A clam adductor muscle tension-related gene enhancer lincrna, interference sequence and application thereof

Abstract

The application belongs to the field of marine biotechnology, and particularly relates to a Crassostrea hongkongensis adductor muscle tension related gene enhancer lincRNA, an interfering gene thereof and application thereof in breeding of heat-resistant new strains. The nucleotide sequence of the Crassostrea hongkongensis adductor muscle tension related gene enhancer lincRNA is shown as SEQ ID NO:1. The interfering sequence (dsRNA) is a 19 bp double strand, and the terminal contains a dTdT structure. The application injects the dsRNA interfering sequence of the enhancer lincRNA into the adductor muscle of the Crassostrea hongkongensis, significantly improves the expression amount of the Crassostrea hongkongensis ManIIa gene and the adductor muscle tension, and causes the survival rate under high temperature stimulation to be significantly higher than that of a control group. The application can be used for breeding of new oyster strains with high heat tolerance / high adductor muscle tension based on RNA interference.

Description

Technical Field

[0001] This invention belongs to the field of marine biotechnology, specifically relating to an enhancer lincRNA of an adductor muscle tension-related gene in the oyster *Crassostrea gigas* and its interfering gene, and its application in the breeding of heat-resistant new strains. Background Technology

[0002] Oysters are an important economically important marine aquaculture species in my country, and the most produced species in marine shellfish farming, reaching 5.8192 million tons in 2021, accounting for 38.13% of the total (2022 Fisheries Yearbook). Currently, the main farmed oyster species along the coasts of northern and southern my country include: Hong Kong oyster (Crassostrea hongkongensis), Fujian oyster (C. angulata), and Pacific oyster (C. gigas). Due to the frequent occurrence of extreme heat in recent years and the excessive increase in aquaculture density, all three main farmed oyster species have experienced varying degrees of large-scale mortality during cultivation, particularly during the hot summer months. Therefore, developing new heat-tolerant oyster strains is an important way to promote the high-quality development of the aquaculture industry.

[0003] Crassula ovata (C. ariakensis) is widely distributed in major estuaries along the coast of my country. Although its wild population has sharply declined in recent years due to overfishing, land-based pollution, and reduced surface runoff, it has historically been an important source of livelihood for fisheries due to its large size, rapid growth, and high adaptability to a wide range of temperatures and salinity. It is an important economic species with the potential to develop into a large-scale aquaculture industry. Developing new heat-tolerant strains of Crassula ovata will, to some extent, mitigate the impact of large-scale summer mortality of the main cultivated oyster species on the oyster industry. Summary of the Invention

[0004] The purpose of this invention is to provide an enhancer lincRNA of the adductor muscle tension-related gene of the Ostrea gigas and its interfering gene, and its application in the breeding of heat-resistant new varieties.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] A lincRNA enhancer of an adductor muscle tension-related gene in the oyster *Crassostrea gigas* is disclosed, and its nucleotide sequence is shown in SEQ ID NO:1.

[0007] Application of lincRNA, an enhancer of the adductor muscle tension-related gene in Crassula omimi, and its application as a molecular target for breeding new oyster strains with high adductor muscle tension.

[0008] An interference sequence of an enhancer lincRNA of a gene related to adductor muscle tension in the oyster *Crassostrea gigas* is disclosed. The interference sequence (dsRNA) is a 19 bp double strand containing a dTdT structure at its end.

[0009] Preferably, the dsRNA contains a dTdT structure at its 3' end.

[0010] The interfering sequence is a sequence obtained using a pair of upstream and downstream specific primers. The upstream and downstream specific primers are:

[0011] Upstream primer dslincRNA-F: 5'-GCACCAAUUUAAUACAAGATT-3';

[0012] Downstream primer dslincRNA-R: 5'-UCUUGUAUUAAAUUGGUGCTT-3'.

[0013] An interference sequence of an enhancer lincRNA of an adductor muscle tension-related gene in the oyster *Crassostrea gigas*, and the application of the interference sequence in the breeding of new heat-tolerant oyster strains.

[0014] A reagent for interfering with the enhancer lincRNA of the adductor muscle tension-related gene in Crassula ovata, the kit containing the aforementioned interfering sequence (dsRNA).

[0015] A method for cultivating a new heat-tolerant oyster strain involves obtaining a dsRNA sequence in vitro using a specific primer and injecting it into the adductor muscle of the Crassula ovata 'Omi'. This inhibits the expression of the enhancer lincRNA and enhances the expression of the alpha-mannosidase-2 (ManⅡa) gene, thereby improving the survival rate of the Crassula ovata 'Omi' under acute high-temperature stimulation. The resulting oyster strain is a new heat-tolerant oyster strain.

[0016] Further, the dsRNA interference sequence of the enhancer lincRNA of the adductor muscle tension-related gene in *Crassostrea gigas* was injected into the adductor muscle. This interference sequence is a double-stranded RNA molecule, and the dsRNA of this sequence was synthesized in vitro using specific primers. The *Crassostrea gigas* was temporarily opened by anesthesia, and then the dsRNA sequence was injected. The results showed that this sequence significantly inhibited the expression of the enhancer lincRNA, while enhancing the expression of the alpha-mannosidase-2 (ManⅡa) gene, resulting in a significant increase in adductor muscle tension. Further investigation into the effect of the enhancer lincRNA on the heat tolerance of *Crassostrea gigas* revealed that inhibiting the expression of the distal enhancer lincRNA of the ManⅡa gene significantly improved the survival rate of *Crassostrea gigas* under acute heat stimulation.

[0017] The injection amount of the dsRNA sequence was 10 μg per animal.

[0018] The beneficial effects of this invention are:

[0019] This invention is the first to discover that enhancer lincRNAs are involved in the expression regulation of the alpha-mannosidase-2 (ManIIa) gene and the shell closure process in the oyster *Crassostrea gigas*. Their transcripts negatively regulate the expression of the ManIIa gene; therefore, inhibiting lincRNA expression significantly enhances the expression level of the ManIIa gene and the adductor muscle strength in *Crassostrea gigas*, and reduces mortality at high temperatures. This enhancer lincRNA can serve as an important molecular target for breeding new oyster strains with high adductor muscle strength.

[0020] In addition, this invention provides an interfering sequence of enhancer lincRNA in the oyster *Crassostrea gigas*, which can significantly knock down the expression of distal enhancer lincRNA in the ManIIa gene, enhance the adductor muscle tension, and improve the survival rate of *Crassostrea gigas* under high temperatures. This interfering sequence of enhancer lincRNA can be used to cultivate new oyster strains with high temperature tolerance. Attached Figure Description

[0021] Figure 1 The effect of dsRNA injected with lincRNA on lincRNA expression in Crassula pistemon is shown in the embodiments of the present invention (different letters indicate significant differences, p<0.05); wherein, the experimental group is ds-lincRNA, and the control group is ds-GFP and SW.

[0022] Figure 2 The effect of dsRNA injected with lincRNA on the expression of the ManⅡa gene in Crassula ovata is shown in the embodiments of the present invention (different letters indicate significant differences, p<0.05); wherein, the experimental group is ds-lincRNA, and the control group is ds-GFP and SW.

[0023] Figure 3 The effect of dsRNA injected with lincRNA on the adductor muscle tension of Crassula ovata 'Oyster' is shown in the embodiments of the present invention (different letters indicate significant differences, p<0.05); wherein, the experimental group is ds-lincRNA, and the control group is ds-GFP and SW.

[0024] Figure 4 The present invention provides an embodiment showing the effect of dsRNA injected with lincRNA on the heat tolerance of Crassula ovata 'Oyster'; wherein, the experimental group is ds-lincRNA, and the control group is ds-GFP and SW. Detailed Implementation

[0025] The following examples further illustrate specific embodiments of the present invention. It should be noted that the specific embodiments described herein are merely for illustration and explanation and are not intended to limit the scope of the present invention.

[0026] Example 1

[0027] Based on previous research (Li A, Dai H, Guo X, Zhang Z, Zhang K, Wang C, Wang X, Wang W, Chen H, Li X, et al: Genome of the estuarine oyster provides insights into climate impact and adaptive plasticity. Communications Biology 2021, 4:1287.), a highly continuous, chromosome-level oyster genome assembly database was obtained using third-generation Nanopore, second-generation HiC, and Illumina sequencing technologies. Integrating information from third-generation full-length transcriptomics, gene prediction, and genome annotation, bioinformatics methods were used to obtain the sequence (SEQ ID NO.1) of a 1213 bp lincRNA (a gene enhancer related to adductor muscle tension) located on chromosome 53091770-53092982 of the oyster genome.

[0028] Example 2

[0029] To further explore the regulatory elements controlling the expression of ManⅡa, a gene related to adductor muscle tension, we integrated oyster genome assembly data, Hi-C interaction data (to identify elements interacting with the upstream regulatory region of the target gene), ATAT-seq data (to obtain chromatin openness in the upstream regulatory region of the target gene and the interacting elements), and transcriptome data to identify a distal enhancer interacting 10 kb upstream of the ManⅡa gene. This enhancer is a 1213 bp genomic fragment located in a 14.17 Mb region upstream of the gene. Expression profiling data further revealed that this enhancer can be transcribed into the lincRNA shown in SEQ ID NO.1.

[0030] The lincRNA has the base sequence shown in SEQ ID NO.1:

[0031] cttttttttttaaagtatattagctttaaaattaagacatggaacacaaggaactttcag 60

[0032] ctacatgctgatcagggacatgtccattgaaagaacacataatgggttggttatactgattg 120

[0033] actctactatacccccctctccccctctttttgaccttaatactagcttcattgtttagc 180

[0034] acattgtataattaaggtataatttacagaacccgcaacgttattttttcaagataaacg 240

[0035] aaaggataggattaacgaacgatgtggtaggattaacgcacgtacacactgtaagctgta 300

[0036] atcggctttatgtttataataacataaaaatgtgttaaaaatgaccataatcttgcttca 360

[0037] aaaatataaatttgtattatgcgtactagtattctcaatagtgacacacaactccttgcc 420

[0038] ccgccctactgatgacgtcacaatgaccgtcacttaccgggaaatactggatctccggga 480

[0039] gtcccccgccacagattctacggtcagagatcccgccttagatccgcgcccgcagagtgt 540

[0040] acaacggatccgcgcctcgagttggggttcattctgagagtacaattagtcctttgacac 600

[0041] tcagagaataatttctacagaattgacaagtagatccgatacctgtctgctatatagtac 660

[0042] agggtatactattagataggttcgtggtcccaagtattttctcagcaccaatttaataca 720

[0043] agataccatgagcttacaggactgtcaggcaacagaaatggccgccatttgatgacacgt 780

[0044] atcctctgtcgggggaaaaaatatttactttagtatgcgtggttcacgggtactgacggc 840

[0045] ccagtactgaaggtccgtactctccaggtactgaaggtccgtactctccaggtactgaag 900

[0046] gtccagtactgaaggtccgtactctccagtactgaaggtccagttttcgtttgcaagaaa 960

[0047] tcacatctcggaatgtcccgcaacaaaatcagctgtgaaaccaatatcctctataccg 1020

[0048] gggacaattctaacgactgtttgacaaatagacagttttatccttctatagtacaaaaaa 1080

[0049] atagtataagtttccattaggtgattgtatacgtttttatatactgaacgtaataacacta 1140

[0050] ctcagtccgttgttacgagttttctcggcatcaacacaacaaatcacatccagggacaag 1200

[0051] caaaacaaaacca

[0052] Example 3

[0053] Bioinformatics methods were used to retrieve the nucleotide sequence of the enhancer that transcribed the lincRNA (which was consistent with the lincRNA sequence). Primers for the dsRNA sequence (ds-lincRNA) were designed online on multiple websites. Based on preliminary experiments, the specific primers with the highest knockdown efficiency were finally determined (Table 1). The primer sequences were then sent to Suzhou GeneGene Co., Ltd. for in vitro artificial chemical synthesis.

[0054] In addition, the dsRNA of green fluorescent protein (ds-GFP) was used as a universal meaningless control sequence, and natural seawater (SW) was set up as a negative control. The ds-GFP control sequence was sent to Suzhou Genegene Co., Ltd. for in vitro artificial chemical synthesis (Table 1).

[0055] Table 1. dsRNA sequences designed in this application

[0056]

[0057] Example 4

[0058] In vivo RNAi experiments were conducted using wild-caught adult oysters:

[0059] The specific procedure is as follows: Wild oysters were cleaned and anesthetized by being placed in pre-prepared MgCl2 seawater. After the oysters opened, the synthesized dsRNA or seawater from the above-mentioned example was injected into the adductor muscle of the oyster using a microsyringe (100 μL). The dosage of both dsRNA and seawater was 10 μg per oyster. Forty-eight hours after injection, the adductor muscle tension was measured, and samples were taken from the adductor muscle to determine the expression levels of lincRNA and ManⅡa gene.

[0060] The adductor muscle tension was measured using an improved device for measuring the adductor muscle tension of bivalve mollusks (CN 211746263 U; 2020.10.27). The opening height was set to 10 mm to ensure that the oyster was not physically damaged. The distance from the adductor muscle to the shell edge was measured during sampling to correct the adductor muscle tension.

[0061] Primers were designed using Primer Premier 5 software based on the lincRNA nucleotide sequence shown in SEQ ID NO.1 and the known nucleotide sequence of the ManIIa gene (Table 2). Total RNA was extracted from the adductor muscle of the above-mentioned Crassula ovata 'Omi', and after reverse transcription, the expression levels of lincRNA, ManIIa gene, and housekeeping gene Ef1α were detected by real-time quantitative PCR (qRT-PCR) (see Table 2). Figure 1 and 2 The qRT-PCR reaction system was 20 μL, with each reaction consisting of 3 μL cDNA, 5.8 μL DEPC water, 10 μL SYBR Green buffer, and 0.4 μL each of forward and reverse primers and ROX dye II. The amplification process included: 30 seconds of DNA polymerase activation at 95°C; 40 cycles of denaturation and extension reactions at 5 seconds at 95°C and 30 seconds at 60°C; and a melting curve program of 15 seconds at 95°C, 1 minute at 60°C, 30 seconds at 95°C, and 15 seconds at 60°C.

[0062] Table 2 Primers used for qRT-PCR detection

[0063]

[0064]

[0065] Example 5

[0066] To verify whether the ManⅡa gene affects the resistance of oysters, a heat tolerance experiment was conducted. Wild-caught oysters were anesthetized and injected with 50 ds-lincRNA (obtained via specific primers), 50 ds-GFP (negative control, obtained via specific primers), and 50 pieces of natural seawater. After the shells closed, they were placed in preheated seawater at 42°C for one hour of acute heat shock, and then temporarily housed in normal seawater for 10 days. Spirulina powder was fed daily and the water was changed once a day. The daily mortality rate was recorded, and the mortality criterion was that the shells, which opened under external stimulation, could not close.

[0067] Six individual *Crassostrea gigas* oysters from each of the experimental and control groups were selected for qRT-PCR verification and adductor muscle tensile strength measurement according to the method described in Example 4 above (see [link]). Figure 3 and 4 ).

[0068] Compared with the control group, the expression level of lincRNA in the experimental group was significantly knocked down, approximately 0.23-0.29% of that in the control group. Figure 1 The expression level of the ManⅡa gene in the experimental group was significantly higher than that in the control group. Figure 2 The expression of lincRNA and ManIIa gene showed no significant difference between the two control groups, indicating that the dsRNA proposed in this application can successfully interfere with the target lincRNA in Crassula ovata and further increase the expression level of ManIIa gene; the adductor muscle tension of the experimental group oysters was significantly greater than that of the control group. Figure 3 This indicates that knocking down this lincRNA enhances the adductor muscle tension of oysters.

[0069] Further investigation into the effect of this lincRNA on the survival rate of Crassula ovata 'Oyster' under acute heat stress revealed a significant increase in the survival rate of the experimental group. Figure 4 This indicates that knocking down the distal enhancer of the ManⅡa gene with lincRNA enhances the high-temperature tolerance of oysters.

Claims

1. A lincRNA enhancing gene related to adductor muscle tension in the oyster shell, characterized in that: The nucleotide sequence of the enhancer lincRNA of the adductor muscle tension-related gene in the Oyster oyster is shown in SEQ ID NO:

1.

2. An interference sequence of lincRNA, an enhancer of a gene related to adductor muscle tension in the oyster *Crassostrea gigas*, characterized in that: The interfering sequence is dsRNA, which is a 19bp double-stranded RNA containing a dTdT structure at its end; The dsRNA sequence is as follows: Chain of Justice: 5'GCACCAAUUUAAUACAAGATT 3'; Antonym chain: 5'UCUUGUAUUAAAUUGGUGCTT 3'.

3. The application of the interference sequence of the lincRNA of the adductor muscle tension-related gene of *Crassostrea gigas* as described in claim 2 in the cultivation of new heat-tolerant oyster strains, characterized in that: By injecting interfering sequences into the adductor muscle of the oyster, the expression of enhancer lincRNA is inhibited, thereby cultivating a new oyster strain with high adductor muscle tension.

4. A reagent for interfering with the enhancer lincRNA of genes related to adductor muscle tension in the oyster shell, characterized in that: The reagent contains the interfering sequence as described in claim 2.

5. A method for cultivating a new high-temperature tolerant oyster strain, characterized in that: Injecting the interfering sequence described in claim 2 into the adductor muscle of *Crassostrea gigas* inhibits the expression of enhancer lincRNA and enhances alpha-mannosidase-2 (…). Man II a The expression of the gene is increased, thereby improving the survival rate of the oyster under acute high temperature stimulation. The resulting oyster is a new oyster strain with high temperature tolerance.

6. The method for cultivating new high-temperature tolerant oyster strains as described in claim 5, characterized in that: The amount of the interference sequence injected was 10 μg per animal.

Images