Modified oligonucleotides and uses thereof

Abstract

The present disclosure provides a modified oligonucleotide and its application. By performing phosphate thio, cytosine methylation, 2'-O-MOE and 2'-O-CET modification on ribose, 5' end conjugated GalNAc group and other various chemical modifications on the oligonucleotide, the affinity of the oligonucleotide molecule to the target gene is improved, the biological activity is improved, and the cytotoxicity is reduced, thereby providing a safer and more effective oligonucleotide and its application.

Description

Technical Field

[0001] This invention relates to the field of nucleic acid modification technology, and more specifically, to an oligonucleotide modified by a variety of chemical methods and its applications. Background Technology

[0002] Nucleic acid drugs can be broadly classified into two categories: small nucleic acid drugs and mRNA drugs. Small nucleic acid drugs, also known as oligonucleotide drugs (ONDs), include antisense nucleotides (ASOs), small interfering nucleic acids (siRNAs), microRNAs (miRNAs), aptamers, and others. mRNA products can be divided into mRNA vaccines and mRNA drugs.

[0003] Oligonucleotides (ONs) are a class of short DNA or RNA molecules, oligomers, that readily bind in a sequence-specific manner to their complementary oligonucleotides, DNA, or RNA to form double strands, or less commonly, higher-order hybrids. This fundamental characteristic makes oligonucleotides widely applicable in gene detection, research, and medicine. These small fragments of nucleic acids can be manufactured into single-stranded molecules with any user-specified sequence. In nature, oligonucleotides are often small RNA molecules (e.g., microRNAs) that play a role in gene expression regulation, or degradation intermediates derived from the breakdown of larger nucleic acid molecules.

[0004] Antisense oligonucleotides (ASOs) are single-stranded DNA or RNA sequences consisting of 15-25 nucleotides that can bind to specific target genes through sequence pairing. They achieve gene regulation by specifically blocking the transcription or translation of target genes. Due to their high specificity, high efficiency, and low safety and toxicity, antisense oligonucleotides have shown broad application prospects in gene therapy and other fields.

[0005] Natural oligonucleotides with phosphodiester backbones, acting as antisense drugs, can specifically bind to complementary RNA strands. After hybridization, they can induce RNase H (ribonuclease H) cleavage of target RNA. However, under physiological conditions, they are particularly sensitive to nucleases. Unmodified, natural oligonucleotide drugs (ONDs) are easily and rapidly degraded by nucleases in vivo, exhibiting low activity and poor drug-like properties. Chemical modification of oligonucleotide structures is an effective way to improve their antisense activity. Nucleic acid structures consist of a base, a phosphate group, and a sugar ring. Due to the poor stability of antisense oligonucleotides, they are easily degraded by nucleases in vivo. Therefore, chemical modification of synthetic antisense oligonucleotides can effectively inhibit the expression of target genes.

[0006] Chemically modified oligonucleotides can: improve stability against nucleases, enhance affinity for target RNA, and better promote endocytosis and tissue targeting, thereby increasing their activity. All marketed oligonucleotide drugs are chemically modified. Since the approval of the first nucleic acid drug, Fomivirsen (Vitravene), in 1998, the technology for chemical modification of nucleic acid drugs has been continuously upgraded.

[0007] Based on the basic structure of oligonucleotides—bases, sugar rings, phosphate backbones, and ends—chemical modifications can be performed on four parts:

[0008] Base modifications are mainly divided into three forms: purine modification, pyrimidine modification, and base substitution. Purine modifications include modifications with N6-methyladenosine, N1-methyladenosine, and 7-methylguanylic acid. Pyrimidine modifications include modifications with 3-methyluridine, 5-methyluridine, 5-methylcytosine, N4-acetylcytidine, pseudouridine, thiouridine, propynourishinidine, and dihydrouridine. Base substitutions include modifications with 4,6-difluorobenzimidazole ribonucleoside, 2,4-difluorophenyl ribonucleoside, and 2,4-dichlorophenyl ribonucleoside.

[0009] Sugar ring modification: This mainly includes sugar ring modification and substitution. Sugar ring modification includes 2'-modification (2'-OMe, 2'-F, 2'-MOE), 4'-modification (4'-S modification, 4'-S-FANA), and 5'-modification (5'-OMe). Isomer modifications include locked nucleic acids 2'-O-LNA, locked nucleic acids 2'-O-CET, thioribose, thiodeoxyribose, and combinations of these modifications. The most common 2'-modification is 2'-OMe modification, which replaces the hydroxyl group at the 2' of the sugar ring with a methoxy group. Compared to native siRNA, siRNA modified with 2'-OMe has a higher Tm value, stronger serum stability, and better activity. Locked nucleic acid LNA can improve the stability of primers and target molecules and increase the primer melting temperature (Tm value). Sugar ring substitution involves replacing the five-carbon sugar ring with a morpholine ring.

[0010] Modification of the phosphate backbone: Since the hydrolysis of the phosphodiester bond of oligonucleotides by nucleases in vivo is the main reason for their rapid degradation in vivo, other suitable analogs are selected to replace the phosphodiester bond backbone to increase stability. The main modification methods are: modification of thiophosphates, which is obtained by replacing a non-bridging oxygen atom in the phosphodiester bond linkage region with a sulfur atom; modification by methyl phosphate, selenophosphate, methylboryl phosphate, dithiophosphate, and by replacing the bridging oxygen atom in the phosphodiester bond linkage region with an S atom; and replacing the phosphate ester group between nucleosides entirely with a group that does not contain phosphorus atoms, such as replacing the P atom with C, S, and N atoms to form guanidine, S-methylthiourea, etc.

[0011] Terminal modification: Covalently conjugating / coupling specific groups at the 5' or 3' end of the oligonucleotide chain, preferably the 5' end, can increase cell affinity, tissue selectivity, and enhance cell targeting. Terminal modification of lipid-soluble small molecules can improve their similarity-to-miscibility with the cell membrane, thereby increasing cell entry efficiency. Lipid molecules used for modification include alkyl chains, cholesterol, and tocopherol. The asialoglycoprotein receptor (ASGPR) is an endocytic receptor specifically expressed by hepatocytes. In recent years, the high-affinity ligand N-acetylgalactosamine (GalNAc) of ASGPR has been used as a targeting molecule to achieve liver-targeted delivery of oligonucleotide drugs (siRNA, ASO, microRNA). In 2019, Alnylam's siRNA drug modified with GalNAc technology received FDA approval for the treatment of acute hepatic porphyria.

[0012] Gapmer modification: A gapmer is a chimeric antisense oligonucleotide containing a central block of deoxyribonucleotide monomers long enough to induce RNase H cleavage. A typical gapmer design consists of a 5'-wing, followed by 8 to 12 intervening deoxyribonucleotide monomers, which can be native nucleic acids or contain sulfide ions in the phosphate group (PS bond), and then a 3'-wing, which is an RNA-DNA-RNA-like configuration fragment.

[0013] Thanks to the advancements in the aforementioned modification technologies, nucleic acid drug development has progressed rapidly. To date, 16 nucleic acid drugs have been approved for marketing worldwide.

[0014] Table 1. Nucleic acid drugs approved for marketing.

[0015]

[0016]

[0017] With the launch of nucleic acid drugs, safety issues have been put to a wider test. The two drugs that were launched earlier were withdrawn from the US market and stopped being sold in the seventh year after their launch.

[0018] Currently, our understanding of the degradation process and mechanism of antisense oligonucleotides in serum is insufficient. Relying on experience, randomly replacing multiple nucleotides in antisense oligonucleotide molecules with modified nucleotides can sometimes effectively improve their serum stability. However, there is no direct relationship between the serum stability, biological activity, and cytotoxicity of antisense oligonucleotide molecules.

[0019] To improve the stability of antisense oligonucleotides to ribozymes and increase their half-life, it is necessary to modify and improve their chemical structure through chemical means. However, any modification, while increasing the half-life, will inevitably reduce the specific binding of antisense oligonucleotides to target RNA, decrease their affinity for target RNA, and increase cytotoxicity.

[0020] Excessive modification of antisense oligonucleotides may increase their cytotoxicity and, in many cases, reduce their biological activity (CN103184222B). Although there are numerous chemical modification techniques for nucleic acid drugs, simultaneously improving the serum stability and biological activity of antisense oligonucleotides while reducing cytotoxicity is highly contradictory and difficult. The impact of different modification methods on drug safety and efficacy is unpredictable, whether using the same sequence with different modifications, the same modification method on different sequences, or a free combination of multiple modification methods.

[0021] Although numerous modification methods for antisense oligonucleotide drugs have been developed and researched to date, no single method can perfectly balance the various requirements of antisense oligonucleotide activity, serum stability, and cytotoxicity. Furthermore, many modification methods have not been systematically studied and validated. Because many laboratories draw conclusions based on results from only one or two antisense oligonucleotides, the phenomena exhibited after modification with antisense oligonucleotides of different sequences may not conform to expectations in practical applications. Due to these issues, the rational modification of antisense oligonucleotide drugs remains primarily empirical, requiring repeated experiments to verify specific antisense oligonucleotide sequences.

[0022] Insulin-like growth factor 1 receptor (IGF-1R) is a protein found on the surface of human cells. It is a transmembrane receptor. The IGF-1R gene is located on chromosome 15q25-26. IGF-1R is a transmembrane tyrosine kinase protein with a tetrameric structure composed of two subunits, α and β. The extracellular α subunit (130 kDa) binds to IGF-1R ligands (IGF-1, IGF-2) via disulfide bonds, leading to phosphorylation. The intracellular β subunit (97 kDa) transmits downstream signals through phosphorylation of its own tyrosine residues.

[0023] It mediates the biological activities of insulin-like growth factor 1 (IGF-1) and most of insulin-like growth factor 2 (IGF-2). Currently, IGF-1R is mainly believed to have the following functions: (1) promoting cell division and proliferation; (2) inducing and maintaining cell phenotype transformation and tumorigenesis; and (3) anti-apoptosis.

[0024] IGF-1R is expressed on the surface of various cell types and possesses tyrosinase activity. When IGF-1 binds to IGF-1R, the tyrosinase activity of IGF-1R is enhanced, the insulin system is activated, thereby promoting cell mitosis and exerting an anti-apoptotic effect, leading to malignant transformation of normal cells. The first downstream signaling pathway mediated by IGF-1R is the phosphatidylinositol-3 kinase / protein kinase B (PI3K / AKT) signaling pathway, which promotes cell division and proliferation, controls the cell cycle, and inhibits apoptosis. The second is the mitogen-activated protein kinase / extracellular signal-regulated kinase (MAPK / ERK) signaling pathway, which mainly induces cell differentiation. Meanwhile, the destruction of the extracellular matrix is ​​a key step in tumor invasion and distant metastasis. Matrix metalloproteinases are important proteolytic enzymes involved in the destruction of the extracellular matrix. IGF-1R inhibitors applied to liver cancer cells have been shown to downregulate the expression of some matrix metalloproteinases, thus preventing liver cancer cell metastasis. IGF-1R is significantly overexpressed in various malignant tumors, including liver cancer, lung cancer, brain cancer, kidney cancer, prostate cancer, colon cancer, breast cancer, and nasopharyngeal carcinoma. IGF-1R and its signaling pathway are closely related to the growth, invasion, and metastasis of malignant tumors. The antisense oligonucleotide CT102 can inhibit IGF-1R gene expression and may be used for anti-tumor therapy.

[0025] Chinese patent CN114246829A discloses an antisense oligonucleotide CT102 for liver cancer. It mentions that CT102 has a high dosage and frequency of administration (10 mg / kg in mice, administered every other day, for a total of 10 doses via tail vein injection). Therefore, the CT102 sequence 5'-UCCUCCGGAGCCAGACUUCA-3' (SEQ ID NO.1) was chemically modified using various methods: methylation of cytosine and uracil, modification of the phosphate backbone with thiophosphate, and modification of the ribose structure with 2'-O-MOE. Even with so many modification methods, the modified structure lacks tissue targeting. It is still necessary to formulate it into a targeted lipid nanoparticle formulation for administration to reduce the dosage and improve targeting to liver tissue. Our detailed study on the chemical modification of CT102 revealed that the existing publicly reported modification schemes still have many shortcomings. How to improve the targeting of CT102 to liver tissue, enhance efficacy, and reduce cytotoxicity through chemical modification, thereby reducing the dosage and making the drug safer and more reliable, remains a topic that needs further exploration. Summary of the Invention

[0026] The purpose of this disclosure is to improve the biological activity of antisense oligonucleotide molecules and reduce cytotoxicity by chemically modifying the sequence 5'-UCCUCCGGAGCCAGACUUCA-3' (SEQ ID NO.1) of the antisense oligonucleotide CT102, thereby providing a safer and more effective oligonucleotide and its applications.

[0027] The inventors discovered during the screening and adjustment of chemical modifications for CT102 that different modification methods significantly impacted its activity and cytotoxicity. New modification technologies are constantly emerging and evolving, and the available modification methods are diverse and complex. Combinations of different modification methods can significantly affect drug activity and toxicity, and there are no universal rules to follow. Through extensive experimentation, the inventors screened out a combination of modification methods more suitable for the CT102 sequence, resulting in compounds with higher biological activity and lower cytotoxicity. This invention is achieved through the following methods:

[0028] This disclosure provides a modified oligonucleotide, its acidic structure, or a pharmaceutically acceptable salt thereof, said oligonucleotide comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleotides of the nucleotide sequence shown in formula (I); wherein the oligonucleotide sequence shown in formula (I) is:

[0029] 5′- m U (X) C (X) m / n C (X) m U (X) m C (X) m CGGAG m C m CAGA m C (X) m U (X) m U (X) C (X) A (X) -3'Formula (I)

[0030] in,

[0031] m U is 5-methyluracil modified.

[0032] m C represents 5-methylcytosine modification.

[0033] m / n C represents 5-methylcytosine modified or unmodified cytosine.

[0034] (X) represents a chemically modified ribose at the 2' position, wherein the chemically modified ribose is selected from any one or a combination of two or more of the following formulas: 2'-F-RNA, 2'-O-Me, 2'-O-MOE, 2'-O-LNA, and 2'-O-CET.

[0035]

[0036] The 3',5'-phosphodiester bonds connecting the nucleotide monomers in the sequence shown are thiolated.

[0037] In some implementations, the oligonucleotide is:

[0038] 5′- m U (X) C (X) C (X) m U (X) m C (X) m CGGAG m C m CAGA m C (X) m U (X) m U (X) C (X) A (X) -3', or 5'- m / n C (X) m U (X) m C (X) m CGGAG m C m CAGA m C (X) m U (X) m U (X) -3′; or a nucleotide sequence that is more than 80% identical to this sequence, wherein,

[0039] m U is 5-methyluracil modified.

[0040] m C represents 5-methylcytosine modification.

[0041] m / n C represents 5-methylcytosine modified or unmodified cytosine.

[0042] (X) represents a ribose chemically modified at the 2' position, wherein the ribose chemically modified at the 2' position in the modified oligonucleotide is selected from any one or a combination of two or more of 2'-O-Me, 2'-O-MOE, 2'-O-LNA, and 2'-O-CET.

[0043] The 10 nucleotides in the very middle region of the sequence shown have deoxyribose ribose.

[0044]

[0045] The 3',5'-phosphodiester bonds connecting the nucleotide monomers in the sequence shown are partially thiolated.

[0046] In some implementations, the oligonucleotide is:

[0047] 5′- m U (X) C (X) C (X) m U (X) m C (X) m CGGAG m C m CAGA m C (X) m U (X) m U (X) C (X) A (X) -3', or 5'-C (X) m U (X) m C (X) m CGGAG m C m CAGA m C (X) m U (X) m U (X) -3′; or a nucleotide sequence that is more than 80% identical to this sequence, wherein,

[0048] m U is 5-methyluracil modified.

[0049] m C represents 5-methylcytosine modification;

[0050] (X) is a ribose chemically modified at the 2' position, wherein the 2'-position chemically modified ribose is selected from 2'-O-Me or 2'-O-MOE, and a combination selected from 2'-O-LNA or 2'-O-CET.

[0051] In some implementations, the oligonucleotide is:

[0052] 5′-C (X) m U (X) m C (X) m CGGAG m C m CAGA m C (X) m U (X) m U (X) -3′; or a nucleotide sequence that is more than 80% identical to this sequence, wherein,

[0053] m U is 5-methyluracil modified.

[0054] m C represents 5-methylcytosine modification;

[0055] (X) represents a ribose chemically modified at the 2' position, wherein the 2'-position chemically modified ribose is a combination of 2'-O-MOE and 2'-O-CET.

[0056] Preferably, the number of 2'-O-CET modifications is not less than 3, and the others are 2'-O-MOE modifications.

[0057] In some embodiments, the aforementioned oligonucleotide, wherein the 3',5'-phosphodiester bonds connecting the nucleotide monomers in the shown sequence are thiomodified to form 3',5'-thiophosphodiester bonds, and the number of modifications is 11-17, preferably 12-15.

[0058] In some embodiments, the oligonucleotides, wherein 12 or 13 of the nucleotide monomers in the shown sequence are linked by 3',5'-phosphothioester bonds:

[0059] When the sequence is 5′- m U (X) C (X) C (X) m U (X) m C (X) m CGGAG m Cm CAGA m C (X) m U (X) m U (X) C (X) A (X) At -3′, the linkage between nucleotides is soooosssssssssssooss, where “s” represents thiophosphate nucleoside linkage and “o” represents phosphodiester nucleoside linkage.

[0060] When the sequence is 5′-C (X) m U (X) m C (X) m CGGAG m C m CAGA m C (X) m U (X) m U (X) At -3′, the linkage between nucleotides is soossssssssssos, where “s” represents thiophosphate nucleoside linkage and “o” represents phosphodiester nucleoside linkage.

[0061] In some embodiments, the oligonucleotide comprises the aforementioned oligonucleotide, its acidic structure, or a pharmaceutically acceptable salt thereof, preferably a sodium or potassium salt, more preferably a sodium salt.

[0062] In some embodiments, the oligonucleotide is an oligonucleotide containing a conjugation group, comprising the oligonucleotide of the preceding claims, its acidic form, or a pharmaceutically acceptable salt thereof, wherein the oligonucleotide has a conjugation group attached to its 5' or 3' end, the conjugation group comprising an N-acetylated galactosamine structure.

[0063] Preferably, the conjugation group comprises a GaLNAc cluster of 1-3 N-acetylated galactosamine ligands.

[0064] In some embodiments, the oligonucleotide has a conjugation group attached to its 5' end, the conjugation group comprising a GaLNAc cluster of three N-acetylated galactosamine ligands.

[0065] In some embodiments, the oligonucleotide, wherein the conjugation group has the following structural formula:

[0066]

[0067] The linking point is the 5' oxygen atom of the 5'-hydroxyl group of the 5'-terminal nucleoside.

[0068] In some embodiments, the oligonucleotide is CT102-1, CT102-2, CT102-3, CT102-4, CT102-5, CT102-6, CT102-7, CT102-8, CT102-9, or CT102-10 as specified in the specific embodiments of this specification.

[0069] In some embodiments, the oligonucleotide is CT102-1-Z, CT102-2-Z, CT102-4-Z, CT102-5-Z, CT102-6-Z, CT102-7-Z, CT102-8-Z, CT102-9-Z or CT102-10-Z as specified in the specific embodiments of the specification;

[0070] In one embodiment, the oligonucleotide includes its acidic structure or a pharmaceutically acceptable salt thereof, said oligonucleotide being selected from any one of formulas (II), (III), (IV), (V), and (VI).

[0071]

[0072]

[0073]

[0074] Formula (IV)

[0075]

[0076]

[0077] In one embodiment, the salt of the oligonucleotide is a sodium or potassium salt of the above structural formula, preferably a sodium salt.

[0078] This disclosure also provides a pharmaceutical composition comprising an oligonucleotide modified by any of the foregoing claims, its acidic structure or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

[0079] Preferably, the salt is a sodium salt or a potassium salt, and more preferably a sodium salt.

[0080] The compositions disclosed herein can be used to treat or prevent a variety of diseases or conditions, particularly those related to the overexpression of the IGF-1R gene, or other diseases related to similar gene silencing, such as Graves' ophthalmopathy (GO).

[0081] In one embodiment, the composition disclosed herein can be used for the treatment of tumors associated with the expression of the IGF-1R gene, such as solid tumors and hematological malignancies.

[0082] In one embodiment, the compositions disclosed herein can be used for the treatment of solid tumors, such as liver cancer, lung cancer, brain cancer, kidney cancer, pancreatic cancer, bile duct cancer, brain tumors, prostate cancer, gastrointestinal tumors, hematological malignancies, colon cancer, breast cancer, and nasopharyngeal carcinoma.

[0083] In one embodiment, the compositions disclosed herein can be used for the treatment of liver cancer, lung cancer, kidney cancer, pancreatic cancer, bile duct cancer, brain cancer, gastrointestinal tumors, hematologic malignancies, particularly liver cancer. Attached Figure Description

[0084] To more clearly illustrate the technical solutions in the embodiments of this disclosure or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of this disclosure. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0085] Figure 1 The results showed that different chemical modifications to the CT102 oligonucleotide sequence resulted in seven modified oligonucleotides with different chemical structures (CT102-1, CT102-2, CT102-3, CT102-4, CT102-5, CT102-6, CT102-7, CT102-8, CT102-9, CT102- ... MOE5 and CT102 MOE5-1 Inhibition rate of expression of human liver cancer cells (HepG2) - in vitro activity.

[0086] Figure 2 The results showed that different chemical modifications to the CT102 oligonucleotide sequence resulted in seven modified oligonucleotides with different chemical structures (CT102-1, CT102-2, CT102-3, CT102-4, CT102-5, CT102-6, CT102-7, CT102-8, CT102-9, CT102- ... MOE5 and CT102 MOE5-1 Cell viability-cytotoxicity of normal human hepatocytes (L-02).

[0087] Figure 3 The results showed that different chemical modifications to the CT102 oligonucleotide sequence resulted in seven modified oligonucleotides with different chemical structures (CT102-1, CT102-2, CT102-3, CT102-4, CT102-5, CT102-6, CT102-7, CT102-8, CT102-9, CT102- ... MOE5 and CT102 MOE5-1 Cell viability and cytotoxicity of BEAS-2B normal human lung epithelial cells.

[0088] Figure 4 The results show that by chemically modifying the CT102 oligonucleotide sequence in different ways and covalently coupling it with a structure containing an N-acetylated galactosamine GaLNAc conjugate group, 12 modified oligonucleotides with different chemical structures were formed (CT102-1-Z, CT102-2-Z, CT102-4-Z, CT102-5-Z, CT102-6-Z, CT102-7-Z, CT102-8-Z, CT102-9-Z, CT102-10-Z, CT102-7-D, CT102-9-D, CT102...). MOE5-1 -Z), Effect of human liver cancer orthotopic xenografts on mouse body weight - in vivo safety.

[0089] Figure 5 The results show that by chemically modifying the CT102 oligonucleotide sequence in different ways and covalently coupling it with a structure containing an N-acetylated galactosamine GaLNAc conjugate group, 12 modified oligonucleotides with different chemical structures were formed (CT102-1-Z, CT102-2-Z, CT102-4-Z, CT102-5-Z, CT102-6-Z, CT102-7-Z, CT102-8-Z, CT102-9-Z, CT102-10-Z, CT102-7-D, CT102-9-D, CT102...). MOE5-1 -Z) Effect of tumor weight on human hepatocellular carcinoma orthotopic xenografts in nude mice - inhibition rate.

[0090] Figure 6 The results show that by chemically modifying the CT102 oligonucleotide sequence in different ways and covalently coupling it with a structure containing an N-acetylated galactosamine GaLNAc conjugate group, 12 modified oligonucleotides with different chemical structures were formed (CT102-1-Z, CT102-2-Z, CT102-4-Z, CT102-5-Z, CT102-6-Z, CT102-7-Z, CT102-8-Z, CT102-9-Z, CT102-10-Z, CT102-7-D, CT102-9-D, CT102...). MOE5-1 Effect of -Z) on serum alpha-fetoprotein concentration in nude mice with human hepatocellular carcinoma orthotopic xenografts. Detailed Implementation

[0091] This disclosure provides a modified oligonucleotide. By performing various chemical modifications on the oligonucleotide, such as phosphate ester thiolation, cytosine methylation, 2'-O-MOE and 2'-O-CET modification on the ribose, and 5' end conjugation with a GalNAc structure, the stability, affinity for target genes, and biological activity of the oligonucleotide molecule are improved, while cytotoxicity is reduced. This provides a safer and more effective oligonucleotide and its applications.

[0092] The following examples are used to illustrate this disclosure, but are not intended to limit the scope of this disclosure. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0093] Example 1: Synthesis of Modified Oligonucleotides

[0094] 1. Base monomers used

[0095] DMT-dA(ibu) phosphoramide monomer (Formula 1), DMT-d m C(Ac)phosphite monomer (Formula 2), DMT-dG(ibu)phosphite monomer (Formula 3) and DMT- m C-MOE phosphoramide monomer (Formula 4), DMT- m U-MOE phosphorus amide monomer (Formula 5), ​​DMT-C-MOE phosphorus amide monomer (Formula 6), and DMT-A-MOE phosphorus amide monomer (Formula 7), other monomers DMT- m U-CET phosphorus amide monomer (Formula 8), DMT-C-CET phosphorus amide monomer (Formula 9) and DMT- m C-CET phosphorus amide monomer (Formula 10) and DMT-A-CET phosphorus amide monomer (Formula 11) were prepared with acetonitrile to obtain the required base monomer solutions, with a monomer concentration of 0.15M.

[0096]

[0097] 2. Instruments:

[0098] The OligoPilot 100 synthesizer from GE in the United States uses cross-linked polystyrene beads as its solid support, specifically the Primer support 5G Unylinker 350 (manufacturer: Cytiva).

[0099] 3. The synthesis steps are as follows:

[0100] 1) Deprotection

[0101] A 3% dichloroacetic acid toluene solution was used as the deprotecting agent to remove the 5'-DMT protecting group (the first step was to remove the protecting group on the support), releasing the 5'-hydroxyl group, followed by rinsing with acetonitrile.

[0102] 2) Coupling

[0103] The base monomer was activated using a 0.25M acetonitrile solution of 5-ethylthiotetrazole as an activator to form an active intermediate, which was then coupled with a 5'-hydroxyl group via a condensation reaction. The mixture was then washed with acetonitrile.

[0104] 3) Oxidation-thiolation

[0105] Oxidation was performed using a 3% pyridine solution of hydroflavin as the oxidant (for non-thiolated flavin, oxidation was performed using a solution of iodine and pyridine, 0.05M pyridine / water 90:10), followed by rinsing with acetonitrile.

[0106] 4) Hydroxyl protection

[0107] Hydroxyl protection was performed on the 5'-hydroxyl group of nucleosides that had not undergone coupling reaction using a 10% acetic anhydride tetrahydrofuran solution (CAP A) tetrahydrofuran / pyridine / N-methylimidazole 74 / 10 / 16 (v / v / v) (CAP B) as a hydroxyl protecting agent, followed by rinsing with acetonitrile.

[0108] Repeat steps 1)-4) above, following the set sequence, until the sequence coupling is complete, resulting in a fully protected product.

[0109] 5) Use a 3% dichloroacetic acid toluene solution as the deprotecting agent to remove the 5'-DMT protecting group of the last base monomer, followed by washing with acetonitrile.

[0110] 6) Ammonolysis and purification

[0111] The solid support was transferred to a reactor, and concentrated ammonia (25-28%) was added. The mixture was kept at 60°C for 12 hours to hydrolyze the ester bonds between the support and the nucleotides, removing the protecting groups on phosphate, adenine, guanine, and cytosine. The system was then cooled to room temperature, and the mixture was transferred to a filter press. The mixture was washed with a mixture of purified water and ethanol, and the filtrates were combined, passed through a reverse-phase chromatography column, concentrated, and lyophilized to obtain the product.

[0112] 4. Following the above method, the modified oligonucleotides shown in Table 2 below were prepared.

[0113] In Table 2, CT102-1, CT102-6, and CT102 MOE5 and CT102 MOE5-1 The naked nucleotide sequence is as follows:

[0114] UCCUCCGGAGCCAGACUUCA (SEQ ID NO. 1).

[0115] The naked nucleotide sequences of CT102-2, CT102-3, CT102-4, CT102-5, CT102-7, CT102-8, CT102-9, and CT102-10 are as follows:

[0116] CUCCGGAGCCAGACUU (SEQ ID NO. 2).

[0117] Table 2: Modified oligonucleotides

[0118]

[0119]

[0120] Remark:

[0121] (1) * indicates that the nucleotides are linked by phosphodiester bonds; the others are linked by thiophosphate diester bonds.

[0122] (2) m C represents 5 - Methylcytosine modification.

[0123] (3) m U represents 5 - Methyluracil modification.

[0124] (4) (MOE) is modified by 2'-O-MOE, and (CET) is modified by 2'-O-CET.

[0125] (5) Preparation of conjugated oligonucleotides

[0126] After the oligonucleotide sequence synthesized in the solid phase was completed, the 5'-dimethoxytriphenylmethyl (DMT) protecting group of the last nucleotide was removed using a 3% dichloroacetic acid toluene solution as a deprotecting agent to provide a free 5' hydroxyl group. The conjugate with phosphoramidite and protecting group on Am-Is-C6-GalNAc3 (1.75 equivalents in 0.2 M acetonitrile solution) was dried on a molecular sieve for 24 hours. Then, the conjugate was activated using a 1 M acetonitrile solution of 4,5-dicyanimidazolium as an activator to form an active intermediate. A corresponding volume of 0.1 M N-methylimidazolium was then used as an acid-binding agent to condense with the exposed 5'-hydroxyl group at the 5' end of the oligonucleotide for coupling. The coupling solution was circulated for 10 minutes and then washed with acetonitrile.

[0127] Oxidation was performed using a 0.05M iodine-pyridine solution (pyridine / water = 90:10) as the oxidant, followed by rinsing with acetonitrile.

[0128] The obtained conjugated oligonucleotides were treated with a 30% diethylamine acetonitrile solution for 45 minutes to remove the cyanoethoxy protecting group, followed by treatment with concentrated ammonia (25-30 wt%) to remove the protecting group. The product was then lysed from the solid support, and the lysed conjugated oligonucleotides were diluted with water and purified using an AKTA pilot 600 fully automated pilot-scale chromatography system on a strong anion exchange column (GE Healthcare Bioscience, Source 30Q, 30 μm, 2.54 x 8 cm, Solution A = 100 mM ammonium acetate solution (30% acetonitrile / water), Solution B = 1.5 M NaBr aqueous solution). The purified oligonucleotides were desalted by ultrafiltration to obtain 5'-Am-Is-C6-GalNAc3 conjugated oligonucleotides. The obtained products are shown in Table 2.

[0129] The conjugate with phosphoramide and protecting group on Am-Is-C6-GalNAc3 is shown in the following formula:

[0130]

[0131] Table 3: Conjugated Oligonucleotides

[0132]

[0133]

[0134] Note: The following group (abbreviated as 5'-Am-Is-C6-GalNAc3 phosphate) is concatenated at the 5' end of the sequence:

[0135]

[0136] 6. Selection of conjugating groups—Preparation of comparative examples

[0137] Select sequence numbers CT102-7 and CT102-9, and prepare CT102-7-D and CT102-9-D respectively using the same method as in step 5 above. The difference from CT102-7-Z and CT102-9-Z is that the conjugation group at the 5' end of the sequence is replaced as follows:

[0138]

[0139] Table 4

[0140] CT102-7-D <![CDATA[5′-C (MOE) m U (MOE)* m C (CET)* m CGGAG m C m CAGA m C (CET)* m U (CET) m U (MOE) -3′]]> CT102-9-D <![CDATA[5′-C (CET) m U (CET)* m C (CET)* m CGGAG m C m CAGA m C (CET)* m U (CET) m U (CET) -3′]]>

[0141] Example 2 Activity Assay - Cell Proliferation Inhibition Experiment - 1

[0142] 2.1 Experimental Materials

[0143] Test samples: Modified oligonucleotides prepared in Example 1: CT102-1, CT102-2, CT102-3, CT102-4, CT102-5, CT102 MOE5 and CT102 MOE5-1 ; among them CT102 MOE5 and CT102 MOE5-1 The modified sequence is a structure reported in Chinese patent publication CN114246829A, which serves as a comparison.

[0144] Cell type: Human non-small cell lung cancer cells NCI-H1299.

[0145] Positive control drug: Paclitaxel

[0146] 2.2 Experimental Methods

[0147] The MTT assay was used to detect the growth inhibition of the test samples on human non-small cell lung cancer cells NCI-H1299, with paclitaxel as a positive control.

[0148] 2.2.1 Cell Culture

[0149] Human non-small cell lung cancer (NSCLC) cells NCI-H1299 were resuscitated and passaged in culture dishes to the desired cell count. Passaged NCI-H1299 cells were then cultured in RPMI 1640 medium (supplemented with 100 μL / mL penicillin and streptomycin) at 37°C in a 5% CO2, saturated humidity incubator, with the medium changed daily and cell density checked. Cells were passaged using trypsin (0.25% Trypsin-0.53 mM EDTA) until most cells became rounded and detached. Cells were collected, centrifuged at 1000 RPM for 5 minutes, the supernatant discarded, and fresh medium added to prepare a cell suspension. Cell counts were performed to adjust the cell concentration to 4 × 10⁶ cells / mL. 4 / ml of cell suspension.

[0150] 2.2.2 Cell transfection

[0151] Add 100 μL of the medium to each well of a 96-well cell culture plate, with 4000 cells per well. After ensuring cell adhesion, aspirate the medium, wash once with PBS phosphate-buffered saline, and then replace with serum-free (Opti-MEM) medium.

[0152] Prepare the transfection reagent according to the instructions for Lipofectamine 3000 liposome transfection reagent: Solution A: Add 0.2 μL of Lipo3000 transfection reagent to 5 μL of Opti-MEM medium, vortex to mix, and centrifuge briefly, then let stand for 5 min; Solution B: Add the corresponding concentrations of the sample to be transfected (final concentrations: 75 nmol / L, 150 nmol / L, and 300 nmol / L, respectively) to 5 μL of Opti-MEM medium, then add 0.4 μL of P3000 reagent, vortex to mix, and centrifuge briefly, then let stand for 5 min; Add solution B to solution A, mix gently, centrifuge briefly, and incubate at room temperature for 15 min;

[0153] Add the incubated transfection reagent to the prepared cells and set up three parallel wells; in addition, set up a blank control group (no reagent added, only cells) and a positive control group (paclitaxel, administration concentration of 7.5 μg / mL).

[0154] Six hours after transfection, the culture medium in each well was aspirated, and 100 μL of normal culture medium containing serum was added back to each well. The wells were then placed in a 37°C, 5% CO2 incubator for further incubation, and the incubation status was observed.

[0155] 2.2.3 Cell proliferation detection

[0156] After 72 hours of incubation, 10 μL of 0.5% MTT solution was added to each well, and the wells were placed in a 37°C, 5% CO2 incubator for another 4 hours. The supernatant was then removed, and 150 μL of dimethyl sulfoxide was added to each well. The wells were then shaken at low speed for 10 minutes to fully dissolve the crystals. The absorbance (OD) at 490 nm was measured using a multi-mode microplate reader (Wallac Biotechnology, USA).

[0157] 2.2.4 Data Processing

[0158] Formula for calculating expression inhibition rate:

[0159] Inhibition rate (%) = [(OD value of blank control group - OD value of experimental group) / OD value of blank control group] × 100%.

[0160] 2.3 Experimental Results

[0161] See Table 5

[0162] Table 5: Inhibition rate of modified oligonucleotides on the expression of human non-small cell lung cancer cells NCI-H1299

[0163]

[0164] As shown in Table 5, the seven modified oligonucleotides (CT102-1, CT102-2, CT102-3, CT102-4, CT102-5, CT102...) MOE5 and CT102 MOE5-1 It showed inhibitory activity against the proliferation of human non-small cell lung cancer cells NCI-H1299. It exhibited certain inhibitory activity at 75 nmol / L, and the inhibitory effect increased with increasing concentration. Furthermore, different concentrations of CT102-1, CT102-2, CT102-3, CT102-4, CT102-5, and CT102... MOE5 and CT102 MOE5-1 The inhibition rates against NCI-H1299 cells were as follows:

[0165] At a drug concentration of 75 nmol / L, the inhibition rates were 36.37%, 50.64%, 53.93%, 50.62%, 50.49%, 41.61%, and 33.51%, respectively.

[0166] At a drug concentration of 300 nmol / L, the inhibition rates were 51.68%, 63.20%, 66.50%, 73.31%, 60.92%, 50.05%, and 43.86%, respectively; the order of inhibition intensity from highest to lowest was: CT102-4, CT102-3, CT102-2, CT102-5, CT102-1, and CT102... MOE5 and CT102 MOE5-1 .

[0167] Example 3 Activity Assay - Cell Proliferation Inhibition Experiment - 2

[0168] 3.1 Experimental Materials

[0169] Test sample:

[0170] The modified oligonucleotides synthesized in Example 1: CT102-1, CT102-2, CT102-3, CT102-4, CT102-5, CT102 MOE5 and CT102 MOE5-1 .

[0171] Cell type: Human pancreatic cancer cells PANC-1.

[0172] Positive control drug: Paclitaxel

[0173] 3.2 Experimental Methods

[0174] The MTT assay was used to detect the inhibitory effect of the test samples on the growth of human pancreatic cancer cells PANC-1, with paclitaxel as a positive control.

[0175] The experimental procedure is the same as in Example 2, except that:

[0176] The culture medium was changed to 10% fetal bovine serum DMEM medium, replacing the 10% fetal bovine serum RPMI1640 medium in Example 2.

[0177] 3.3 Experimental Results

[0178] See Table 6

[0179] Table 6: Inhibition rate of modified oligonucleotides on the expression of PANC-1 in human pancreatic cancer cells

[0180]

[0181] As shown in Table 6, the seven modified oligonucleotides (CT102-1, CT102-2, CT102-3, CT102-4, CT102-5, CT102...) MOE5 and CT102 MOE5-1 It exhibits inhibitory activity against the proliferation of human pancreatic cancer cells PANC-1. It shows some inhibitory activity at 75 nmol / L, and the inhibitory effect increases with increasing concentration.

[0182] Seven modified oligonucleotides (CT102-1, CT102-2, CT102-3, CT102-4, CT102-5, CT102...) MOE5 and CT102 MOE5-1 At a drug concentration of 300 nmol / L, the inhibition rates were 50.79%, 64.85%, 63.88%, 76.37%, 65.02%, 51.42%, and 46.66%, respectively; the order of inhibition intensity from highest to lowest was: CT102-4, CT102-5, CT102-2, CT102-3, CT102 MOE5 CT102-1 and CT102 MOE5-1 .

[0183] Example 4 Activity Assay - Cell Proliferation Inhibition Experiment - 3

[0184] 4.1 Experimental Materials

[0185] Test sample:

[0186] The modified oligonucleotides synthesized in Example 1: CT102-1, CT102-2, CT102-3, CT102-4, CT102-5, CT102 MOE5 and CT102 MOE5-1 .

[0187] Cell type: Human liver cancer cells Hep3B

[0188] Positive control drug: Paclitaxel

[0189] 4.2 Experimental Methods

[0190] The MTT assay was used to detect the inhibitory effect of the test samples on the growth of human hepatocellular carcinoma cells Hep3B, with paclitaxel as a positive control.

[0191] The experimental procedure is the same as in Example 2, except that:

[0192] The culture medium was changed to 10% fetal bovine serum DMEM medium, replacing the 10% fetal bovine serum RPMI1640 medium in Example 2.

[0193] 4.3 Experimental Results

[0194] See Table 7

[0195] Table 7: Inhibition rate of modified oligonucleotides on the expression of Hep3B liver cancer cells

[0196]

[0197] As shown in Table 7, the seven modified oligonucleotides (CT102-1, CT102-2, CT102-3, CT102-4, CT102-5, CT102...) MOE5 and CT102 MOE5-1 It exhibits inhibitory activity against the proliferation of human hepatocellular carcinoma cells (Hep3B). It shows some inhibitory activity at 75 nmol / L, and the inhibitory effect increases with increasing concentration.

[0198] Seven modified oligonucleotides (CT102-1, CT102-2, CT102-3, CT102-4, CT102-5, CT102...) MOE5 and CT102 MOE5-1 At a drug concentration of 300 nmol / L, the inhibition rates were 54.74%, 63.92%, 63.13%, 74.23%, 59.23%, 55.32%, and 51.67%, respectively; the order of inhibition intensity from highest to lowest was: CT102-4, CT102-2, CT102-3, CT102-5, and CT102... MOE5 CT102-1 and CT102 MOE5-1 .

[0199] 4.4 Summary of Examples 2-4

[0200] 4.4.1 Experiment Summary

[0201] Seven modified oligonucleotides (CT102-1, CT102-2, CT102-3, CT102-4, CT102-5, CT102...) MOE5and CT102 MOE5-1 At the highest concentration, the inhibition rates and order of inhibition strength varied slightly among the three different cancer cell types. However, the overall order of inhibition strength from strongest to weakest was: CT102-4 was the strongest; CT102-2, CT102-3, and CT102-5 were in the middle. The order of strength among these three was not entirely consistent for different cell types. Furthermore, CT102-1 and CT102... MOE5 However, the order of strength between these two factors is not entirely consistent across different cell types; CT102 MOE5-1 It is the weakest.

[0202] Specifically:

[0203] and CT102 MOE5-1 Compared to other methods, CT102-1 increased the inhibition rate of expression in human non-small cell lung cancer cells NCI-H1299 by 4.82%, indicating that CT102-1 has better biological activity.

[0204] and CT102 MOE5-1 Compared to the previous method, CT102-1 increased the inhibition rate of PANC-1 expression in human pancreatic cancer cells by 4.13%, and CT102-1 showed better biological activity.

[0205] and CT102 MOE5-1 Compared to the previous method, CT102-1 increased the inhibition rate of Hep3B human liver cancer cells by 3.07%, and CT102-1 showed better biological activity.

[0206] CT102 MOE5 The inhibition rates of CT102-1 and NCI-H1299 human non-small cell lung cancer cells were 50.05% and 51.68%, respectively, with no significant difference.

[0207] CT102 MOE5 The inhibition rates of PANC-1 expression in human pancreatic cancer cells by CT102-1 and CT102-1 were 51.42% and 50.79%, respectively, with no significant difference.

[0208] CT102 MOE5 The inhibition rates of CT102-1 and CT102-1 on the expression of Hep3B cells in human liver cancer cells were 55.32% and 54.74%, respectively, with no significant difference.

[0209] CT102 MOE5-1 Compared to CT102-1, the difference in their chemical structures lies in the fact that both have the same number of methylated cytosine molecules (5), but the positions of these methylations differ: CT102... MOE5-1 The methylation modification of cytosine is located at 5′- m Um C m C m U m CCGGAGCCAGA m C m U m U m The cytosine methylation modification of CA-3′, CT102-1 is located at 5′- m UCC m U m C m CGGAG m C m CAGA m C m U m UCA-3′.

[0210] CT102 MOE5 Compared to CT102-1, the difference in its chemical structure is: CT102 MOE5 The methylation modification of cytosine is located at 5′- m U m C m C m U m C m CGGAG m C m CAGA m C m U m U m The cytosine methylation modification of CA-3′, CT102-1 is located at 5′- m UCC m U m C m CGGAG m C m CAGA m C m U m UCA-3′; and CT102 MOE5 In comparison, the CT102-1 sequence contains 5 methylated cytosine residues, while CT102... MOE5 The sequence contains 8 methylated cytosine compounds.

[0211] Compared with CT102-1, CT102-2, CT102-3, CT102-4 and CT102-5 showed better inhibition of Hep3B expression in human liver cancer cells. Compared with CT102-1, the latter four sequences had a reduction of 4 bases from 20 to 16, shortening the sequence by 20%. At the same time, the 2' position of the ribose in the latter four sequences was modified with CET.

[0212] 4.4.2 Experimental Conclusions:

[0213] The selection of the amount and position of cytosine methylation is crucial for oligonucleotide modification, with the methylation position being 5′-. m U m C m C m U m CCGGAGCCAGA m C m U m U m CA-3′, the methylation modification site is 5′- m UCC m U m C m CGGAG m C m CAGA m C m U m UCA-3′ exhibits better biological activity.

[0214] By modifying the ribose 2' position using the CET method, the base sequence can be shortened from 20 to 16 bases while maintaining the same or better biological activity.

[0215] Modified oligonucleotides can more effectively inhibit the proliferation of lung cancer, pancreatic cancer, and liver cancer cells, and can be better used to treat lung cancer, pancreatic cancer, and liver cancer.

[0216] Example 5 Activity Assay - Cell Proliferation Inhibition Experiment - 4

[0217] 5.1 Experimental Materials

[0218] Test samples: Modified oligonucleotides prepared in Example 1: CT102-1, CT102-2, CT102-3, CT102-4, CT102-5, CT102 MOE5 and CT102 MOE5-1 .

[0219] Cell type: Human liver cancer cells (HepG2)

[0220] Positive control: Paclitaxel

[0221] 5.2 Experimental Methods

[0222] The MTT assay was used to detect the inhibitory effect of the test samples on the growth of human liver cancer cells (HepG2), with paclitaxel as a positive control.

[0223] The experimental procedure is the same as in Example 2, except that:

[0224] The culture medium was changed to 10% fetal bovine serum DMEM medium, replacing the 10% fetal bovine serum RPMI1640 medium in Example 2.

[0225] The final concentration of the sample to be transfected was adjusted to a maximum concentration of 300 nmol / L, replacing the original three concentrations (75 nmol / L, 150 nmol / L, and 300 nmol / L).

[0226] The number of replicates for each sample was adjusted to 6 replicates for the same concentration, instead of 3 replicates for each concentration in Example 2. The number of replicates for the blank control group and the positive control group was also adjusted to 6, instead of 3 replicates for each concentration in Example 2. The experiment was repeated twice.

[0227] Perform statistical analysis.

[0228] 5.3 Experimental Results

[0229] See Table 8 and Figure 1

[0230] Table 8: Inhibition rate of modified oligonucleotides on the expression of human hepatocellular carcinoma cells (HepG2)

[0231] CT102-1 60.43±4.14 CT102-2 68.75±4.50 CT102-3 69.06±4.66 CT102-4 75.26±4.79 CT102-5 63.64±4.08 <![CDATA[CT102 MOE5 ]]> 61.78±4.17 <![CDATA[CT102 MOE5-1 ]]> 53.08±3.73 Positive control 64.08±4.24

[0232] As shown in Table 8, the seven modified oligonucleotides (CT102-1, CT102-2, CT102-3, CT102-4, CT102-5, CT102...) MOE5 and CT102 MOE5-1 It has an inhibitory effect on the proliferation of human liver cancer cells (HepG2):

[0233] The inhibition rates of the seven modified oligonucleotides (CT102-1, CT102-2, CT102-3, CT102-4, CT102-5, CT102MOE5, and CT102MOE5-1) at a drug concentration of 300 nmol / L were 60.43%, 68.75%, 69.06%, 75.26%, 63.64%, 61.78%, and 53.08%, respectively.

[0234] The order of suppression intensity from largest to smallest is: CT102-4, CT102-3, CT102-2, CT102-5, CT102 MOE5 CT102-1 and CT102 MOE5-1 ;

[0235] CT102-4 showed the highest expression inhibition rate and the strongest effect, while CT102...MOE5-1 Weakest;

[0236] The expression inhibition rates of CT102-3 and CT102-2 were 69.06% and 68.75%, respectively, with no significant difference.

[0237] The expression inhibition rates of CT102-2 and CT102-5 differed by 5.11%.

[0238] CT102 MOE5 The inhibition rates of CT102-1 and CT102-1 on the expression of human hepatocellular carcinoma (HepG2) cells were 61.78% and 60.43%, respectively, with a difference of 1.35%, which was not statistically significant.

[0239] and CT102 MOE5-1 In comparison, CT102-1 significantly increased the inhibition rate of human hepatocellular carcinoma (HepG2) cell expression by 7.35% (P<0.05).

[0240] 5.4 Experiment Summary

[0241] As shown in Table 8, the modified CT102 oligonucleotide sequence exhibits a high affinity for the target gene IGF-1R in human hepatocellular carcinoma (HepG2) cells, effectively inhibiting the expression of the target gene and thus suppressing the proliferation of hepatocellular carcinoma cells. Compared with existing modification methods, the modification method disclosed herein for the CT102 oligonucleotide sequence demonstrates a better inhibitory effect on cell proliferation. Specifically:

[0242] and CT102 MOE5-1 In comparison, CT102-1 significantly increased the inhibition rate of human hepatocellular carcinoma (HepG2) cell expression by 7.35% (P<0.05);

[0243] CT102 MOE5-1 Compared to CT102-1, the chemical structure is basically the same, the difference being that CT102... MOE5-1 The methylation modification of cytosine is located at 5′- m U m C m C m U m CCGGAGCCAGA m C m U m U m The cytosine methylation modification of C A-3′, CT102-1 is located at 5′- m UCC m U m C m CGGAG m C mCAGA m C m U m UCA-3′; CT102-1 and CT102 MOE5-1 The number of methylated cytosines in the sequences is the same, both being 5, but the positions of the modifications in the sequences are different.

[0244] Compared to CT102 MOE5-1 CT102-1 increased the expression inhibition rate of human hepatocellular carcinoma (HepG2) cells by 7.35%, and CT102-1 has better biological activity;

[0245] and CT102 MOE5 In comparison, the inhibition rate of CT102-1 on human hepatocellular carcinoma (HepG2) cells was basically the same;

[0246] Compared with CT102-1, CT102-2, CT102-3, CT102-4 and CT102-5 have a better inhibitory effect on the expression rate of human liver cancer (HepG2) cells. Compared with CT102-1, the number of bases in the latter sequence is reduced from 20 to 16, a reduction of 4 bases and a shortening of 20%. At the same time, the 2' position of the ribose in the latter four sequences adopts the CET modification method.

[0247] 5.5 Conclusion

[0248] The selection of the amount and position of cytosine methylation is crucial for oligonucleotide modification, with the methylation position being 5′-. m U m C m C m U m CCGGAGCCAGA m C m U m U m CA-3′, the methylation modification site is 5′- m UCC m U m C m CGGAG m C m CAGA m C m U m UCA-3′ exhibits better biological activity.

[0249] By modifying the ribose 2' position using the CET method, the base sequence can be shortened from 20 to 16 bases while maintaining the same or better biological activity.

[0250] Example 6 Cytotoxicity Detection-1

[0251] 6.1 Experimental Materials

[0252] Test samples: Modified oligonucleotides prepared in Example 1: CT102-1, CT102-2, CT102-3, CT102-4, CT102-5, CT102 MOE5 and CT102 MOE5-1 .

[0253] Cell type: Normal human hepatocytes (L-02).

[0254] Positive control: Paclitaxel

[0255] 6.2 Experimental Methods

[0256] The inhibitory effect of the test samples on the growth of normal human hepatocytes (L-02) was detected by a similar MTT assay, with paclitaxel as a positive control.

[0257] 6.2.1 Cell Culture

[0258] Human normal hepatocytes (L-02) were passaged and cultured in DMEM medium supplemented with 10% fetal bovine serum (100 μL / mL penicillin and streptomycin). The cells were incubated at 37°C, 5% CO2, and saturated humidity, with the medium changed daily and cell density checked. Cells were then passaged using a digestion solution (0.25% Trypsin-0.53 mM EDTA) until most cells became rounded and detached. Cells were collected, centrifuged at 1000 RPM for 5 minutes, the supernatant discarded, and fresh medium added to prepare a cell suspension. Cell counts were performed to adjust the cell concentration to 8 × 10⁶ cells / mL. 4 / ml of cell suspension.

[0259] 6.2.2 Cell Transfection

[0260] Add 100 μL of the medium to each well of a 96-well cell culture plate, with 8000 cells per well. After ensuring cell adhesion, aspirate the medium, wash once with PBS phosphate-buffered saline, and then replace with serum-free (Opti-MEM) medium.

[0261] The transfection reagent was prepared according to the liposome transfection reagent Lipofectamine 3000: Solution A: Add 0.3 μL of Lipo3000 transfection reagent to 5 μL of Opti-MEM medium, vortex to mix, and centrifuge briefly, then let stand for 5 min; Solution B: Add the corresponding concentration of the sample to be transfected (final concentration: 1200 nmol / L) to 5 μL of Opti-MEM medium, then add 0.6 μL of Lipo3000 reagent, vortex to mix, and centrifuge briefly, then let stand for 5 min; Add solution B to solution A, mix gently, centrifuge briefly, and incubate at room temperature for 15 min;

[0262] The incubated transfection reagent was added to the prepared cells, and six parallel replicates were set up. A blank control group (liposome transfection reagent without drug loading) and a positive control group (paclitaxel, drug concentration of 7.5 μg / mL) were also set up. The experiment was repeated twice.

[0263] Six hours after transfection, the culture medium in each well was discarded, and 100 μL of normal culture medium containing serum was added to each well. The wells were then placed in a 37°C, 5% CO2 incubator for further incubation, and the incubation status was observed.

[0264] 6.2.3 Cell proliferation detection

[0265] After 72 hours of incubation, 10 μL of 0.5% MTT solution was added to each well, and the wells were placed in a 37°C, 5% CO2 incubator for another 4 hours. The supernatant was then removed, and 150 μL of dimethyl sulfoxide was added to each well. The wells were then shaken at low speed for 10 minutes to fully dissolve the crystals. The absorbance (OD) at 490 nm was measured using a multi-mode microplate reader (Wallac Biotechnology, USA).

[0266] 6.2.4 Data Processing

[0267] Formula for calculating cell viability:

[0268] Cell viability (%) = (OD value of experimental group / OD value of blank control group) × 100%.

[0269] 6.3 Experimental Results

[0270] See Table 9 and Figure 2 .

[0271] Table 9: Cell viability of modified oligonucleotides -1

[0272] CT102-1 80.79±4.19 CT102-2 88.04±5.29 CT102-3 82.90±4.71 CT102-4 71.44±4.55 CT102-5 81.46±4.63 <![CDATA[CT102 MOE5 ]]> 73.06±4.05 <![CDATA[CT102 MOE5-1 ]]> 79.85±4.31 Positive control 65.08±4.82

[0273] As shown in Table 9, the cytotoxicity test results of the seven modified oligonucleotides (CT102-1, CT102-2, CT102-3, CT102-4, CT102-5, CT102-6, CT102-7, CT102-8, CT102-9, CT102- ...MOE5 and CT102 MOE5-1 At certain dosage concentrations, these drugs exhibit cytotoxicity against the growth of normal human hepatocytes (L-02), inhibiting their growth. However, there are significant differences between these drugs.

[0274] Seven modified oligonucleotides (CT102-1, CT102-2, CT102-3, CT102-4, CT102-5, CT102...) MOE5 and CT102 MOE5-1 At a drug concentration of 1200 nmol / L, the cell viability (inversely proportional to cytotoxicity) were 80.79%, 88.04%, 82.90%, 71.44%, 81.46%, 73.06%, and 79.85%, respectively.

[0275] The order of cytotoxicity from lowest to highest is: CT102-2, CT102-3, CT102-5, CT102-1, CT102 MOE5-1 CT102 MOE5 and CT102-4;

[0276] CT102-2 showed the lowest cytotoxicity against human hepatocellular carcinoma (HepG2) cells;

[0277] Compared with CT102-2, CT102-5 showed a significant increase of 6.58% in cytotoxicity against human hepatocellular carcinoma (HepG2) cells;

[0278] Compared with CT102-2, CT102-3 showed a significant increase of 5.14% in cytotoxicity against human hepatocellular carcinoma (HepG2) cells;

[0279] and CT102 MOE5 In comparison, CT102-1 significantly reduced the cytotoxicity of human hepatocellular carcinoma (HepG2) cells by 7.73% (P<0.05), showing a significant difference and a significant reduction in cytotoxicity;

[0280] and CT102 MOE5-1 In comparison, the cytotoxicity of CT102-1 against human hepatocellular carcinoma (HepG2) cells differed by 0.94%, which was not significant.

[0281] 6.4 Experiment Summary

[0282] As shown in Tables 8 and 9, the modified CT102 sequence oligonucleotides, while acting on human hepatocellular carcinoma cells (HepG2), also exhibited cytotoxicity against normal human hepatocytes (L-02), inhibiting their growth. However, the efficacy and cytotoxicity varied significantly among samples with different chemical structures. The drug activity against human hepatocellular carcinoma cells (HepG2) was significantly enhanced, and the cytotoxicity against normal human hepatocytes (L-02) was somewhat mitigated. Specifically:

[0283] And the CT102 in the already disclosed prior art MOE5 In comparison, CT102-1 showed slightly lower drug activity (expression inhibition rate) against human hepatocellular carcinoma (HepG2) cells (1.35%), with no significant difference. However, CT102-1 significantly reduced the cytotoxicity (inversely proportional to cell survival) of normal human hepatocytes (L-02) by 7.73% (P<0.05).

[0284] CT102 MOE5 Compared to CT102-1, the difference in its chemical structure is: CT102 MOE5 The methylation modification of cytosine is located at 5′- m U m C m C m U m C m CGGAG m C m CAGA m C m U m U m The cytosine methylation modification of CA-3′, CT102-1 is located at 5′- m UCC m U m C m CGGAG m C m CAGA m C m U m UCA-3′; and CT102 MOE5 In comparison, the CT102-1 sequence contains 5 methylated cytosine residues, while CT102... MOE5 The sequence contains 8 methylated cytosine molecules, indicating that appropriately reducing the number of methylated cytosine molecules can improve safety.

[0285] Compared to CT102 MOE5 The modification method using CT102-1 was employed, which reduced the number of methylated cytosine molecules to five, with the selected methylation position being 5′-.m UCC m U m C m CGGAG m C m CAGA m C m U m When using UCA-3′, cytotoxicity can be significantly reduced while maintaining biological activity.

[0286] And the CT102 in the already disclosed prior art MOE5-1 In comparison, CT102-1 showed a significant increase in drug activity (expression inhibition rate) against human hepatocellular carcinoma (HepG2) cells by 7.35% (P < 0.05); however, the cytotoxicity of CT102-1 against human hepatocellular carcinoma (HepG2) cells (inversely proportional to cell survival) was only 0.94%, which was not statistically significant.

[0287] CT102 MOE5-1 Compared to CT102-1, the chemical structure is basically the same, the difference being that CT102... MOE5-1 The methylation modification of cytosine is located at 5′- m U m C m C m U m CCGGAGCCAGA m C m U m U m The cytosine methylation modification of C A-3′, CT102-1 is located at 5′- m UCC m U m C m CGGAG m C m CAGA m C m U m UCA-3′; CT102-1 and CT102 MOE5-1 The number of methylated cytosine molecules in the sequences is the same, both being 5, but the positions of the methylation in the sequences are different.

[0288] Compared to CT102 MOE5-1 The drug activity of CT102-1 against human hepatocellular carcinoma (HepG2) cells was significantly improved by 7.35% (P<0.05), indicating that CT102-1 had better biological activity; while the cytotoxicity against human hepatocellular carcinoma (HepG2) cells was basically the same.

[0289] This demonstrates that the choice of the amount and location of cytosine methylation modifications is crucial for oligonucleotide modification.

[0290] Compared with CT102-5, CT102-2 significantly increased the drug activity (expression inhibition rate) of human hepatocellular carcinoma (HepG2) cells by 5.11%, and significantly reduced the cytotoxicity (inversely proportional to cell survival) of CT102-2 on normal human hepatocytes (L-02) by 6.58%.

[0291] The chemical structures of CT102-2 and CT102-5 are basically similar, with the only difference being that the methylation modification of cytosine in CT102-5 is at the 5′- m C m U m C m CGGAG m C m CAGAC m U m The cytosine methylation modification of U-3′, CT102-2 is located at 5′-C. m U m C m CGGAG m C m CAGA m C m U m U-3′; CT102-1 and CT102 MOE5-1 Both sequences contain five methylated cytosine residues, but the positions of these residues differ. The former methylates the five cytosine residues at the 3' end, while the latter methylates the five cytosine residues at the 5' end. This demonstrates that the choice of modification position is crucial.

[0292] 6.5 Conclusion:

[0293] In the treatment of liver cancer, compared with the existing technology CT102 MOE5 and CT102 MOE5-1 The modification method using CT102-1 was employed, which reduced the number of methylated cytosine molecules to five, with the selected methylation position being 5′-. m UCC m U m C m CGGAG m C m CAGA m C m U m When using UCA-3′, cytotoxicity can be significantly reduced while maintaining biological activity;

[0294] By modifying the 2' position of the ribose using the CET method, the base sequence can be shortened from 20 to 16 bases while maintaining the same or better biological activity. Combined with the appropriate selection of the methylation site for cytosine, the 5'-C position was chosen for methylation modification. m U m C m CGGAG m C m CAGA m C m U m When using U-3′, cytotoxicity can be significantly reduced while maintaining biological activity.

[0295] Example 7 Cytotoxicity Detection - 2

[0296] 7.1 Experimental Materials

[0297] Test samples: Modified oligonucleotides prepared in Example 1: CT102-1, CT102-2, CT102-3, CT102-4, CT102-5, CT102 MOE5 and CT102 MOE5-1 ;

[0298] Cell type: Human normal lung epithelial cells BEAS-2B;

[0299] Positive control: Paclitaxel

[0300] 7.2 Experimental Methods

[0301] The MTT assay was used to detect the inhibitory effect of the test samples on the growth of normal human lung epithelial cells BEAS-2B, with paclitaxel as a positive control.

[0302] The experimental procedure is the same as in Example 6, except that:

[0303] The culture medium was changed to 10% fetal bovine serum RPMI 1640 medium, replacing the 10% fetal bovine serum DMEM medium in Example 6.

[0304] 7.3 Experimental Results

[0305] See Table 10 and Figure 3 .

[0306] Table 10: Cell viability of modified oligonucleotides -2

[0307]

[0308]

[0309] As shown in Table 10, the cytotoxicity test results of the seven modified oligonucleotides (CT102-1, CT102-2, CT102-3, CT102-4, CT102-5, CT102-6, CT102-7, CT102-8, CT102-9, CT102- ... MOE5 and CT102 MOE5-1 At certain drug concentrations, it exhibits cytotoxicity on the growth of normal human lung epithelial cells (BEAS-2B) and inhibits the growth of normal liver cells, but there are significant differences between these studies.

[0310] The cell viability (inversely proportional to cytotoxicity) of the seven modified oligonucleotides (CT102-1, CT102-2, CT102-3, CT102-4, CT102-5, CT102MOE5, and CT102MOE5-1) at a drug concentration of 1200 nmol / L was 81.44%, 86.97%, 83.06%, 68.56%, 78.11%, 71.89%, 75.95%, and 62.16%, respectively.

[0311] The order of cytotoxicity from lowest to highest is: CT102-2, CT102-3, CT102-1, CT102-5, CT102 MOE5-1 CT102 MOE5 and CT102-4;

[0312] CT102-2 showed the lowest cytotoxicity against normal human lung epithelial cells BEAS-2B.

[0313] Compared with CT102-2, CT102-3 showed a 3.91% increase in cytotoxicity against normal human lung epithelial cells BEAS-2B.

[0314] Compared with CT102-2, CT102-5 showed a significant increase in cytotoxicity against normal human lung epithelial cells BEAS-2B by 8.86% (P<0.05), indicating a significant increase in cytotoxicity.

[0315] and CT102 MOE5 Compared to CT102-1, CT102-1 showed a 9.55% reduction in cytotoxicity against normal human lung epithelial cells BEAS-2B (P<0.05), which was statistically significant, indicating a significant decrease in cytotoxicity.

[0316] and CT102 MOE5-1 In comparison, CT102-1 showed a significant reduction of 5.49% in cytotoxicity against normal human lung epithelial cells BEAS-2B.

[0317] 7.4 Experiment Summary

[0318] As shown in Tables 4 and 9, the modified CT102 sequence oligonucleotides, while effective against human non-small cell lung cancer cells (NCI-H1299), also exhibit cytotoxicity against normal human lung epithelial cells (BEAS-2B), inhibiting their growth. However, the efficacy and cytotoxicity varied significantly among samples with different chemical structures. Modification of the CT102 sequence oligonucleotides using the method disclosed in this paper significantly enhanced the drug activity against human non-small cell lung cancer cells (NCI-H1299) and improved the cytotoxicity against normal human lung epithelial cells (BEAS-2B). Specifically:

[0319] and CT102 MOE5 In comparison, CT102-1 showed 1.63% lower drug activity (expression inhibition rate) against human non-small cell lung cancer cells NCI-H1299, and significantly reduced 9.55% (P<0.05) cytotoxicity (inversely proportional to cell survival) against normal human lung epithelial cells BEAS-2B.

[0320] CT102 MOE5 Compared to CT102-1, the difference in its chemical structure is: CT102 MOE5 The methylation modification of cytosine is located at 5′- m U m C m C m U m C m CGGAG m C m CAGA m C m U m U m The cytosine methylation modification of CA-3′, CT102-1 is located at 5′- m UCC m U m C m CGGAG m C m CAGA m C m U m UCA-3′; and CT102 MOE5 In comparison, the CT102-1 sequence contains 5 methylated cytosine residues, while CT102... MOE5 The sequence contains 8 methylated cytosine molecules, indicating that appropriately reducing the number of methylated cytosine molecules can improve safety.

[0321] Compared to CT102 MOE5-1The drug activity of CT102-1 against human non-small cell lung cancer cells NCI-H1299 was increased by 4.82%, while its cytotoxicity against normal human lung epithelial cells BEAS-2B was significantly reduced by 5.49%.

[0322] Choosing the amount and location of cytosine methylation modifications is crucial for the structural modification of oligonucleotides;

[0323] Compared with CT102-5, CT102-2 increased the drug activity (expression inhibition rate) of human non-small cell lung cancer cells NCI-H1299 by 2.28%, and reduced the cytotoxicity of CT102-2 on human normal lung epithelial cells BEAS-2B by 8.86% (P<0.05).

[0324] CT102-2 and CT102-5 have essentially the same chemical structure, with the only difference being that the methylation modification of cytosine in CT102-5 is at the 5′- m C m U m C m C m GGAG m C m CAGAC m U m The cytosine methylation modification of U-3′, CT102-2 is located at 5′-C. m U m C m CGGAG m C m CAGA m C m U m U-3′; CT102-1 and CT102 MOE5-1 Both sequences contain five methylated cytosine residues, but the positions of these residues differ. The former methylates the five cytosine residues at the 3' end, while the latter methylates the five cytosine residues at the 5' end. This demonstrates that the choice of modification position is crucial.

[0325] 6.5 Conclusion:

[0326] In the treatment of lung cancer, compared with the existing technology CT102 MOE5 and CT102 MOE5-1 The modification method using CT102-1 was employed, which reduced the number of methylated cytosine molecules to five, with the selected methylation position being 5′-. m UCC m U m C mCGGAG m C m CAGA m C m U m When using UCA-3′, cytotoxicity can be significantly reduced while maintaining biological activity.

[0327] By modifying the 2' position of the ribose using the CET method, the base sequence can be shortened from 20 to 16 bases while maintaining the same or better biological activity. Combined with the appropriate selection of the cytosine methylation position, the 5'-C position was chosen for cytosine methylation modification. m U m C m CGGAG m C m CAGA m C m U m U-3′ can better reduce cytotoxicity while maintaining biological activity.

[0328] Example 8: In vivo activity assay of conjugated oligonucleotides

[0329] 8.1 Mouse orthotopic transplantation model of liver cancer

[0330] 8.1-1 Experimental Materials

[0331] Test samples: Conjugated oligonucleotides prepared in Example 1: CT102-1-Z, CT102-2-Z, CT102-4-Z, CT102-5-Z, CT102-6-Z, CT102-7-Z, CT102-8-Z, CT102-9-Z, CT102-10-Z, CT102-7-D, CT102-9-D, CT102 MOE5-1 -Z;

[0332] Positive control drug: Sorafenib;

[0333] Cell type: Human liver cancer cells HepG2;

[0334] Experimental animals: BALB / c nude mice; 4-5 weeks old, 16-18g;

[0335] 8.1-2 Experimental Methods

[0336] HepG2 human liver cancer cells in the logarithmic growth phase were digested with 0.25% trypsin, centrifuged, and then resuspended in phosphate-buffered saline (PBS). Cell counts were adjusted to obtain a concentration of approximately 5 × 10⁻⁶ cells / mL. 7 A cell suspension of 1 cell / ml is prepared for later use.

[0337] BALB / c nude mice were acclimatized for one week and fasted for 12 hours before the experiment. BALB / c mice were anesthetized with 5% chloral hydrate. After anesthesia took effect, the mice were fixed in a supine position on a board. A small transverse incision of approximately 1 cm was made in the left abdominal cavity after disinfection with alcohol to expose the liver. The left lobe of the liver was gently pulled out with a saline-moistened cotton swab to fully expose it. Cell suspension was taken using a 25 μl microsyringe and injected at a dose of 25 μl per mouse, along the edge of the left lobe of the liver capsule, at a 20° angle to the liver plane. 0 Insert the needle about 1.5cm (press the needle insertion point) and slowly inject into the left lobe of the liver. After successful injection, apply pressure with a cotton swab for 2-3 minutes to stop bleeding and prevent leakage of tumor cells. Then, put the liver back into its original position in the body and suture the incision layer by layer with silk thread. Apply antibiotics to disinfect the wound and place it in a 37°C incubator. After the operation, all tumor-bearing mice are temporarily separated and kept warm at 37°C until they are fully awake. After they are awake, they are fed a normal diet.

[0338] Inject 25 μL of tumor cells slowly using a syringe.

[0339] One week later, mice were anesthetized with 5% chloral hydrate and injected intraperitoneally with luciferin at a concentration of 150 mg / kg. Fluorescence in vivo imaging was performed 10 minutes after substrate injection to monitor the growth of in situ tumors. Mice that died or did not develop tumors were removed.

[0340] 8.2 Grouping and Dosing

[0341] Mice that successfully developed the model were selected and divided into the following groups of 8 mice each: CT102-1-Z, CT102-2-Z, CT102-4-Z, CT102-5-Z, CT102-6-Z, CT102-7-Z, CT102-8-Z, CT102-9-Z, CT102-10-Z, CT102-7-D, CT102-9-D, and CT102... MOE5-1 -Z group, positive control group, and blank control group; via the tail vein, CT102-1-Z, CT102-2-Z, CT102-4-Z, CT102-5-Z, CT102-6-Z, CT102-7-Z, CT102-8-Z, CT102-9-Z, CT102-10-Z, CT102-7-D, CT102-9-D, and CT102 prepared in Example 1 were administered respectively. MOE5-1-Z, the dosage was 0.45 mg / kg; the blank control group was given phosphate buffer; the administration time was once every 48 hours via tail vein injection, for 30 consecutive days, for a total of 15 administrations; the positive control group was given sorafenib at a dosage of 30 mg / kg, once every 48 hours via gavage, for 30 consecutive days, for a total of 15 administrations.

[0342] The body weight of tumor-bearing mice was measured weekly, and changes in body weight were recorded to assess the toxic side effects of each treatment group.

[0343] On the third day after drug withdrawal, blood was collected from the ocular venous plexus of tumor-bearing nude mice. The alpha-fetoprotein (AFP) level of the tumor-bearing nude mice was detected by radioimmunoassay. The tumor-bearing mice were sacrificed, their body weight was measured, the tumor tissue was dissected, and the tumor weight was measured. The tumor growth inhibition rate was calculated to evaluate the in vivo efficacy of each drug administration group.

[0344] Tumor inhibition rate (%)

[0345] = (Mean tumor weight in the blank control group - mean tumor weight in the experimental group) / mean tumor weight in the blank control group × 100%

[0346] 8.3 Experimental Results 1 - Changes in Body Weight of Tumor-Bearing Mice

[0347] The body weight of the tumor-bearing mice was measured every 7 days to record their survival status. The results of the body weight changes of the experimental mice are shown in Table 11 and 2023. Figure 4 :

[0348] Table 11: Effects of conjugated oligonucleotides on body weight in nude mouse orthotopic transplantation model of human liver cancer

[0349]

[0350]

[0351] From Table 11 and Figure 4 The results show:

[0352] During the administration period, the treatment groups, positive control group, and blank control group were as follows:

[0353] Weight changes: In the first week after drug administration, all groups of mice experienced varying degrees of weight loss. In the second week, the rate of weight loss slowed. In the third week, weight gain began to slow. By the fourth week, differences in weight changes among the groups became apparent; some groups showed significant weight gain, while others remained relatively unchanged. The groups were ranked according to the increase in weight at the end of the treatment compared to the initial weight: CT102-7-Z, CT102-8-Z, CT102-9-Z, CT102-6-Z, CT102-9-D, CT102-2-Z, CT102-10-Z, CT102-1-Z, CT102-7-D, CT102-4-Z, CT102-5-Z, CT102... MOE5-1 -Z group, positive control group, blank control group.

[0354] Mouse survival: In the blank control group, 1 animal died on day 12, 1 on day 20, and 1 on day 24, for a total of 3 deaths. In the positive control group, 1 animal died on day 16, 1 on day 18, and 1 on day 28, for a total of 3 deaths. The CT102-1-Z, CT102-4-Z, CT102-5-Z, CT102-10-Z, CT102-7-D, CT102-9-D, and CT102 groups also experienced mortality. MOE5-1 -Z group, each of these groups had 2 mice die; the drug administration groups with 1 mouse death were: CT102-2-Z group, CT102-6-Z group, CT102-8-Z group and CT102-9-Z group; the drug administration group with no mouse deaths was: CT102-7-Z group.

[0355] 8.3.1 Experimental Conclusions

[0356] Based on the survival of tumor-bearing mice, each treatment group showed higher safety compared to the positive control group; and each treatment group showed better treatment efficacy compared to the blank control group and the positive control group.

[0357] Specific dosage groups during the dosing period:

[0358] The number of animal deaths in the CT102-6-Z, CT102-7-Z, CT102-8-Z and CT102-9-Z groups was relatively small. Compared with other groups, their main common feature in chemical structure was the reduction in the number of thiomodifications of phosphodiester bonds. This indicates that reasonably reducing the number of thiomodifications of phosphodiester bonds can reduce drug toxicity.

[0359] One animal died in the CT102-2-Z group, while two animals died in the CT102-5-Z group. The main difference in chemical structure between the two groups lies in the position of methylation modification. Compared to CT102-5-Z, both groups have the same number of cytosine methylations. The only difference is that the latter selects to methylate the five cytosine residues at the 5' end, while the former selects to methylate the five cytosine residues at the 3' end. This indicates that the choice of modification position affects the drug's toxicity in vivo; specifically, the 5'-C position is chosen for cytosine methylation modification. m U m C m CGGAG m C m CAGA m C m U m When using U-3′, biological activity can be maintained while reducing related toxicity in vivo;

[0360] One animal died in the CT102-7-Z group, and two animals died in the CT102-7-D group. The chemical structure difference between CT102-7-Z and CT102-7-D lies in the conjugation group they use. CT102-7-Z uses the conjugation group 5'-Am-Is-C6-GalNAc3, which has better safety than the latter. Similarly, one animal died in the CT102-9-Z group, and two animals died in the CT102-9-D group. The chemical structure difference between CT102-9-Z and CT102-9-D lies in the conjugation group they use. CT102-9-Z uses the conjugation group 5'-Am-Is-C6-GalNAc3, which has better safety than the latter.

[0361] Based on the changes in body weight of tumor-bearing mice, no significant weight loss was observed in any of the treatment groups during the drug withdrawal period. Compared with the positive control group, each treatment group showed higher safety. Compared with the blank control group and the positive control group, each treatment group showed better therapeutic effect.

[0362] 8.4 Effect of conjugated oligonucleotides on tumor weight of human hepatocellular carcinoma orthotopic xenografts in nude mice

[0363] After euthanizing the nude mice, the tumor volume and weight were measured, and the tumor growth inhibition rate was calculated.

[0364] The experimental results are shown in Table 12 and Figure 5

[0365] Tumor inhibition rate (%)

[0366] = (Mean tumor weight in the blank control group - mean tumor weight in the experimental group) / mean tumor weight in the blank control group × 100%

[0367] Table 12: Effects of conjugated oligonucleotides on tumor weight of human hepatocellular carcinoma orthotopic xenografts in nude mice

[0368]

[0369]

[0370] From Table 12 and Figure 5 The results show:

[0371] The conjugated oligonucleotides showed a good inhibitory effect on human hepatocellular carcinoma orthotopic xenografts in nude mice. Compared with the blank control group, the tumor inhibition rate of each treatment group was greater than 37.4%; compared with the positive control group, except for CT102... MOE5-1 Except for group Z, the tumor inhibition rates of all other groups were greater than the 52.4% tumor inhibition rate of the positive control group.

[0372] Based on their inhibitory effects on tumors, the drug administration groups, in descending order of strength, are: CT102-9-Z, CT102-8-Z, CT102-7-Z, CT102-9-D, CT102-4-Z, CT102-2-Z, CT102-6-Z, CT102-5-Z, CT102-7-D, CT102-10-Z, CT102-1-Z, and CT102... MOE5-1 -Z group.

[0373] Among them, the CT102-9-Z group showed the strongest tumor inhibition rate of 80.8%; while CT102 MOE5-1 - Group Z showed the weakest tumor inhibition rate, with a tumor inhibition rate of 37.4%.

[0374] 8.4.1 Experimental Conclusions

[0375] From Table 12 and Figure 5 The results show that:

[0376] Compared to publicly reported -CT102 MOE5-1 Based on this, CT102 is formed by conjugating targeting groups. MOE5-1 -Z, the conjugated oligonucleotides CT102-9-Z, CT102-8-Z, CT102-7-Z, CT102-9-D, CT102-4-Z, CT102-2-Z, CT102-6-Z, CT102-5-Z, CT102-7-D, CT102-10-Z and CT102-1-Z prepared in this disclosure have significant therapeutic effects on tumor treatment based on the tumor inhibition rate.

[0377] Compared to the positive control drug sorafenib, the conjugated oligonucleotides CT102-9-Z, CT102-8-Z, CT102-7-Z, CT102-4-Z, CT102-2-Z, CT102-6-Z, CT102-5-Z, CT102-10-Z and CT102-1-Z prepared in this disclosure have better therapeutic effects on tumors in terms of tumor inhibition rate.

[0378] Among them, the CT102-9-Z group showed the strongest tumor inhibition effect, with a tumor inhibition rate of 80.8%; the CT102-9-D group showed a tumor inhibition rate of 70.0%, and the tumor inhibition rate of CT102-9-Z was increased by 10.8%; the difference in chemical structure between CT102-9-Z and CT102-9-D lies in the different conjugation groups used. The conjugation group used by CT102-9-Z is 5'-Am-Is-C6-GalNAc3, which has better efficacy than the conjugation group of the latter. Similarly, the tumor inhibition rate of the CT102-7-Z group was 72.6%, while that of the CT102-7-D group was 59.3%, with CT102-7-Z showing a 13.3% increase in tumor inhibition rate. The difference in chemical structure between CT102-7-Z and CT102-7-D lies in the different conjugation groups they use. CT102-7-Z uses the conjugation group 5'-Am-Is-C6-GalNAc3, which has better efficacy than the latter.

[0379] Among them, the tumor inhibition rate of the CT102-1-Z group was 56.6%, and the CT102 MOE5-1 The tumor inhibition rate of the -Z group was 37.4%, while the tumor inhibition rate of CT102-1-Z increased by 19.2%; CT102-1-Z and CT102 MOE5-1 The difference in the chemical structure of -Z lies in the different positions of cytosine methylation modification. The position of cytosine methylation modification in CT102-1-Z is more advantageous than that in the latter, thus better enhancing the inhibitory effect on tumors.

[0380] The tumor inhibition rate of the CT102-6-Z group was 60.8%, while that of the CT102-1-Z group was 56.6%, with the former showing an increase of 4.2%. The difference in chemical structure between CT102-6-Z and CT102-1-Z lies in the fact that the former has 6 fewer thiomodifications. This indicates that for oligonucleotides with targeted conjugation modifications, reasonably reducing the number of thiomodifications on the phosphodiester bond does not necessarily reduce the drug's efficacy in vivo.

[0381] Similarly, the tumor inhibition rate of the CT102-2-Z group was 60.8%, while that of the CT102-8-Z group was 75.6%, representing a 14.8% increase in tumor inhibition rate compared to CT102-2-Z. Likewise, the tumor inhibition rate of the CT102-4-Z group was 65.0%, while that of the CT102-9-Z group was 80.8%, representing a 15.8% increase in tumor inhibition rate compared to CT102-9-Z. The tumor inhibition effect of CT102-9-Z was significantly superior to that of CT102-4-Z.

[0382] Similarly, the tumor inhibition rate of the CT102-10-Z group was 57.1%, while that of the CT102-7-Z group was 72.6%. The tumor inhibition rate of CT102-7-Z was increased by 15.5%. This indicates that the targeted conjugation modification of oligonucleotides, while reasonably reducing thiomodification, did not reduce their tumor inhibition effect in vivo. On the contrary, it partially improved the efficacy.

[0383] Effects of conjugated oligonucleotides on serum alpha-fetoprotein concentration in nude mice with orthotopic transplantation of human hepatocellular carcinoma

[0384] Alpha-fetoprotein (AFP) is an acidic glycoprotein present in the liver and yolk sac during early fetal development. It gradually disappears shortly after birth, with AFP levels decreasing in infants until reaching adult levels at 8-12 months. Normal adults have low but detectable AFP levels. AFP has no known function in normal adults, but its expression in adults is often associated with tumor development (such as liver cancer, testicular cancer, ovarian cancer, and malignant teratomas). Serum AFP levels are often correlated with tumor size. In patients with AFP-secreting tumors, serum levels can be used to assess treatment response. Currently, detecting serum AFP concentration is commonly used for screening and early diagnosis of primary liver cancer, and can also indicate the effectiveness of surgical resection of liver cancer (i.e., whether it is complete or recurrent). Generally, if AFP levels decrease after treatment, the tumor has not grown. AFP has become an important diagnostic indicator for primary liver cancer, serving as a key biomarker for monitoring tumor presence and treatment, and can be used to evaluate the effectiveness of liver cancer treatment.

[0385] After treatment of tumor-bearing nude mice, the levels of alpha-fetoprotein (AFP) in the tumor-bearing nude mice and the concentration of serum alpha-fetoprotein (AFP) (expressed as ng / ml) were measured. The experimental results are shown in Table 13 and... Figure 6

[0386] Table 13: Effects of conjugated oligonucleotides on serum alpha-fetoprotein concentration in nude mice with human hepatocellular carcinoma orthotopic xenografts

[0387] CT102-1-Z group 471.93±75.51 CT102-2-Z group 453.89±72.62 CT102-4-Z group 410.35±61.55 CT102-5-Z group 466.71±88.68 CT102-6-Z group 439.69±87.94 CT102-7-Z group 358.15±60.89 CT102-8-Z group 327.74±72.1 CT102-9-Z group 235.97±49.55 CT102-10-Z group 485.38±87.37 CT102-7-D group 463.61±64.91 CT102-9-D group 387.16±69.69 <![CDATA[CT102 MOE5-1 -Z Group]]> 573.91±74.61 Positive control group 503.75±120.9 Blank control group 1223.17±330.26

[0388] From Table 13 and Figure 6 The results show:

[0389] A positive alpha-fetoprotein (AFP) test can serve as a dynamic indicator for observing the inhibitory effect of drugs on liver cancer. By detecting the concentration of AFP in experimental animals or tumor patients, it can be used to evaluate the therapeutic effect of tumor drugs. The lower the AFP concentration, the stronger the inhibitory effect of the drug on the tumor and the better the efficacy. Conjugated oligonucleotides have a good inhibitory effect on the secretion of AFP in nude mice with human liver cancer orthotopic xenografts, that is, they have a good inhibitory effect on tumors.

[0390] Based on their inhibitory effects on alpha-fetoprotein (i.e., tumor inhibition), the drug administration groups, in descending order of strength, were: CT102-9-Z, CT102-8-Z, CT102-7-Z, CT102-9-D, CT102-4-Z, CT102-6-Z, CT102-2-Z, CT102-7-D, CT102-5-Z, CT102-1-Z, CT102-10-Z, and CT102... MOE5-1 -Z group.

[0391] Among them, the CT102-9-Z group showed the strongest inhibitory effect on tumors; while CT102 MOE5-1 - Group Z had the weakest inhibitory effect on tumors;

[0392] 8.5.1 Experimental Conclusions

[0393] From Table 13 and Figure 6 The results show that:

[0394] Compared to CT102 reported in publicly available literature MOE5-1 Based on this, CT102 is formed by conjugating targeting groups. MOE5-1 -Z, the conjugated oligonucleotides CT102-9-Z, CT102-8-Z, CT102-7-Z, CT102-9-D, CT102-4-Z, CT102-2-Z, CT102-7-Z, CT102-5-Z, CT102-1-D and CT102-1-Z prepared in this disclosure have a significant inhibitory effect on the secretion of alpha-fetoprotein, that is, they have a significant inhibitory effect on tumor growth, P<0.05;

[0395] Compared to the positive control drug sorafenib, the conjugated oligonucleotides CT102-9-Z, CT102-8-Z, CT102-7-Z, CT102-4-Z, CT102-2-Z, CT102-6-Z, CT102-5-Z, CT102-10-Z, and CT102-1-Z prepared in this disclosure have a significant inhibitory effect on alpha-fetoprotein secretion, that is, a significant inhibitory effect on tumor growth.

[0396] Among them, the CT102-9-Z group showed the strongest inhibitory effect on alpha-fetoprotein (AFP) secretion, with an AFP concentration of 235.97 ng / ml; the AFP concentration in the CT102-9-D group was 387.16 ng / ml. There was a significant difference in the inhibitory effect on AFP secretion between the two groups (P<0.05). The difference in chemical structure between CT102-9-Z and CT102-9-D lies in the different conjugation groups they use. The conjugation group used in CT102-9-Z is 5'-Am-Is-C6-GalNAc3, which has a significant inhibitory effect on tumors compared to the latter. Similarly, the alpha-fetoprotein (AFP) concentration in the CT102-7-Z group was 358.15 ng / ml, while that in the CT102-7-D group was 463.61 ng / ml. There was a significant difference in the inhibitory effect of AFP secretion between the two groups (P < 0.05). The difference in chemical structure between CT102-7-Z and CT102-7-D lies in the different conjugation groups used. The conjugation group used in CT102-7-Z is 5'-Am-Is-C6-GalNAc3. Compared to the latter, the oligonucleotide formed when the conjugation group is 5'-Am-Is-C6-GalNAc3 has a significant inhibitory effect on tumors.

[0397] Among them, the tumor inhibition rate of the CT102-1-Z group was 56.6%, and the CT102 MOE5-1 The tumor inhibition rate of group Z was 37.4%, and there was a significant difference in tumor inhibition between the two groups (P<0.05); CT102-1-Z and CT102 MOE5-1 The difference in the chemical structure of -Z lies in the different positions of cytosine methylation modification. The position of cytosine methylation modification in CT102-1-Z is more advantageous than that in the latter, thus better enhancing the inhibitory effect on alpha-fetoprotein secretion.

[0398] The alpha-fetoprotein (AFP) concentration in the CT102-6-Z group was 439.69 ng / ml, and the AFP concentration in the CT102-1-Z group was 471.93 ng / ml, with no significant difference between the two. The difference in chemical structure between CT102-6-Z and CT102-1-Z lies in the fact that the former has 6 fewer thiomodifications. This indicates that for oligonucleotides with targeted conjugation modifications, reasonably reducing the number of thiomodifications on the phosphodiester bond does not necessarily reduce the drug's efficacy in vivo.

[0399] Similarly, the alpha-fetoprotein (AFP) concentration in the CT102-2-Z group was 453.89 ng / ml, while that in the CT102-8-Z group was 327.74 ng / ml. CT102-8-Z showed significantly better inhibitory effects on AFP secretion than CT102-2-Z (P < 0.05). The difference in chemical structure between CT102-2-Z and CT102-8-Z lies in the latter's reduction of three thiolated modifications in the phosphodiester bond. Likewise, the AFP concentration in the CT102-4-Z group was 410.35 ng / ml, while that in the CT102-9-Z group was 235.97 ng / ml. CT102-9-Z showed significantly better inhibitory effects on AFP secretion than CT102-4-Z (P < 0.05). The difference in chemical structure between CT102-4-Z and CT102-9-Z lies in the latter's reduction of three thiolated modifications in the phosphodiester bond.

[0400] Similarly, the alpha-fetoprotein (AFP) concentration in the CT102-10-Z group was 485.38 ng / ml, while that in the CT102-7-Z group was 358.15 ng / ml. CT102-7-Z showed significantly better inhibitory effect on AFP secretion than CT102-10-Z (P<0.05). The difference in chemical structure between CT102-10-Z and CT102-7-Z lies in the fact that the latter has three fewer thiolation modifications on the phosphodiester bond. This indicates that for targeted conjugated oligonucleotides, reasonably reducing the number of thiolation modifications on the phosphodiester bond does not reduce their inhibitory effect on AFP secretion in vivo; on the contrary, it may partially improve efficacy.

[0401] The serum alpha-fetoprotein (AFP) concentrations in the CT102-7-Z, CT102-8-Z, and CT102-9-Z groups were significantly lower than those in the CT102-1-Z and CT102-6-Z groups. This indicates that, based on serological indicators, the CET-modified short sequences, compared to the unmodified long sequences, have an inhibitory effect on liver cancer in vivo that reaches or exceeds that of the unmodified long oligonucleotide sequences.

[0402] The serum alpha-fetoprotein concentration in the CT102-9-Z group was significantly lower than that in the CT102-7-Z, CT102-8-Z, and CT102-10-Z groups, indicating that the reasonable increase in the amount of CET modification at both ends has a more obvious inhibitory effect on liver cancer, as seen from serological indicators.

[0403] In summary, the modified oligonucleotide molecules effectively silenced the insulin-like growth factor 1 receptor (IGF1R) gene, inhibiting the growth, migration, and invasion of liver cancer cells. This increased the drug's serum stability and biological activity while reducing cytotoxicity. In particular, the conjugated and targeting groups CT102-6-Z, CT102-7-Z, CT102-8-Z, CT102-9-Z, and CT102-10-Z significantly enhanced the in vivo biological activity of the oligonucleotide molecules against liver tumor cells (inhibiting the expression of the tumor-associated gene cell proliferation receptor IGF1R) compared to other modifications, while simultaneously reducing cytotoxicity (or achieving activity comparable to the unmodified form). These modifications could represent a direction for drug optimization.

[0404] Although this disclosure has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, such modifications or improvements made without departing from the spirit of this disclosure are all within the scope of protection claimed by this disclosure.

Claims

1. A modified oligonucleotide, its acidic structure, or a pharmaceutically acceptable salt thereof, said oligonucleotide having the sequence: 5'-C (CET) m U (CET) * m C (CET) * m CGGAG m C m CAGA m C (CET) * m U (CET) m U (CET) -3'; in, m U is 5-methyluracil modified. m C represents 5-methylcytosine modification. An asterisk (*) indicates that the nucleotides are linked by a phosphodiester bond; the others are linked by a phosphothiodiester bond. (CET) Modified by 2'-O-CET.

2. The oligonucleotide according to claim 1, its acidic structure or a pharmaceutically acceptable salt thereof, wherein the salt is a sodium or potassium salt.

3. The oligonucleotide according to claim 1, its acidic structure or a pharmaceutically acceptable salt thereof, wherein the salt is a sodium salt.

4. An oligonucleotide containing a conjugating group, the structure of which is: 。 5. A pharmaceutical composition comprising the oligonucleotide of any one of claims 1-3, its acidic form or a pharmaceutically acceptable salt thereof, or the oligonucleotide of claim 4, and a pharmaceutically acceptable carrier.

6. The composition according to claim 5, wherein the salt is a sodium salt or a potassium salt.

7. The composition according to claim 6, wherein the salt is a sodium salt.

8. The use of the oligonucleotide according to any one of claims 1-3, its acidic structure or a pharmaceutically acceptable salt thereof, or the oligonucleotide containing a conjugation group according to claim 4, or the composition according to any one of claims 5-7, in the preparation of a medicament for treating diseases related to the overexpression of the IGF-1R gene; The diseases associated with the overexpression of the IGF-1R gene mentioned are selected from liver cancer, lung cancer, kidney cancer, and pancreatic cancer.

Images