High frequency indel molecular markers in sorghum and their applications

Abstract

This invention discloses a high-frequency Indel molecular marker in the genus *Sorghum* and its application. The invention first provides a method for rapidly predicting the minimum allele frequency of Indel markers, comprising the following steps: DNA is extracted from germplasm resources, and n genotypes are mixed in equal pools to obtain N pooled samples. PCR with specific primers is then performed on each of the N pooled DNA samples. The resulting N products are mixed twice to obtain a final product, which is then separated by electrophoresis using 4% agarose gel. The intensity of different Indel bands on the same lane is quantitatively analyzed, and the MAF(%) is calculated as: MAF(%) = Intensity(weak band) / [Intensity(weak band) + Intensity(strong band)] * ​​100, where n and N are both integers greater than 1. Using the aforementioned screening method, this invention screens out 23 high-frequency Indel molecular markers, as shown in SEQ ID Nos: 1–46. The Indel markers screened by this invention all have actual MAF values ​​>10%, indicating high polymorphism; and the fragment differences among Sorghum germplasm resources are all >50bp, which significantly facilitates agarose electrophoresis separation, shortens the experimental cycle, and is simple, easy to implement, and highly operable.

Description

Technical Field

[0001] This invention specifically relates to a high-frequency Indel molecular marker for the genus Sorghum and its application, belonging to the field of molecular marker technology. Background Technology

[0002] Driven by China's brewing industry, sorghum planting has developed rapidly in recent years, with both the planting area and output increasing year by year. The planting area increased by 58.86% between 2015 and 2021, with an average annual compound growth rate of approximately 8.01%; output increased by 42.26%, with an average annual compound growth rate of approximately 6.05%. Sorghum is also an excellent forage crop; in 2021, the national industrial feed output reached 293.44 million tons, a year-on-year increase of 5.4%. The rapid growth trend of my country's sorghum industry will further drive significant progress in the sorghum seed industry. Since the implementation of the registration system for non-major crop varieties in 2017, a total of 761 sorghum varieties have been registered, of which brewing and grain varieties account for 63.7% and 16.8% respectively, while other uses, including feed, account for 19.5%. The number of registered sorghum varieties in my country is increasing rapidly; in 2022, 132 sorghum varieties were registered, more than double the number registered in 2021 (64 varieties). In order to maximize the efficiency of molecular genetic breeding of Sorghum and protect the rights of Sorghum varieties, it is urgent to develop high-frequency molecular markers for brewing, grain and feed Sorghum varieties with higher accuracy and shorter identification cycles.

[0003] Compared to SSR molecular markers, Indel markers offer higher resolution and accuracy, and shorter identification cycles. SSRs (Simple Sequence Repeats), as important sequence buffers in the genome, preserve genetic characteristics from recombination and are widely used in genetic diversity analysis. However, SSR molecular marker methods still suffer from drawbacks such as small fragment differences, difficulty in precise separation / identification, weak operability, low analytical efficiency, and high operating costs. Indels (Insert and Delete) refer to a certain number of nucleotide insertions or deletions in the genome of one genotype relative to other genotypes. Indel markers are amplification markers designed based on PCR primers at Indel sites. The advantages of this marker method are: 1) association with target gene function, facilitating molecularly assisted screening and identification; 2) the ability to screen fragments with differences greater than 50 bp, facilitating separation and precise identification; 3) the ability to use the most common agarose gel electrophoresis method for separation, which is simple, convenient, has a short analysis cycle, and low operating costs. Currently, relevant Indel molecular markers have been developed for major crops such as rice, wheat, corn, rapeseed, soybean, and cotton.

[0004] Modern molecular genetic research methods can directly identify gene indels. A 2021 pan-genome analysis of sorghum germplasm published in the authoritative journal *Nature* showed that gene structural variation among sorghum species (*Sorghum pseudosorghum*, *Sorghum sulphureus*, and *Sorghum sacchariformis*) exceeded 64%, with numerous important agronomical trait variations associated with indel characteristics of major genes. Furthermore, pan-genome analysis can directly screen for structural variations within coding genes. For example, a large insertion in the MYB transcription factor encoded by the *yellow seed1* gene on chromosome 1 caused significant variations in the inner and outer seed coat colors of different sorghum germplasms. Therefore, designing indel markers for important traits based on pan-genome analysis is significantly beneficial for the genetic analysis of sorghum germplasm resources and the molecular identification of cultivars.

[0005] In a patent published in 2019, application number CN109811087A, entitled "Indel Molecular Markers in Sorghum and Their Applications," compared the genomic series of Jiutian1 and BT×623, screened Indel sites with fragment differences >10bp, and designed and screened 87 Indel markers across the entire chromosome. However, the actual polymorphism of the molecular markers in Sorghum germplasm resources and their minor allele frequency (MAF) are unknown in this patent, and the fragment differences are relatively small, making them difficult to separate by ordinary agarose gel electrophoresis. Furthermore, high-resolution Indel molecular markers with fragments >50bp are lacking. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the first objective of this invention is to provide a method for rapidly predicting the minimum allele frequency of an Indel marker, which can quickly and accurately calculate the MAF value of the marker and screen out high-frequency markers without having to analyze individual samples in a large population one by one.

[0007] The second objective of this invention is to provide primers and chromosomal physical locations for the 23 high-frequency Indel markers screened by the method described above;

[0008] A third objective of this invention is to provide the application of the 23 high-frequency Indel markers mentioned above in Sorghum germplasm;

[0009] The objective of this invention can be achieved through the following technical solutions:

[0010] In a first aspect, the present invention protects a method for rapidly predicting the minimum allele frequency of Indel markers, comprising the following steps: extracting DNA from germplasm resources, mixing n genotypes in equal pools to obtain N pooled samples, performing PCR on the DNA of each of the N pooled samples with specific primers, mixing the resulting N products in a second pool to obtain a final product, separating them by electrophoresis using 4% agarose gel, and quantitatively analyzing the intensity of different Indel bands on the same lane, calculating MAF(%) = Intensity(weak band) / [Intensity(weak band) + Intensity(strong band)] * ​​100, where n and N are both integers greater than 1.

[0011] Methods for predicting MAF, such as Figure 1 As shown.

[0012] In some preferred embodiments of this application, the quantity n < 15, N = number of germplasm resources / n, the specific primers are sorghum genome primers with strong amplification and single bands, the PCR program is falling PCR type, and the annealing temperature is between 63-54℃.

[0013] Secondly, this invention also protects a sorghum InDel molecular marker, comprising forward and reverse primers corresponding to the following 23 sites, the positions of which on the chromosome are as follows: Figure 2 As shown.

[0014] WA01 locus: Chro.01 chromosome at 11.93 Mbp;

[0015] Upstream primer F: CTCCGGGTTGTGGTAGCTTT, as shown in SEQ ID No: 1;

[0016] Downstream primer R: CACTGCGGAGGATGACCATT, as shown in SEQ ID No: 2.

[0017] WA02 locus: Chro.01 chromosome at 62.91 Mbp;

[0018] Upstream primer F: CTGCTTCGTTTCGGAGGCTA, as shown in SEQ ID No: 3;

[0019] Downstream primer R: CATCCTCCTGTGTTCCGTCC, as shown in SEQ ID No: 4.

[0020] WA03 locus: 0.262 Mbp on chromosome 10.02;

[0021] Upstream primer F: CGTGAGCGATCATCGGATCAACAA, as shown in SEQ ID No: 5;

[0022] Downstream primer R: ACCTTGGCGTGCCGTGAGAT, as shown in SEQ ID No: 6.

[0023] WA04 locus: Chro.02 chromosome at 55.545 Mbp;

[0024] Upstream primer F: GGAACTGCGGAACGACCACA, as shown in SEQ ID No: 7;

[0025] Downstream primer R: GTTGTAAGGTTACATCCTGCTTCTCC, as shown in SEQ ID No: 8.

[0026] WA05 locus: 0.943 Mbp on chromosome 0.03;

[0027] Upstream primer F: AGGATGAGGCGGATTCTTGG, as shown in SEQ ID No: 9;

[0028] Downstream primer R: TCCATAGGCATTCATCGGTC, as shown in SEQ ID No: 10.

[0029] WA06 locus: Chro.03 chromosome at 55.646 Mbp;

[0030] Upstream primer F: CCTCAACTGTGAATTGGTGACGGATAT, as shown in SEQ ID No: 11;

[0031] Downstream primer R: AACAGATATATACAAATCCAGGCTGCTACC, as shown in SEQ ID No: 12.

[0032] WA07 locus: 0.212 Mbp on chromosome Chro.04;

[0033] Upstream primer F: GCTCAATCATGGGCTAACTAGACTCAA, as shown in SEQ ID No: 13;

[0034] Downstream primer R: ATTTGCCTCTAATTTGCGAGACGAATC, as shown in SEQ ID No: 14.

[0035] WA08 locus: Chro.04 chromosome at position 63.669 Mbp;

[0036] Upstream primer F: AGAATGAAGGTATGCGCTGTGT, as shown in SEQ ID No: 15;

[0037] Downstream primer R: GAGGAGGAGAAGACGACGACAG, as shown in SEQ ID No: 16.

[0038] WA09 locus: Chro.05 chromosome at 1.118 Mbp;

[0039] Upstream primer F: AAGCATCTTGATTAAGGACGGAATGGA, as shown in SEQ ID No: 17;

[0040] Downstream primer R: TACATGCCTTGACAACGAACCTAGC, as shown in SEQ ID No: 18.

[0041] WA10 locus: Chro.05 chromosome at 12.853 Mbp;

[0042] Upstream primer F: CATGATTGATTGACACGGCACATCTC, as shown in SEQ ID No: 19;

[0043] Downstream primer R: GTTCCGCTTGCCATTCAGCATTATG, as shown in SEQ ID No: 20.

[0044] WA11 locus: Chro.05 chromosome at 68.653 Mbp;

[0045] Upstream primer F: TCCTCCCGAATTAGAAGACGAAACAAAG, as shown in SEQ ID No: 21; Downstream primer R: CAGTGAGATACCACATTGGAACTTGAGT, as shown in SEQ ID No: 22.

[0046] WA12 locus: Chro.06 chromosome at 3.262 Mbp;

[0047] Upstream primer F: TCCTGTCTATGTGGTTGAAGCCTATAAG, as shown in SEQ ID No: 23; Downstream primer R: AATGACTGAAAGGCAACACAGAGAAAC, as shown in SEQ ID No: 24.

[0048] WA13 locus: Chro.06 chromosome at 40.431 Mbp;

[0049] Upstream primer F: TAACAGGTTAGGGATCTCCACCCAATA, as shown in SEQ ID No: 25;

[0050] Downstream primer R: GCGTAACTTCATAGCTCATGCCAATT, as shown in SEQ ID No: 26.

[0051] WA14 locus: 0.074 Mbp on chromosome 0.07;

[0052] Upstream primer F: GGTGATTGTGCAATGTGCATGATATAGAC, as shown in SEQ ID No: 27; Downstream primer R: ACCACCGCTACACTCGCCAAA, as shown in SEQ ID No: 28.

[0053] WA15 locus: Chro.07 chromosome at 57.814 Mbp;

[0054] Upstream primer F: GTGACACTTTAGCACTTTCGTTTGT, as shown in SEQ ID No: 29;

[0055] Downstream primer R: CGGCAGAAGGAGATCACGATACT, as shown in SEQ ID No: 30.

[0056] WA16 locus: Chro.07 chromosome at 63.740 Mbp;

[0057] Upstream primer F: GCGTTCTGTAGCCTCGTGAGTC, as shown in SEQ ID No: 31;

[0058] Downstream primer R: TCCCGTCACATCGAATCTTTAGACA, as shown in SEQ ID No: 32.

[0059] WA17 locus: Chro.08 chromosome at position 4.569 Mbp;

[0060] Upstream primer F: ATCAATGGCTATGGCGGTGCTG, as shown in SEQ ID No: 33;

[0061] Downstream primer R: GGACAACAACGGAATCGGTGGT, as shown in SEQ ID No: 34.

[0062] WA18 locus: Chro.08 chromosome at 9.499 Mbp;

[0063] Upstream primer F: GCATGGAATCTTAACTCTTAGCTTCTCAC, as shown in SEQ ID No: 35; Downstream primer R: CAATGGACTGGTTCTCGCTTCGT, as shown in SEQ ID No: 36.

[0064] WA19 locus: Chro.08 chromosome at 58.972 Mbp;

[0065] Upstream primer F: CCGAGACGCACAGAGAAACAGAAA, as shown in SEQ ID No: 37;

[0066] Downstream primer R: ATGAAGAGGGAGATATTTGTTGGGCTTAG, as shown in SEQ ID No: 38.

[0067] WA20 locus: Chro.09 chromosome at position 4.075 Mbp;

[0068] Upstream primer F: ACTCCACCACTTCTCCTCCTCC, as shown in SEQ ID No: 39;

[0069] Downstream primer R: AGATCCACCACAGCTCAAACTCAAA, as shown in SEQ ID No: 40.

[0070] WA21 locus: Chro.09 chromosome at 44.364 Mbp;

[0071] Upstream primer F: TGAAGCATTGGTGGACAACTGATGG, as shown in SEQ ID No: 41;

[0072] Downstream primer R: GAGGGCCTCTTTGGTTACTCATTACAT, as shown in SEQ ID No: 42.

[0073] WA22 locus: Chro.10 chromosome at 1.86 Mbp;

[0074] Upstream primer F: TAGAGAGGAGAGAGGAGGGACAGAGAG, as shown in SEQ ID No: 43;

[0075] Downstream primer R: GGACGCATGAAAGACCTGGA, as shown in SEQ ID No: 44.

[0076] WA23 locus: Chro.10 chromosome at 49.341 Mbp;

[0077] Upstream primer F: CTGAAGAGATCTGTCACGAAGTTGCT, as shown in SEQ ID No: 45;

[0078] Downstream primer R: ACACTGAATCCTGCATTCTGTCTAAGATAG, as shown in SEQ ID No: 46.

[0079] Thirdly, the present invention also protects the use of the sorghum InDel molecular marker described above or the substance for detecting the sorghum InDel molecular marker described above in the following (A1)-(A5):

[0080] (A1) Application in genetic diversity research in Sorghum germplasm;

[0081] (A2) Application in the construction of genetic linkage maps of sorghum;

[0082] (A3) Application in the identification of sorghum hybrids / purity;

[0083] (A4) Application in the mapping of genes related to important agronomic traits in sorghum;

[0084] (A5) Applications in molecular breeding or assisted breeding.

[0085] In a specific implementation scheme, the substance is selected from (B1) or (B2);

[0086] (B1) Detect the primers for the InDel molecular marker of sorghum, the primers being shown in SEQ ID No: 1-46;

[0087] (B2) Detection reagent containing the primers in (B1);

[0088] (B3) A kit containing the primers described in (B1) or the reagents described in (B2).

[0089] Fourthly, the present invention also protects the primers described above, and reagents or kits containing the primers described above.

[0090] Fifthly, the present invention also protects the primers described above, and the application of reagents or kits containing the primers described above in the study of genetic diversity in Sorghum germplasm.

[0091] Band differences of 23 Indel markers among 6 representative sorghum genus germplasms, as shown in Figure 3 As shown. The fragment differences among different germplasms were all >50 bp, significantly facilitating separation by agarose gel electrophoresis. Genetic diversity analysis was performed on 276 Sorghum germplasms using 23 markers, and the resulting genetic matrix was analyzed using PCO, as shown below. Figure 4 As shown, germplasm resources from different sorghum genera are significantly segregated in PCO.

[0092] Sixthly, the present invention also protects the primers described above, reagents or kits containing the primers described above, their application in the construction of sorghum genetic linkage maps, their application in the identification of sorghum hybrids / purity, and their application in the localization of genes related to important agronomic traits of sorghum and molecular-assisted selection breeding.

[0093] Beneficial effects

[0094] The Indel marker frequency prediction method developed in this invention can estimate the actual allele frequency of the marker in germplasm resources without analyzing individual samples from a large population, greatly shortening the development cycle of high-frequency Indel markers.

[0095] The Indel markers screened in this invention all had two actual allele types in 276 germplasm resources. During the screening process, markers with three or more allele types were filtered out, and the 23 marker alleles were restricted to binary, which is significantly beneficial for genetic analysis methods based on binary computation.

[0096] The 23 Indel markers screened in this invention all had actual MAF values ​​>10% in 276 germplasm resources, indicating high polymorphism.

[0097] The 23 Indel markers screened in this invention all showed fragment differences of >50bp among Sorghum germplasm resources, which significantly facilitated separation by agarose gel electrophoresis, shortened the experimental cycle, and were simple, easy to implement, highly operable, economical and practical. Attached Figure Description

[0098] Figure 1 This document presents a MAF prediction procedure for Indel markers in the genus *Sorghum*. A represents the construction of a mixed DNA pool, the PCR process for the mixed DNA sample, and the electrophoretic detection of the mixed product. B shows the electrophoretic detection image of the PCR mixed sample. C represents the detection of different band intensities in a single sample and its MAF estimation method. D shows the linear relationship between the actual MAF and the predicted MAF value.

[0099] Figure 2 The distribution locations of 23 high-frequency Indel markers in the genus Sorghum on chromosomes.

[0100] Figure 3 Electrophoresis results for 23 high-frequency Indel markers in the genus *Sorghum*, including BT×623, Rio, Tx430, *Hongyingzi*, local species of Jiangsu sweet sorghum, and Sudan grass 2098.

[0101] Figure 4 Genetic diversity analysis of 276 germplasm accessions based on 23 high-frequency Indel markers of the genus Sorghum was performed. The PCO analysis results of the genetic matrix included domestic local species, foreign germplasm, commercially bred varieties, and forage germplasm. Detailed Implementation

[0102] The present invention will be further described in detail below with reference to the embodiments. Reagents or instruments used without a specified manufacturer are considered to be conventional products that can be purchased on the market.

[0103] (1) Extraction of sorghum germplasm DNA

[0104] Young leaves at the three-leaf stage of 276 sorghum germplasms were chopped and transferred to 2.0 mL centrifuge tubes. Three zirconia grinding beads and 500 μL of extraction buffer [2M NaCl, 20 mM EDTA, 100 mM Tris-HCl (pH = 8.0)] were added. The samples were ground at 80 Hz for 2 min, and then ground three times. CTAB lysis buffer [6% CTAB, 2M NaCl, 20 mM EDTA, 100 mM Tris-HCl (pH = 8.0)] was added. After thoroughly mixing with Tris-HCl (pH = 8.0), incubate at 65°C for 1 hour. Cool to room temperature, add 1 ml of chloroform, invert and mix. Centrifuge at 10000 rpm for 10 minutes at room temperature. Transfer 800 μL of the supernatant to a 1.5 ml centrifuge tube, add 1 ml of pre-chilled anhydrous ethanol, and incubate overnight at -20°C. Centrifuge at 12000 rpm for 10 minutes, discard the supernatant, wash the DNA precipitate three times with 75% ethanol, and once with anhydrous ethanol. Dry at room temperature, add an appropriate amount of TE solution or ddH2O, and after complete dissolution, determine and quantify the DNA concentration using a NanoDrop (Eppendorf) analyzer. Store at -20°C.

[0105] (2) Preparation of DNA from mixed pools of Sorghum germplasm

[0106] After taking an equal volume of single germplasm DNA with a stock solution concentration of 200 ng / μL, randomly mix 13 germplasm DNA samples into one centrifuge tube to obtain one mixed pool DNA sample. A total of 12 mixed pool DNA samples were obtained from 276 germplasms and stored at -20℃.

[0107] (3) Design of Indel markers for the Sorghum genome

[0108] The genome sequences of 13 published germplasms of the genus *Sorghum* (https: / / db.cngb.org / search / project / CNP0001440 / ) were compared with the reference genome sequence of the sorghum cultivar BT×623 (https: / / ftp.ensemblgenomes.ebi.ac.uk / pub / plants / release-55 / fasta / sorghum_bicolor / dna / ). Large-fragment homologous sequence alignment was performed using the software MUMmer (https: / / mummer.sourceforge.net / ) to screen for InDel sites with sequence differences ≥50 bp in the target region. InDel-labeled primers were designed using Primer Premier 6.0 software. Primer design conditions were as follows: PCR amplification product length 150-500 bp; denaturation temperature (Tm) between 54-63℃, with 60℃ being optimal; primer length 18-30 bp, with 20 bp being optimal. Polymorphism analysis of 500 markers covering 10 chromosomes of sorghum in 12 pooled DNA samples.

[0109] (4) Filtering of high-frequency Indel markers

[0110] PCR was performed on 12 mixed-sample DNA samples using synthesized primers. The PCR amplification reaction volume was 20 μL, containing 2.0 μL genomic DNA (20 ng / μL), 8.6 μL 2×Rapid Taq Master Mix (Novizan, P222-AA), 8.6 μL sterile water, 0.4 μL forward primer (10 μM), and 0.4 μL reverse primer (10 μM). The PCR amplification program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 sec, Tm annealing at 63℃ for 15 sec, decreasing by 0.5℃ to 54℃ per cycle, extension at 72℃ for 20 sec, 95℃ denaturation for 15 sec, Tm annealing at 54℃ for 15 sec, extension at 72℃ for 20 sec, for 30 cycles; final extension at 72℃ for 5 min, and storage at 4℃. The PCR products from the 12 mixed-sample DNA samples were mixed into a centrifuge tube. Weigh 4g of agarose (Toroivd) and add 100mL of 1×TAE electrophoresis buffer [12.2g Tris, 2.85mL glacial acetic acid, 10mL 0.25mol / L EDTA (pH 8.0)], heat to dissolve and prepare 100mL of 4.0% agarose gel. Add 3μL of nucleic acid dye (Warbio, M0754) and mix well; install the electrophoresis tank and sample comb, pour the gel, and after the gel cools and solidifies, pour 1×TAE electrophoresis buffer into the electrophoresis tank. Spot 6μL of the PCR mixture into the sample wells. Use an electrophoresis apparatus (Beijing Liuyi, DYY-6C type) with electrodes connected and perform electrophoresis at a constant voltage of 60V until the amplified DNA bands are fully expanded. PCR verification showed that there were 23 pairs of InDel primers with MAF>10%, and the primer sequences are shown in the sequence listing SEQ ID NO: 1-SEQ ID NO: 46.

[0111] (5) High-frequency Indel marker analysis of genetic diversity in Sorghum germplasm

[0112] The 23 high-frequency Indel markers selected above were used to perform PCR analysis on DNA from 276 germplasm accessions. Bands in the agarose gel electrophoresis results were read, with small fragments denoted as "11", large fragments as "22", deletions as "00", and heterozygotes as "12". The MAF value of each marker was calculated, as shown in Table 1. The genetic matrix of the above germplasm was analyzed using GenAlEx software, and PCO analysis was performed. Figure 4 As shown, germplasm resources from different sorghum genera are significantly segregated in PCO.

[0113] Table 1. MAF values ​​of Indel markers in 276 Sorghum germplasm resources.

[0114] WA01 27.5％ WA07 44.9％ WA13 32.2％ WA19 19.2％ WA02 35.8％ WA08 29.7％ WA14 37.3％ WA20 37.3％ WA03 25.0％ WA09 15.9％ WA15 49.2％ WA21 10.8％ WA04 48.9％ WA10 26.1％ WA16 21.0％ WA22 26.8％ WA05 19.2％ WA11 42.0％ WA17 38.7％ WA23 36.5％ WA06 36.9％ WA12 25.7％ WA18 27.5％

[0115] The scope of protection of this invention is not limited to the above embodiments. Variations and advantages that can be conceived by those skilled in the art without departing from the spirit and scope of the inventive concept are included in this invention and are protected by the appended claims.

Claims

1. A primer for sorghum InDel molecular markers, characterized in that, The sorghum InDel molecular marker has the following 23 sites corresponding to forward and reverse primers. WA01 locus: Chro.01 chromosome at 11.93 Mbp; Upstream primer F: CTCCGGGTTGTGGTAGCTTT, as shown in SEQ ID No: 1; Downstream primer R: CACTGCGGAGGATGACCATT, as shown in SEQ ID No: 2; WA02 locus: Chro.01 chromosome at 62.91 Mbp; Upstream primer F: CTGCTTCGTTTCGGAGGCTA, as shown in SEQ ID No: 3; Downstream primer R: CATCCTCCTGTGTTCCGTCC, as shown in SEQ ID No: 4; WA03 locus: 0.262 Mbp on chromosome 10.02; Upstream primer F: CGTGAGCGATCATCGGATCAACAA, as shown in SEQ ID No: 5; Downstream primer R: ACCTTGGCGTGCCGTGAGAT, as shown in SEQ ID No: 6; WA04 locus: Chro.02 chromosome at 55.545 Mbp; Upstream primer F: GGAACTGCGGAACGACCACA, as shown in SEQ ID No: 7; Downstream primer R: GTTGTAAGGTTACATCCTGCTTCTCC, as shown in SEQ ID No: 8; WA05 locus: 0.943 Mbp on chromosome ro.03; Upstream primer F: AGGATGAGGCGGATTCTTGG, as shown in SEQ ID No: 9; Downstream primer R: TCCATAGGCATTCATCGGTC, as shown in SEQ ID No: 10; WA06 locus: Chro.03 chromosome at 55.646 Mbp; Upstream primer F: CCTCAACTGTGAATTGGTGACGGATAT, as shown in SEQ ID No: 11; Downstream primer R: AACAGATATATACAAATCCAGGCTGCTACC, as shown in SEQ ID No: 12; WA07 locus: 0.212 Mbp on chromosome 0.04; Upstream primer F: GCTCAATCATGGGCTAACTAGACTCAA, as shown in SEQ ID No: 13; Downstream primer R: ATTTGCCTCTAATTTGCGAGACGAATC, as shown in SEQ ID No: 14; WA08 locus: Chro.04 chromosome at 63.669 Mbp; Upstream primer F: AGAATGAAGGTATGCGCTGTGT, as shown in SEQ ID No: 15; Downstream primer R: GAGGAGGAGAAGACGACGACAG, as shown in SEQ ID No: 16; WA09 locus: Chro.05 chromosome at 1.118 Mbp; Upstream primer F: AAGCATCTTGATTAAGGACGGAATGGA, as shown in SEQ ID No: 17; Downstream primer R: TACATGCCTTGACAACGAACCTAGC, as shown in SEQ ID No: 18; WA10 locus: Chro.05 chromosome at 12.853 Mbp; Upstream primer F: CATGATTGATTGACACGGCACATCTC, as shown in SEQ ID No: 19; Downstream primer R: GTTCCGCTTGCCATTCAGCATTATG, as shown in SEQ ID No: 20; WA11 locus: Chro.05 chromosome at 68.653 Mbp; Upstream primer F: TCCTCCCGAATTAGAAGACGAAACAAAG, as shown in SEQ ID No: 21; Downstream primer R: CAGTGAGATACCACATTGGAACTTGAGT, as shown in SEQ ID No: 22; WA12 locus: Chro.06 chromosome at 3.262 Mbp; Upstream primer F: TCCTGTCTATGTGGTTGAAGCCTATAAG, as shown in SEQ ID No: 23; Downstream primer R: AATGACTGAAAGGCAACACAGAGAAAC, as shown in SEQ ID No: 24; WA13 locus: Chro.06 chromosome at 40.431 Mbp; Upstream primer F: TAACAGGTTAGGGATCTCCACCCAATA, as shown in SEQ ID No: 25; Downstream primer R: GCGTAACTTCATAGCTCATGCCAATT, as shown in SEQ ID No: 26; WA14 locus: 0.074 Mbp on chromosome 0.07; Upstream primer F: GGTGATTGTGCAATGTGCATGATATAGAC, as shown in SEQ ID No: 27; Downstream primer R: ACCACCGCTACACTCGCCAAA, as shown in SEQ ID No: 28; WA15 locus: Chro.07 chromosome at 57.814 Mbp; Upstream primer F: GTGACACTTTAGCACTTTCGTTTGT, as shown in SEQ ID No: 29; Downstream primer R: CGGCAGAAGGAGATCACGATACT, as shown in SEQ ID No: 30; WA16 locus: Chro.07 chromosome at 63.740 Mbp; Upstream primer F: GCGTTCTGTAGCCTCGTGAGTC, as shown in SEQ ID No: 31; Downstream primer R: TCCCGTCACATCGAATCTTTAGACA, as shown in SEQ ID No: 32; WA17 locus: Chro.08 chromosome at 4.569 Mbp; Upstream primer F: ATCAATGGCTATGGCGGTGCTG, as shown in SEQ ID No: 33; Downstream primer R: GGACAACAACGGAATCGGTGGT, as shown in SEQ ID No: 34; WA18 locus: Chro.08 at 9.499 Mbp; Upstream primer F: GCATGGAATCTTAACTCTTAGCTTCTCAC, as shown in SEQ ID No: 35; Downstream primer R: CAATGGACTGGTTCTCGCTTCGT, as shown in SEQ ID No: 36; WA19 locus: Chro.08 chromosome at 58.972 Mbp; Upstream primer F: CCGAGACGCACAGAGAAACAGAAA, as shown in SEQ ID No: 37; Downstream primer R: ATGAAGAGGGAGATATTTGTTGGGCTTAG, as shown in SEQ ID No: 38; WA20 locus: Chro.09 chromosome at 4.075 Mbp; Upstream primer F: ACTCCACCACTTCTCCTCCTCC, as shown in SEQ ID No: 39; Downstream primer R: AGATCCACCACAGCTCAAACTCAAA, as shown in SEQ ID No: 40; WA21 locus: Chro.09 chromosome at 44.364 Mbp; Upstream primer F: TGAAGCATTGGTGGACAACTGATGG, as shown in SEQ ID No: 41; Downstream primer R: GAGGGCCTCTTTGGTTACTCATTACAT, as shown in SEQ ID No: 42; WA22 locus: Chro.10 chromosome at 1.86 Mbp; Upstream primer F: TAGAGAGGAGAGAGGAGGGACAGAGAG, as shown in SEQ ID No: 43; Downstream primer R: GGACGCATGAAAGACCTGGA, as shown in SEQ ID No: 44; WA23 locus: Chro.10 chromosome at 49.341 Mbp; Upstream primer F: CTGAAGAGATCTGTCACGAAGTTGCT, as shown in SEQ ID No: 45; Downstream primer R: ACACTGAATCCTGCATTCTGTCTAAGATAG, as shown in SEQ ID No:

46.

2. A reagent or kit containing the primers of claim 1.

3. The application of the primers of claim 1, and reagents or kits containing the primers of claim 1, in the study of genetic diversity in Sorghum germplasm.

4. The primers of claim 1, and the use of reagents or kits containing the primers of claim 1 in the following (C1)-(C4): (C1) Application in the construction of sorghum genetic linkage maps, (C2) Application in the identification of sorghum hybrids / purity; (C3) Application in the mapping of genes related to important agronomic traits in sorghum; (C4) Applications in molecular breeding or molecular-assisted selection breeding.

Images