Mannanase mutants

Abstract

The present application relates to the field of genetic engineering and protein modification technology, and particularly relates to a kind of mannanase mutant.The present application is based on wild-type mannanase M20, provides mutant with significantly improved specific activity, is conducive to reducing the production cost of mannanase, and promotes its wide application in the field of feed.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to an acid mannanase mutant with significantly improved specific activity. Background Technology

[0002] Mannan is the second most abundant hemicellulose resource on Earth after xylan, and it is widely found in higher plants. On the one hand, it is a hemicellulose substance frequently encountered in human life and production activities; on the other hand, the full and effective transformation and utilization of these natural resources can create new value. Among them, the enzymatic transformation of mannan and other hemicellulose resources is one of the current hot topics in the comprehensive research field of cellulosic materials. β-L,4-D-mannanase (EC 3.2.1.78) is a hemicellulase that can degrade plant polysaccharides such as glucomannan, galactomannan, and β-mannan into mannooligosaccharides. Together with cellulase and xylanase, it constitutes the most important enzyme system in the biotransformation of cellulosic materials.

[0003] β-Mannanases have been found in animals, plants, and microorganisms. Animal-derived β-mannanases are mainly found in the intestinal secretions of lower animals, such as marine mollusks; plant-derived β-mannanases are mainly found in the fruits and seeds of plants, such as the germinated seeds of legumes like carob and guar beans, and the germinated corms of konjac. However, microbially produced β-mannanases have advantages such as wide availability, high activity, short production cycle, convenient extraction, low cost, wide pH and temperature range of action, and no seasonal limitations, making them the main source for β-mannanase production and application. Reported β-mannanase-producing strains include fungi such as Aspergillus, Trichoderma, yeast, Polyporaceae, and Sclerotinia; bacteria such as Bacillus, Clostridium, and Vibrio; and actinomycetes such as Streptomyces.

[0004] In recent years, the research and development of β-mannanase has entered a new phase, with wide applications in food, feed, papermaking, textiles, oil extraction, and bioenergy. In the production of functional oligosaccharides, β-mannanase is used to hydrolyze mannan-rich plant gums to produce mannan oligosaccharides composed of different monosaccharide molecules (2-10). Although mannan oligosaccharides cannot be digested and absorbed in the gastrointestinal tract, they can promote the growth and reproduction of beneficial bacteria and inhibit the proliferation of harmful pathogens, thereby protecting the integrity of the intestinal mucosa and regulating the human immune response (lowering blood cholesterol and blood sugar levels, etc.). β-mannanase can effectively degrade water-soluble mannan, which is beneficial for the release of nutrients and reduces the viscosity of contents in the animal's gastrointestinal tract. Furthermore, the mannan oligosaccharides and small amounts of mannose produced by hydrolyzing mannan, although not digested and absorbed by animals, can improve the intestinal microecological environment and enhance the animal's immune response. β-Mannanase is mainly used in the paper industry for the biobleaching of cork pulp. Studies have found that the simultaneous application of β-mannanase and xylanase can significantly improve the bleachability of pulp while avoiding the environmental pollution caused by the addition of alkali in chemical bleaching.

[0005] The yield of mannanase produced by natural strains is low and cannot meet the needs of industrial production. Improving the enzyme activity and performance of existing β-mannanases is crucial for controlling production costs. Specific activity is an important indicator of enzyme properties, and mannanases with high specific activity have broader prospects in practical applications. Summary of the Invention

[0006] The purpose of this invention is to provide a mannanase mutant. The specific activity of the mutant is significantly increased compared to the wild type, which is beneficial for its widespread application in the feed industry.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0008] The present invention relates to a mannanase mutant comprising an amino acid sequence having at least 90% identity with SEQ ID NO:1, and comprising, compared with SEQ ID NO:1, an amino acid substitution at at least one position selected from the group consisting of: 81, 132, 148, 335.

[0009] In some embodiments of the present invention, the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity with SEQ ID NO:1.

[0010] In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity with SEQ ID NO:1.

[0011] In some embodiments of the present invention, the mutant comprises a substitution of at least one amino acid from the following group: S81T / P / R, Y132F, T148K, P335Q.

[0012] In some embodiments of the present invention, the mutant comprises substitutions or combinations of substitutions selected from the following combinations of substitutions:

[0013] S81T;

[0014] S81P;

[0015] S81R;

[0016] Y132F;

[0017] T148K;

[0018] P335Q;

[0019] S81T / Y132F;

[0020] S81T / T148K;

[0021] S81T / P335Q;

[0022] S81T / Y132F / T148K;

[0023] S81T / Y132F / P335Q;

[0024] S81T / T148K / P335Q;

[0025] S81T / Y132F / T148K / P335Q;

[0026] S81P / Y132F;

[0027] S81P / T148K;

[0028] S81P / P335Q;

[0029] S81P / Y132F / T148K;

[0030] S81P / Y132F / P335Q;

[0031] S81P / T148K / P335Q;

[0032] S81P / Y132F / T148K / P335Q;

[0033] S81R / Y132F;

[0034] S81R / T148K;

[0035] S81R / P335Q;

[0036] S81R / Y132F / T148K;

[0037] S81R / Y132F / P335Q;

[0038] S81R / T148K / P335Q;

[0039] S81R / Y132F / T148K / P335Q;

[0040] Y132F / T148K;

[0041] Y132F / P335Q;

[0042] T148K / P335Q;

[0043] Y132F / T148K / P335Q.

[0044] The present invention also relates to DNA molecules encoding the above-mentioned mannanase mutant.

[0045] The present invention also relates to recombinant expression plasmids comprising the above-described DNA molecules.

[0046] The present invention also relates to a host cell comprising the above-described recombinant expression plasmid.

[0047] When the above plasmids were transferred into host cells, the specific activity of the recombinant mannanase mutant was significantly improved.

[0048] In some embodiments of the present invention, the host cell is Pichia pastoris (Pichia pastoris). Pichia pastoris ).

[0049] In some embodiments of the present invention, the host cell is *Trichoderma reesei* (…). Trichoderma reesei ).

[0050] The present invention also provides the application of the above-mentioned mannanase mutant in the field of feed.

[0051] This invention provides mutants based on wild-type mannanase M20, containing at least one mutation site among S81T / P / R, Y132F, T148K, and P335Q. Compared with wild-type mannanase, the specific activity of the mutants provided by this invention is generally increased by 12.19-67.08%. Among them, the mannanase mutant M20-7 containing two-point mutations of Y132F / T148K has the highest specific activity, reaching 1033.88 U / mg, which is 67.08% higher than that of wild-type, achieving unexpected technical results.

[0052] In summary, the specific activity of the mannanase mutant provided by this invention is significantly improved, which helps to reduce the production cost of mannanase and promote its widespread application in the feed industry. Detailed Implementation

[0053] This invention discloses a mannanase mutant, its preparation method and application, the DNA molecule encoding the mannanase mutant, the vector, and the host cell. Those skilled in the art can refer to the content herein and appropriately modify the process parameters to achieve the desired result. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0054] This invention utilizes conventional techniques and methods used in the fields of genetic engineering and molecular biology, such as those described in *MOLECULAR CLONING: A LABORATORY MANUAL, 3rd Ed.* (Sambrook, 2001) and *CURRENTPROTOCOLS IN MOLECULAR BIOLOGY* (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can use other conventional methods, experimental protocols, and reagents based on the technical solutions described in this invention, without being limited to the specific embodiments of this invention. For example, the following experimental materials and reagents may be used in this invention:

[0055] Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, vector pPIC9k, Amp, and G418 were purchased from Invitrogen.

[0056] Enzymes and kits: PCR enzymes and ligases were purchased from Takara, restriction endonucleases from Fermentas, plasmid extraction kits and gel purification and recovery kits from Omega, and GeneMorph II random mutagenesis kits from Beijing Bomais Biotechnology Co., Ltd.

[0057] Culture medium formulation:

[0058] Escherichia coli culture medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0;

[0059] Yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose;

[0060] Yeast selection medium (MD medium): 2% peptone, 2% agarose;

[0061] BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4 × 10⁻⁶ -5 % Biotin, 1% Glycerin;

[0062] BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4 × 10⁻⁶ -5 % Biotin, 0.5% Methanol;

[0063] LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0;

[0064] LB-AMP plates: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0.

[0065] The present invention will be further illustrated below with reference to the embodiments:

[0066] Example 1 Cloning of the mannanase gene

[0067] Aspergillus niger ( Aspergillus niger The genome was used as a template for PCR amplification. The PCR primers M20-F1 and M20-R1 are as follows:

[0068] M20-F1: GCT GAATTC GGCCTCCAATTCACCATTGATGGCG (The underlined part is the EcoRI restriction enzyme recognition site).

[0069] M20-R1: CTG GCGGCCGC TTAGGCGCTATCAATAGCAG (The underlined part is the NotI restriction enzyme recognition site).

[0070] The PCR product was recovered via gel extraction, ligated into the pEASY-T vector, and transformed into *E. coli* DH5α. Correct transformants were selected for sequencing. Sequencing results showed that the nucleotide sequence of the amplified gene fragment was SEQ ID NO: 2, and its encoded amino acid sequence was SEQ ID NO: 1. NCBI BLAST comparison revealed that SEQ ID NO: 1 had 100% similarity to the mannanase sequence derived from *Aspergillus niger*, thus confirming that the gene obtained by PCR was the mannanase gene, named M20.

[0071] Example 2: Screening for high specific activity mannanase mutants

[0072] To improve the specific activity of mannanase M20, the applicant screened for a large number of mutations in the enzyme using directed evolution technology.

[0073] Using the M20 gene as a template, PCR amplification was performed using the primers M20-F1 and M20-R1 described in Example 1, and the GeneMorph II random mutation PCR kit (Beijing Bomais). The PCR product was recovered from the gel, digested with EcoRI and Not I, and then ligated into the pET21a vector digested with the same enzymes. The transformed product was then transferred to Escherichia coli BL21(DE3) and plated on LB+Amp plates. The plates were incubated upside down at 37°C. After the transformants appeared, they were picked one by one into a 96-well plate with a toothpick. 150 μL of LB+Amp medium containing 0.1 mM IPTG was added to each well. The plates were incubated at 37°C and 220 rpm for about 6 h. The supernatant was discarded by centrifugation, and the cells were resuspended in buffer. The cells were repeatedly frozen and thawed to break up the cell walls and obtain Escherichia coli cell lysate containing acid mannanase.

[0074] 30 μL of lysis buffer was transferred to two new 96-well plates. 30 μL of substrate was added to one well, and the mixture was incubated at 37°C for 30 min. The reducing sugar content was then determined using the DNS method. 150 μL of Coomassie Brilliant Blue solution was added to the other well, and the mixture was allowed to stand for 10 min. The protein content was then determined using the Coomassie Brilliant Blue (Bradford) binding assay. The enzyme activity and protein content of different mutants were calculated. Finally, the applicant screened from over 10,000 transformants for mutations that significantly increased the specific activity of the mannanase mutant M20: S81T, S81P, S81R, Y132F, T148K, and P335Q.

[0075] Based on wild-type mannanase M20, this invention provides mannanase mutants containing single mutation sites of S81T, S81P, S81R, Y132F, T148K, and P335Q, respectively.

[0076] The mannanase mutant containing the S81T single-point mutation was named M20-1, and its amino acid sequence is SEQ ID NO: 3;

[0077] The mannanase mutant containing the S81P single-point mutation was named M20-2, and its amino acid sequence is SEQ ID NO: 4;

[0078] The mannanase mutant containing the S81R single-point mutation was named M20-3, and its amino acid sequence is SEQ ID NO: 5;

[0079] The mannanase mutant containing the Y132F single-point mutation was named M20-4, and its amino acid sequence is SEQ ID NO: 6;

[0080] The mannanase mutant containing the T148K single-point mutation was named M20-5, and its amino acid sequence is SEQ ID NO: 7;

[0081] The mannanase mutant containing the P335Q single-point mutation was named M20-6, and its amino acid sequence is SEQ ID NO: 8.

[0082] The present invention also provides a mannanase mutant containing two-point mutations of Y132F / T148K, named M20-7, whose amino acid sequence is SEQ ID NO: 9.

[0083] The present invention also provides S81T / Y132F, S81T / T148K, S81T / P335Q, S81T / Y132F / T148K, S81T / Y132F / P335Q, S81T / T148K / P335Q, S81T / Y132F / T148K / P335Q, S81P / Y132F, S81P / T148K; S81P / P335Q, S81P / Y132F / T148K Mannanase mutants formed by any combination of mutation sites among S81P / Y132F / P335Q, S81P / T148K / P335Q, S81P / Y132F / T148K / P335Q, S81R / Y132F, S81R / T148K, S81R / P335Q, S81R / Y132F / T148K, S81R / Y132F / P335Q, S81R / T148K / P335Q, S81R / Y132F / T148K / P335Q, Y132F / P335Q, T148K / P335Q, and Y132F / T148K / P335Q.

[0084] Referring to the above amino acid sequences, the coding nucleotide sequences of the mutants were obtained respectively.

[0085] Example 3 Expression of mannanase in Pichia pastoris

[0086] 3.1 Construction of expression plasmids

[0087] Based on the codon preference of Pichia pastoris, the gene sequence of wild-type mannanase M20 and its mutants was optimized. The gene was synthesized by Shanghai Jereh Biotechnology Co., Ltd., and EcoRI and NotI restriction sites were added at the 5' and 3' ends of the synthesized sequence, respectively.

[0088] Following the method in Example 1, the gene sequence of the synthesized mutant was double-digested with EcoRI and NotI, then ligated with the pPIC9k vector digested with the same enzymes overnight at 16°C, and transformed into E. coli DH5α. The transformed samples were plated on LB+Amp plates and incubated upside down at 37°C. After the transformants appeared, the positive clones were verified by colony PCR, and the correct recombinant mutant expression plasmid was obtained after sequencing verification.

[0089] 3.2 Construction of Pichia pastoris engineered strains

[0090] 3.2.1 Preparation of competent yeast cells

[0091] Pichia pastoris strain GS115 was activated on YPD plates and cultured at 30℃ for 48 h. Activated GS115 single clones were then inoculated into 6 mL of YPD liquid medium and cultured at 30℃ and 220 rpm for approximately 12 h. The culture was then transferred to Erlenmeyer flasks containing 30 mL of YPD liquid medium and cultured at 30℃ and 220 rpm for approximately 5 h. Cell density was measured using a UV spectrophotometer. Once the OD600 value was within the range of 1.1–1.3, the cells were centrifuged at 4℃ and 9000 rpm for 2 min. 4 mL of cells were collected into sterile EP tubes, the supernatant was gently discarded, and the remaining supernatant was blotted dry with sterile filter paper. The cells were resuspended in 1 mL of pre-cooled sterile water, centrifuged at 4℃ and 9000 rpm for 2 min, and the supernatant was gently discarded. The cells were washed once more with 1 mL of sterile water, centrifuged at 4℃ and 9000 rpm for 2 min, and the supernatant was gently discarded. 1 mL of pre-cooled sorbitol (1... Resuspend the bacterial cells in sorbitol (1 mol / L); centrifuge at 4℃ and 9000 rpm for 2 min, gently discard the supernatant, and gently resuspend the bacterial cells in 100-150 μL of pre-cooled sorbitol (1 mol / L).

[0092] 3.2.2 Conversion and Screening

[0093] The expression plasmids obtained in Example 1 and Example 3.1 were linearized with Sac I. After purification and recovery of the linearized fragments, they were transformed into Pichia pastoris GS115 by electroporation. Recombinant Pichia pastoris strains were screened on MD plates, and multi-copy transformants were then screened on YPD plates (0.5 mg / mL-8 mg / mL) containing different concentrations of genimycin.

[0094] The obtained transformants were transferred to BMGY medium and cultured at 30℃ and 250 rpm for 1 day with shaking. They were then transferred to BMMY medium and cultured at 30℃ and 250 rpm with shaking. 0.5% methanol was added daily to induce expression for 4 days. The cells were removed by centrifugation at 9000 rpm for 10 min to obtain fermentation supernatants containing wild-type mannanase M20 and its mutant, respectively.

[0095] 3.3 Mannanase Activity Detection Method

[0096] (1) Definition of mannanase enzyme activity unit

[0097] Under conditions of 37°C and pH 5.5, the amount of enzyme required to degrade and release 1 μmol of reducing sugar per minute from a mannan solution with a concentration of 3 mg / mL is defined as one enzyme activity unit (U).

[0098] (2) Enzyme activity assay method

[0099] (2.1) Plotting the standard curve:

[0100] Pipette 4.0 mL of acetate-sodium acetate buffer solution, add 5.0 mL of DNS reagent, and heat in a boiling water bath for 5 min. Cool to room temperature with tap water, and dilute to 25.0 mL with water to prepare a standard blank sample.

[0101] Take 1.00, 2.00, 3.00, 4.00, 5.00, 6.00 and 7.00 mL of mannose solution (5.5) respectively, and dilute to 100 mL with acetate-sodium acetate buffer solution to prepare D-mannose standard solutions with a concentration of 0.10-0.70 mg / mL.

[0102] Pipette 2.00 mL of each of the above concentration series of mannose standard solutions (make two replicates) into separate graduated test tubes, then add 2 mL of acetate-sodium acetate buffer solution and 5 mL of DNS reagent to each. Incubate with electromagnetic oscillation for 3 seconds, then heat in a boiling water bath for 5 minutes. Cool to room temperature with tap water, then dilute to 25 mL with water. Zero the tube using a standard blank as a control, and measure the absorbance (OD) value at 540 nm.

[0103] A standard curve was plotted with mannose concentration on the Y-axis and absorbance (OD) value on the X-axis. The standard curve needs to be re-plotted each time a new DNS reagent is prepared.

[0104] (2.2) Enzyme activity assay:

[0105] Take 10.0 ml of mannan solution and equilibrate at 37°C for 10 min.

[0106] Take 10.0 ml of appropriately diluted enzyme solution and equilibrate at 37°C for 10 min.

[0107] Pipette 2.00 mL of appropriately diluted enzyme solution (equilibrated at 37°C) into a graduated test tube, add 5 mL of DNS reagent, and vortex for 3 seconds. Then add 2.0 mL of mannan solution, incubate at 37°C for 30 minutes, and heat in a boiling water bath for 5 minutes. Cool to room temperature with tap water, and dilute to 25 mL with water, vortexing for 3 seconds. Using a standard blank sample as a blank control, measure the absorbance at 540 nm. A B .

[0108] Pipette 2.0 mL of appropriately diluted enzyme solution (equilibrated at 37°C) into a graduated test tube, then add 2.0 mL of mannan solution (equilibrated at 37°C). Vibrate electromagnetically for 3 seconds, then incubate at 37°C for 30 minutes. Add 5.0 mL of DNS reagent, vibrate electromagnetically for 3 seconds to initiate the enzymatic hydrolysis reaction. Heat in a boiling water bath for 5 minutes, cool to room temperature with tap water, and dilute to 25 mL with water. Vibrate electromagnetically for 3 seconds. Using a standard blank sample as a control, measure the absorbance at 540 nm. A E .

[0109] Enzyme activity calculation formula:

[0110] X D =

[0111] In the formula: X D To dilute the mannanase activity in the enzyme solution, U / mL; A E The absorbance of the enzyme reaction solution; A B λ is the absorbance of the enzyme blank solution; K is the slope of the standard curve; C0 is the intercept of the standard curve; M is the molar mass of xylose, 180.2 g / mol; t is the enzymatic reaction time, min; N is the enzyme dilution factor; 1000 is the conversion factor, 1 mmol = 1000 μmol.

[0112] (3) Results of enzyme activity assay

[0113] Enzyme activity was detected using the above method, and the results showed that the enzyme activity of the fermentation supernatant of the recombinant Pichia pastoris strain expressing mannanase M20 and its mutant was 250-530 U / mL.

[0114] 3.4 Methods for determining protein content

[0115] (1) Measurement method

[0116] The Coomassie Brilliant Blue (Bradford) binding method for protein determination is a combined colorimetric and dye-based method. Coomassie Brilliant Blue G-250 is brownish-red in acidic solution, turning blue upon binding with protein. Within a certain protein concentration range, it follows Beer's Law and can be measured colorimetrically at 595 nm. It exhibits significant absorption within 3–5 minutes and remains stable for at least 1 hour. In the range of 10–1000 μg / mL, the absorbance is directly proportional to the protein concentration.

[0117] The enzyme solution and Coomassie Brilliant Blue solution were mixed at a volume ratio of 1:5, allowed to stand for 10 minutes, and then the protein content was determined using the Coomassie Brilliant Blue (Bradford) binding method.

[0118] (2) Protein content determination results

[0119] The protein content was determined using the method described above. The results showed that the protein content of the fermentation supernatant of the recombinant Pichia pastoris strain expressing mannanase M20 and its mutants was 0.37-0.51 mg / mL.

[0120] 3.5 Specific vitality calculation

[0121] "Specific Activity" refers to the number of enzyme activity units per unit weight of protein, usually expressed as U / mg protein.

[0122] Specific activity calculation formula: Specific activity (U / mg) = enzyme activity (U / mL) / protein content (mg / mL).

[0123] The specific calculation results are shown in Table 1.

[0124] Table 1 Comparison of specific activities of mannanase mutants

[0125] Mannanase and its mutants mutation site Specific activity (U / mg) Wild type M20 - 618.78 M20-1 S81T 694.23 M20-2 S81P 704.23 M20-3 S81R 727.31 M20-4 Y132F 819.89 M20-5 T148K 728.00 M20-6 P335Q 766.53 M20-7 Y132F / T148K 1033.88

[0126] As can be seen from the results in Table 1, compared with wild-type mannanase M20, the specific activity of the mannanase mutants provided by this invention is generally increased by 12.19-67.08%. Among them, the mannanase mutant containing two point mutations, Y132F and T148K, has the highest specific activity, reaching 1033.88 U / mg, which is 67.08% higher than that of wild-type mannanase M20, achieving unexpected technical results.

[0127] The high-specific-activity mannanase mutant provided by this invention can also be used in Trichoderma reesei ( Trichoderma reesei Efficient expression in the host.

[0128] The high specific activity mannanase mutant provided by this invention can be widely used in the feed industry. sequence list <110> Qingdao Blue Ocean Biotechnology Group Co., Ltd. <120> Mannanase mutant <160> 9 <170> SIPOSequenceListing 1.0 <210> 1 <211> 362 <212> PRT <213> Aspergillus niger <400> 1 Leu Pro Lys Ala Ser Pro Ala Pro Ser Thr Ser Ser Ser Ala Ala Ser 1 5 10 15 Thr Ser Phe Ala Ser Thr Ser Gly Leu Gln Phe Thr Ile Asp Gly Glu 20 25 30 Thr Gly Tyr Phe Ala Gly Thr Asn Ser Tyr Trp Ile Gly Phe Leu Thr 35 40 45 Asp Asn Ala Asp Val Asp Leu Val Met Gly His Leu Lys Ser Ser Gly 50 55 60 Leu Lys Ile Leu Arg Val Trp Gly Phe Asn Asp Val Thr Ser Gln Pro 65 70 75 80 Ser Ser Gly Thr Val Trp Tyr Gln Leu His Gln Asp Gly Lys Ser Thr 85 90 95 Ile Asn Thr Gly Ala Asp Gly Leu Gln Arg Leu Asp Tyr Val Val Ser 100 105 110 Ser Ala Glu Gln His Asp Ile Lys Leu Ile Ile Asn Phe Val Asn Tyr 115 120 125 Trp Thr Asp Tyr Gly Gly Met Ser Ala Tyr Val Ser Ala Tyr Gly Gly 130 135 140 Ser Gly Glu Thr Asp Phe Tyr Thr Ser Asp Thr Met Gln Ser Ala Tyr 145 150 155 160 Gln Thr Tyr Ile Lys Thr Val Val Glu Arg Tyr Ser Asn Ser Ser Ala 165 170 175 Val Phe Ala Trp Glu Leu Ala Asn Glu Pro Arg Cys Pro Ser Cys Asp 180 185 190 Thr Ser Val Leu Tyr Asn Trp Ile Glu Lys Thr Ser Lys Phe Ile Lys 195 200 205 Gly Leu Asp Ala Asp Arg Met Val Cys Ile Gly Asp Glu Gly Phe Gly 210 215 220 Leu Asn Ile Asp Ser Asp Gly Ser Tyr Pro Tyr Gln Phe Ser Glu Gly 225 230 235 240 Leu Asn Phe Thr Met Asn Leu Gly Ile Asp Thr Ile Asp Phe Gly Thr 245 250 255 Leu His Leu Tyr Pro Asp Ser Trp Gly Thr Ser Asp Asp Trp Gly Asn 260 265 270 Gly Trp Ile Thr Ala His Gly Ala Ala Cys Lys Ala Ala Gly Lys Pro 275 280 285 Cys Leu Leu Glu Glu Tyr Gly Val Thr Ser Asn His Cys Ser Val Glu 290 295 300 Gly Ser Trp Gln Lys Thr Ala Leu Ser Thr Thr Gly Val Gly Ala Asp 305 310 315 320 Leu Phe Trp Gln Tyr Gly Asp Asp Leu Ser Thr Gly Lys Ser Pro Asp 325 330 335 Asp Gly Asn Thr Ile Tyr Tyr Gly Thr Ser Asp Tyr Gln Cys Leu Val 340 345 350 Thr Asp His Val Ala Ala Ile Asp Ser Ala 355 360 <210> 2 <211> 1089 <212> DNA <213> Aspergillus niger <400> 2 ctgccgaaag cctcccctgc accgagcacc agcagcagtg ctgcctccac ctccttcgcc 60 agcacctccg gcctccaatt caccattgat ggcgaaactg gctacttcgc cggaacgaac 120 agctactgga tcggtttcct cactgacaac gcggacgtcg acctcgtcat gggccacctg 180 aagtcgtccg gcctcaagat cctccgcgtg tggggcttca acgatgtcac ctcgcagccc 240 tcctccggca cagtctggta ccaactgcac caggacggca aatcgacaat caacacgggt 300 gccgacggtc tccagcgcct cgactacgtc gtctcgtctg ccgaacagca cgacatcaaa 360 ctcatcatca acttcgtcaa ctactggacc gattacggtg gtatgtctgc gtacgtgagc 420 gcgtatggcg gatccggcga gacggatttc tataccagtg ataccatgca gagtgcctat 480 cagacatata tcaagacggt cgtggagcgg tacagtaact cctcggcggt gtttgcgtgg 540 gagttggcga atgagccgag atgtccgagt tgcgatactt ctgtgttgta taactggatt 600 gagaagacga gtaagtttat taaggggttg gatgcggatc gtatggtttg tattggtgat 660 gagggcttcg gtctcaacat cgactcggac ggcagctacc cttatcaatt ctccgagggc 720 ttgaacttta cgatgaacct cggtatcgat actattgact ttggtaccct ccacttgtac 780 cctgatagct ggggcacctc cgacgactgg ggcaacggct ggatcaccgc ccacggcgca 840 gcctgcaaag cggccggcaa gccatgtctc ctggaggaat acggagtcac ctcgaaccac 900 tgcagtgtgg agggctcgtg gcagaagaca gcgctcagca caacgggcgt cggcgcggat 960 ctgttctggc agtatggtga tgatttgagt accgggaagt cgccggatga tgggaatact 1020 atctactatg ggactagtga ttatcagtgc ctggtgacgg atcatgttgc tgctattgat 1080 agcgcctaa 1089 <210> 3 <211> 362 <212> PRT <213> Artificial Sequence <400> 3 Leu Pro Lys Ala Ser Pro Ala Pro Ser Thr Ser Ser Ser Ala Ala Ser 1 5 10 15 Thr Ser Phe Ala Ser Thr Ser Gly Leu Gln Phe Thr Ile Asp Gly Glu 20 25 30 Thr Gly Tyr Phe Ala Gly Thr Asn Ser Tyr Trp Ile Gly Phe Leu Thr 35 40 45 Asp Asn Ala Asp Val Asp Leu Val Met Gly His Leu Lys Ser Ser Gly 50 55 60 Leu Lys Ile Leu Arg Val Trp Gly Phe Asn Asp Val Thr Ser Gln Pro 65 70 75 80 Thr Ser Gly Thr Val Trp Tyr Gln Leu His Gln Asp Gly Lys Ser Thr 85 90 95 Ile Asn Thr Gly Ala Asp Gly Leu Gln Arg Leu Asp Tyr Val Val Ser 100 105 110 Ser Ala Glu Gln His Asp Ile Lys Leu Ile Ile Asn Phe Val Asn Tyr 115 120 125 Trp Thr Asp Tyr Gly Gly Met Ser Ala Tyr Val Ser Ala Tyr Gly Gly 130 135 140 Ser Gly Glu Thr Asp Phe Tyr Thr Ser Asp Thr Met Gln Ser Ala Tyr 145 150 155 160 Gln Thr Tyr Ile Lys Thr Val Val Glu Arg Tyr Ser Asn Ser Ser Ala 165 170 175 Val Phe Ala Trp Glu Leu Ala Asn Glu Pro Arg Cys Pro Ser Cys Asp 180 185 190 Thr Ser Val Leu Tyr Asn Trp Ile Glu Lys Thr Ser Lys Phe Ile Lys 195 200 205 Gly Leu Asp Ala Asp Arg Met Val Cys Ile Gly Asp Glu Gly Phe Gly 210 215 220 Leu Asn Ile Asp Ser Asp Gly Ser Tyr Pro Tyr Gln Phe Ser Glu Gly 225 230 235 240 Leu Asn Phe Thr Met Asn Leu Gly Ile Asp Thr Ile Asp Phe Gly Thr 245 250 255 Leu His Leu Tyr Pro Asp Ser Trp Gly Thr Ser Asp Asp Trp Gly Asn 260 265 270 Gly Trp Ile Thr Ala His Gly Ala Ala Cys Lys Ala Ala Gly Lys Pro 275 280 285 Cys Leu Leu Glu Glu Tyr Gly Val Thr Ser Asn His Cys Ser Val Glu 290 295 300 Gly Ser Trp Gln Lys Thr Ala Leu Ser Thr Thr Gly Val Gly Ala Asp 305 310 315 320 Leu Phe Trp Gln Tyr Gly Asp Asp Leu Ser Thr Gly Lys Ser Pro Asp 325 330 335 Asp Gly Asn Thr Ile Tyr Tyr Gly Thr Ser Asp Tyr Gln Cys Leu Val 340 345 350 Thr Asp His Val Ala Ala Ile Asp Ser Ala 355 360 <210> 4 <211> 362 <212> PRT <213> Artificial Sequence <400> 4 Leu Pro Lys Ala Ser Pro Ala Pro Ser Thr Ser Ser Ser Ala Ala Ser 1 5 10 15 Thr Ser Phe Ala Ser Thr Ser Gly Leu Gln Phe Thr Ile Asp Gly Glu 20 25 30 Thr Gly Tyr Phe Ala Gly Thr Asn Ser Tyr Trp Ile Gly Phe Leu Thr 35 40 45 Asp Asn Ala Asp Val Asp Leu Val Met Gly His Leu Lys Ser Ser Gly 50 55 60 Leu Lys Ile Leu Arg Val Trp Gly Phe Asn Asp Val Thr Ser Gln Pro 65 70 75 80 Pro Ser Gly Thr Val Trp Tyr Gln Leu His Gln Asp Gly Lys Ser Thr 85 90 95 Ile Asn Thr Gly Ala Asp Gly Leu Gln Arg Leu Asp Tyr Val Val Ser 100 105 110 Ser Ala Glu Gln His Asp Ile Lys Leu Ile Ile Asn Phe Val Asn Tyr 115 120 125 Trp Thr Asp Tyr Gly Gly Met Ser Ala Tyr Val Ser Ala Tyr Gly Gly 130 135 140 Ser Gly Glu Thr Asp Phe Tyr Thr Ser Asp Thr Met Gln Ser Ala Tyr 145 150 155 160 Gln Thr Tyr Ile Lys Thr Val Val Glu Arg Tyr Ser Asn Ser Ser Ala 165 170 175 Val Phe Ala Trp Glu Leu Ala Asn Glu Pro Arg Cys Pro Ser Cys Asp 180 185 190 Thr Ser Val Leu Tyr Asn Trp Ile Glu Lys Thr Ser Lys Phe Ile Lys 195 200 205 Gly Leu Asp Ala Asp Arg Met Val Cys Ile Gly Asp Glu Gly Phe Gly 210 215 220 Leu Asn Ile Asp Ser Asp Gly Ser Tyr Pro Tyr Gln Phe Ser Glu Gly 225 230 235 240 Leu Asn Phe Thr Met Asn Leu Gly Ile Asp Thr Ile Asp Phe Gly Thr 245 250 255 Leu His Leu Tyr Pro Asp Ser Trp Gly Thr Ser Asp Asp Trp Gly Asn 260 265 270 Gly Trp Ile Thr Ala His Gly Ala Ala Cys Lys Ala Ala Gly Lys Pro 275 280 285 Cys Leu Leu Glu Glu Tyr Gly Val Thr Ser Asn His Cys Ser Val Glu 290 295 300 Gly Ser Trp Gln Lys Thr Ala Leu Ser Thr Thr Gly Val Gly Ala Asp 305 310 315 320 Leu Phe Trp Gln Tyr Gly Asp Asp Leu Ser Thr Gly Lys Ser Pro Asp 325 330 335 Asp Gly Asn Thr Ile Tyr Tyr Gly Thr Ser Asp Tyr Gln Cys Leu Val 340 345 350 Thr Asp His Val Ala Ala Ile Asp Ser Ala 355 360 <210> 5 <211> 362 <212> PRT <213> Artificial Sequence <400> 5 Leu Pro Lys Ala Ser Pro Ala Pro Ser Thr Ser Ser Ser Ala Ala Ser 1 5 10 15 Thr Ser Phe Ala Ser Thr Ser Gly Leu Gln Phe Thr Ile Asp Gly Glu 20 25 30 Thr Gly Tyr Phe Ala Gly Thr Asn Ser Tyr Trp Ile Gly Phe Leu Thr 35 40 45 Asp Asn Ala Asp Val Asp Leu Val Met Gly His Leu Lys Ser Ser Gly 50 55 60 Leu Lys Ile Leu Arg Val Trp Gly Phe Asn Asp Val Thr Ser Gln Pro 65 70 75 80 Arg Ser Gly Thr Val Trp Tyr Gln Leu His Gln Asp Gly Lys Ser Thr 85 90 95 Ile Asn Thr Gly Ala Asp Gly Leu Gln Arg Leu Asp Tyr Val Val Ser 100 105 110 Ser Ala Glu Gln His Asp Ile Lys Leu Ile Ile Asn Phe Val Asn Tyr 115 120 125 Trp Thr Asp Tyr Gly Gly Met Ser Ala Tyr Val Ser Ala Tyr Gly Gly 130 135 140 Ser Gly Glu Thr Asp Phe Tyr Thr Ser Asp Thr Met Gln Ser Ala Tyr 145 150 155 160 Gln Thr Tyr Ile Lys Thr Val Val Glu Arg Tyr Ser Asn Ser Ser Ala 165 170 175 Val Phe Ala Trp Glu Leu Ala Asn Glu Pro Arg Cys Pro Ser Cys Asp 180 185 190 Thr Ser Val Leu Tyr Asn Trp Ile Glu Lys Thr Ser Lys Phe Ile Lys 195 200 205 Gly Leu Asp Ala Asp Arg Met Val Cys Ile Gly Asp Glu Gly Phe Gly 210 215 220 Leu Asn Ile Asp Ser Asp Gly Ser Tyr Pro Tyr Gln Phe Ser Glu Gly 225 230 235 240 Leu Asn Phe Thr Met Asn Leu Gly Ile Asp Thr Ile Asp Phe Gly Thr 245 250 255 Leu His Leu Tyr Pro Asp Ser Trp Gly Thr Ser Asp Asp Trp Gly Asn 260 265 270 Gly Trp Ile Thr Ala His Gly Ala Ala Cys Lys Ala Ala Gly Lys Pro 275 280 285 Cys Leu Leu Glu Glu Tyr Gly Val Thr Ser Asn His Cys Ser Val Glu 290 295 300 Gly Ser Trp Gln Lys Thr Ala Leu Ser Thr Thr Gly Val Gly Ala Asp 305 310 315 320 Leu Phe Trp Gln Tyr Gly Asp Asp Leu Ser Thr Gly Lys Ser Pro Asp 325 330 335 Asp Gly Asn Thr Ile Tyr Tyr Gly Thr Ser Asp Tyr Gln Cys Leu Val 340 345 350 Thr Asp His Val Ala Ala Ile Asp Ser Ala 355 360 <210> 6 <211> 362 <212> PRT <213> Artificial Sequence <400> 6 Leu Pro Lys Ala Ser Pro Ala Pro Ser Thr Ser Ser Ser Ala Ala Ser 1 5 10 15 Thr Ser Phe Ala Ser Thr Ser Gly Leu Gln Phe Thr Ile Asp Gly Glu 20 25 30 Thr Gly Tyr Phe Ala Gly Thr Asn Ser Tyr Trp Ile Gly Phe Leu Thr 35 40 45 Asp Asn Ala Asp Val Asp Leu Val Met Gly His Leu Lys Ser Ser Gly 50 55 60 Leu Lys Ile Leu Arg Val Trp Gly Phe Asn Asp Val Thr Ser Gln Pro 65 70 75 80 Ser Ser Gly Thr Val Trp Tyr Gln Leu His Gln Asp Gly Lys Ser Thr 85 90 95 Ile Asn Thr Gly Ala Asp Gly Leu Gln Arg Leu Asp Tyr Val Val Ser 100 105 110 Ser Ala Glu Gln His Asp Ile Lys Leu Ile Ile Asn Phe Val Asn Tyr 115 120 125 Trp Thr Asp Phe Gly Gly Met Ser Ala Tyr Val Ser Ala Tyr Gly Gly 130 135 140 Ser Gly Glu Thr Asp Phe Tyr Thr Ser Asp Thr Met Gln Ser Ala Tyr 145 150 155 160 Gln Thr Tyr Ile Lys Thr Val Val Glu Arg Tyr Ser Asn Ser Ser Ala 165 170 175 Val Phe Ala Trp Glu Leu Ala Asn Glu Pro Arg Cys Pro Ser Cys Asp 180 185 190 Thr Ser Val Leu Tyr Asn Trp Ile Glu Lys Thr Ser Lys Phe Ile Lys 195 200 205 Gly Leu Asp Ala Asp Arg Met Val Cys Ile Gly Asp Glu Gly Phe Gly 210 215 220 Leu Asn Ile Asp Ser Asp Gly Ser Tyr Pro Tyr Gln Phe Ser Glu Gly 225 230 235 240 Leu Asn Phe Thr Met Asn Leu Gly Ile Asp Thr Ile Asp Phe Gly Thr 245 250 255 Leu His Leu Tyr Pro Asp Ser Trp Gly Thr Ser Asp Asp Trp Gly Asn 260 265 270 Gly Trp Ile Thr Ala His Gly Ala Ala Cys Lys Ala Ala Gly Lys Pro 275 280 285 Cys Leu Leu Glu Glu Tyr Gly Val Thr Ser Asn His Cys Ser Val Glu 290 295 300 Gly Ser Trp Gln Lys Thr Ala Leu Ser Thr Thr Gly Val Gly Ala Asp 305 310 315 320 Leu Phe Trp Gln Tyr Gly Asp Asp Leu Ser Thr Gly Lys Ser Pro Asp 325 330 335 Asp Gly Asn Thr Ile Tyr Tyr Gly Thr Ser Asp Tyr Gln Cys Leu Val 340 345 350 Thr Asp His Val Ala Ala Ile Asp Ser Ala 355 360 <210> 7 <211> 362 <212> PRT Artificial Sequence <400> 7 Leu Pro Lys Ala Ser Pro Ala Pro Ser Thr Ser Ser Ser Ala Ala Ser 1 5 10 15 Thr Ser Phe Ala Ser Thr Ser Gly Leu Gln Phe Thr Ile Asp Gly Glu 20 25 30 Thr Gly Tyr Phe Ala Gly Thr Asn Ser Tyr Trp Ile Gly Phe Leu Thr 35 40 45 Asp Asn Ala Asp Val Asp Leu Val Met Gly His Leu Lys Ser Ser Gly 50 55 60 Leu Lys Ile Leu Arg Val Trp Gly Phe Asn Asp Val Thr Ser Gln Pro 65 70 75 80 Ser Ser Gly Thr Val Trp Tyr Gln Leu His Gln Asp Gly Lys Ser Thr 85 90 95 Ile Asn Thr Gly Ala Asp Gly Leu Gln Arg Leu Asp Tyr Val Val Ser 100 105 110 Ser Ala Glu Gln His Asp Ile Lys Leu Ile Ile Asn Phe Val Asn Tyr 115 120 125 Trp Thr Asp Tyr Gly Gly Met Ser Ala Tyr Val Ser Ala Tyr Gly Gly 130 135 140 Ser Gly Glu Lys Asp Phe Tyr Thr Ser Asp Thr Met Gln Ser Ala Tyr 145 150 155 160 Gln Thr Tyr Ile Lys Thr Val Val Glu Arg Tyr Ser Asn Ser Ser Ala 165 170 175 Val Phe Ala Trp Glu Leu Ala Asn Glu Pro Arg Cys Pro Ser Cys Asp 180 185 190 Thr Ser Val Leu Tyr Asn Trp Ile Glu Lys Thr Ser Lys Phe Ile Lys 195 200 205 Gly Leu Asp Ala Asp Arg Met Val Cys Ile Gly Asp Glu Gly Phe Gly 210 215 220 Leu Asn Ile Asp Ser Asp Gly Ser Tyr Pro Tyr Gln Phe Ser Glu Gly 225 230 235 240 Leu Asn Phe Thr Met Asn Leu Gly Ile Asp Thr Ile Asp Phe Gly Thr 245 250 255 Leu His Leu Tyr Pro Asp Ser Trp Gly Thr Ser Asp Asp Trp Gly Asn 260 265 270 Gly Trp Ile Thr Ala His Gly Ala Ala Cys Lys Ala Ala Gly Lys Pro 275 280 285 Cys Leu Leu Glu Glu Tyr Gly Val Thr Ser Asn His Cys Ser Val Glu 290 295 300 Gly Ser Trp Gln Lys Thr Ala Leu Ser Thr Thr Gly Val Gly Ala Asp 305 310 315 320 Leu Phe Trp Gln Tyr Gly Asp Asp Leu Ser Thr Gly Lys Ser Pro Asp 325 330 335 Asp Gly Asn Thr Ile Tyr Tyr Gly Thr Ser Asp Tyr Gln Cys Leu Val 340 345 350 Thr Asp His Val Ala Ala Ile Asp Ser Ala 355 360 <210> 8 <211> 362 <212> PRT <213> Artificial Sequence <400> 8 Leu Pro Lys Ala Ser Pro Ala Pro Ser Thr Ser Ser Ser Ala Ala Ser 1 5 10 15 Thr Ser Phe Ala Ser Thr Ser Gly Leu Gln Phe Thr Ile Asp Gly Glu 20 25 30 Thr Gly Tyr Phe Ala Gly Thr Asn Ser Tyr Trp Ile Gly Phe Leu Thr 35 40 45 Asp Asn Ala Asp Val Asp Leu Val Met Gly His Leu Lys Ser Ser Gly 50 55 60 Leu Lys Ile Leu Arg Val Trp Gly Phe Asn Asp Val Thr Ser Gln Pro 65 70 75 80 Ser Ser Gly Thr Val Trp Tyr Gln Leu His Gln Asp Gly Lys Ser Thr 85 90 95 Ile Asn Thr Gly Ala Asp Gly Leu Gln Arg Leu Asp Tyr Val Val Ser 100 105 110 Ser Ala Glu Gln His Asp Ile Lys Leu Ile Ile Asn Phe Val Asn Tyr 115 120 125 Trp Thr Asp Tyr Gly Gly Met Ser Ala Tyr Val Ser Ala Tyr Gly Gly 130 135 140 Ser Gly Glu Thr Asp Phe Tyr Thr Ser Asp Thr Met Gln Ser Ala Tyr 145 150 155 160 Gln Thr Tyr Ile Lys Thr Val Val Glu Arg Tyr Ser Asn Ser Ser Ala 165 170 175 Val Phe Ala Trp Glu Leu Ala Asn Glu Pro Arg Cys Pro Ser Cys Asp 180 185 190 Thr Ser Val Leu Tyr Asn Trp Ile Glu Lys Thr Ser Lys Phe Ile Lys 195 200 205 Gly Leu Asp Ala Asp Arg Met Val Cys Ile Gly Asp Glu Gly Phe Gly 210 215 220 Leu Asn Ile Asp Ser Asp Gly Ser Tyr Pro Tyr Gln Phe Ser Glu Gly 225 230 235 240 Leu Asn Phe Thr Met Asn Leu Gly Ile Asp Thr Ile Asp Phe Gly Thr 245 250 255 Leu His Leu Tyr Pro Asp Ser Trp Gly Thr Ser Asp Asp Trp Gly Asn 260 265 270 Gly Trp Ile Thr Ala His Gly Ala Ala Cys Lys Ala Ala Gly Lys Pro 275 280 285 Cys Leu Leu Glu Glu Tyr Gly Val Thr Ser Asn His Cys Ser Val Glu 290 295 300 Gly Ser Trp Gln Lys Thr Ala Leu Ser Thr Thr Gly Val Gly Ala Asp 305 310 315 320 Leu Phe Trp Gln Tyr Gly Asp Asp Leu Ser Thr Gly Lys Ser Gln Asp 325 330 335 Asp Gly Asn Thr Ile Tyr Tyr Gly Thr Ser Asp Tyr Gln Cys Leu Val 340 345 350 Thr Asp His Val Ala Ala Ile Asp Ser Ala 355 360 <210> 9 <211> 362 <212> PRT <213> Artificial Sequence <400> 9 Leu Pro Lys Ala Ser Pro Ala Pro Ser Thr Ser Ser Ser Ala Ala Ser 1 5 10 15 Thr Ser Phe Ala Ser Thr Ser Gly Leu Gln Phe Thr Ile Asp Gly Glu 20 25 30 Thr Gly Tyr Phe Ala Gly Thr Asn Ser Tyr Trp Ile Gly Phe Leu Thr 35 40 45 Asp Asn Ala Asp Val Asp Leu Val Met Gly His Leu Lys Ser Ser Gly 50 55 60 Leu Lys Ile Leu Arg Val Trp Gly Phe Asn Asp Val Thr Ser Gln Pro 65 70 75 80 Ser Ser Gly Thr Val Trp Tyr Gln Leu His Gln Asp Gly Lys Ser Thr 85 90 95 Ile Asn Thr Gly Ala Asp Gly Leu Gln Arg Leu Asp Tyr Val Val Ser 100 105 110 Ser Ala Glu Gln His Asp Ile Lys Leu Ile Ile Asn Phe Val Asn Tyr 115 120 125 Trp Thr Asp Phe Gly Gly Met Ser Ala Tyr Val Ser Ala Tyr Gly Gly 130 135 140 Ser Gly Glu Lys Asp Phe Tyr Thr Ser Asp Thr Met Gln Ser Ala Tyr 145 150 155 160 Gln Thr Tyr Ile Lys Thr Val Val Glu Arg Tyr Ser Asn Ser Ser Ala 165 170 175 Val Phe Ala Trp Glu Leu Ala Asn Glu Pro Arg Cys Pro Ser Cys Asp 180 185 190 Thr Ser Val Leu Tyr Asn Trp Ile Glu Lys Thr Ser Lys Phe Ile Lys 195 200 205 Gly Leu Asp Ala Asp Arg Met Val Cys Ile Gly Asp Glu Gly Phe Gly 210 215 220 Leu Asn Ile Asp Ser Asp Gly Ser Tyr Pro Tyr Gln Phe Ser Glu Gly 225 230 235 240 Leu Asn Phe Thr Met Asn Leu Gly Ile Asp Thr Ile Asp Phe Gly Thr 245 250 255 Leu His Leu Tyr Pro Asp Ser Trp Gly Thr Ser Asp Asp Trp Gly Asn 260 265 270 Gly Trp Ile Thr Ala His Gly Ala Ala Cys Lys Ala Ala Gly Lys Pro 275 280 285 Cys Leu Leu Glu Glu Tyr Gly Val Thr Ser Asn His Cys Ser Val Glu 290 295 300 Gly Ser Trp Gln Lys Thr Ala Leu Ser Thr Thr Gly Val Gly Ala Asp 305 310 315 320 Leu Phe Trp Gln Tyr Gly Asp Asp Leu Ser Thr Gly Lys Ser Pro Asp 325 330 335 Asp Gly Asn Thr Ile Tyr Tyr Gly Thr Ser Asp Tyr Gln Cys Leu Val 340 345 350 Thr Asp His Val Ala Ala Ile Asp Ser Ala 355 360

Claims

1. A mannanase mutant, characterized in that, The amino acid sequence of the mutant is shown in SEQ ID NO:6 or SEQ ID NO:

9.

2. A DNA molecule encoding the mutant of claim 1.

3. A recombinant expression plasmid comprising the DNA molecule of claim 2.

4. A host cell, characterized in that, The host cell comprises the recombinant expression plasmid as described in claim 3, and the host cell is Pichia pastoris (…). Pichia pastoris ) or Trichoderma reesei ( Trichoderma reesei ).