences for hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c, wherein, The hsa-miR-320a-3p-specific reverse transcription primer is shown in SEQ ID NO: 4: 5'GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTCGCCCT3'; The hsa-miR-320b-specific reverse transcription primer is shown in SEQ ID NO: 5: 5'GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTTGCCC3'; The hsa-miR-320c-specific reverse transcription primer is shown in SEQ ID NO: 6: 5'GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACACCCTC3'.

[0011] Furthermore, it also includes specific primers for the internal reference gene hsa-miR-423-5p required for the detection of hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c of exosomes in plasma: P3: 5'-TGAGGGGCAGAGAGCGA-3'; P4: 5'-GTGCGTGTCGTGGAGTCG-3'.

[0012] Furthermore, it also includes specific primers for the housekeeping gene Cel-miR-39-3p required for detecting hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c in plasma, which are: 5'-UCACCGGGUGUAAAUCAGCUUG-3'.

[0013] To address the second technical problem, this invention provides a method for detecting hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c molecular markers of hsa-miR-320 in plasma exosomes using the aforementioned kit, characterized in that the method comprises the following steps: (1) Collect peripheral blood and extract plasma exosomes; (2) Extract total RNA from exosomes; (3) Reverse transcribe total RNA into cDNA; (4) Quantitative PCR was performed on the cDNA solution from step (2) using the combined amplification primers of hsa-miR-320a-3p, hsa-miR-320b and hsa-miR-320c and the upstream and downstream primers for the amplification of the internal reference gene hsa-miR-423-5p.

[0014] To address the third technical problem, this invention provides a method for detecting hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c molecular markers of hsa-miR-320 in plasma using the aforementioned kit, characterized in that the method comprises the following steps: (1) Collect peripheral blood and extract total RNA from plasma; (2) Reverse transcribe total RNA into cDNA; (3) Quantitative PCR was performed on the cDNA solution from step (2) using the combined amplification primers of hsa-miR-320a-3p, hsa-miR-320b and hsa-miR-320c and the upstream and downstream primers for amplifying the housekeeping gene Cel-miR-39-3p.

[0015] Compared with the prior art, the advantages of the present invention are as follows: The kit of the present invention uses hsa-miR-320a-3p, hsa-miR-320b and hsa-miR-320c in combination as biomarkers for the auxiliary diagnosis of methamphetamine addiction. hsa-miR-320 can be expressed in both plasma and exosomes. Only a small amount of sample is needed to quickly and accurately complete the detection of methamphetamine addiction. It has high sensitivity, high accuracy and rapid detection. Attached Figure Description

[0016] Figure 1 This is a graph showing the differential sequencing results of plasma exosomal miRNAs in this invention (the names of the abnormally expressed and significantly differentially expressed miRNAs are on the right; the arrows indicate hsa-miR-320a-3p, hsa-miR-320b-1, hsa-miR-320b-2, hsa-miR-320c-1, and hsa-miR-320c-2). Figure 2 This is a differential expression diagram of hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c in plasma exosomes of healthy controls and methamphetamine addicts in this invention. Figure 3 The ROC curve was used to evaluate the ability of plasma exosomes hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c to jointly diagnose methamphetamine addiction in this invention. Figure 4 This is a differential expression diagram of hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c in the plasma of healthy controls and methamphetamine addicts in this invention. Figure 5 The ROC curve was used to evaluate the ability of plasma hsa-miR-320 a-3p, hsa-miR-320b, and hsa-miR-320c to jointly diagnose methamphetamine addiction. Detailed Implementation

[0017] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Example 1

[0018] The expression of plasma exosomal hsa-miR-320 in methamphetamine-addicted patients and healthy controls was detected by sequencing. Plasma exosome extraction: This invention uses differential ultracentrifugation to separate plasma exosomes. The main steps are as follows: a. Collect 500g of peripheral blood from the researcher and centrifuge for 5 minutes to remove cells from the sample. This step must be completed within 2 hours (4°C) of blood collection. b. Transfer the supernatant to a new centrifuge tube, centrifuge at 2000g for 10 minutes, and then transfer the supernatant to a new centrifuge tube. c. Centrifuge at 10000g (i.e. 11700rpm) for 30min to remove any detached microbubbles; d. Filter the supernatant using a 0.22µm filter membrane; e. Centrifuge at 100,000g (i.e., 36,800 rpm) for 2 hours; f. Add 1×PBS and mix well by pipetting. Repeat step e once. g. Reconstitute exosomes with 50-100 μL of 1×PBS and store at -80°C; h. Observe the morphology of exosomes using cryo-transmission electron microscopy; Exosomal miRNA sequencing analysis: Total RNA was extracted from exosomals, and after quality control and quantification using agarose and Nanodrop, a library was constructed. Library quality was determined using an Agilent 2100 Bioanalyzer. The sequencing library was mixed and denatured to generate single-stranded DNA, which was then sequenced on an Illumina NextSeq 500 sequencer. After quality control, the sequencing data were further analyzed to detect the levels of miRNAs in the exosomals of methamphetamine addicts and healthy controls.

[0019] Results of exosomal miRNA sequencing analysis: The results are as follows Figure 1 And as shown in Table 1; Table 1. Changes in miRNA expression in exosomes of methamphetamine addicts and healthy controls ( P <0.05)

[0020]

[0021]

[0022]

[0023] Results analysis: hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c were upregulated by an average of 9.17-fold in plasma exosomes of methamphetamine addicts and healthy controls, suggesting that the combined effects of hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c may have important value in the diagnosis of methamphetamine addiction.

[0024] The applicant should note: Figure 1 The reason why sa-miR-320b-1, hsa-miR-320b-2, hsa-miR-320c-1, and hsa-miR-320c-2 appear in the graph is that the final mature forms of hsa-miR-320b-1, hsa-miR-320b-2, hsa-miR-320c-1, and hsa-miR-320c-2 are all hsa-miR-320b and hsa-miR-320c. If the mature forms are used directly for mapping, there will be two identical hsa-miR-320b or hsa-miR-320c with different expression levels. Therefore, they are distinguished here.

[0025] Example 2 This diagnostic kit for methamphetamine includes a combination reagent for detecting hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c in plasma and its exosomes. The genomic location of hsa-miR-320a-3p is: chr8:22244966-22245037; The genomic location of hsa-miR-320b is as follows: chr1:224257040-224257110 / chr1:116671746-116671817; The genomic location of hsa-miR-320c is: chr18:21683518-21683589 / chr18:24321675-24321746; and, The nucleotide sequence of hsa-miR-320a-3p is shown in SEQ ID NO: 1: AAAAGCUGGGUUGAGAGGGCGA; hsa-miR-320a-3p is significantly upregulated in the plasma and exosomes of methamphetamine patients. The nucleotide sequence of hsa-miR-320b is shown in SEQ ID NO: 2: AAAAGCUGGGUUGAGAGGGCAA; hsa-miR-320b is significantly upregulated in the plasma and exosomes of methamphetamine patients; The nucleotide sequence of hsa-miR-320c is shown in SEQ ID NO: 3: AAAAGCUGGGUUGAGAGGGU; The hsa-miR-320c was significantly upregulated in the plasma and exosomes of methamphetamine patients; The primers used for the combined detection of hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c are: P1: 5'-GGGGGAAAGCTGGGTTG-3'; P2: 5'-GTGCGTGTCGTGGAGTCG-3'.

[0026] For details, please refer to the combined primer sequences designed for hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c in Table 2 below; Table 2 Designed tRF primer sequences

[0027] Example 3: Blood was collected from methamphetamine addicts and healthy controls, and plasma was separated. Plasma exosomes were isolated and RNA was extracted. Quantitative PCR was performed to detect the expression of hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c of hsa-miR-320. The steps include the following: a. The researcher's plasma collection and exosome isolation were the same as in Experiment 1; b. Homogenization: Add 750 μl of TRIzol LS Reagent to the isolated exosomes and manually shake the tube vigorously until well mixed; c. Phase Separation: After homogenization, incubate the sample at 15-30°C for 5 minutes to allow complete dissociation of the nucleic acid-protein complex. Add 0.2 ml of chloroform to each 750 μl of TRIzol LS Reagent reagent homogenized sample and tighten the cap. Vigorously shake the tube manually for 15 seconds, then incubate at 15-30°C for 2-3 minutes. Centrifuge at 12000g for 15 minutes at 4°C. After centrifugation, the mixture will separate into a lower red phenol-chloroform phase, an intermediate layer, and a colorless aqueous phase on top. All RNA will be partitioned into the aqueous phase. d. RNA precipitation: Transfer the aqueous phase to a new centrifuge tube (be careful not to aspirate the lower layer), and add 500 μl of isopropanol. Mix well to precipitate the RNA. After mixing, incubate at 15 to 30°C for 10 minutes, then centrifuge at 12000g for 10 minutes at 4°C. At this point, the RNA precipitate, which was not visible before centrifugation, will form a gel-like precipitate on the bottom and side walls of the tube. e. RNA washing: Remove the supernatant, add 1 ml of 75% ethanol to wash the RNA precipitate, vortex, and centrifuge at 7500g for 5 minutes at 4℃. f. Redissolve the RNA precipitate: Remove the ethanol solution and air-dry the RNA precipitate for 5-10 minutes. Do not vacuum centrifuge. Note that the RNA precipitate should not be completely dried, otherwise the solubility of the RNA will be greatly reduced. To dissolve the RNA, first add RNase-free water and repeatedly pipette the solution, then incubate at 55-60°C for 10 minutes. Store the obtained RNA solution at -80°C. g. RNA quality testing: NanoDrop-2000 was used to determine RNA concentration and purity; h. RNA reverse transcription: The RNA extracted in step g above was reverse transcribed using a reverse transcription kit. The reverse transcription procedure is shown in Table 5 according to the reverse transcription reaction system (Table 3) and specific primers (Table 4). cDNA was obtained and stored at -20℃ for later use. i. Real-time quantitative PCR: Add the cDNA obtained in step h above to the reaction system according to the ratio in Table 6, and set the PCR parameters according to the program in Table 7.

[0028] Table 3 RT reaction system

[0029] Table 4 Specific RT primers

[0030] Table 5 Reverse Transcription Procedure

[0031] Table 6 Real-time PCR reaction system

[0032] Table 7 PCR parameters

[0033] The reason for adding specific primers (hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c) for amplification of RNA extracted from exosomes and reverse transcribed into cDNA is as follows: Because the content of miRNA in exosomes is low, the content of hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c is relatively low when reverse transcribing cDNA from whole-genome RNA. They may not be detectable in the later RT-PCR. Therefore, hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c are added during reverse transcription to ensure that they can be detected by subsequent RT-PCR.

[0034] The expression levels of hsa-miR-320 (hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c) in plasma exosomes from 39 methamphetamine patients and 21 healthy controls were detected using quantitative PCR. A list of primers for hsa-miR-320 and the internal reference gene (hsa-miR-423-5p) is shown in Table 8. Compared with healthy controls, the expression level of hsa-miR-320 was significantly increased in methamphetamine patients. t =-6.350, P <0.001. For example... Figure 2 The results of quantitative PCR detection of hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c were basically consistent with those of the microarray (e.g., Figure 1 We further evaluated the ability of hsa-miR-320 to induce methamphetamine addiction using ROC curves, finding an area under the ROC curve of 0.962, with sensitivity and specificity of 0.846 and 0.952, respectively. Figure 3 In this invention, the combination of hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c of hsa-miR-320 can effectively distinguish between methylaniline addicts and healthy controls.

[0035] Table 8 Primer List

[0036] Note: GSP is the specific primer for the corresponding miRNA, and R is the primer that matches the RT primer.

[0037] Example 4 Based on the discovery of hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c in exosomes from the plasma of methamphetamine addicts and healthy controls, we further collected plasma from 82 methamphetamine addicts and 50 healthy controls for combined detection of hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c. The plasma RNA extraction and real-time quantitative PCR methods were basically the same as those in Example 2.

[0038] Plasma RNA extraction was performed using the miRNeasy Serum / Plasma Kit from Qiagen (Germany). The main steps are as follows: a. Take the sample and thaw it on ice. Add Trizol, shake well, and then lyse it fully at room temperature for 5 minutes. Add chloroform equal to the amount of the sample in miRNeasySerum / Plasma Spike-in Control and let it stand at room temperature for 2-3 minutes. b. Centrifuge the sample at 12000g for 15 min at 4℃, transfer the supernatant to a new EP tube, add 1.5 times the volume of anhydrous ethanol, and mix thoroughly; place the sample in an Rneasy MinElute centrifuge column and centrifuge at ≥ 8000g for 15 s. c. Add Buffer RPE to the RNeasy MinElute centrifuge column, centrifuge at ≥ 8000g for 15s at room temperature, and discard the filtrate; add 80% ethanol to the RNeasy MiniElute centrifuge tube, and centrifuge at ≥ 8000g for 2min. d. Place the RNeasy MinElute centrifuge column into a new 2ml EP tube, open the EP tube cap and centrifuge at maximum speed for 5min; place the RNeasy MinElute centrifuge column into a new EP tube, add RNase-free water to the centrifuge column membrane, and centrifuge at full speed for 1min to collect RNA. e. Use NanoDrop 2000 to measure the concentration and OD value of the collected RNA. An OD value between 1.7 and 1.9 indicates high RNA purity. If the OD value exceeds the above range, the sample may be contaminated and should be discarded. f. RNA reverse transcription to cDNA was performed using the Qiagen miScript® II RT Kit (Germany). The reverse transcription reaction procedure is as follows: Table 9 Reverse Transcription Procedure

[0039] 2. Plasma miRNA detection and analysis were performed using the Qiagen miScript SYBR® Green PCR Kit (Germany). The hsa-miR-320 primers are shown in Table 8. The internal control gene used was Cel-miR-39-3p (5'-UCACCGGGUGUAAAUCAGCUUG-3'), and the reaction system and procedure are as follows: Table 10 RT-PCR reaction system

[0040] The expression changes of hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c in the plasma of methamphetamine addicts and healthy controls were detected using real-time quantitative PCR. Compared with healthy controls, the combined expression levels of hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c in peripheral plasma were significantly increased. t =-3.618, P <0.001. For example... Figure 4 Further analysis using ROC curves to evaluate the diagnostic value of the combined hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c for methamphetamine addiction revealed an area under the ROC curve of 0.751, with a sensitivity of 0.900 and a specificity of 0.463 (e.g., ...). Figure 5 The combined use of hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c of hsa-miR-320 can effectively differentiate between methylaniline addicts and healthy controls.

Claims

1. A detection kit for the auxiliary diagnosis of methamphetamine, characterized in that: This includes combined reagents for detecting hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c in plasma and its exosomes; in The nucleotide sequence of hsa-miR-320a-3p is shown in SEQ ID NO: 1: AAAAGCUGGGUUGAGAGGGCGA; hsa-miR-320a-3p is significantly upregulated in the plasma and exosomes of methamphetamine patients. The nucleotide sequence of hsa-miR-320b is shown in SEQ ID NO: 2: AAAAGCUGGGUUGAGAGGGCAA; hsa-miR-320b is significantly upregulated in the plasma and exosomes of methamphetamine patients; The nucleotide sequence of hsa-miR-320c is shown in SEQ ID NO: 3: AAAAGCUGGGUUGAGAGGGU; hsa-miR-320c was significantly upregulated in the plasma and exosomes of methamphetamine patients; The primers used for the combined detection of hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c are: P1: 5'-GGGGGAAAGCTGGGTTG-3'; P2: 5'-GTGCGTGTCGTGGAGTCG-3'.

2. The detection kit for auxiliary diagnosis of methamphetamine according to claim 1, characterized in that: The kit also includes reverse transcription primer sequences for hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c, wherein... The hsa-miR-320a-3p-specific reverse transcription primer is shown in SEQ ID NO: 4: 5'GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTCGCCCT3'; The hsa-miR-320b-specific reverse transcription primer is shown in SEQ ID NO: 5: 5'GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTTGCCC3'; The hsa-miR-320c-specific reverse transcription primer is shown in SEQ ID NO: 6: 5'GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACACCCTC3'.

3. The detection kit for auxiliary diagnosis of methamphetamine according to claim 1 or 2, characterized in that: It also includes specific primers for the internal reference gene hsa-miR-423-5p required for the detection of hsa-miR-320 in plasma, specifically for hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c. P3: 5'-TGAGGGGCAGAGAGCGA-3'; P4: 5'-GTGCGTGTCGTGGAGTCG-3'.

4. The detection kit for auxiliary diagnosis of methamphetamine according to claim 1 or 2, characterized in that: It also includes specific primers for the housekeeping gene Cel-miR-39-3p required for the detection of hsa-miR-320a-3p, hsa-miR-320b, and hsa-miR-320c in plasma, which are: 5'-UCACCGGGUGUAAAUCAGCUUG-3'.

Images