A detection method for detecting porcine epidemic diarrhea virus, porcine dyspepsia brachyspira and porcine intracellular lawsonia

Abstract

The application provides a detection method for detecting porcine epidemic diarrhea virus, porcine dysentery leptospira and porcine intracellular lawsonia. The detection method realizes simultaneous detection of porcine epidemic diarrhea virus, porcine dysentery leptospira and porcine intracellular lawsonia by using primers and probes for detecting porcine epidemic diarrhea virus, porcine dysentery leptospira and porcine intracellular lawsonia. The method provided by the application saves detection cost and time, and the detection of the three pathogens is completed in one reaction system, greatly avoiding aerosol pollution.

Description

Technical Field

[0001] This invention belongs to the field of animal disease detection technology, and in particular relates to a detection method for porcine epidemic diarrhea virus, swine dysentery short spirochetes and porcine intracellular Lawsonia. Background Technology

[0002] China is the world's largest pig-producing country, and pig farming holds a special place in the development of my country's livestock industry. China ranks first globally in both the total number of pigs and pork consumption. During the development of the pig farming industry, swine diarrhea has always been a major problem plaguing my country's pig industry, causing huge economic losses. The causes of swine diarrhea are varied, but swine epidemic diarrhea (PED) caused by Porcine Epidemic Diarrhea Virus (PEDV) is currently the most common swine diarrhea disease clinically. This disease is more prevalent in spring and winter, and can cause agalactia and delayed estrus in sows. The mortality rate of infected young piglets is close to 100%. Although the prevalence of ileitis (PPE) caused by Lawsonia Intracellularis (LI) and swine dysentery (SD) caused by Brachyspira hyodysenteriae (BH) is lower than that of PED, both PPE and SD can lead to high mortality rates in infected pigs, causing significant losses to the pig farming industry. The three types of swine diarrhea mentioned above have similar symptoms and are difficult to distinguish visually: PED causes watery diarrhea, and in severe cases, vomiting may occur; PPE is divided into acute, chronic, and subclinical forms. The acute form mainly presents with bloody watery diarrhea, while the chronic form mainly presents with loss of appetite or complete anorexia, lethargy or drowsiness, intermittent diarrhea, and soft, loose, pasty or watery feces. The subclinical form has no obvious clinical symptoms, but may also have mild diarrhea; SD's main clinical symptom is diarrhea, with the acute form mainly presenting with hemorrhagic diarrhea, and the subacute and chronic forms mainly presenting with mucous diarrhea. The cause of diarrhea cannot be accurately determined from the pig's external symptoms alone; accurate diagnosis requires laboratory testing.

[0003] The main losses caused by diarrhea are piglet mortality and growth retardation in the farrowing house, and sows carrying the virus are one of the main causes of diarrhea outbreaks in farrowing houses. Therefore, the diagnosis and control of diarrhea pathogens in large pigs are crucial. PED, PPE, and SD can all cause diarrhea in medium and large pigs. PEDV is an acute, highly pathogenic, and infectious enterovirus that can infect pigs of all ages. In fattening pigs, PEDV infection causes diarrhea lasting about a week before gradually returning to normal. A small number of pigs experience growth retardation before recovering. The mortality rate is 1%–3%. Acute PPE is most common in growing pigs aged 4–12 months, with a morbidity rate of approximately 6% and a mortality rate of approximately 50%. In addition, pregnant sows infected with PEDV may abort within a week of showing symptoms. SD (slowed-down syndrome) can occur in pig herds of all ages, leading to decreased production performance, reduced daily weight gain, slower growth, and increased mortality. In medium and large-sized pigs, infected pigs generally have a normal or reduced appetite, exhibit chronic, wasting, and progressive emaciation, rough and dull coat, mild anemia and pale skin, and significantly reduced feed efficiency.

[0004] For the detection of pathogens causing swine diarrhea, single-mode fluorescence quantitative PCR is still the primary method. Compared with multiplex fluorescence detection methods, it has the following shortcomings: First, single-mode fluorescence quantitative PCR can only specifically detect one pathogen and cannot confirm whether there is a dual or multiple infection. Second, to detect multiple pathogens simultaneously, single-mode fluorescence quantitative PCR requires multiple reactions, resulting in reagent waste and increased detection costs. Third, to detect multiple pathogens on the same sample, single-mode fluorescence quantitative PCR requires multiple tests on the same sample, which can easily lead to sample waste and even aerosol contamination, polluting the laboratory environment and causing false positives in other test results.

[0005] Therefore, although many detection methods for the above-mentioned pathogens have been disclosed in the prior art, no detection method that can detect all three of the above pathogens at the same time has been found. Summary of the Invention

[0006] The purpose of this invention is to address the problems existing in the prior art by establishing a triple fluorescence quantitative detection method that can simultaneously detect PEDV, BH and LI.

[0007] To achieve the above objectives, the present invention provides the following technical solution:

[0008] This invention provides primers and probes for the simultaneous detection of porcine epidemic diarrhea virus, swine dysentery breech spirochetes, and porcine Lawsonia intracellularis. The primers include primers for porcine epidemic diarrhea virus, primers for swine dysentery breech spirochetes, and primers for porcine Lawsonia intracellularis.

[0009] The probes include porcine epidemic diarrhea virus probes, swine dysentery short spirochetes probes, and porcine intracellular Lawsonia probes.

[0010] The upstream primer sequence of the porcine epidemic diarrhea virus primer is: 5'-CATCTGATTCTGGACAGTTG-3'; the downstream primer sequence of the porcine epidemic diarrhea virus primer is: 5'-CTATACACCAACACAGGCTC-3';

[0011] The upstream primer sequence of the swine dysentery short spirochete primer is: 5'-GTAGGAAGAAGAAATCTGACAATGCA-3'; the downstream primer sequence of the swine dysentery short spirochete primer is: 5'-TATGAAGAAGGCAGCAGACGTTTAT-3';

[0012] The upstream primer sequence of the Lawsonia intracellularis primer is: 5'-CACCTGGACGATAACTGACACT-3'; the downstream primer sequence of the Lawsonia intracellularis primer is: 5'-TAACTCCCCAGCACCTAGCAC-3';

[0013] The sequence of the porcine epidemic diarrhea virus probe is 5'-TTTCAGAGCAGGCTGCATAT-3';

[0014] The sequence of the short spirochetal probe for swine dysentery is: 5'-GCTTCAGCATGATTGTGT-3';

[0015] The sequence of the intracellular Lawsonia probe is: 5'-GAGGTGCGAAAGCGTGGGG-3'.

[0016] Preferably, the porcine epidemic diarrhea virus probe is labeled with a FAM fluorescent group at its 5' end and with a BHQ1 group at its 3' end.

[0017] Preferably, the 5' end of the swine dysentery short spirochete probe is labeled with a VIC fluorescent group, and the 3' end is labeled with a BHQ1 group.

[0018] Preferably, the intracellular Lawsonia probe is labeled with a CY5 fluorescent group at its 5' end and with a BHQ3 group at its 3' end.

[0019] Secondly, the present invention provides a method for simultaneously detecting porcine epidemic diarrhea virus, swine dysentery short spirochetes and porcine intracellular Lawsonia, characterized in that the method is a non-diagnostic research method;

[0020] The method includes the following steps:

[0021] a. Nucleic acid extraction: Extracting nucleic acid from the sample to be tested as a template for RT-PCR reaction;

[0022] b. Preparation of the premixed system: Prepare the premixed system according to the RT-PCR kit to be used. The kit used in this invention is TransScript Probe One-Step qRT-PCR SuperMix (Beijing TransGen Biotech Co., Ltd., catalog number AQ221). The reaction system is 20 μL. The premixed system includes 10 μL of 2×perfectstart Probe One-Step qPCR SuperMix, 0.4 μL of TransScript Probe One-Step RT / RI Enzyme Mix, 0.4 μL of Forward Primer, 0.4 μL of Reverse Primer, and 2.8 μL of RNase-free Water.

[0023] c. Reaction grouping: Negative control sample, positive control sample, and test sample should be added to the premixed system to divide it into negative control group, positive control group, and test experimental group;

[0024] d. Amplification: The negative control group, positive control group, and experimental group to be tested were placed in a fluorescence quantitative instrument for RT-PCR amplification, and the fluorescence signals of the three channels FAM, VIC, and CY5 were collected at the same time.

[0025] e. Analyze the results and determine the samples to be tested.

[0026] Preferably, the positive control is a mixture of positive plasmids of porcine epidemic diarrhea virus, swine dysentery spirochetes, and Lawsonia intracellularis.

[0027] The positive plasmid of the porcine epidemic diarrhea virus contains the gene sequences corresponding to the primers and probes of the porcine epidemic diarrhea virus, and the gene sequences corresponding to the primers and probes of the porcine epidemic diarrhea virus are shown in SEQ ID NO.10;

[0028] The positive treatment for swine dysentery spirochetes includes the gene sequences corresponding to the primers and probes of swine dysentery spirochetes, and the gene sequences corresponding to the primers and probes of swine dysentery spirochetes are shown in SEQ ID NO.11;

[0029] The positive plasmid of Lawsonia suis contains the gene sequences corresponding to the primers and probes of Lawsonia suis, and the gene sequences corresponding to the primers and probes of Lawsonia suis are shown in SEQ ID NO.12.

[0030] Preferably, the RT-PCR amplification reaction program is as follows: reverse transcription at 45°C for 5 min, pre-denaturation at 95°C for 5 min, denaturation at 95°C for 10 s, annealing and extension at 52°C for 30 s, for 40 cycles, during which fluorescence signals from the FAM, VIC, and CY5 channels are collected simultaneously during the annealing stage.

[0031] Preferably, the detection method determines whether the detection result is valid based on the number of cycles Ct required for the fluorescence signal to reach a set threshold.

[0032] The validity of the detection method depends on the following conditions: if the Ct value of the positive control group corresponding to the FAM, VIC, and CY5 fluorescence signals is less than 30 and the negative control group has no Ct value, then the result is valid; otherwise, the result is invalid and the sample to be tested needs to be retested.

[0033] Preferably, the method for determining the detection result is as follows:

[0034] If one or more of the Ct values ​​of the three fluorescent signals FAM, VIC, and CY5 corresponding to a sample are less than or equal to 35, then the pathogen corresponding to that fluorescent signal is determined to be positive, that is, there is a single pathogen infection or a mixed infection of multiple pathogens in the sample.

[0035] If the Ct values ​​of the three fluorescence signals FAM, VIC, and CY5 corresponding to the sample are greater than 35, the result is considered suspicious and repeated testing is required. If the test result still has a Ct value, the result is considered positive; otherwise, it is considered negative.

[0036] If the Ct values ​​of the three corresponding fluorescence signals FAM, VIC, and CY5 of a sample are all zero, the sample is determined to be a negative sample for porcine epidemic diarrhea virus, swine dysentery short spirochetes, and Lawsonia intracellularis.

[0037] The beneficial effects of this invention are:

[0038] The method provided by this invention saves detection costs and time, and the detection of three pathogens is completed in one reaction system, which greatly avoids aerosol pollution.

[0039] Meanwhile, the method provided by this invention has excellent sensitivity and specificity, as well as good repeatability and stability. Attached Figure Description

[0040] Figure 1 This is the result of the feasibility verification of using positive plasmids for primers and probes in this invention;

[0041] Figure 2 This is the result of the feasibility verification of primers and probes using positive samples in this invention;

[0042] Figure 3 This is the standard curve of the multiplex real-time PCR detection method established in this invention;

[0043] Figure 4 This is a graph showing the specificity verification results of the multiplex real-time PCR detection method established in this invention;

[0044] Figure 5 This is a graph showing the sensitivity verification results of the multiplex real-time PCR detection method LI established in this invention;

[0045] Figure 6 This is a graph showing the sensitivity verification results of the multiplex real-time PCR detection method for PEDV established in this invention;

[0046] Figure 7 This is a graph showing the sensitivity verification results of the multiplex real-time PCR detection method BH established in this invention. Detailed Implementation

[0047] The embodiments described are provided to better illustrate the present invention, but are not intended to limit the scope of the invention to the embodiments described. Therefore, non-essential improvements and adjustments made to the embodiments by those skilled in the art based on the above description are still within the scope of protection of the present invention.

[0048] Example 1

[0049] The primer-probe combination involved in this invention is designed based on the following principles:

[0050] The PEDV primers and probes are designed to target conserved sequences of the PEDV S gene. The corresponding primer and probe sequences are as follows:

[0051] Upstream primer SEQ ID NO.1: 5'-CATCTGATTCTGGACAGTTG-3';

[0052] Downstream primer SEQ ID NO.2: 5'-CTATACACCAACACAGGCTC-3';

[0053] Fluorescent probe SEQ ID NO.3: 5'-TTTCAGAGCAGGCTGCATAT-3';

[0054] The gene fragment sequence corresponding to the primer probe, SEQ ID NO.10, is: 5'-CATCTGATTCTGGACAGTTGTTAGCTTTTAAGAATGTCACTAGTGGTGCTG TTTATTCTGTTACGCCATGTTCTTTTTCAGAGCAGGCTGCATATGTTGATGATGATATAGTGGGTGTTATTTCTAGTTTGTCTAGCTCCACTTTTAACAGTACTAGGGAGTTGCCTGGTTTCTTCTACCATTCTAATGATGGCTCTAATTGTACAGAGCCTGTGTTGGTGTATAG-3';

[0055] The BH primer and probe design targets the conserved sequence of the NADH gene in BH, and the corresponding primer and probe sequences are as follows:

[0056] Upstream primer SEQ ID NO.4: 5'-GTAGGAAGAAGAAATCTGACAATGCA-3';

[0057] Downstream primer SEQ ID NO.5: 5'-TATGAAGAAGGCAGCAGACGTTTAT-3';

[0058] Fluorescent probe SEQ ID NO.6: 5'-GCTTCAGCATGATTGTGT-3';

[0059] The gene fragment sequence corresponding to the primer probe, SEQ ID NO.11, is: 5'-GTAGGAAGAAGAAATCTGACAATGCAAATTGATCAACAGTCATACCATTT TGTATAGCAAGAGAGAATGCATGAATAGCTTCAGCATGATTGTGTTTAGAA GCTATTTGAGCACCTAATAAACGTCTGCTGCCTTCTTCATA-3';

[0060] The LI primer and probe design targets the conserved sequence of the 16S gene of LI, and the corresponding primer and probe sequences are as follows:

[0061] Upstream primer SEQ ID NO.7: 5'-CACCTGGACGATAACTGACACT-3';

[0062] Downstream primer SEQ ID NO.8: 5'-TAACTCCCCAGCACCTAGCAC-3';

[0063] Fluorescent probe SEQ ID NO.9: 5'-GAGGTGCGAAAGCGTGGGG-3';

[0064] The gene fragment sequence corresponding to the primer probe, SEQ ID NO.12, is: 5'-CACCTGGACGATAACTGACACTGAGGTGCGAAAGCGTGGGGAGCAAAC AGGATTAGATACCCTGGTAGTCCACGCTGTAAACGATGGGTGCTAGGTGCTGGGGAGTTA-3'.

[0065] In the above gene fragment sequences, fluorescent probe sequences are labeled with fluorescent groups on both sides. The labeling combinations are as follows: the 5' end of SEQ ID NO.3 is modified with FAM and the 3' end is modified with BHQ1; the 5' end of SEQ ID NO.6 is modified with VIC and the 3' end is modified with BHQ1; and the 5' end of SEQ ID NO.9 is modified with CY5 and the 3' end is modified with BHQ3.

[0066] Example 2

[0067] The specific test method of the detection method involved in this invention is as follows:

[0068] (1) Nucleic acid extraction: Extract nucleic acid from the sample to be tested as a template for RT-PCR reaction;

[0069] (2) Prepare the premixed system: Prepare the premixed system according to the RT-PCR kit to be used. The premixed system should contain primers and probes corresponding to all three pathogens: PEDV, BH and LI.

[0070] (3) Reaction grouping: Negative control sample, test sample and positive control sample should be added to the premixed system to divide it into negative control group, test group and positive control group. The order of adding samples should strictly follow the principle of negative first and positive later to avoid the positive control from affecting other samples and causing false positives.

[0071] (4) Amplification: The negative control group, positive control group and test group were placed in the fluorescence quantitative instrument. The program was set as follows: 45℃ reverse transcription for 5 min, 95℃ pre-denaturation for 5 min, 95℃ denaturation for 10 s, 52℃ annealing extension for 30 s, 40 cycles. During the annealing stage, the fluorescence signals of the three channels FAM, VIC and CY5 were collected simultaneously.

[0072] (5) Validity determination of results: The positive control group corresponding to FAM, VIC, and CY5 fluorescence signals all have Ct values ​​less than 30, and the negative control group corresponding to FAM, VIC, and CY5 fluorescence signals all have no Ct values. If the above two limiting conditions are met, the test results are determined to be valid.

[0073] (6) Sample result determination: If one or more fluorescent signals in the sample to be tested have no Ct value, the pathogen corresponding to the signal is determined to be negative, provided that the result is valid. If one or more fluorescent signals in the sample to be tested have a Ct value greater than 35, the result is determined to be suspicious and repeated testing is required. If the test result still has a Ct value, the result is determined to be positive; otherwise, it is negative. If the Ct value corresponding to one or more fluorescent signals in the sample to be tested is less than or equal to 35, the pathogen corresponding to the signal is determined to be positive.

[0074] Example 3

[0075] Before use, the primers and probes involved in this invention were first validated for feasibility. Specifically, the primers and probes were validated using positive plasmids and positive samples of PEDV, BH, and LI, respectively. The experimental procedures in this embodiment were strictly performed according to the experimental method described in Example 2, and the experimental results are as follows: Figure 1 , Figure 2 As shown, in the positive plasmid verification and positive sample verification, the fluorescence signals corresponding to the three pathogens all showed amplification curves, and the Ct values ​​were all less than 35. The negative control had no Ct value. Therefore, the primer probe designed in this invention can successfully detect the relevant pathogens in the sample, and the primer probe is deemed feasible.

[0076] Example 4

[0077] Standard curves were plotted for the three primer-probe combinations involved in this invention. The positive plasmid was increased from 1×10⁻⁶. 8 Starting with copies / uL, dilute 10-fold sequentially to 1×10⁻⁶. 1 Eight different concentrations of positive plasmid standards were obtained by measuring copies / µL. Multiplex quantitative PCR amplification was performed on each concentration, with three replicates per concentration. The results were analyzed, and a standard curve was plotted. Figure 3 As shown, the amplification efficiencies of the three pathogens were all within the range of 90%–110%, indicating good efficiency; and R 2 A value ≥0.999 indicates a high level of reliability and a good linear relationship.

[0078] Example 5

[0079] The specificity of the three primer-probe combinations involved in this invention was verified. Positive samples of PEDV, BH, and LI were used as positive controls, and deionized water as a negative control. Samples positive for African swine fever, porcine rotavirus, porcine deltacoronavirus, porcine circovirus type 2, porcine circovirus type 3, porcine reproductive and respiratory syndrome virus, Haemophilus parasuis, and pseudorabies were used as test samples. Multiplex quantitative PCR amplification was performed to verify the specificity of this multiplex quantitative PCR method. The experimental results are as follows: Figure 4 As shown, no amplification curves or Ct values ​​were observed in the African swine fever positive samples, porcine rotavirus positive samples, porcine deltacoronavirus positive samples, porcine circovirus type 2 positive samples, porcine circovirus type 3 positive samples, porcine reproductive and respiratory syndrome virus positive samples, Haemophilus parasuis positive samples, pseudorabies positive samples, and negative controls. PEDV positive samples, BH positive samples, and LI positive samples showed amplification curves with Ct values ​​less than 35. Therefore, the primers and probes involved in this invention are determined to have good specificity.

[0080] Example 6

[0081] Sensitivity verification of the three primer-probe combinations involved in this invention. A concentration of 1×10⁻⁶ was used. -1 copies / uL, 1×10 0 copies / uL, 1×10 1 copies / uL, 1×10 2 copies / uL, 1×10 3 copies / uL, 1×10 4 copies / uL, 1×10 5 copies / uL, 1×10 6 copies / uL, 1×10 7 copies / uL, 1×10 8 The sensitivity of this multiplex fluorescence quantitative detection method was validated using positive plasmid standards at concentrations of 10 copies / µL. The experimental results are as follows: Figure 5 , Figure 6 , Figure 7 As shown, based on the experimental results, the sensitivity information of the three sets of primers and probes can be obtained: the lowest detection threshold for PEDV is 1×10⁻⁶. 1 copies / uL, the minimum detection threshold for BH is 1×10 1 copies / uL, the minimum detection threshold for LI is 1×10 1 copies / uL.

[0082] Example 7

[0083] Repeatability verification of the three primer-probe combinations involved in this invention. A concentration of 1×10⁻⁶ was selected. 4 copies / uL, 1×10 5 copies / uL, 1×10 6 The repeatability of this multiplex quantitative PCR method was validated using positive plasmids at three concentrations (copies / µL). Within each batch, each concentration was repeated three times; between batches, the experiments were repeated every three days, for a total of three repetitions. The coefficient of variation (CV) was calculated based on the results, as shown in the table below:

[0084] Table 1. Repeatability verification results

[0085]

[0086]

[0087] As shown in the table above, the inter-batch repeatability verification coefficient of the multiplex fluorescent PCR method established in this invention is as high as 3.50%, and the intra-batch repeatability coefficient of variation is as high as 0.74%, both of which are better than the relevant application standards, indicating that the multiplex fluorescent PCR method established in this invention has good repeatability and stability.

[0088] Example 8

[0089] Clinical sample validation of the three primer-probe combinations involved in this invention. One hundred diarrheal pig samples collected in our laboratory were tested using both a single-mode quantitative fluorescence detection method and the multiplex quantitative fluorescence detection method established in this patent. The results showed that among the 100 samples tested using both methods, there were 14 positive samples for PEDV, 7 positive samples for BH, 52 positive samples for LI, and 3 positive samples for PEDV+LI. There were no positive samples for BH+LI or BH+PEDV. The concordance rate between the two detection methods was 100%.

[0090] Table 2 Clinical Sample Validation Results

[0091]

[0092] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. A primer and probe combination for the simultaneous detection of porcine epidemic diarrhea virus, *Shigella swineis*, and *Lawsonia intracellularis*, characterized in that, The primer and probe combination consists of primers and probes for porcine epidemic diarrhea virus, primers and probes for swine dysentery short spirochetes, and primers and probes for porcine intracellular Lawsonia. The porcine epidemic diarrhea virus primers and probes target the conserved sequence of the S gene of porcine epidemic diarrhea virus, and the corresponding amplified fragment sequence is shown in SEQ ID NO.

10. The upstream primer sequence is 5'-CATCTGATTCTGGACAGTTG-3', the downstream primer sequence is 5'-CTATACACCAACACAGGCTC-3', and the probe sequence is 5'-TTTCAGAGCAGGCTGCATAT-3'. The 5' end of the probe is labeled with a FAM fluorescent group, and the 3' end is labeled with a BHQ1 group. The primers and probes for *Treponema hygroscopicus* target the conserved sequence of the *Treponema hygroscopicus* NADH gene. The corresponding amplified fragment sequence is shown in SEQ ID NO.

11. The upstream primer sequence is 5'-GTAGGAAGAAGAAATCTGACAATGCA-3', the downstream primer sequence is 5'-TATGAAGAAGGCAGCAGACGTTTAT-3', and the probe sequence is 5'-GCTTCAGCATGATTGTGT-3'. The 5' end of the probe is labeled with a VIC fluorescent group, and the 3' end is labeled with a BHQ1 group. The *L. intracellularis* primers and probes target the conserved sequence of the *L. intracellularis* 16S gene, and the corresponding amplified fragment sequence is shown in SEQ ID NO.

12. The upstream primer sequence is 5'-CACCTGGACGATAACTGACACT-3', the downstream primer sequence is 5'-TAACTCCCCAGCACCTAGCAC-3', and the probe sequence is 5'-GAGGTGCGAAAGCGTGGGG-3'. The 5' end of the probe is labeled with the CY5 fluorescent group, and the 3' end is labeled with the BHQ3 group.

2. A method for simultaneously detecting porcine epidemic diarrhea virus, swine dysentery brevis, and porcine Lawsonia intracellularis for non-diagnostic purposes, characterized in that, The method using the primer and probe combination of claim 1 includes the following steps: a. Nucleic acid extraction: Extract total nucleic acid from the sample to be tested, which will be used as a template for the real-time RT-PCR reaction; b. Preparation of the reaction system: Prepare a 20 μL reaction system containing the primer and probe combination as described in claim 1 in the same reaction tube. The reaction system includes 10 μL of 2×PerfectStart Probe One-Step qPCR SuperMix, 0.4 μL of TransScript Probe One-Step RT / RI Enzyme Mix, 0.4 μL of upstream primer, 0.4 μL of downstream primer, and 2.8 μL of RNase-free water. c. Set up a negative control group, a positive control group, and a sample group to be tested, wherein the positive control is a mixture of three positive plasmids containing the sequences shown in SEQ ID NO.10, SEQ ID NO.11, and SEQ ID NO.12, respectively; d. Amplification and signal acquisition: Each group was placed in a real-time PCR instrument and subjected to reverse transcription at 45℃ for 5 min; pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 10 s and annealing extension at 52℃ for 30 s, for a total of 40 cycles. During the annealing extension stage at 52℃, the fluorescence signals of the three channels FAM, VIC and CY5 were acquired simultaneously. e. Result Interpretation: When the positive control Ct values ​​for the three channels FAM, VIC, and CY5 are all less than 30 and the negative controls have no Ct values, the test results are considered valid; when the Ct value of any channel of the sample is less than or equal to 35, the pathogen corresponding to that channel is considered positive; if the Ct value is greater than 35, the test is repeated. If the repeated test still shows a Ct value, the result is considered positive; otherwise, the result is considered negative; when any channel has no Ct value, the pathogen corresponding to that channel is considered negative.

Images