Primer composition for identifying or assisting in identifying rice bacterial leaf blight resistance and application thereof

CN115852037BActive Publication Date: 2026-09-25SANYA NATIONAL INSTITUTE OF SOUTHERN BREEDING CHINESE ACADEMY OF AGRICULTURAL SCIENCES +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202211606767.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-13
Publication Date
2026-09-25
Estimated Expiration
2042-12-13

AI Technical Summary

Benefits of technology

[0092]本发明提供了一种引物组合物,还提供了利用引物组合物鉴定或辅助鉴定水稻白叶枯病抗性的方法。本发明建立的方法可用于预测水稻对白叶枯病的抗性,可以对待筛选水稻进行早期筛选,可用于水稻分子标记辅助育种,在发掘抗白叶枯病水稻种质资源和选育抗白叶枯病水稻品种的研究中具有重要的应用价值。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003995481960000101
    Figure BDA0003995481960000101
  • Figure BDA0003995481960000111
    Figure BDA0003995481960000111
  • Figure BDA0003995481960000121
    Figure BDA0003995481960000121
Patent Text Reader

Abstract

The application discloses a primer composition for identifying or assisting in identifying rice bacterial blight resistance and application thereof, and belongs to the field of genetic biotechnology, and particularly relates to a primer composition for identifying or assisting in identifying rice bacterial blight resistance and application thereof. By detecting the polymorphism or genotype (allele) of an SNP site in the genome of the rice to be detected, the rice bacterial blight resistance is identified or assisted in identifying according to the genotype, the SNP site is a site on the 6th chromosome of the rice, the nucleotide type is A or G, and the 23rd nucleotide in sequence 4 in the sequence table. The primer composition can be used for predicting the rice bacterial blight resistance of the rice and performing rice breeding. The substance for detecting the polymorphism and genotype of the SNP site can be combined with other substances (such as a substance for detecting single nucleotide polymorphism or genotype of other molecular markers related to the rice bacterial blight resistance) to prepare a product for identifying rice bacterial blight resistance varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of gene biotechnology, specifically relating to primer compositions for identifying or assisting in the identification of rice bacterial blight resistance and their applications. Background Technology

[0002] Rice bacterial blight, caused by the fungus *Xanthomonas oryzae* pv. oryzae (Xoo), is a significant bacterial disease in rice cultivation worldwide, causing severe damage in rice-growing areas of South my country and Southeast Asia. In normal years, it can lead to a yield reduction of about 10%, and in severe cases, a reduction of 50%-60%. For a long time, breeding and planting resistant varieties have played a crucial role in controlling bacterial blight. Developing molecular markers for detecting resistance to rice bacterial blight is of significant application value in screening resistant rice germplasm resources and in rapidly identifying resistant plants during the breeding process.

[0003] KASP (Kompetitive Allele-Specific PCR) achieves genotyping by specifically recognizing gene loci using fluorescent probes, and can be used to detect SNP and InDel loci. Compared with molecular markers such as SSR, RFLP, and InDel, KASP markers offer advantages such as rapid detection, low cost, and ease of large-scale application. KASP markers do not require genotyping based on DNA fragment size, overcoming the relatively cumbersome and low-throughput drawbacks of traditional gel electrophoresis methods, making them suitable for high-throughput molecular detection platforms. Therefore, identifying functional SNP loci associated with rice bacterial blight resistance and developing KASP molecular markers suitable for high-throughput molecular detection platforms is of significant application value for improving rice breeding efficiency and breeding level in my country. Summary of the Invention

[0004] The problem to be solved by this invention is how to identify or assist in the identification of rice bacterial blight resistance.

[0005] To address the above technical problems, this invention first provides the application of a substance for detecting SNP polymorphisms or genotypes in the rice genome in any of the following situations:

[0006] (1) To identify or assist in the identification of rice bacterial blight resistance;

[0007] (2) Screening or breeding rice single plants, lines, strains or varieties resistant to bacterial blight;

[0008] (3) Screening or breeding rice plants, lines, strains or varieties susceptible to bacterial blight;

[0009] (4) Rice breeding;

[0010] (5) Prepare products for identifying or assisting in the identification of rice bacterial blight resistance;

[0011] (6) Prepare or select rice single plants, lines, strains or varieties resistant to bacterial blight;

[0012] (7) Prepare products for screening or breeding rice single plants, lines, strains or varieties susceptible to bacterial blight;

[0013] (8) Prepare rice breeding products.

[0014] The SNP site is a site on rice chromosome 6, and its nucleotide type is A or G, which is the 23rd nucleotide of sequence 4 in the sequence listing.

[0015] Using the Nipponbare genome sequence as a reference genome, the SNP site is located at 12116672 bp on rice chromosome 6 (specifically, position 23 of sequence 4 in the sequence listing).

[0016] This invention also provides a method for identifying or assisting in the identification of rice bacterial blight resistance, comprising detecting the genotype of SNP loci in the genome of the rice to be tested, and identifying or assisting in the identification of rice bacterial blight resistance based on the genotype, wherein the genotype is AA or GG, wherein AA is a homozygous type of the SNP locus being A, and GG is a homozygous type of the SNP locus being G.

[0017] Optionally, according to the above method, the identification or auxiliary identification of rice bacterial blight resistance based on the genotype can be any of the following methods:

[0018] 1) The rice varieties tested with the SNP genotype AA are or candidates for rice varieties resistant to bacterial blight.

[0019] 2) The rice varieties tested with the SNP genotype GG are or candidates for rice varieties susceptible to bacterial blight;

[0020] 3) The bacterial blight resistance of the tested rice with the SNP genotype AA is higher than that of the tested rice with the SNP genotype GG.

[0021] As one implementation method, the method for identifying or assisting in the identification of rice bacterial blight resistance may include the following steps:

[0022] (1) Using the genomic DNA of the rice to be tested as a template, KASP was performed using the following primer composition; the primer composition consisted of primer A, primer B and primer C;

[0023] Primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 1 in the sequence listing or whose nucleotide sequence is the single-stranded DNA at positions 22-44 of sequence 1 in the sequence listing;

[0024] Primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing or whose nucleotide sequence is single-stranded DNA at positions 22-43 of sequence 2 in the sequence listing;

[0025] The primer C nucleotide sequence is a single-stranded DNA molecule of sequence 3 in the sequence listing.

[0026] (2) After completing step (1), perform fluorescence detection to determine the genotype of the SNP in the rice to be tested;

[0027] (3) Identify the bacterial blight resistance of the rice to be tested based on the genotype results: The bacterial blight resistance of the rice to be tested with the SNP genotype AA is higher than that of the rice to be tested with the SNP genotype GG.

[0028] In the above method, the primer dissolution and preparation method can be as follows: first, dilute the three primers to 100mM with ddH2O, and then prepare the primer working solution as follows: primer A 12μL, primer B 12μL, primer C 30μL, ddH2O 46μL.

[0029] In the above method, the KASP reaction system can be: 1 μL template solution, 0.14 μL primer working solution, 5 μL KASPHiGeno 2x Probe Mix, and 3.86 μL sterile ultrapure water.

[0030] In the above method, KASP can be performed on a BIO-RAD T100 Thermal Cycler PCR amplification instrument.

[0031] In the above method, the reaction procedure of KASP can be:

[0032] Step 1: Pre-denaturation at 94℃ for 10 min;

[0033] Step 2: 94℃ for 20s, 61℃ for 40s, 94℃ for 20s, 60.4℃ for 40s, 94℃ for 20s, 59.8℃ for 40s, 94℃ for 20s, 59.2℃ for 40s, 94℃ for 20s, 58.6℃ for 40s, 94℃ for 20s, 58℃ for 40s, 94℃ for 20s, 57.4℃ for 40s, 94℃ for 20s, 56.8℃ for 40s, 94℃ for 20s, 56.2℃ for 40s, 94℃ for 20s, 61℃ for 40s, 94℃ for 20s, 55.6℃ for 40s;

[0034] Step 3: Denaturation at 94℃ for 20 seconds, annealing at 55℃ for 40 seconds, 34 cycles.

[0035] The above method can be used to determine the genotype of the SNP in the rice to be tested as follows: perform fluorescence reading on an ABI 7500 real-time PCR instrument at a temperature of 35℃ for 30 seconds, and use the terminal fluorescence value to perform genotyping.

[0036] The application of the above-described methods in rice breeding also falls within the scope of protection of this invention.

[0037] This invention also provides a method for rice breeding.

[0038] The rice breeding method provided by this invention is M1 or M2:

[0039] M1. The method includes detecting the genotype of the SNP in the rice genome, selecting rice with the genotype AA of the SNP as a parent for breeding, wherein AA is a homozygous type of the SNP locus A, and the breeding objective of the method includes selecting rice with resistance to bacterial blight;

[0040] M2. The method includes detecting the genotype of the SNP in the rice genome, selecting rice with the genotype GG of the SNP as a parent for breeding, wherein GG is a homozygous type of the SNP locus G, and the breeding purpose of the method includes selecting rice susceptible to bacterial blight.

[0041] As an implementation method, rice breeding methods may include the following steps:

[0042] (1) Using the genomic DNA of the rice to be tested as a template, KASP was performed using the above primer set;

[0043] (2) After completing step (1), perform fluorescence detection to determine the genotype of the SNP in the rice to be tested;

[0044] (3) Select AA genotype rice for breeding.

[0045] In the method described, the primer dissolution and preparation method can be as follows: first, dilute the three primers to 100mM with ddH2O, and then prepare the primer working solution as follows: primer A 12μL, primer B 12μL, primer C 30μL, ddH2O 46μL.

[0046] In the method described, the KASP reaction system may consist of: 1 μL template solution, 0.14 μL primer working solution, 5 μL KASPHiGeno 2x Probe Mix, and 3.86 μL sterile ultrapure water.

[0047] In this method, KASP can be performed on a Bio-Rad T100 Thermal Cycler PCR amplification instrument.

[0048] In the aforementioned method, the KASP reaction procedure can be as follows:

[0049] Step 1: Pre-denaturation at 94℃ for 10 min;

[0050] Step 2: 94℃ for 20s, 61℃ for 40s, 94℃ for 20s, 60.4℃ for 40s, 94℃ for 20s, 59.8℃ for 40s, 94℃ for 20s, 59.2℃ for 40s, 94℃ for 20s, 58.6℃ for 40s, 94℃ for 20s, 58℃ for 40s, 94℃ for 20s, 57.4℃ for 40s, 94℃ for 20s, 56.8℃ for 40s, 94℃ for 20s, 56.2℃ for 40s, 94℃ for 20s, 61℃ for 40s, 94℃ for 20s, 55.6℃ for 40s;

[0051] Step 3: Denaturation at 94℃ for 20 seconds, annealing at 55℃ for 40 seconds, 34 cycles.

[0052] The method for determining the genotype of the SNP in the rice to be tested is as follows: A fluorescence plate is read using an ABI 7500 real-time PCR instrument at a temperature of 35°C for 30 seconds, and the fluorescence value is read from the terminal ends for genotyping.

[0053] This invention also provides products for detecting polymorphisms or genotypes of SNP sites in the rice genome.

[0054] The product provided by this invention for detecting the polymorphism or genotype of the SNP sites in the rice genome is any of the substances mentioned above for detecting the polymorphism or genotype of SNP sites in the rice genome.

[0055] C1) Products that detect single nucleotide polymorphisms or genotypes related to resistance to rice bacterial blight;

[0056] C2) Products used to identify or assist in identifying resistance to rice bacterial blight;

[0057] C3) Products used in rice breeding;

[0058] C4) Screening or breeding of rice single plants, lines, strains or varieties resistant to bacterial blight;

[0059] C5) Screening or breeding of rice single plants, lines, strains or varieties susceptible to bacterial blight;

[0060] In the above applications, methods, and products, the substance may be a reagent and / or instrument required to determine the polymorphism or genotype of the SNP site by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP chips. The SNP chips include chips based on nucleic acid hybridization reactions, chips based on single-base extension reactions, chips based on allele-specific primer extension reactions, chips based on one-step reactions, chips based on primer ligation reactions, chips based on restriction endonuclease reactions, chips based on protein-DNA binding reactions, and chips based on fluorescent molecule-DNA binding reactions.

[0061] Optionally, the substance may be D1), D2), or D3):

[0062] D1) Contains a primer composition that amplifies rice genomic DNA fragments including the SNP sites;

[0063] D2) PCR reagents containing the primer composition described in D1);

[0064] D3) A kit containing the primer composition described in D1) or the PCR reagent described in D2).

[0065] Optionally, the amplification may be PCR amplification. The primer composition consists of primer A, primer B, and primer C.

[0066] D3) The kit may further include a specific probe set. The specific probe set includes fluorescent probe A, quencher probe A, fluorescent probe B, and quencher probe B; fluorescent probe A, as shown in sequence 5 of the sequence listing, has a fluorescent group attached to its 5' end; fluorescent probe B, as shown in sequence 6 of the sequence listing, has a fluorescent group attached to its 5' end; the fluorescent groups in fluorescent probe A and fluorescent probe B are different; quencher probe A, as shown in sequence 7 of the sequence listing, has a quencher group attached to its 3' end; quencher probe B, as shown in sequence 8 of the sequence listing, has a quencher group attached to its 3' end. Fluorescent probe A may specifically be attached to the FAM fluorescent group. Fluorescent probe B may specifically be attached to the HEX fluorescent group. Quencher probe A may specifically be attached to the quencher group BHQ. Quencher probe B may specifically be attached to the quencher group BHQ.

[0067] The kit described in D3 may also include KASP HiGeno 2x Probe Mix.

[0068] In the above applications, methods, and products, the primer composition may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be linked to a nucleic acid. Markers include, but are not limited to, dyes; radioactive markers, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties whose emission spectra can be inhibited or shifted by fluorescence resonance energy transfer (FRET). The marker can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetric determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, optionally, charge-neutral. The marker can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the marker is detectable. In some embodiments, nucleic acids are detected directly without labeling (e.g., direct sequence reading). The primer composition described herein may be a primer composition consisting of single-stranded DNA with nucleotide sequences of positions 22-44 of Sequence 1 in the sequence listing, single-stranded DNA with nucleotide sequences of positions 22-43 of Sequence 2 in the sequence listing, and single-stranded DNA with nucleotide sequences of Sequence 3 in the sequence listing. The primer composition may also be a primer set consisting of single-stranded DNA shown in Sequence 1, Sequence 2, and Sequence 3 in the sequence listing. Sequence 1 in the sequence listing consists of 44 nucleotides, with nucleotides 1-21 being the FAM sequence (as a marker) and nucleotides 22-44 being the specific sequence; Sequence 2 in the sequence listing consists of 43 nucleotides, with nucleotides 1-21 being the HEX sequence (as a marker) and nucleotides 22-43 being the specific sequence.

[0069] The present invention also provides a DNA molecule, the nucleotide sequence of which is shown in Sequence 4 of the sequence listing.

[0070] The applications of the aforementioned DNA molecules also fall within the scope of protection of this invention. Specifically, the applications are those found in any of the following:

[0071] (1) To identify or assist in the identification of rice bacterial blight resistance;

[0072] (2) Screening or breeding rice single plants, lines, strains or varieties resistant to bacterial blight;

[0073] (3) Screening or breeding rice plants, lines, strains or varieties susceptible to bacterial blight;

[0074] (4) Rice breeding;

[0075] (5) Prepare products for identifying or assisting in the identification of rice bacterial blight resistance;

[0076] (6) Prepare or select rice single plants, lines, strains or varieties resistant to bacterial blight;

[0077] (7) Prepare products for screening or breeding rice single plants, lines, strains or varieties susceptible to bacterial blight;

[0078] (8) Prepare rice breeding products.

[0079] Optionally, in the above applications, the DNA molecule serves as a detection target.

[0080] In this study, it was found that rice resistant to bacterial blight exhibits higher resistance to bacterial blight than rice susceptible to bacterial blight.

[0081] In this article, rice resistant to bacterial blight can specifically refer to rice with leaf lesion length less than or equal to 3 cm in the disease resistance test.

[0082] In this article, rice susceptible to bacterial blight can specifically refer to rice with leaf lesions longer than or equal to 20 cm in the disease resistance test.

[0083] The disease resistance test was conducted as follows: during the peak tillering stage of rice plants, the leaves of the rice variety to be tested were inoculated with a bacterial suspension of bacterial blight pathogen using the leaf-cutting method, and the length of the lesions on the leaves was measured 3 weeks after inoculation.

[0084] The bacterial blight strain can specifically be strain GIV.

[0085] The concentration of the bacterial suspension can specifically be 10. 8 cfu / mL.

[0086] The specific method for preparing the bacterial suspension is as follows: inoculate strain GIV onto PSA solid medium, incubate at 28°C for 48 hours, and wash off the colonies with sterile water to obtain the bacterial suspension.

[0087] For details on the manual leaf-pruning method, please refer to the reference "Kauffman HE, Reddy APK, Hsieh SP, et al. A improved technique for evaluation of resistance of rice varieties to Xanthomonas oryzea[J]. Plant Dis Rep, 1973, 57: 537-541".

[0088] The bacterial blight mentioned above can specifically be bacterial blight caused by GIV or other strains.

[0089] The rice species to be tested mentioned above can be any one of the following rice materials: DV 86::IRGC8840-1, DHARIAL::IRGC 34034-1, DL 5::IRGC 8593-1, UCP 41::IRGC 8742-1, ARC14901::IRGC41811-1, CHILE BORO::IRGC 45297-2, DD 126::IRGC 8667-1, LAL SAR::IRGC 16185-1, M142::IRGC 35054-1, BAO DAM::IRGC 89352-1, R 146::IRGC38606-1, NS 252::IRGC68878-1, PAGAIYAHAN::IRGC 8267-1, MAKALIOKA STANDARD::IRGC 12768-1, DANGAR::IRGC76296-1, MUGA::GERVEX 1099-C1, DORELLA::GERVEX 100-C1, TSIVIMBININA::IRGC 69890-1, FIDJI::GERVEX 1636-C1, SALVO::GERVEX 1672-C1, SUPER::GERVEX 1304-C1, ARC11424::IRGC 21380-2, 79UPLA::GERVEX 154-C1, GANIGI::IRGC 48698-C1, KITRANA1007::IRGC 68517-1, LACASSINE::GERVEX 1660-C1, HAI NA::IRGC 107117-1, GLADIO::GERVEX 1652-C1, MAK KHEUA KANG::IRGC 107712-1, GOOLARAH::GERVEX 500-C1, GRALDO::GERVEX 108-C1, MAK KHEUA DENG::IRGC 107709-1, RUBI::GERVEX 1247-C1, B 106::IRGC31352-1, BUAGKOG::IRGC 74318-1, FAMILIA 181::GERVEX 901-C1, CHA LOY OE::C1, BERYA::IRGC99970-1, IR 63380-16::C1, TOPAZIO::GERVEX 1332-C1, SLAVA::GERVEX 1287-C1, ROJOKELY::GERVEX 8410-C1, T 757::GERVEX 1316-C1, B 6311A5553-16-2::IRGC14541-1、ARC 12493::IRGC 22098-1。

[0090] The rice varieties tested above are offspring obtained from any one or two of the following rice materials as parents: DV86::IRGC 8840-1, DHARIAL::IRGC 34034-1, DL 5::IRGC 8593-1, UCP 41::IRGC 8742-1, ARC 14901::IRGC 41811-1, CHILE BORO::IRGC 45297-2, DD 126::IRGC 8667-1, LALSAR::IRGC 16185-1, M 142::IRGC 35054-1, BAO DAM::IRGC 89352-1, R 146::IRGC38606-1, NS 252::IRGC 68878-1, PAGAIYAHAN::IRGC 8267-1, MAKALIOKA STANDARD::IRGC12768-1, DANGAR::IRGC 76296-1, MUGA::GERVEX 1099-C1, DORELLA::GERVEX 100-C1, TSIVIMBININA::IRGC 69890-1, FIDJI::GERVEX 1636-C1, SALVO::GERVEX 1672-C1, SUPER::GERVEX 1304-C1, ARC 11424::IRGC 21380-2, 79UPLA::GERVEX 154-C1, GANIGI::IRGC 48698-C1, KITRANA 1007::IRGC 68517-1, LACASSINE::GERVEX 1660-C1, HAI NA::IRGC 107117-1, GLADIO::GERVEX 1652-C1, MAK KHEUA KANG::IRGC 107712-1, GOOLARAH::GERVEX 500-C1, GRALDO::GERVEX 108-C1, MAK KHEUA DENG::IRGC 107709-1, RUBI::GERVEX 1247-C1, B 106::IRGC 31352-1, BUAGKOG::IRGC 74318-1, FAMILIA 181::GERVEX901-C1, CHA LOY OE::C1, BER YA::IRGC99970-1, IR 63380-16::C1, TOPAZIO::GERVEX1332-C1, SLAVA::GERVEX 1287-C1, ROJOKELY::GERVEX 8410-C1, T 757::GERVEX1316-C1, B 6311A 5553-16-2::IRGC 14541-1, ARC 12493::IRGC 22098-1.

[0091] The substance that detects the SNP site polymorphism and genotype can be combined with other substances (such as substances that detect single nucleotide polymorphisms or genotypes of other molecular markers associated with rice resistance to bacterial blight) to prepare products for identifying rice varieties resistant to bacterial blight.

[0092] This invention provides a primer composition and a method for identifying or assisting in the identification of rice bacterial blight resistance using the primer composition. The method established by this invention can be used to predict rice resistance to bacterial blight, for early screening of rice varieties, and for marker-assisted breeding of rice. It has significant application value in the research of discovering bacterial blight-resistant rice germplasm resources and breeding bacterial blight-resistant rice varieties. Attached Figure Description

[0093] Figure 1 This is a graph showing the genotype test results. Detailed Implementation

[0094] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0095] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0096] In the quantitative experiments in the following examples, three replicate experiments were set up, and the average value of the results was taken.

[0097] The rice materials used in the following examples are all publicly described in the reference: Wang W, Mauleon R, Hu Z, et al. Genomic variation in 3010 diverse accessions of Asian cultivated rice, Nature, 2018, 557(7703):43-49. The public can obtain the biological materials from the applicant. The biological materials are only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0098] The bacterial blight pathogen strain GIV is described in the article “Fang Zhongda, Xu Zhigang, Guo Chongjian, Yin Shangzhi, Wu Shangzhong, Xu Xianming, Zhang Qi. Study on pathogenicity of bacterial blight pathogen in rice in China. Acta Phytopathologica Sinica, 1990, 20(2):81-88”, which can be obtained by the public from the Institute of Crop Science, Chinese Academy of Agricultural Sciences.

[0099] HiGeno 2x Probe Mix: Beijing Jiacheng Biotechnology Co., Ltd., Product No.: AQP-001S.

[0100] Example 1: Detection of rice resistance to bacterial blight using SNPs

[0101] 1. 340 rice varieties were selected from the globally sequenced (average depth 14×) core rice germplasm resources (Wang W, Mauleon R, Hu Z, et al. Genomic variation in 3010 diverse accessions of Asian cultivated rice, Nature, 2018, 557(7703):43-49.) as experimental materials and inoculated with rice strain Xoo GIV. Based on the high-density SNP genotypes, genome-wide association analysis was performed on the resistance and susceptibility phenotypes of the 340 rice varieties to bacterial blight. Combined with linkage disequilibrium (LD) analysis, a region on chromosome 6 associated with resistance to bacterial blight was identified. The SNP locus within this region that was most significantly associated with resistance to bacterial blight was selected for further analysis. Using the Nipponbare genome sequence as a reference genome, this SNP locus is located at 12116672 bp on chromosome 6. The SNP locus (SNP-12116672) and its surrounding nucleotides are shown in Sequence 4 of the sequence listing, where nucleotide 23 is the SNP locus and exhibits an A / G polymorphism. The genotype of this SNP locus is either AA or GG. AA is the homozygous type for the A genotype at this SNP locus, and GG is the homozygous type for the G genotype at this SNP locus. Rice varieties with the AA genotype at this SNP locus show significantly higher resistance to bacterial blight than rice varieties with the GG genotype at this SNP locus.

[0102] 2. Convert SNP markers to KASP markers and design a primer set for detecting these markers.

[0103] SNP markers were converted to KASP markers for use in marker-assisted selection breeding.

[0104] A primer set for detecting KASP markers based on KASP technology was designed, referred to as the KASP primer set. The KASP primer set consists of two upstream primers (primer A and primer B) and one downstream primer (primer C).

[0105] The nucleotide sequence of primer A is shown in Sequence 1 of the sequence listing.

[0106] Sequence 1: 5'- GAAGGTGACCAAGTTCATGCT GAGAACTGGTTCTCGGAGGTCGA-3'.

[0107] The nucleotide sequence of primer B is shown in Sequence 2 of the sequence listing.

[0108] Sequence 2: 5'- GAAGGTCGGAGTCAACGGATT AGAACTGGTTCTCGGAGGTCGG-3'.

[0109] The nucleotide sequence of primer C is shown in Sequence 3 of the sequence listing.

[0110] Sequence 3: 5'-CCATACTTGAGTAGACACGGAGGCC-3'.

[0111] SNP-12116672 is located at the 23rd nucleotide of the DNA molecule shown in Sequence 4 of the rice genome sequence listing.

[0112] Primer A is a primer with a FAM fluorescent tag sequence (underlined bases) at the 5' end, and primer C amplifies the fragment A of SNP-12116672. The fluorescent signal of the FAM group can be read using an ELISA reader or a real-time PCR instrument.

[0113] Primer B is a primer with a HEX fluorescent tag sequence (underlined bases) at the 5' end, and primer C amplifies the G fragment of SNP-12116672. The fluorescent signal of the HEX group can be read using an ELISA reader or a real-time PCR instrument.

[0114] 3. Establishment of a method for detecting resistance to bacterial leaf blight in rice

[0115] 3.1. Genomic DNA was extracted from the leaves of the rice plants to be tested and diluted to obtain a template solution. The DNA concentration in the template solution was 30-40 ng / μL.

[0116] 3.2 Perform KASP.

[0117] Primer working solution: First, dilute the three primers to 100mM with ddH2O, then prepare the primer working solution according to the following formula: Primer A 12μL, Primer B 12μL, Primer C 30μL, ddH2O 46μL.

[0118] KASP HiGeno 2x Probe Mix is ​​a product of Beijing Jiacheng Biotechnology Co., Ltd. (Catalog No. AQP-001S). KASP HiGeno 2x Probe Mix contains fluorescent probe A, fluorescent probe B, quencher probe A, quencher probe B, high-fidelity Taq enzyme, dNTPs, and Mg. 2+ The sequence of fluorescent probe A is 5'-GAAGGTGACCAAGTTCATGCT-3', with a FAM fluorescent group attached to the 5' end. The sequence of fluorescent probe B is 5'-GAAGGTCGGAGTCAACGGATT-3', with a HEX fluorescent group attached to the 5' end. The sequence of quencher probe A is 5'-AGCATGAACTTGGTCACCTTC-3', with a BHQ quencher group attached to the 3' end. The sequence of quencher probe B is 5'-AATCCGTTGACTCCGACCTTC-3', with a BHQ quencher group attached to the 3' end.

[0119] The KASP reaction system consisted of 1 μL template solution, 0.14 μL primer working solution, 5 μL KASP HiGeno 2x Probe Mix, and 3.86 μL sterile ultrapure water.

[0120] KASP was performed on a Bio-Rad T100 Thermal Cycler PCR instrument using the Touch-down PCR amplification program.

[0121] KASP's response procedure:

[0122] Step 1: Pre-denaturation at 94℃ for 10 min;

[0123] Step 2: 94℃ for 20s, 61℃ for 40s, 94℃ for 20s, 60.4℃ for 40s, 94℃ for 20s, 59.8℃ for 40s, 94℃ for 20s, 59.2℃ for 40s, 94℃ for 20s, 58.6℃ for 40s, 94℃ for 20s, 58℃ for 40s, 94℃ for 20s, 57.4℃ for 40s, 94℃ for 20s, 56.8℃ for 40s, 94℃ for 20s, 56.2℃ for 40s, 94℃ for 20s, 61℃ for 40s, 94℃ for 20s, 55.6℃ for 40s;

[0124] Step 3: Denaturation at 94℃ for 20 seconds, annealing at 55℃ for 40 seconds, 34 cycles.

[0125] The experiment also included a blank control (NTC) in the reaction system without template DNA, with two or more blank controls in each plate.

[0126] 3.3 Perform fluorescence scanning.

[0127] After completing step 2, perform fluorescence reading on an ABI 7500 real-time PCR instrument at 35°C for 30 seconds, and use the terminal ends to read the fluorescence values ​​for genotyping.

[0128] The FAM excitation wavelength is 485 nm, and the emission wavelength is 520 nm. The HEX excitation wavelength is 535 nm, and the emission wavelength is 556 nm. The system reference fluorescence ROX excitation wavelength is 575 nm, and the emission wavelength is 610 nm.

[0129] If only the HEX group shows a fluorescent signal, then the genotype of the rice sample SNP-12116672 is GG (i.e., SNP-12116672 in the genome is homozygous for G); if only the FAM group shows a fluorescent signal, then the genotype of the rice sample SNP-12116672 is AA (i.e., SNP-12116672 in the genome is homozygous for A).

[0130] 4. Identification of resistance to bacterial leaf blight in rice

[0131] 4.1. Inoculate strain GIV onto PSA solid medium and incubate at 28°C for 48 hours. Wash the colonies with sterile water to prepare a 10% concentration. 8 A bacterial suspension of cfu / mL.

[0132] 4.2 Select 55 rice materials from Table 1 as experimental materials. Sow the rice seeds to be tested in seedling trays containing nutrient soil that has been sprayed with soil fungicide. After being cultivated in a greenhouse for about 25 days, transplant them to a net house for planting. Each variety was set up with 3 replicates, with 2 rows planted in each replicate and 6 seedlings transplanted in each row.

[0133] 4.3. During the peak tillering stage of the rice plants in step 2, take the bacterial suspension obtained in step 1 and artificially inoculate the rice plants using the manual leaf-cutting method (refer to the literature: Kauffman HE, Reddy AP K, Hsieh SPY, et al. A improved technique for evaluation of resistance of rice varieties to Xanthomonas oryzea[J]. Plant Dis Rep, 1973, 57: 537-541). Inoculate 5-6 leaves per plant.

[0134] 4.4 After completing step 3, continue cultivation for 21 days. After 21 days, measure the length of lesions on the leaves of each plant. There is one lesion along the vein of each leaf. Measure the length of lesions on 3 inoculated leaves of each plant. Repeat the survey for 6 plants and take the average length of the lesions. According to the grading standard of Fang Zhongda et al. (1990), rice varieties are classified into resistance and susceptibility types: lesion length <3cm, 3cm≤lesion length <5cm, 5cm≤lesion length <10cm, 10cm≤lesion length <15cm and lesion length ≥15cm are respectively classified as resistant, moderately resistant, moderately susceptible, susceptible and highly susceptible (Fang Zhongda, Xu Zhigang, Guo Chongjian, Yin Shangzhi, Wu Shangzhong, Xu Xianming, Zhang Qi. Study on pathogenicity of bacterial blight of rice in China. Acta Phytopathologica Sinica, 1990, 20(2):81-88).

[0135] The results are shown in Table 1. Of the 45 rice materials, 9 were resistant to bacterial blight and 36 were susceptible to bacterial blight.

[0136] 5. Identify rice bacterial blight resistance using SNP-12116672.

[0137] The genotype of SNP-12116672 in the rice sample was detected according to the method in step 3. The bacterial blight resistance of the rice sample was then determined based on the genotype results: if the genotype of SNP-12116672 was AA, the rice sample was resistant to bacterial blight. If the genotype of SNP-12116672 was GG, the rice sample was susceptible to bacterial blight. The bacterial blight resistance of the resistant rice was higher than that of the susceptible rice.

[0138] The results are shown in Tables 1 and 2. Figure 1 . Figure 1 In the above, AA refers to the rice material with the genotype AA for SNP-12116672, GG refers to the rice material with the genotype GG for SNP-12116672, and NTC is the blank control in the reaction system without the addition of template DNA.

[0139] Table 1. Leaf lesion length and SNP genotypes after rice germplasm resources were inoculated with GIV-fungus bacterial blight pathogen.

[0140]

[0141]

[0142]

[0143]

[0144] The above results indicate that the genotype of all nine bacterial blight-resistant rice varieties SNP-12116672 was AA; the genotype of all 36 bacterial blight-susceptible rice varieties SNP-15471465 was GG. Rice varieties with the genotype AA in SNP-12116672 showed significantly higher resistance to bacterial blight than those with the genotype GG. According to the grading criteria for bacterial blight resistance levels in rice by Fang Zhongda et al. (Fang Zhongda, Xu Zhigang, Guo Chongjian, Yin Shangzhi, Wu Shangzhong, Xu Xianming, Zhang Qi. Study on pathogenicity of bacterial blight pathogen in rice in China. Acta Phytopathologica Sinica, 1990, 20(2):81-88), rice varieties with the genotype GG in SNP-12116672 showed resistance to bacterial blight.

[0145] The results of this invention in identifying rice bacterial blight resistance using SNP-12116672 are consistent with the actual results of rice bacterial blight resistance testing. Therefore, by detecting polymorphisms or genotypes of SNP-12116672 in the rice genome, rice bacterial blight resistance can be identified rapidly and accurately.

[0146] In breeding rice resistant to bacterial blight, it is best to select rice with the genotype AA at the aforementioned SNP locus as the parent for breeding; in breeding rice susceptible to bacterial blight, it is best to select rice with the genotype GG at the aforementioned SNP locus as the parent for breeding.

[0147] Table 2. Analysis of the relationship between SNP-12116672 genotype and resistance to rice bacterial blight.

[0148] AA <![CDATA[2.24±0.29 b ]]> Disease resistance GG <![CDATA[34.2±0.88 a ]]> Highly susceptible to disease

[0149] Note: Different superscript letters in the same column indicate significant differences (P<0.05).

[0150] Table 2 shows that the average lesion length of homozygous AA rice varieties was 2.24 cm, indicating resistance to bacterial blight. The average lesion length of homozygous GG rice varieties was 34.2 cm, indicating susceptibility to the disease. There was a significant difference in lesion length between the two genotypes.

[0151] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Application of substances for detecting SNP polymorphisms or genotypes in the rice genome in any of the following: (1) To identify or assist in the identification of rice bacterial blight resistance; (2) Screening or breeding rice single plants, lines, strains or varieties resistant to bacterial blight; (3) Screening or breeding of rice individual plants, lines, strains or varieties susceptible to bacterial blight; (4) Prepare products for identification or auxiliary identification of rice bacterial blight resistance; (5) Prepare or select rice single plants, lines, strains or varieties resistant to bacterial blight; (6) Prepare or select rice single plants, lines, strains or varieties susceptible to bacterial blight; The SNP site is a site on rice chromosome 6, and its nucleotide type is A or G, which is the 23rd nucleotide of sequence 4 in the sequence listing. The genotype of the SNP is AA or GG, where AA is the homozygous type of the SNP locus being A, and GG is the homozygous type of the SNP locus being G. The identification or auxiliary identification of rice bacterial blight resistance based on the genotype can be carried out in any of the following ways: 1) The rice species tested with the genotype AA of the SNP is or is a candidate for rice species resistant to bacterial blight; 2) The rice varieties tested with the SNP genotype GG are or candidates for rice varieties susceptible to bacterial blight; 3) The bacterial blight resistance of the tested rice with the SNP genotype AA is higher than that of the tested rice with the SNP genotype GG.

2. The application according to claim 1, characterized in that: The substance is either D1), D2), or D3). D1) A primer composition containing primers that amplify rice genomic DNA fragments including the SNP sites; D2) PCR reagents containing the primer composition described in D1); D3) A kit containing the primer composition described in D1) or the PCR reagent described in D2).

3. The application according to claim 2, characterized in that: The primer composition consists of primer A, primer B and primer C; Primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 1 in the sequence listing or whose nucleotide sequence is the single-stranded DNA at positions 22-44 of sequence 1 in the sequence listing; Primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing or whose nucleotide sequence is single-stranded DNA at positions 22-43 of sequence 2 in the sequence listing; The primer C nucleotide sequence is a single-stranded DNA molecule of sequence 3 in the sequence listing.

4. A method for identifying or assisting in the identification of rice bacterial blight resistance, characterized in that: This includes detecting the genotype of SNP sites in the genome of rice to be tested, and identifying or assisting in the identification of rice bacterial blight resistance based on the genotype. The SNP site is a site on rice chromosome 6, and its nucleotide type is A or G, which is the 23rd nucleotide of sequence 4 in the sequence listing. The genotype of the SNP is AA or GG, where AA is the homozygous type of the SNP site being A, and GG is the homozygous type of the SNP site being G. Rice bacterial blight resistance can be identified or determined using any of the following methods based on the genotype: 1) The rice species tested with the genotype AA of the SNP is or is a candidate for rice species resistant to bacterial blight; 2) The rice varieties tested with the SNP genotype GG are or candidates for rice varieties susceptible to bacterial blight; 3) The bacterial blight resistance of the tested rice with the SNP genotype AA is higher than that of the tested rice with the SNP genotype GG.

5. The application of the method of claim 4 in rice breeding; the purpose of the breeding is to select rice varieties resistant to bacterial blight.

6. A method for rice breeding, characterized by: The method is M1 or M2. M1. The method includes detecting the genotype of the SNP in claim 1 in the rice genome, selecting rice with the genotype AA of the SNP as a parent for breeding, wherein AA is a homozygous type of the SNP locus A, and the breeding purpose of the method includes selecting rice with resistance to bacterial blight. M2. The method includes detecting the genotype of the SNP in claim 1 in the rice genome, selecting rice with the genotype GG of the SNP as a parent for breeding, wherein GG is a homozygous type of the SNP locus G, and the breeding purpose of the method includes selecting rice susceptible to bacterial blight.