Str marker site amplification primer set, kit and method for cat parentage identification

Abstract

The application discloses a STR marker site amplification primer group, a kit and a method for cat parentage identification, wherein the STR marker detection method for cat parentage identification comprises the following steps: collecting genetic information; performing PCR amplification on the collected genetic information by using a STR marker site amplification primer group to obtain a PCR product; analyzing the PCR product to obtain a genotyping result; and judging parent-child relationship according to the genotyping result. By the method, breed cat parentage identification is realized by using STR marker sites, and the method has high identification accuracy, high repeatability and short identification time.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a primer set, kit, and method for amplifying STR marker sites for feline paternity testing. Background Technology

[0002] Pedigree information plays a crucial role in the breeding process of purebred cats. Incorrect pedigrees can significantly reduce the accuracy of genetic assessments, affecting the effectiveness of selection and mating, and thus impacting the economic benefits of cat breeding. Driven by economic interests, many purebred cats suffer from pedigree errors during breeding. Furthermore, in large-scale cat breeding farms with extensive, free-range conditions, it is difficult to determine the father or even mother of kittens after birth. Therefore, conducting parentage testing and individual identification in purebred cats is essential. Implementing parentage and individual identification in purebred cats can correct pedigree errors, accelerate the breeding process, and improve economic efficiency.

[0003] Short tandem repeats (STRs) are widely present in biological genomes, and are a class of highly polymorphic genetic marker loci. STRs are characterized by high polymorphism, short amplified fragments, high sensitivity, and fast detection speed. Therefore, STR multiplex amplification technology is well-suited for application in the field of biological paternity testing. Summary of the Invention

[0004] To address the problems existing in the prior art, this invention provides an STR marker primer set, kit, and method for paternity testing of purebred cats.

[0005] According to a first aspect of the present invention, a primer set for STR marker amplification in pedigree cat parentage testing is provided, the primer set comprising at least one primer pair:

[0006] (1) Primer pair 1, used to amplify the FCA123 site, includes:

[0007] Upstream primer 5'-ACTGCGAGAGGACTTTCGAA-3';

[0008] Downstream primer 5'-CTTCTGACAGGCTCCAGGTT-3';

[0009] (2) The second primer pair, used to amplify the FCA132 site, includes:

[0010] Upstream primer 5'-ATCAAGGCCAACTGTCCG-3';

[0011] Downstream primer 5'-GATGCCTCATTAGAAAAATGGC-3';

[0012] (3) The third primer pair, used to amplify the FCA161 site, includes:

[0013] Upstream primer 5'-TTACCGATACACACCTGCCA-3';

[0014] Downstream primer 5'-CACAGACGTGCTCTAGCCAA-3';

[0015] (4) The fourth primer pair, used to amplify the FCA201 site, includes:

[0016] Upstream primer 5'-TCTGCAGGACCAGTCAGATG-3';

[0017] Downstream primer 5'-AGCATACACAAATTGATGCTGG-3';

[0018] (5) The fifth primer pair, used to amplify the FCA224 site, includes:

[0019] Upstream primer 5'-CTGGGTGCTGACAGCATAGA-3';

[0020] Downstream primer 5'-TGCCAGAGTTGTATGAAAGGG-3';

[0021] (6) Primer pair 6, used to amplify the FCA229 site, includes:

[0022] Upstream primer 5'-CAAACTGACAAGCTTAGAGGGC-3';

[0023] Downstream primer 5'-GCAGAAGTCCAATCTCAAAGTC-3';

[0024] (7) Primer pair 7, used to amplify the FCA247 site, includes:

[0025] Upstream primer 5'-GGAAATTAGGAGCTCTGCCA-3';

[0026] Downstream primer 5'-AAGATTTACCCAGTTGCCCC-3';

[0027] (8) The 8th primer pair is used to amplify the FCA290 site, including: upstream primer 5'-GTAAGGTCCCTGCCACACAT-3';

[0028] Downstream primer 5'-GTATCTGCCCATTTGAGAAAGG-3';

[0029] (9) The 9th primer pair is used to amplify the FCA293 site, including: upstream primer 5'-GATGGCCCAAAAGCACAC-3';

[0030] Downstream primer 5'-CCCACATCTTGTCAACAACG-3';

[0031] (10) The 10th primer pair is used to amplify the FCA424 site, including: upstream primer 5'-TGGAAAAATGTGGAATACTGA-3'; downstream primer 5'-CCAATTTGTAGTGACATCCCC-3';

[0032] (11) Primer pair 11, used to amplify FCA441 site, includes: upstream primer 5'-ATCGGTAGGTAGGTAGATATAG-3'; downstream primer 5'-GCTTGCTTCAAAATTTTCAC-3';

[0033] (12) Primer pair 12, used to amplify FCA567 site, includes: upstream primer 5'-TCAGGGTTTTCCAGAGAAACA-3'; downstream primer 5'-TAGACACATACAGATGGGGTGC-3';

[0034] (13) Primer pair 13, used to amplify the FCA82 site, includes:

[0035] Upstream primer 5'-TCCCTTGGGACTAACCTGTG-3';

[0036] Downstream primer 5'-AAGGTGTGAAGCTTCCGAAA-3';

[0037] (14) Primer pair 14, used to amplify FCA506 site, including: upstream primer 5'-AATGACACCAAGCTGTTGTCC-3';

[0038] Downstream primer 5'-AGAATGTTCTCTCCGCGTGT-3';

[0039] (15) Primer pair 15, used to amplify the F115 site, includes:

[0040] Upstream primer 5'-CTCACACAAGTAACTCTTTG-3';

[0041] Downstream primer 5'-CCTTCCAGATTAAGATGAGA-3'.

[0042] In one embodiment of this disclosure, the STR marker site amplification primer set, each primer pair is labeled with fluorescein:

[0043] (1) The first primer pair is used to amplify the FCA123 site and is labeled with FAM fluorescent dye;

[0044] (2) The second primer pair is used to amplify the FCA132 site and is labeled with VIC fluorescein;

[0045] (3) The third primer pair is used to amplify the FCA161 site and is labeled with FAM fluorescent dye;

[0046] (4) The fourth primer pair is used to amplify the FCA201 site and is labeled with NED fluorescent dye;

[0047] (5) The fifth primer pair is used to amplify the FCA224 site and is labeled with FAM fluorescent dye;

[0048] (6) The sixth primer pair is used to amplify the FCA229 site and is labeled with VIC fluorescein;

[0049] (7) Primer pair 7 is used to amplify the FCA247 site and is labeled with FAM fluorescent dye;

[0050] (8) Primer pair 8 is used to amplify the FCA290 site and is labeled with FAM fluorescent dye;

[0051] (9) Primer pair 9 is used to amplify the FCA293 site and is labeled with FAM fluorescent dye;

[0052] (10) Primer pair 10 is used to amplify the FCA424 site and is labeled with VIC fluorescent dye;

[0053] (11) Primer pair 11, used to amplify FCA441 site, is labeled with NED fluorescent dye;

[0054] (12) Primer pair 12 is used to amplify the FCA567 site and is labeled with VIC fluorescent dye;

[0055] (13) Primer pair 13 is used to amplify the FCA82 site and is labeled with FAM fluorescent dye;

[0056] (14) Primer pair 14 is used to amplify the FCA506 site and is labeled with PET fluorescent dye;

[0057] (15) Primer pair 15 is used to amplify the F115 site and is labeled with VIC fluorescein.

[0058] According to a second aspect of the present invention, an STR marker detection kit for paternity testing of pedigree cats is also provided, comprising a primer mixture; said primer mixture comprises the STR marker site amplification primer set provided in the first aspect of the present invention.

[0059] According to a third aspect of the present invention, a method for detecting STR markers for pedigree identification in purebred cats is also provided, comprising the following steps:

[0060] Collect genetic information;

[0061] The collected gene information was amplified by PCR using the STR marker site amplification primer set provided in the first aspect of the present invention, or by using the STR marker detection kit provided in the second aspect of the present invention, to obtain PCR products;

[0062] The PCR products were analyzed to obtain the genotyping results;

[0063] Determining parentage based on genotyping results.

[0064] In one embodiment of this disclosure, the step of collecting the genetic information of the cat to be tested includes:

[0065] Collect biological samples from cats, wherein the biological samples are at least one of the following: cat blood, semen, mucosal cells, hard tissue, and hair with follicles;

[0066] Genetic information of cats was extracted from the biological sample.

[0067] In one embodiment of this disclosure, the step of performing PCR amplification on the collected gene information includes:

[0068] The genetic information is mixed with the components of the STR marker detection kit provided in the third aspect of the present invention in a certain proportion to form a reaction solution;

[0069] The gene information is amplified by PCR under predetermined conditions to obtain the PCR product.

[0070] In one embodiment of this disclosure, the collected gene information is divided into at least five groups, each of which is then subjected to PCR amplification, wherein:

[0071] The annealing temperature of the first group was 53.3℃, ​​in order to amplify the F115 site, FCA441 site and FCA424 site;

[0072] The annealing temperature for the second group was 55.2℃, in order to amplify the FCA132 and FCA293 sites;

[0073] The annealing temperature of the third group was 56.2℃, in order to amplify the FCA247, FCA82, FCA506 and FCA201 sites;

[0074] The annealing temperature of the fourth group was 56.8℃, in order to amplify the FCA567, FCA123, FCA161 and FCA224 sites;

[0075] The annealing temperature for the fifth group was 57.5℃ to amplify the FCA290 and FCA229 sites.

[0076] In one embodiment of this disclosure, the step of analyzing the PCR product includes:

[0077] The PCR products were subjected to electrophoresis;

[0078] Analyze the electrophoresis data to obtain the genotyping data of the tested cats.

[0079] In one embodiment of this disclosure, the genotyping data of the cat being tested is the length of the STR marker site.

[0080] In one embodiment of this disclosure, the step of determining parentage based on genotyping results includes:

[0081] When at least one locus does not satisfy Mendel's laws of inheritance, the determination of parentage is not valid.

[0082] When all fifteen loci satisfy Mendel's laws of inheritance, a parent-child relationship can be established.

[0083] One of the advantages of this invention is that it enables paternity testing of purebred cats using STR marker loci, with high accuracy, high repeatability, and short testing time.

[0084] Other features and advantages of the invention will become clear from the following detailed description of exemplary embodiments of the invention with reference to the accompanying drawings. Attached Figure Description

[0085] The accompanying drawings, which are incorporated in and form part of this specification, illustrate embodiments of the invention and, together with their description, serve to explain the principles of the invention.

[0086] Figure 1 This is a flowchart of a method for paternity testing of purebred cats provided in an embodiment of the present invention. Detailed Implementation

[0087] To make the inventive objectives, technical solutions, and beneficial technical effects of this application clearer, the following detailed description is provided in conjunction with specific embodiments. It should be understood that the embodiments described in this specification are merely illustrative and not intended to limit the scope of this application.

[0088] For simplicity, this paper only explicitly discloses some numerical ranges. However, any lower limit can be combined with any upper limit to form an unspecified range; and any lower limit can be combined with other lower limits to form an unspecified range, just as any upper limit can be combined with any other upper limit to form an unspecified range. Furthermore, although not explicitly stated, every point or individual value between the endpoints of a range is included within that range. Therefore, each point or individual value can serve as its own lower or upper limit and be combined with any other point or individual value, or with other lower or upper limits, to form an unspecified range.

[0089] In the description of this article, it should be noted that, unless otherwise stated, "above" and "below" include the number itself, and "several" in "one or more" means two or more.

[0090] The foregoing description of this invention is not intended to describe every disclosed embodiment or implementation. Instead, the following description provides more specific examples of exemplary embodiments. Throughout the application, guidance is provided through a series of embodiments that can be used in various combinations. The examples listed are merely representative and should not be construed as exhaustive.

[0091] According to a first aspect of the present invention, a primer set for STR marker amplification in pedigree cat parentage testing is provided, the primer set comprising at least one primer pair:

[0092] (1) Primer pair 1, used to amplify the FCA123 site, includes:

[0093] Upstream primer 5'-ACTGCGAGAGGACTTTCGAA-3';

[0094] Downstream primer 5'-CTTCTGACAGGCTCCAGGTT-3';

[0095] (2) The second primer pair, used to amplify the FCA132 site, includes:

[0096] Upstream primer 5'-ATCAAGGCCAACTGTCCG-3';

[0097] Downstream primer 5'-GATGCCTCATTAGAAAAATGGC-3';

[0098] (3) The third primer pair, used to amplify the FCA161 site, includes:

[0099] Upstream primer 5'-TTACCGATACACACCTGCCA-3';

[0100] Downstream primer 5'-CACAGACGTGCTCTAGCCAA-3';

[0101] (4) The fourth primer pair, used to amplify the FCA201 site, includes:

[0102] Upstream primer 5'-TCTGCAGGACCAGTCAGATG-3';

[0103] Downstream primer 5'-AGCATACACAAATTGATGCTGG-3';

[0104] (5) The fifth primer pair is used to amplify the FCA224 site, including: upstream primer 5'-CTGGGTGCTGACAGCATAGA-3';

[0105] Downstream primer 5'-TGCCAGAGTTGTATGAAAGGG-3';

[0106] (6) The 6th primer pair is used to amplify the FCA229 site, including: upstream primer 5'-CAAACTGACAAGCTTAGAGGGC-3'; downstream primer 5'-GCAGAAGTCCAATCTCAAAGTC-3';

[0107] (7) The 7th primer pair is used to amplify the FCA247 site, including: upstream primer 5'-GGAAATTAGGAGCTCTGCCA-3';

[0108] Downstream primer 5'-AAGATTTACCCAGTTGCCCC-3';

[0109] (8) The 8th primer pair is used to amplify the FCA290 site, including: upstream primer 5'-GTAAGGTCCCTGCCACACAT-3';

[0110] Downstream primer 5'-GTATCTGCCCATTTGAGAAAGG-3';

[0111] (9) The 9th primer pair is used to amplify the FCA293 site, including: upstream primer 5'-GATGGCCCAAAAGCACAC-3';

[0112] Downstream primer 5'-CCCACATCTTGTCAACAACG-3';

[0113] (10) The 10th primer pair is used to amplify the FCA424 site, including: upstream primer 5'-TGGAAAAATGTGGAATACTGA-3'; downstream primer 5'-CCAATTTGTAGTGACATCCCC-3';

[0114] (11) Primer pair 11, used to amplify FCA441 site, includes: upstream primer 5'-ATCGGTAGGTAGGTAGATATAG-3'; downstream primer 5'-GCTTGCTTCAAAATTTTCAC-3';

[0115] (12) Primer pair 12, used to amplify the FCA567 site, includes:

[0116] Upstream primer 5'-TCAGGGTTTTCCAGAGAAACA-3';

[0117] Downstream primer 5'-TAGACACATACAGATGGGGTGC-3';

[0118] (13) Primer pair 13, used to amplify the FCA82 site, includes:

[0119] Upstream primer 5'-TCCCTTGGGACTAACCTGTG-3';

[0120] Downstream primer 5'-AAGGTGTGAAGCTTCCGAAA-3';

[0121] (14) Primer pair 14, used to amplify the FCA506 site, includes:

[0122] Upstream primer 5'-AATGACACCAAGCTGTTGTCC-3';

[0123] Downstream primer 5'-AGAATGTTCTCTCCGCGTGT-3';

[0124] (15) Primer pair 15, used to amplify the F115 site, includes:

[0125] Upstream primer 5'-CTCACACAAGTAACTCTTTG-3';

[0126] Downstream primer 5'-CCTTCCAGATTAAGATGAGA-3'.

[0127] In one embodiment of this disclosure, the STR marker site amplification primer set, each primer pair is labeled with fluorescein:

[0128] (1) The first primer pair is used to amplify the FCA123 site and is labeled with FAM fluorescent dye;

[0129] (2) The second primer pair is used to amplify the FCA132 site and is labeled with VIC fluorescein;

[0130] (3) The third primer pair is used to amplify the FCA161 site and is labeled with FAM fluorescent dye;

[0131] (4) The fourth primer pair is used to amplify the FCA201 site and is labeled with NED fluorescent dye;

[0132] (5) The fifth primer pair is used to amplify the FCA224 site and is labeled with FAM fluorescent dye;

[0133] (6) The sixth primer pair is used to amplify the FCA229 site and is labeled with VIC fluorescein;

[0134] (7) Primer pair 7 is used to amplify the FCA247 site and is labeled with FAM fluorescent dye;

[0135] (8) Primer pair 8 is used to amplify the FCA290 site and is labeled with FAM fluorescent dye;

[0136] (9) Primer pair 9 is used to amplify the FCA293 site and is labeled with FAM fluorescent dye;

[0137] (10) Primer pair 10 is used to amplify the FCA424 site and is labeled with VIC fluorescent dye;

[0138] (11) Primer pair 11, used to amplify FCA441 site, is labeled with NED fluorescent dye;

[0139] (12) Primer pair 12 is used to amplify the FCA567 site and is labeled with VIC fluorescent dye;

[0140] (13) Primer pair 13 is used to amplify the FCA82 site and is labeled with FAM fluorescent dye;

[0141] (14) Primer pair 14 is used to amplify the FCA506 site and is labeled with PET fluorescent dye;

[0142] (15) Primer pair 15 is used to amplify the F115 site and is labeled with VIC fluorescein.

[0143] According to a second aspect of the present invention, an STR marker detection kit for paternity testing of pedigree cats is also provided, comprising a primer mixture; said primer mixture comprises the STR marker site amplification primer set provided in the first aspect of the present invention.

[0144] According to a third aspect of the present invention, a method for detecting STR markers for pedigree identification in purebred cats is also provided, comprising the following steps:

[0145] Collect genetic information;

[0146] The collected gene information was amplified by PCR using the STR marker site amplification primer set provided in the first aspect of the present invention, or by using the STR marker detection kit provided in the second aspect of the present invention, to obtain PCR products;

[0147] The PCR products were analyzed to obtain the genotyping results;

[0148] Determining parentage based on genotyping results.

[0149] In one embodiment of this disclosure, the step of collecting the genetic information of the cat to be tested includes:

[0150] Collect biological samples from cats, wherein the biological samples are at least one of the following: cat blood, semen, mucosal cells, hard tissue, and hair with follicles;

[0151] Genetic information of cats was extracted from the biological sample.

[0152] In one embodiment of this disclosure, the step of performing PCR amplification on the collected gene information includes:

[0153] The genetic information is mixed with the components of the STR marker detection kit provided in the third aspect of the present invention in a certain proportion to form a reaction solution;

[0154] The gene information is amplified by PCR under predetermined conditions to obtain the PCR product.

[0155] In one embodiment of this disclosure, the collected gene information is divided into at least five groups, each of which is then subjected to PCR amplification, wherein:

[0156] The annealing temperature of the first group was 53.3℃, ​​in order to amplify the F115 site, FCA441 site and FCA424 site;

[0157] The annealing temperature for the second group was 55.2℃, in order to amplify the FCA132 and FCA293 sites;

[0158] The annealing temperature of the third group was 56.2℃, in order to amplify the FCA247, FCA82, FCA506 and FCA201 sites;

[0159] The annealing temperature of the fourth group was 56.8℃, in order to amplify the FCA567, FCA123, FCA161 and FCA224 sites;

[0160] The annealing temperature for the fifth group was 57.5℃ to amplify the FCA290 and FCA229 sites.

[0161] In one embodiment of this disclosure, the step of analyzing the PCR product includes:

[0162] The PCR products were subjected to electrophoresis;

[0163] Analyze the electrophoresis data to obtain the genotyping data of the tested cats.

[0164] In one embodiment of this disclosure, the genotyping data of the cat being tested is the length of the STR marker site.

[0165] In one embodiment of this disclosure, the step of determining parentage based on genotyping results includes:

[0166] When at least one locus does not satisfy Mendel's laws of inheritance, the determination of parentage is not valid.

[0167] When all fifteen loci satisfy Mendel's laws of inheritance, a parent-child relationship can be established.

[0168] Example 1

[0169] Screening and determination of STR marker loci for paternity testing in purebred cats:

[0170] 1. Screening of STR marker sites

[0171] 1228 purebred cats were selected, and their whole genomes were sequenced at a depth of 20× using next-generation sequencing (NGS) technology. After statistical analysis of the data from several high-linkage STR loci, 60 STR loci with no linkage relationship and high polymorphic information content were selected.

[0172] The DNA sequences corresponding to these 60 STR sites were identified in the cat genome. The cat genome sequence was analyzed to design primers that could be directly applied to cat STR amplification (see Table 1), which were then synthesized. These 60 primer pairs (see Table 1) were then used to amplify the 60 selected STR sites, and the amplification products were detected by electrophoresis.

[0173] Table 1: Information on 60 pairs of common primers for feline STRs

[0174]

[0175]

[0176]

[0177]

[0178]

[0179] 2. Determination of STR marker sites

[0180] Based on the electrophoresis results, 15 primer pairs with clear bands, high yield, and good specificity were selected from 60 primer pairs. These 15 primer pairs were ultimately determined as primers for pedigree cat parentage testing. Their corresponding amplified STR sites are: F115, FCA441, FCA424, FCA132, FCA293, FCA247, FCA82, FCA506, FCA201, FCA567, FCA123, FCA161, FCA224, FCA290, and FCA229. Detailed information is shown in Table 2.

[0181] Table 2: Information on 15 pairs of fluorescent primers used for paternity testing in purebred cats

[0182]

[0183]

[0184] Example 2

[0185] Grouping and fluorescent labeling of STR loci for paternity testing in purebred cats:

[0186] Through numerous repeated experiments, the applicant considered factors such as the interaction between primers, the optimal annealing temperature of each primer, and amplification efficiency, and grouped and fluorescently labeled the 15 STR sites described in Table 2 as shown in Table 3.

[0187] Table 3: Grouping information of 15 pairs of STR fluorescent primers that can be used for paternity testing in purebred cats

[0188]

[0189]

[0190] In this embodiment, the length and color of the actual amplified PCR product are compared with the expected product length and color recorded in Table 3 using a genetic analyzer. The actual amplified product length only needs to be within or close to the length range recorded in Table 3. There may be some deviation between the two, as long as it is within the range acceptable to those skilled in the art, or it can be confirmed by sequencing to be the fragment to be amplified.

[0191] Example 3

[0192] STR marker detection kit for paternity testing in purebred cats:

[0193] This invention optimizes amplification conditions and adjusts the concentration of each component in the reaction system to screen for the optimal detection system composition and amplification conditions, providing a detection kit for paternity testing of purebred cats. The kit contains PCR fluorescent primers (primer mixture) for amplifying the STR sites described in Table 2, as well as other necessary components and their containers, the specific composition of which is shown in Table 4. Genotyping can be performed using the genomic DNA of the cat to be tested as a template, combining multiplex fluorescent PCR and capillary electrophoresis techniques.

[0194] Table 4: Composition of the STR locus identification kit for purebred cats

[0195]

[0196]

[0197] Note: The reagent volume of this kit is sufficient for 200 STR detection experiments using a 10μL system.

[0198] As shown in Table 4, the kit consists of a primer mixture, which includes the STR marker site amplification primer set provided in Table 2 of Example 1. Due to the different amplification efficiencies and fluorescent labels of different primers, the fluorescence signal intensities of their amplification products often differ. To ensure that the fluorescence intensity of the amplification products of each primer is as similar as possible, facilitating genotyping after amplification, the applicant adjusted the concentration of each primer, as detailed in Table 5.

[0199] Table 5: Concentration and annealing temperature of each group of fluorescent primer mixtures

[0200]

[0201]

[0202] Note: 1. The upstream and downstream primer concentrations are the same at each site, and they appear in pairs in each group; 2. The annealing temperature is the temperature at which the effect of each group is optimal in the multiplex PCR amplification experiment.

[0203] Example 4

[0204] See Figure 1 , Figure 1 The flowchart illustrates a method for using an STR marker detection kit for paternity testing of purebred cats according to an embodiment of the present invention, specifically including the following steps:

[0205] Step 102: Collect genetic information.

[0206] In this embodiment, it is necessary to collect the genetic information of the cat to be tested, specifically the DNA information of the cat to be tested.

[0207] In practical applications, the DNA information of the cat to be tested is contained in its biological sample. A biological sample can be understood as all or part of the remaining traces of living plants and animals, such as blood, semen, mucosal cells, hard tissue, and hair with follicles, all of which carry DNA information. After obtaining the biological sample, the DNA information of the cat to be tested can be extracted from it.

[0208] In one specific embodiment of the present invention, taking blood as the biological sample, whole blood is extracted from the cat to be tested. During sample collection, to ensure DNA stability, heparin sodium anticoagulant is added to the collected whole blood, and the blood collection tube is stored in a liquid nitrogen container. Upon returning to the laboratory, the whole blood is transferred to a specific sample storage tube at a ratio of DNA preservation solution to whole blood (1:3) and stored at -80°C. Then, the whole blood DNA is extracted using the phenol-chloroform-isoamyl alcohol extraction method to obtain the genetic information of the cat to be tested.

[0209] In another specific embodiment of the present invention, taking the oral swab of the cat to be tested as an example, the oral swab of the cat to be tested is collected and placed into the test tube. The collected oral swab is centrifuged or compressed to ensure that the sample meets the experimental requirements (at least 1 ml). Then, DNA is extracted from the sample. The extraction method can be a two-plate extraction method. The extracted sample is temporarily stored in a 4°C refrigerator.

[0210] In practical applications, the concentration of extracted DNA needs to be quantitatively determined. When the concentration is greater than 10 ng / μL, the DNA concentration needs to be diluted to 10 ng / μL. When the concentration is less than 10 ng / μL, it is recommended to concentrate the DNA before proceeding to subsequent experiments. If the concentration is still too low after concentration, resampling is required.

[0211] Of course, other methods that can achieve the sampling purpose can be selected for extracting biological samples and extracting DNA, and this invention does not limit this.

[0212] Step 104: The collected gene information was amplified by PCR using the STR marker site amplification primer set to obtain PCR products.

[0213] The primer set for STR marker site amplification is the primer set in Table 2 of Example 1.

[0214] In one specific embodiment of the present invention, the DNA sample extracted in step 102 and the solution in the kit provided in Example 3 are mixed according to the amounts specified in Table 6 to obtain at least five mixed reaction solutions. The PCR reaction buffer in the kit provided in Example 3 is a 10-fold concentration solution, which needs to be diluted 5 times before mixing to obtain a 2-fold concentration PCR reaction buffer. The diluted solution is then used to prepare the reaction system shown in Table 6.

[0215] Table 6: Multiplex fluorescent PCR reaction system for STR locus detection in purebred cats (10 μL)

[0216]

[0217] Add one portion of the mixed reaction solution to a PCR reaction vessel and place it in a PCR instrument; set the PCR reaction program, and the PCR reaction conditions are shown in Table 7; perform PCR amplification on the sample to be tested to obtain one PCR product; repeat the operation more than 4 times, and each time the annealing temperature needs to be reset according to Table 7; after amplification, a total of five PCR products were obtained. This PCR product is a specific amplified fragment of the STR gene locus provided in Example 1.

[0218] Table 7: Multiplex PCR reaction conditions for STR locus detection in purebred cats

[0219]

[0220] Step 106: Analyze the PCR products to obtain the genotyping results.

[0221] The five PCR products obtained in step 104 were separately loaded into a genetic analyzer for electrophoresis. Since the PCR products were labeled with different fluorescent colors, and the length ranges of STR loci labeled with the same fluorescence in each group did not overlap, different STR loci could be accurately identified based on the electrophoresis data. Analysis of the electrophoresis data yielded the accurate lengths of 15 STR loci, which constituted the genotyping results.

[0222] In detail, according to Embodiment 2, the present invention employs four fluorescent markers, corresponding to the following colors: green (VIC), yellow (NED), blue (FAM), and red (PET). It is understandable to those skilled in the art that the fluorescent dyes may produce light of a different color after excitation in different analyzers.

[0223] Step 108: Determine parentage based on genotyping results.

[0224] Paternity testing is based on Mendel's laws of segregation and independent assortment. By matching the genotyping results obtained in step 106, if at least one of the fifteen STR loci does not satisfy Mendel's laws of inheritance, then a parent-child relationship is not established; if all fifteen STR loci satisfy Mendel's laws of inheritance, showing a 99.9999% probability of a parent-child relationship, then a parent-child relationship is established.

[0225] Example 5

[0226] A case of feline trio paternity testing:

[0227] In a cat breeding facility, there is a female cat that has given birth and a male cat that mated with the female cat. It is known that this pair of cats has two suspected offspring. Using the kit provided in Example 3, paternity testing was performed on the above four cats to identify which of the two suspected offspring is the biological offspring of the female and male cats.

[0228] 1. Sample collection:

[0229] Blood samples were collected from the female cat, the male cat, and two suspected offspring (candidate offspring 1 and candidate offspring 2). Genomic DNA was extracted from the four blood samples from each of the four cats.

[0230] 2. Inspection:

[0231] Multiplex fluorescent PCR amplification was performed on each sample using the kit provided in Example 3, and the PCR amplification products were detected by capillary electrophoresis.

[0232] 3. Results:

[0233] Based on the differences in fluorescence signals and positions of the amplification products in the capillary electrophoresis, the lengths of the amplification products at 15 STR sites were read, and the results are shown in Table 8.

[0234] Table 8: Genotyping for paternity testing in feline triads

[0235]

[0236]

[0237] Note: The genotypes in the boxes are those that do not show a kinship relationship.

[0238] 4. Expert opinion

[0239] Of the 15 STR markers tested, all STR gene loci of candidate offspring 1 and the father cat conformed to Mendel's laws of inheritance, as did all STR gene loci of candidate offspring 1 and the mother cat. However, 12 STR gene loci of candidate offspring 2 and the father and mother cats did not conform to Mendel's laws of inheritance. Therefore, candidate offspring 2 was excluded as the biological offspring of the father and mother cats, and candidate offspring 1 was selected as the biological offspring of the father and mother cats.

[0240] The various embodiments of the present invention have been described above. These descriptions are exemplary and not exhaustive, and are not limited to the disclosed embodiments. Many modifications and variations will be apparent to those skilled in the art without departing from the scope and spirit of the described embodiments. The terminology used herein is chosen to best explain the principles, practical application, or technical improvements to the embodiments in the market, or to enable others skilled in the art to understand the embodiments disclosed herein. The scope of the invention is defined by the appended claims.

Claims

1. The application of an STR marker amplification primer set in pedigree cat paternity testing, characterized in that, The primer set includes the following: (1) Primer pair 1, used to amplify the FCA123 site, includes: Upstream primer 5'-ACTGCGAGAGGACTTTCGAA-3'; Downstream primer 5'-CTTCTGACAGGCTCCAGGTT-3'; (2) The second primer pair, used to amplify the FCA132 site, includes: Upstream primer 5'-ATCAAGGCCAACTGTCCG-3'; Downstream primer 5'-GATGCCTCATTAGAAAAATGGC-3'; (3) The third primer pair, used to amplify the FCA161 site, includes: Upstream primer 5'-TTACCGATACACACCTGCCA-3'; Downstream primer 5'-CACAGACGTGCTCTAGCCAA-3'; (4) The fourth primer pair, used to amplify the FCA201 site, includes: Upstream primer 5'-TCTGCAGGACCAGTCAGATG-3'; Downstream primer 5'-AGCATACACAAATTGATGCTGG-3'; (5) The fifth primer pair, used to amplify the FCA224 site, includes: Upstream primer 5'-CTGGGTGCTGACAGCATAGA-3'; Downstream primer 5'- TGCCAGAGTTGTATGAAAGGG-3'; (6) The sixth primer pair, used to amplify the FCA229 site, includes: Upstream primer 5'-CAAACTGACAAGCTTAGAGGGC-3'; Downstream primer 5'-GCAGAAGTCCAATCTCAAAGTC-3'; (7) Primer pair 7, used to amplify the FCA247 site, includes: Upstream primer 5'-GGAAATTAGGAGCTCTGCCA -3'; Downstream primer 5'-AAGATTTACCCAGTTGCCCC-3'; (8) Primer pair 8, used to amplify the FCA290 site, includes: Upstream primer 5'-GTAAGGTCCCTGCCACACAT-3'; Downstream primer 5'- GTATCTGCCCATTTGAGAAAGG -3'; (9) Primer pair number 9, used to amplify the FCA293 site, includes: Upstream primer 5'-GATGGCCCAAAAGCACAC-3'; Downstream primer 5'-CCCACATCTTGTCAACAACG-3'; (10) Primer pair number 10, used to amplify the FCA424 site, includes: Upstream primer 5'-TGGAAAAATGTGGAATACTGA-3'; Downstream primer 5'-CCAATTTGTAGTGACATCCCC-3'; (11) Primer pair 11, used to amplify the FCA441 site, includes: Upstream primer 5'-ATCGGTAGGTAGGTAGATATAG-3'; Downstream primer 5'- GCTTGCTTCAAAATTTTCAC -3'; (12) Primer pair 12, used to amplify the FCA567 site, includes: Upstream primer 5'-TCAGGGTTTTCCAGAGAAACA -3'; Downstream primer 5'- TAGACACATACAGATGGGGTGC -3'; (13) Primer pair 13, used to amplify the FCA82 site, includes: Upstream primer 5'-TCCCTTGGGACTAACCTGTG-3'; Downstream primer 5'-AAGGTGTGAAGCTTCCGAAA-3'; (14) Primer pair 14, used to amplify the FCA506 site, includes: Upstream primer 5'- AATGACACCAAGCTGTTGTCC -3'; Downstream primer 5'-AGAATTGTTCTCTCCCGCGTGT-3'; and (15) Primer pair 15, used to amplify the F115 site, includes: Upstream primer 5'-CTCACACAAGTAACTCTTTG-3'; Downstream primer 5'-CCTTCCAGATTAAGATGAGA-3'; Genes from the parent and offspring of the cats to be tested were collected, and PCR amplification was performed using the primers described above to obtain PCR products. The PCR products were analyzed to obtain genotyping results. Parentage was determined based on the genotyping results. If at least one locus did not satisfy Mendel's laws of inheritance, the parentage was not established. If all fifteen loci satisfied Mendel's laws of inheritance, the parentage was established.

2. The application according to claim 1, characterized in that, Each primer pair was labeled with fluorescein: (1) The first primer pair is used to amplify the FCA123 site and is labeled with FAM fluorescent dye; (2) The second primer pair is used to amplify the FCA132 site and is labeled with VIC fluorescein; (3) The third primer pair is used to amplify the FCA161 site and is labeled with FAM fluorescent dye; (4) The fourth primer pair is used to amplify the FCA201 site and is labeled with NED fluorescent dye; (5) The fifth primer pair is used to amplify the FCA224 site and is labeled with FAM fluorescent dye; (6) The sixth primer pair is used to amplify the FCA229 site and is labeled with VIC fluorescein; (7) The 7th primer pair is used to amplify the FCA247 site and is labeled with FAM fluorescent dye; (8) The 8th primer pair is used to amplify the FCA290 site and is labeled with FAM fluorescent dye; (9) The 9th primer pair is used to amplify the FCA293 site and is labeled with FAM fluorescent dye; (10) Primer pair 10, used to amplify FCA424 site, is labeled with fluorescein VIC; (11) Primer pair 11, used to amplify FCA441 site, is labeled with NED fluorescent dye; (12) Primer pair 12 is used to amplify the FCA567 site and is labeled with VIC fluorescein; (13) Primer pair 13 is used to amplify the FCA82 site and is labeled with FAM fluorescent dye; (14) Primer pair 14, used to amplify the FCA506 site, is labeled with PET fluorescent dye; (15) Primer pair 15 is used to amplify the F115 site and is labeled with VIC fluorescein.

3. A method for detecting STR markers in pedigree cat parentage testing, characterized in that, Includes the following steps: Collect genetic information; Using the STR marker site amplification primer set as described in claim 1 or 2, the collected gene information was amplified by PCR to obtain PCR products; The PCR products were analyzed to obtain the genotyping results; Determining parentage based on genotyping results; The steps for determining parentage based on genotyping results include: When at least one locus does not satisfy Mendel's laws of inheritance, the determination of parentage is not valid. When all fifteen loci satisfy Mendel's laws of inheritance, a parent-child relationship can be established.

4. The method according to claim 3, characterized in that, The steps for collecting genetic information from the cat to be tested include: Collect biological samples from cats, wherein the biological samples are at least one of the following: cat blood, semen, mucosal cells, hard tissue, and hair with follicles; Genetic information of cats was extracted from the biological sample.

5. The method according to claim 4, characterized in that, The collected gene information was divided into at least five groups, each of which underwent PCR amplification. The annealing temperature of the first group was 53.3℃, ​​in order to amplify the F115 site, FCA441 site and FCA424 site; The annealing temperature for the second group was 55.2℃, in order to amplify the FCA132 and FCA293 sites; The annealing temperature of the third group was 56.2℃, in order to amplify the FCA247, FCA82, FCA506 and FCA201 sites; The annealing temperature of the fourth group was 56.8℃, in order to amplify the FCA567, FCA123, FCA161 and FCA224 sites; The annealing temperature for the fifth group was 57.5℃ to amplify the FCA290 and FCA229 sites.

6. The method according to claim 3, characterized in that, The steps for analyzing the PCR products include: The PCR products were subjected to electrophoresis; Analyze the electrophoresis data to obtain the genotyping data of the tested cats.

7. The method according to claim 6, characterized in that, The genotyping data of the tested cats is the length of the STR marker sites.

Images