An acetic acid bacterium, WJJ, and its application in the degradation of organic pollutants.

CN115873766BActive Publication Date: 2026-09-01ZHEJIANG UNIV OF TECH
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211634201.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-19
Publication Date
2026-09-01
Estimated Expiration
2042-12-19

AI Technical Summary

Technical Problem

解决了物理化学方法的处理效果不佳、不经济的局限性,减少了能耗并解决了二次污染问题

Benefits of technology

[0018]与现有技术相比,本发明有益效果体现在:

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115873766B_ABST
    Figure CN115873766B_ABST
Patent Text Reader

Abstract

This invention discloses an acetic acid bacterium, WJJ, and its application in degrading organic pollutants. The acetic acid bacterium (Acetobacter sp.) WJJ provided by this invention is obtained from a wastewater treatment plant and exhibits highly efficient degradation of propanethiol, completely converting the pollutant into recyclable substances such as elemental sulfur. Simultaneously, this strain is also tolerant of pollutants such as hydrogen sulfide, dimethyl sulfide, ammonia, n-hexane, and benzene compounds, demonstrating strong environmental tolerance. Therefore, it has broad application prospects in the biological purification of industrial waste gas. The acetic acid bacterium described in this invention can completely degrade propanethiol into inorganic substances (CO2, H2O) and cellular biomass, achieving complete mineralization with a high removal rate. Therefore, this acetic acid bacterium has a highly efficient degradation capacity for propanethiol and can withstand high concentrations of pollutants.
Need to check novelty before this filing date? Find Prior Art

Description

(I) Technical Field

[0001] This invention relates to an acetic acid bacterium (Acetobacter sp.) WJJ and its application in degrading pollutants such as propanethiol. (II) Background Technology

[0002] my country is a major livestock country. While livestock farming improves the living standards of its people and provides for their daily needs, it also generates large amounts of difficult-to-treat manure and foul-smelling gases, significantly impacting the daily lives of farm workers and nearby residents. Furthermore, the foul-smelling gases accompanying manure are mainly composed of sulfur and nitrogen compounds, such as hydrogen sulfide, methanethiol, sulfides, and ammonia. These substances are highly irritating to the human respiratory tract, and prolonged exposure can even damage the nervous system. The presence of foul-smelling gases is also detrimental to the healthy growth of livestock and poultry. Moreover, these gases often contain pathogenic microorganisms, suspended particles, parasite eggs, and other toxic and harmful components, posing a significant threat to human health. Therefore, it is essential to strengthen the treatment of livestock and poultry manure, control the emission of foul-smelling gases, and ultimately eliminate or recycle them.

[0003] Physical adsorption methods have been developed for propanethiol in waste gas, but biological processes are generally considered to be a cost-effective alternative. These processes can directly degrade odorous substances or inhibit their production through the action of exogenous functional bacteria or biological enzymes. This method is green, environmentally friendly, safe, and has a good deodorization effect with virtually no secondary pollution.

[0004] Therefore, screening for highly efficient propanethiol-degrading strains from the environment is essential for environmental health. Literature review shows that current research, both domestically and internationally, mainly focuses on the application of acetic acid bacteria (Acetobacter sp.) in catalytic production, with very little research on their degradation of pollutants. (III) Summary of the Invention

[0005] The purpose of this invention is to provide an acetic acid bacterium (Acetobacter sp.) WJJ and its application in degrading organic pollutants. This strain can degrade organic pollutants using propanethiol as the sole sulfur source, producing elemental sulfur. It exhibits good environmental adaptability, is easy to cultivate on a large scale, and possesses a highly efficient and strong ability to degrade malodorous gaseous pollutants, making it a green, economical, and sustainable development approach. It overcomes the limitations of physicochemical methods, such as poor treatment effects and lack of economy, reduces energy consumption, and solves the problem of secondary pollution. This invention is of great significance for promoting the sustainable development of animal husbandry, ensuring national food security, and driving the comprehensive revitalization of rural areas.

[0006] The technical solution adopted in this invention is:

[0007] This invention provides a novel strain of acetic acid bacteria (Acetobacter sp.) WJJ, deposited at the China Center for Type Culture Collection (CCTCC), accession number: CCTCC NO: M20221016, deposit date: July 4, 2022, address: Wuhan University, Wuhan, China, 430072.

[0008] The basic characteristics of the acetic acid bacteria WJJ of this invention are: the colonies are white, with neat edges, opaque, easy to pick up, and the bacterial growth follows the streaks; it is aerobic and Gram-negative.

[0009] The present invention also provides an application of the acetic acid bacteria WJJ in the degradation of organic pollutants. The application involves adding the bacterial solution obtained by expanding the culture of acetic acid bacteria WJJ or the resting cells after centrifugation of the bacterial solution to a liquid culture medium of lactobacillus containing organic pollutants at pH 6-8, and culturing it at 25-35℃ and 100-200 rpm to achieve the degradation of organic pollutants.

[0010] Furthermore, the organic pollutants include propanethiol, dimethyl sulfide, n-hexane, and toluene.

[0011] Furthermore, in the Lactobacillus liquid culture medium, the amount of bacterial solution added is 0.01-0.05 (preferably 0.02) based on OD600; the amount of resting cells added is 20-80 mg / L based on bacterial dry weight, preferably 50 mg / L; and the initial concentration of the organic pollutants is 200-600 mg / L, preferably 400 mg / L.

[0012] Furthermore, the composition of the Lactobacillus liquid culture medium is as follows: 10 g / L beef protein powder, 5 g / L yeast extract, 20 g / L glucose, 5 g / L sodium acetate, 2 g / L disodium citrate, 0.1 g / L Tween 80, 0.58 g / L magnesium sulfate, 0.28 g / L manganese sulfate, with deionized water as the solvent and a pH of 6.2-6.4.

[0013] Furthermore, the acetic acid bacteria WJJ resting cells were prepared according to the following steps:

[0014] (1) Slant culture:

[0015] Acetic acid bacteria WJJ were inoculated into Lactobacillus solid culture medium and cultured in a bacterial incubator at 30℃ for 2 days to obtain slant cells. The Lactobacillus solid culture medium consisted of: 10 g / L beef protein powder, 5 g / L yeast extract, 20 g / L glucose, 5 g / L sodium acetate, 2 g / L disodium citrate, 0.1 g / L Tween 80, 0.58 g / L magnesium sulfate, 0.28 g / L manganese sulfate, 18-20 g / L agar, and deionized water as the solvent, with a pH of 6.2-6.4.

[0016] (2) Expanded cultivation:

[0017] Using an inoculation loop, pick up the slant cells obtained in step (1) and inoculate them into Lactobacillus liquid culture medium. Incubate at 30°C for 24–36 h to obtain a bacterial suspension with OD600 = 0.04–0.08. Centrifuge, collect the wet cells, wash with Lactobacillus liquid culture medium, and obtain resting cells of Acetic Acid Bacteria WJJ. The Lactobacillus liquid culture medium consists of: 10 g / L beef protein powder, 5 g / L yeast extract, 20 g / L glucose, 5 g / L sodium acetate, 2 g / L disodium citrate, 0.1 g / L Tween 80, 0.58 g / L magnesium sulfate, 0.28 g / L manganese sulfate, with deionized water as the solvent and pH 6.2–6.4.

[0018] Compared with the prior art, the beneficial effects of the present invention are reflected in:

[0019] The acetic acid bacteria (Acetobacter sp.) WJJ provided in this invention, obtained from a wastewater treatment plant, exhibits highly efficient degradation of propanethiol, effectively converting pollutants into recyclable substances such as elemental sulfur. Furthermore, this strain is tolerant to pollutants such as hydrogen sulfide, dimethyl sulfide, ammonia, n-hexane, and benzene compounds, demonstrating strong environmental tolerance. Therefore, it has broad application prospects in the biological purification of industrial waste gases.

[0020] The acetic acid bacteria described in this invention can completely degrade propanethiol into inorganic substances (CO2, H2O) and cellular biomass, achieving complete mineralization with a high removal rate. Therefore, this acetic acid bacteria has a highly efficient degradation capacity for propanethiol and can withstand high concentrations of pollutants. (iv) Description of the attached drawings

[0021] Figure 1 This is a photograph of the colony morphology of acetic acid bacteria WJJ on lactobacillus solid culture medium.

[0022] Figure 2 This is a phylogenetic tree diagram of acetic acid bacteria WJJ.

[0023] Figure 3 The degradation curves of propanethiol at different concentrations are shown by acetic acid bacteria WJJ. (V) Detailed Implementation

[0024] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0025] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0026] The Lactobacillus liquid culture medium consists of: 10 g / L beef protein powder, 5 g / L yeast extract, 20 g / L glucose, 5 g / L sodium acetate, 2 g / L disodium citrate, 0.1 g / L Tween 80, 0.58 g / L magnesium sulfate, 0.28 g / L manganese sulfate, and deionized water as the solvent, with a pH of 6.2-6.4.

[0027] The Lactobacillus solid culture medium described herein consists of: 10 g / L beef protein powder, 5 g / L yeast extract, 20 g / L glucose, 5 g / L sodium acetate, 2 g / L disodium citrate, 0.1 g / L Tween 80, 0.58 g / L magnesium sulfate, 0.28 g / L manganese sulfate, and 20 g / L agar. The solvent is deionized water, and the pH is 6.2-6.4.

[0028] Example 1: Isolation, purification and identification of acetic acid bacteria (Acetobacter sp.) WJJ.

[0029] 1. Isolation and purification of acetic acid bacteria WJJ.

[0030] Acetic acid bacteria WJJ is a Gram-negative bacterium that was domesticated and isolated from activated sludge. The specific steps are as follows:

[0031] Add 50 mL of Lactobacillus liquid culture medium to a 300 mL shake flask, along with 10 mL of activated sludge and 0.6 g / mL propanethiol for enrichment culture. When the propanethiol concentration reaches 50% of the initial concentration, take 5 mL of the enriched solution and add it to 50 mL of fresh Lactobacillus liquid culture medium. Add the same amount of propanethiol, and repeat the above enrichment process 5 times. After the final enriched solution is serially diluted and plated onto Lactobacillus solid culture medium, single colony isolation plates are used for purification by streaking. Figure 1 The selected candidate bacteria were added to a liquid culture medium containing 0.6 g / ml propanethiol for verification. The colonies that grew were picked to obtain strain WJJ.

[0032] 2. Identification of strain WJJ

[0033] 1) Characteristics of strain WJJ: The colonies are white with neat edges, opaque, easy to pick up, and Gram-negative.

[0034] 2) The ability of the strain to utilize 47 carbon sources on bioMérieux BN cards.

[0035] The metabolic activity of strain WJJ to 47 different carbon sources was investigated using the bioMérieux automated identification system (contracted to Zhejiang Tianke High-Tech Development Co., Ltd. (formerly Zhejiang Institute of Microbiology)). The identification results are shown in Table 1. Using the VITEK biochemical reaction system, strain WJJ showed strong utilization of 16 carbon sources, but could not utilize the other 31.

[0036] 3) Through 16S rRNA sequence analysis and physiological and biochemical experiments, the strain was identified as *Acetobacter* sp., with the specific steps as follows:

[0037] DNA from strain WJJ was extracted and purified using the Ezup column-based bacterial genomic DNA extraction kit and stored at 4°C. The purified DNA was amplified by PCR using universal primers for bacteria: 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT). The PCR reaction program was set as follows: 94°C pre-denaturation for 4 min, followed by 94°C denaturation for 45 s, 55°C annealing for 45 s, and 72°C extension for 1 min, for 30 cycles, and a final 72°C repair extension for 10 min. The PCR product was purified and recovered, and then sequenced (Zhejiang Tianke High-Tech Development Co., Ltd. (formerly Zhejiang Institute of Microbiology)). The 16S rRNA sequencing result (SEQ ID NO.1) was uploaded to NCBI, obtaining accession number OP649447. This sequence was also compared with gene sequences in the NCBI database using BLAST. It was found to belong to the genus *Acetobacter*, and showed 99% homology with *Acetobacter aceti* NBRC 14818 strain JCM 7641, *Acetobacter sicerae* strain LMG 1530, and *Acetobacter conturbans* strain LMG 1627. Ten representative *Acetobacter* strains were selected from the results, and a phylogenetic tree was constructed using MEGA 7.0 software based on 16S rRNA gene sequence homology. Figure 2 Based on genetic distance and 16S rRNA sequence comparison, combined with physiological and biochemical characteristics, strain WJJ was identified as *Acetobacter* sp. and named *Acetobacter* sp. WJJ. It is deposited at the China Center for Type Culture Collection (CCTCC), accession number: CCTCC NO: M20221016, deposit date: July 4, 2022, address: Wuhan University, Wuhan, China, 430072, China.

[0038] Table 1. Biochemical reaction results of strain WJJ using the VITEK automated identification system (GN card).

[0039]

[0040]

[0041]

[0042] Note: + indicates a positive reaction; - indicates a negative reaction.

[0043] Example 2: Obtaining resting cells of acetic acid bacteria WJJ

[0044] 1. Slant culture

[0045] Acetic acid bacteria WJJ were inoculated into liquid culture medium of lactobacillus and cultured at 30℃ and 160 rpm for 24-36 h. The activated bacteria were then streaked on solid culture medium plates of lactobacillus and incubated at 30℃. Single colonies were taken and streaked again to test the purity of the bacteria. The lactobacillus solid test tube slant was then routinely stored (4℃).

[0046] 2. Expand training

[0047] The slant cells from step 1 were inoculated into Lactobacillus liquid culture medium and cultured at 30℃ and 160 rpm for 24–36 h to obtain a bacterial suspension with OD600 = 0.04–0.08. The suspension was centrifuged, the wet cells were collected, washed with Lactobacillus liquid culture medium, and resting cells of Acetic Acid Bacteria WJJ were obtained.

[0048] Example 3: Degradation performance of acetic acid bacteria WJJ on propanethiol at different concentrations.

[0049] Lactobacillus liquid culture medium was dispensed into 300 mL shake flasks (100 mL per flask) and sterilized at 121°C for 20 min. After sterilization, the flasks were left at room temperature for 2 days to confirm the absence of contaminating bacteria. Resting cells obtained in Example 2 were added to a final concentration of 50 mg / L (based on cell dry weight). Propanethyl mercaptan was then added as the sole sulfur and carbon source to final concentrations of 200, 400, and 600 mg / L, respectively. The shake flasks were sealed and incubated at 30°C and 160 rpm using a shaker. A blank control without bacteria was also included. The residual propanethyl mercaptan concentration in the shake flasks was periodically measured using gas chromatography. Removal rate curves of propanethyl mercaptan at different initial concentrations were plotted over time. The results are shown in [Figure number missing]. Figure 3 As shown in the figure. The results indicate that strain WJJ can rapidly degrade all added substrates when the concentration of propanethiol is 200-600 mg / L.

[0050] The content of propanethiol was determined using a Shimadzu GC-2014 gas chromatograph. For the determination of propanethiol, an RTX-1 capillary column (30 m × 250 μm × 25 μm) was used, and the carrier gas (high-purity N2) flow rate was 20.4 mL / min. -1 The column flow rate was 0.83 mL / min. -1 The column oven and flame ionization detector (FID) temperatures were set to 120 °C and 230 °C, respectively. Under these conditions, the elution time of propanethiol was 2.3 min.

[0051] Example 4, Other Substrates

[0052] In practical applications, propanethiol is not the only organic pollutant present; industrial waste gases generally contain a variety of volatile organic compounds. Therefore, it is necessary to study the degradation effects of bacteria WJJ on other substrates.

[0053] Lactobacillus liquid culture medium was dispensed into 300 mL shake flasks (100 mL per flask) and sterilized at 121°C for 20 min. After sterilization, the flasks were left at room temperature for 2 days to confirm no contamination. The bacterial culture obtained in Example 2 was added to bring the initial bacterial concentration (OD600) to 0.02. Propanethyl mercaptan was then added as the sole sulfur and carbon source to a final concentration of 400 mg / L. The shake flasks were sealed and cultured on a shaker at pH 6.4, 30°C, and 160 rpm. A blank control without bacteria was also included. Samples were taken periodically, and the concentration of residual propanethyl mercaptan in the shake flasks was determined using the gas chromatograph described in Example 3. As shown in Table 2, the strain exhibited varying degrees of degradation ability for methyl sulfide, n-hexane, and toluene.

[0054] Table 2. Degradation effect of bacteria WJJ on different carbon sources

[0055] Dimethyl sulfide 10.1 24 100% n-Hexane 7.92 24 75% Toluene 10.5 24 70%

[0056] Although the present invention has been disclosed above with reference to embodiments, it is not intended to limit the scope of protection of the present invention. Any modifications and refinements made by those skilled in the art without departing from the concept and scope of the present invention shall fall within the scope of protection of the present invention.

Claims

1. Acetic acid bacteria ( Acetobacter sp. WJJ, characterized in that, Acetic acid bacteria WJJ is deposited at the China Center for Type Culture Collection, accession number: CCTCC NO: M 20221016, deposit date: July 4, 2022, address: Wuhan University, Wuhan, China, 430072, China.

2. The application of the acetic acid bacteria WJJ as described in claim 1 in the degradation of organic pollutants, characterized in that, The organic pollutants are propane mercaptan, dimethyl sulfide, n-hexane, or toluene.

3. The application according to claim 2, characterized in that, The application described is as follows: The bacterial culture obtained by expanding the culture of acetic acid bacteria WJJ or the resting cells after centrifugation of the bacterial culture are added to a liquid culture medium of lactobacillus containing organic pollutants at pH 6-8, and cultured at 25-35℃ and 100-200rpm to achieve the degradation of organic pollutants.

4. The application according to claim 3, characterized in that, In the Lactobacillus liquid culture medium, the amount of bacterial solution added is 0.01-0.05 based on OD600; the amount of resting cells added is 20-80 mg / L based on bacterial dry weight.

5. The application according to claim 3, characterized in that, The initial concentration of the organic pollutant is 200-600 mg / L.

6. The application according to claim 3, characterized in that, The Lactobacillus liquid culture medium consists of: 10 g / L beef protein powder, 5 g / L yeast extract, 20 g / L glucose, 5 g / L sodium acetate, 2 g / L disodium citrate, 0.1 g / L Tween 80, 0.58 g / L magnesium sulfate, 0.28 g / L manganese sulfate, and deionized water as the solvent, with a pH of 6.2-6.

4.

7. The application according to claim 3, characterized in that, The resting cells of the acetic acid bacteria WJJ were prepared according to the following steps: (1) Slant culture: Acetic acid bacteria WJJ were inoculated into Lactobacillus solid culture medium and cultured in a bacterial incubator at 30℃ for 2 days to obtain slant cells. The Lactobacillus solid culture medium consisted of: 10 g / L beef protein powder, 5 g / L yeast extract, 20 g / L glucose, 5 g / L sodium acetate, 2 g / L disodium citrate, 0.1 g / L Tween 80, 0.58 g / L magnesium sulfate, 0.28 g / L manganese sulfate, 18-20 g / L agar, and deionized water as the solvent, with a pH of 6.2-6.

4. (2) Expanded cultivation: Using an inoculation loop, pick up the slant cells obtained in step (1) and inoculate them into Lactobacillus liquid culture medium. Incubate at 30°C for 24-36 hours to obtain a bacterial suspension with OD600 = 0.04-0.

08. Centrifuge, collect the wet cells, wash with Lactobacillus liquid culture medium, and obtain resting cells of Acetic Acid Bacteria WJJ. The Lactobacillus liquid culture medium consists of: 10 g / L beef protein powder, 5 g / L yeast extract, 20 g / L glucose, 5 g / L sodium acetate, 2 g / L disodium citrate, 0.1 g / L Tween 80, 0.58 g / L magnesium sulfate, 0.28 g / L manganese sulfate, with deionized water as the solvent and pH 6.2-6.4.

Citation Information

Patent Citations

  • Stain for degrading ethanethiol, as well as culture method and application of strain

    CN103667119A

  • Treatment method realizing resource utilization and zero pollution emission of pig farm waste

    CN107698119A