A moso bamboo circrna sequence and application thereof

Abstract

The present application relates to the technical field of plant genetic engineering, and particularly relates to a Phyllostachys edulis Meissn. circRNA sequence and application thereof.The nucleotide sequence of the PecircCDPK gene provided by the present application is shown as SEQ ID NO.1.The PecircCDPK sequence is obtained from Phyllostachys edulis Meissn. for the first time, and the biological function of the PecircCDPK sequence is verified by overexpressing the PecircCDPK sequence in Arabidopsis.The PecircCDPK has the function of regulating the drought resistance of plants, can provide strong support for Phyllostachys edulis Meissn. transgenic research, and provide valuable candidate genes for Phyllostachys edulis Meissn. molecular breeding.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to a moso bamboo circRNA sequence and its applications. Background Technology

[0002] Moso bamboo (Phyllostachys edulis), also known as nan bamboo or cat's head bamboo, grows rapidly, is widely distributed, has great production potential, and is widely used. However, with global climate change, the growth of moso bamboo is often affected by adverse environmental factors such as drought and high temperatures.

[0003] Circular RNAs (circRNAs) are a novel type of non-coding RNA covalently bound at their 5' and 3' ends. Compared to traditional linear RNAs, circRNAs have a closed circular structure and are not easily degraded by exonucleases, leading them to be long considered as cleavage errors and devoid of any function. However, in recent years, with the development of high-throughput sequencing technology and bioinformatics, circRNAs have been found to directly or indirectly participate in multiple biological processes in plants, including growth and development, flowering regulation, and responses to abiotic stresses. In the bamboo shoot stage, circRNAs have also been identified as participating in lignin synthesis.

[0004] However, there are currently no reports on the circRNAs of moso bamboo under drought stress. Therefore, conducting functional studies on the circRNAs of moso bamboo under drought stress is of great significance, as it can provide new theoretical basis and genetic resources for bamboo resistance breeding. Summary of the Invention

[0005] The purpose of this invention is to provide the PecircCDPK gene and its applications; specifically, this invention provides circRNAs associated with drought stress in moso bamboo.

[0006] To achieve the objectives of this invention, in a first aspect, this invention provides a PecircCDPK gene associated with drought resistance, the nucleotide sequence of which is shown in SEQ ID NO.1. The PecircCDPK gene encodes a circular RNA associated with plant drought resistance.

[0007] The present invention uses the following method to verify the PecircCDPK gene:

[0008] (1) Total RNA and DNA were extracted from bamboo leaves cultured for 3 months. The total RNA was treated with RNase R and reverse transcribed into cDNA. In this invention, the extraction of total RNA and DNA from bamboo can be performed using methods commonly used in the field for extracting total RNA and DNA from cells. In the embodiments of this invention, the Trizol method was used for total RNA and the CTAB method was used for DNA.

[0009] (2) After extracting total RNA and DNA from moso bamboo, the total RNA is treated with RNase R enzyme and reverse transcribed to synthesize cDNA. In this invention, cDNA synthesis can be performed using conventional cDNA synthesis methods in the art, without any other special requirements; in the embodiments of this invention, a cDNA synthesis kit from Takara Corporation can be used for cDNA synthesis.

[0010] (3) After obtaining cDNA and DNA, PCR amplification verification of the PecircCDPK gene using divergent and convergent primers was performed. In this invention, the preferred PCR amplification system for the PecircCDPK gene is a 20 μL system, comprising 4.0 μL of 5×PrimeSTAR GXL Buffer, 1.6 μL of 2.5 mM dNTP Mix, 1.0 μL of upstream primer, 1.0 μL of downstream primer, 2.0 μL of cDNA / gDNA, 0.2 μL of PrimeSTAR GXL DNA, and 10.0 μL of ddH2O. The preferred PCR amplification reaction program is: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s; 55℃ annealing for 30 s; 72℃ extension for 10 s, 30 cycles; storage at 4℃.

[0011] Primers for divergence and convergence were designed using Primer Premier 5 software, targeting gDNA and cDNA (RNase R), respectively. + PecircCDPK was used as a template for verification. The primer sequences are as follows:

[0012] Diverging upstream primer: 5′-TTCAAGGCAATGGACACAGA-3′ (SEQ ID NO.5)

[0013] Downstream primer for dispersion: 5′-AGGAGCAACTCCATGGTCAC-3′ (SEQ ID NO.6)

[0014] Converging upstream primer: 5′-AGAGCCTTTCAGAGGAGGAGA-3′ (SEQ ID NO.7)

[0015] The downstream primer for convergence is 5′-CGCCTCCATAAGATCACGAA-3′ (SEQ ID NO.8).

[0016] (4) After obtaining the target fragment by PCR amplification, the target fragment is sequenced to verify the PecircCDPK gene. It is preferable to purify the target fragment after PCR amplification. There are no specific limitations on the purification method; any DNA purification kit familiar to those skilled in the art can be used.

[0017] (5) After purification, the purified target fragment is preferably ligated into the pGEM-T Easy vector, introduced into Escherichia coli Trans5α competent cells, and sequenced after being verified as a positive clone by colony PCR.

[0018] Secondly, the present invention provides biological materials containing the PecircCDPK gene described above. The biological materials are recombinant DNA, expression cassettes, transposons, plasmid vectors, viral vectors, engineered bacteria, or non-renewable plant parts.

[0019] Thirdly, the present invention seeks protection for the use of the PecircCDPK gene or the biological material described above in achieving any one or more of the following:

[0020] 1) Regulating plant drought resistance;

[0021] 2) Preparation of drought-resistant plants;

[0022] 3) Prepare substances that regulate plant drought resistance.

[0023] Specifically, in the application provided by this invention, transgenic plants are prepared using the PecircCDPK gene or the biological material.

[0024] More specifically, in the applications provided by this invention, the plants include Arabidopsis thaliana and bamboo.

[0025] Fourthly, the present invention provides a method for improving the drought resistance of plants, comprising: overexpressing the PecircCDPK gene in plants using genetic engineering techniques; preferably, the plants include Arabidopsis thaliana and moso bamboo.

[0026] In the method for improving plant drought resistance provided by the present invention, the overexpression mode is selected from the following 1) to 5), or any combination of 1) to 5):

[0027] 1) By importing a plasmid containing the gene;

[0028] 2) By increasing the copy number of the aforementioned genes on plant chromosomes;

[0029] 3) By altering the promoter sequence of the aforementioned genes on plant chromosomes;

[0030] 4) By operatively linking a strong promoter to the gene;

[0031] 5) By importing enhancers.

[0032] In the method provided by this invention, the PecircCDPK gene is transferred into Arabidopsis thaliana plants using Agrobacterium-mediated transformation to obtain transgenic Arabidopsis thaliana plants overexpressing the gene.

[0033] Preferably, the PecircCDPK gene is constructed into the plant expression vector pCAMBIAsuper1300-GFP, transformed into Agrobacterium, and then Arabidopsis inflorescences are inoculated to screen transgenic Arabidopsis plants.

[0034] As a specific embodiment of the present invention, the expression vector carrying the target gene can be introduced into plant cells using conventional biotechnological methods such as Ti plasmids, plant virus vectors, direct DNA transformation, microinjection, and electroporation.

[0035] Furthermore, the PecircCDPK gene was transferred into Arabidopsis thaliana plants using Agrobacterium-mediated transformation to obtain transgenic plants overexpressing the gene.

[0036] Preferably, the PecircCDPK gene is constructed into the plant expression vector pCAMBIAsuper1300-GFP, transformed into Agrobacterium, and then Arabidopsis inflorescences are inoculated to screen transgenic plants.

[0037] In one specific embodiment of the present invention, the plant overexpression vector pCAMBIAsuper1300-GFP is used as the base vector and modified to obtain the pCAM BIAsuper1300-GFP-PecircCDPK overexpression vector. The specific implementation scheme is as follows:

[0038] 1. Cloning and ligation of upstream circularization-driven sequences

[0039] Using the DNA of the bamboo gene PH02Gene31251 as a template, an internal intron fragment of 437 bp, representing the upstream circularization-driven sequence, was selected. XbaI and KpnI restriction enzyme sites were introduced at both ends. The amplified product was ligated into the pGEM-TEasy vector, transformed into Trans5α competent cells, and sequenced. Plasmid was extracted, and the upstream intron fragment, digested with XbaI and KpnI, was ligated into pCAMBIAsuper1300-GFP, transformed, and the plasmid was extracted and sequenced. The bamboo gene PH02Gene31251 is available on the bamboo genome public website. http: / / 172.26.100.143 / # / )(Bamboo It can be found in version V2; see SEQ ID NO.3 for specific sequence information.

[0040] 2. Cloning and ligation of downstream circularization-driven sequences

[0041] The downstream circularization-driven sequence is the reverse complementary sequence of the upstream circularization-driven sequence. BsrGI and EcoRI restriction sites were introduced at both ends. The amplification product was ligated into the pGEM-T Easy vector, transformed into Trans5α competent cells, and sequenced. The plasmid was extracted, and the downstream intron fragment, double-digested with BsrGI and EcoRI, was ligated into pCAMBIAsuper1300-GFP containing the upstream circularization-driven sequence. The cells were then transformed, the plasmid was extracted, and sequenced.

[0042] 3. Recombinant expression vectors driven by reverse complementation and flanking intron-assisted circular sequence ligation.

[0043] To ensure accurate circularization of the target sequence via reverse splicing, flanking intron sequences of at least 100 bp from both ends of the target sequence need to be cloned simultaneously during PCR. Using DNA from the bamboo gene PH02Gene31251 as a template, flanking intron sequences (171 bp upstream, 137 bp downstream) were cloned from the PecircCDPK circularization region. KpnI and BsrGI restriction sites were introduced at both ends, respectively. The vector was then ligated to pCAMBIAsuper1300-GFP, which contains the upstream and downstream circularization driver sequences, using homologous recombination. The resulting vector was transformed, plasmid extracted, and sequenced. The plant expression vector pCAMBIAsuper1300-GFP-PecircCDPK was then constructed.

[0044] The preparation method of transgenic Arabidopsis thaliana is as follows:

[0045] The constructed plant expression vector pCAMBIAsuper1300-GFP-PecircCDPK was transformed into competent Agrobacterium strain GV3101; positive clones were selected for inoculation, inflorescence infection, and screening of homozygous seeds; total RNA was extracted from the leaves of positive Arabidopsis seedlings, treated with RNase R, and reverse transcribed into cDNA, which was then identified by PCR using the divergent upstream primer PecircCDPK-F and the divergent downstream primer PecircCDPK-R.

[0046] As understood by those skilled in the art, this invention also seeks protection for the application of transgenic plants obtained by the above-described method for improving plant drought resistance in plant breeding.

[0047] The breeding objective is to improve the drought resistance of plants. The PecircCDPK gene is involved in the drought stress response of moso bamboo, and drought stress can induce the expression of this gene.

[0048] In the applications provided by this invention, the breeding methods include transgenic, hybridization, backcrossing, self-pollination, or asexual reproduction.

[0049] The beneficial effects of this invention are as follows:

[0050] This invention reveals the biological function of the PecircCDPK gene for the first time. By constructing a PecircCDPK gene expression vector and combining it with Agrobacterium-mediated genetic transformation, Arabidopsis thaliana was heterologously transformed. The effects of PecircCDPK on the drought resistance of transgenic Arabidopsis thaliana were investigated, and the response of PecircCDPK to drought stress in moso bamboo was also detected. This provides a powerful tool for transgenic research on moso bamboo and a valuable candidate gene for molecular breeding of moso bamboo resistance. Attached Figure Description

[0051] Figure 1 The images shown in this embodiment of the invention are: (A) electrophoresis of the PecircCDPK gene verification PCR product; (B) electrophoresis of the PCR product of the PecircCDPK circular region plus flanking intron fragment and the intron fragment selected from the PH02Gene31251 gene of moso bamboo; and (C) electrophoresis of the PecircCDPK plant expression vector and enzyme digestion verification. In lane A, divergent primers and convergent primers were used for amplification, respectively. In lanes 1-2 of lane B, the PecircCDPK circular region plus flanking intron fragment and the intron fragment selected from the PH02Gene31251 gene of moso bamboo are respectively, and M1-M2 are DNA markers. In lanes 1-2 of lane C, the enzyme digestion products are shown, and M1-M2 are DNA markers.

[0052] Figure 2 This is a schematic diagram of constructing a recombinant expression vector driven by reverse complementarity and flanking intron-assisted circular sequence ligation in an embodiment of the present invention, wherein 1031bp = upstream of flanking intron (171bp) + exon 1 (118bp) + unspliced ​​intron in the middle (439bp) + exon 2 (166bp) + downstream of flanking intron (137bp).

[0053] Figure 3 The values ​​represent the relative expression levels of the PecircCDPK gene in bamboo leaves under different drought stresses in this embodiment of the invention.

[0054] Figure 4 This invention provides an analysis of root length in Arabidopsis thaliana transgenic with the PecircCDPK gene and wild-type Arabidopsis thaliana under different drought stresses.

[0055] Figure 5 This invention relates to the determination of leaf water loss rate and relative water content in Arabidopsis thaliana transgenic with the PecircCDPK gene and wild-type Arabidopsis thaliana.

[0056] Figure 6This study examines the free proline content (A), malondialdehyde content (B), superoxide dismutase activity (C), and peroxidase activity (D) of Arabidopsis thaliana transgenic with the PecircCDPK gene and wild-type Arabidopsis thaliana under drought stress in embodiments of the present invention.

[0057] Figure 7 This study aims to detect the expression levels of relevant CDPK genes in Arabidopsis thaliana transgenic with the PecircCDPK gene and wild-type Arabidopsis thaliana in this embodiment of the invention. Detailed Implementation

[0058] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the examples are conducted under conventional experimental conditions, such as those described in Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001, or as recommended in the manufacturer's instructions.

[0059] Example 1: Obtaining the full length of the PecircCDPK gene

[0060] The bamboo material used in this embodiment was sourced from Guangxi Zhuang Autonomous Region and placed in a constant temperature and light incubator with a day / night temperature of 25℃ / 18℃ and a photoperiod of 16h / 8h light / dark. After approximately three months of cultivation, drought stress was simulated using 20% ​​PEG 6000. Leaves from the same location at 0h, 6h, 12h, 24h, and 48h after treatment were rapidly frozen in liquid nitrogen and stored at -80℃. Total RNA was extracted from bamboo leaves under different drought stress treatments using the Trizol method. The total RNA was processed using the RiboZero rRNARemoval Kit, followed by the addition of 20 U / μL of the reagent. -1 RNase R was incubated at 37°C for 1 hour to eliminate interference from linear RNA. A fragmentation reagent was added, and the first-strand cDNA was synthesized using a six-base random primer. Second-strand synthesis reagents were added sequentially to the synthesized first-strand cDNA product, followed by purification. The purified product underwent end repair, the addition of an "A" base, and ligation with a sequencing adapter. Fragment size screening was then performed, followed by PCR amplification. Finally, sequencing was performed using Illumina HiSeq. The resulting full-length circular RNA sequence, SEQ ID NO. 1, is shown below.

[0061] gtcatccgtggatttgtgaccatggagttgctcctgatcggcctcttgatccagctgtcctttctcgcattaagcagttctcagcaatgaataagttgaagaagatggctttgcgagtaattgctgagagcctttcagagga ggagaattgcaggactaaaggaaatgttcaaggcaatggacacagataacagcggtgcaattacatatgatgagctcaaagaaggcatgagaaaatatggttcaacactaaaggatacagaaattcgtgatcttatggaggcg.

[0062] Example 2: Validation of the PecircCDPK gene

[0063] This embodiment uses bamboo leaves as material. Total RNA was extracted from the leaves according to the Trizol RNA Extraction Kit (Tiangen Biotech Co., Ltd.) instructions, and total DNA was extracted from the leaves using the CTAB method. The total RNA was treated with RNase R. Each μg of total RNA was mixed with 2-3U RNase R (Gise Biotech, 20U / μl) and incubated at 37℃ for 15 min. 1 ng of RNase R-treated RNA was reverse transcribed into cDNA using a reverse transcription kit (Takara). Based on the bamboo genome database http: / / bamboo.bamboogdb.org / # / , divergent and convergent primers were designed using Primer Premier 5 software to extract gDNA and cDNA (RNase R). + PecircCDPK is used as a template for verification.

[0064] Diverging upstream primer: 5′-TTCAAGGCAATGGACACAGA-3′

[0065] Dispersive downstream primer: 5′-AGGAGCAACTCCATGGTCAC-3′

[0066] Converging upstream primer: 5′-AGAGCCTTTCAGAGGAGGAGA-3′

[0067] Converging downstream primer: 5′-CGCCTCCATAAGATCACGAA-3′

[0068] Polymerase chain reaction:

[0069] 20 μL reaction system: 4.0 μL 5×PrimeSTAR GXL Buffer, 1.6 μL 2.5 mM dNTP Mix, 1.0 μL upstream primer, 1.0 μL downstream primer, 2.0 μL cDNA / gDNA, 0.2 μL PrimeSTAR GXL DNA, 10.0 μL ddH2O.

[0070] PCR reaction procedure: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s; 55℃ annealing for 30 s; 72℃ extension for 10 s, 30 cycles; store at 4℃.

[0071] The recovered product was ligated into the pGEM-T Easy vector, transformed into Trans5α competent cells, and positive clones were selected for plaque PCR detection. The positive clones were then sequenced (Shanghai Sangon Biotech Co., Ltd.), and the sequencing results were accurate. The nucleotide sequence of PecircCDPK was verified as shown in SEQ ID NO.2.

[0072] Example 3: Construction of the plant expression vector pCAMBIAsuper1300-GFP-PecircCDPK

[0073] In this embodiment, the plant overexpression vector pCAMBIAsuper1300-GFP was used as the base vector and modified to obtain the PecircCDPK overexpression vector.

[0074] 1. Cloning and ligation of upstream circularization-driven sequences

[0075] Using the DNA of the bamboo gene PH02Gene31251 as a template, a partial intron fragment with a length of 437 bp (SEQ ID NO.4) was selected, which is the upstream circularization driver sequence. Figure 1 (B) Double restriction enzyme sites of XbaI and KpnI were introduced at both ends; the amplification product was ligated into the pGEM-T Easy vector (Promega), transformed into Trans5α competent cells, and sequenced; the plasmid was extracted, the upstream intron fragment digested with XbaI and KpnI was ligated into pCAMBIAsuper1300-GFP, transformed, the plasmid was extracted, and sequenced.

[0076] Upstream primer Up-2-F: 5′-TCTAGACTCATCACCAAGGAGGACGTC-3′ (SEQ ID NO.9);

[0077] Downstream primer Up-2-R: 5′-GGTACCCTCAGCAGTCGGCAAAGCGA-3′ (SEQ ID NO.10).

[0078] (1) PCR reaction was performed using DNA from bamboo leaves as a template.

[0079] 20 μL reaction system: 4.0 μL of 5×PrimeSTARGXL Buffer, 1.6 μL of 2.5 mM dNTP Mix, 1.0 μL of upstream primer, 1.0 μL of downstream primer, 2.0 μL of DNA template, 0.4 μL of PrimeSTAR GXL DNA, and 10.0 μL of ddH2O.

[0080] PCR reaction procedure: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s; 55℃ annealing for 30 s; 72℃ extension for 26 s, 30 cycles; store at 4℃.

[0081] (2) Recovery and ligation of amplified products

[0082] The recovered fragment was ligated into the pGEM-T Easy vector, transformed into Trans5α competent cells, and sequenced. The sequencing results were accurate.

[0083] (3) Construction of the upstream circularization driver sequence of the expression vector pCAMBIAsuper1300-GFP

[0084] pGEM-T Easy, ligated with an upstream circularization driver sequence, was double-digested with XbaI and KpnI. This was then used to construct a recombinant plasmid with the XbaI and KpnI-digested expression vector pCAMBIAsuper1300-GFP. The digestion system was as follows (50 μL):

[0085]

[0086] The plasmid was digested at 37℃ for 4 hours. The products were subjected to agarose gel electrophoresis, and the large fragment of plasmid pCAMBIAsuper1300-GFP and the small fragment of its upstream circularized driver sequence were recovered using a gel extraction kit (Axygen). The two recovered products were ligated using T4 DNA ligase in the following ligation reaction volume (20 μL):

[0087]

[0088] The ligation reaction was performed overnight at 4°C, and all ligation products were transformed into Trans5α competent cells. After overnight culture at 37°C, single clones were selected, and colony PCR was performed for verification. The cells were then expanded, and the upstream circularization-driven sequence of plasmid pCAMBIAsuper1300-GFP was extracted for sequencing and enzyme digestion verification.

[0089] 2. Cloning and ligation of downstream circularization-driven sequences

[0090] The downstream circularization-driven sequence is the reverse complementary sequence of the upstream circularization-driven sequence. BsrGI and EcoRI restriction sites were introduced at both ends. The amplification product was ligated into the pGEM-T Easy vector, transformed into Trans5α competent cells, and sequenced. The plasmid was extracted, and the downstream intron fragment, double-digested with BsrGI and EcoRI, was ligated into pCAMBIAsuper1300-GFP containing the upstream circularization-driven sequence. The cells were then transformed, the plasmid was extracted, and sequenced.

[0091] Upstream primer Down-2-F: 5′-GAATTCCTCATCACCAAGGAGGACGTC-3′ (SEQ ID NO.11);

[0092] Downstream primer Down-2-R: 5′-TGTACACTCAGCAGTCGGCAAAGCGA-3′ (SEQ ID NO.12).

[0093] (1) PCR reaction was performed using DNA from bamboo leaves as a template.

[0094] 20 μL reaction system: 4.0 μL 5×PrimeSTAR GXL Buffer, 1.6 μL 2.5 mM dNTP Mix, 1.0 μL upstream primer, 1.0 μL downstream primer, 2.0 μL DNA template, 0.4 μL PrimeSTAR GXL DNA, 10.0 μL ddH2O.

[0095] PCR reaction procedure: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s; 55℃ annealing for 30 s; 72℃ extension for 26 s, 30 cycles; store at 4℃.

[0096] (2) Recovery and ligation of amplified products

[0097] The recovered fragment was ligated into the pGEM-T Easy vector, transformed into Trans5α competent cells, and sequenced. The sequencing results were accurate.

[0098] (3) Construction of downstream circularization driver sequence and upstream circularization driver sequence of expression vector pCAMBIAsuper1300-GFP

[0099] pGEM-T Easy, ligated with a downstream circularization driver sequence, was double-digested with BsrGI and EcoRI. A recombinant plasmid was then constructed by combining this plasmid with the upstream circularization driver sequence of the expression vector pCAMBIAsuper1300-GFP, which was also double-digested with BsrGI and EcoRI. The digestion system was as follows (50 μL):

[0100]

[0101] The plasmid was digested at 37℃ for 4 hours. The products were subjected to agarose gel electrophoresis, and the upstream circularization driver sequence (large fragment) and downstream circularization driver sequence (small fragment) of plasmid pCAMBIAsuper1300-GFP- were recovered using a gel extraction kit (Axygen). The two recovered products were ligated using T4 DNA ligase in the following ligation reaction volume (20 μL):

[0102]

[0103] The ligation reaction was performed overnight at 4°C, and all ligation products were transformed into Trans5α competent cells. After overnight culture at 37°C, single clones were selected, and colony PCR was performed for verification. The cells were then expanded, and the upstream and downstream circularization driver sequences of the plasmid pCAMBIAsuper1300-GFP were extracted, sequenced, and verified by enzyme digestion. The obtained vector plasmid was named pCAMBIAsuper1300-GFP-OE.

[0104] 3. Recombinant expression vectors driven by reverse complementation and flanking intron-assisted circular sequence ligation.

[0105] To ensure accurate circularization of the target sequence via backsplicing, flanking intron sequences of at least 100 bp from both ends of the target sequence must be cloned simultaneously during PCR. Using DNA from the bamboo gene PH02Gene31251 as a template, the flanking intron sequences (171 bp upstream and 137 bp downstream) of the PecircCDPK circularization region were cloned. A schematic diagram of the recombinant expression vector construction is shown below. Figure 2 KpnI and BsrGI restriction site sequences were introduced at both ends, respectively; the pCAMBIAsuper1300-GFP-OE containing upstream and downstream circularization driver sequences was ligated and transformed using homologous recombination, plasmid was extracted, and sequenced. The plant expression vector pCAMBIAsuper1300-GFP-PecircCDPK was then constructed.

[0106] Upstream primer circCDPK-2-F: 5′-GGTACCTTCCCATGTAGAACTTCCTTG-3′ (SEQ ID NO.13);

[0107] Downstream primer circCDPK-2-R: 5′-TGTACACATGTGCAAGAAACCAGTTG-3′ (SEQ ID NO.14).

[0108] The target fragment was recovered using a gel extraction kit (Axygen). The ligation reaction was performed according to the standard operating procedure of a one-step cloning kit (Nanjing Novizan), and the ligation reaction volume was as follows (20 μL):

[0109]

[0110]

[0111] The reaction was carried out at 37℃ for 30 min, and all ligation products were transformed into Trans5α competent cells. After overnight culture at 37℃, single clones were selected, and colony PCR was performed for verification. The cells were then expanded, and the plasmid pCAMBIAsuper1300-GFP-PecircCDPK was extracted for sequencing and enzyme digestion verification. Figure 1 ).

[0112] Example 4: Transformation of Arabidopsis thaliana with the plant expression vector pCAMBIAsuper1300-GFP-PecircCDPK

[0113] This embodiment provides a method for transforming Arabidopsis thaliana with the plant expression vector pCAMBIAsuper1300-GFP-PecircCDPK. The specific steps are as follows:

[0114] (1) Freeze-thaw transformation of Agrobacterium GV3101 strain

[0115] Add 1 ng of the recombinant expression vector plasmid to 100 μL of competent GV3101 cells. After incubating on ice for 10 min, rapidly freeze the competent cells in liquid nitrogen for 5 min, then quickly transfer them to a 37°C water bath for 5 min, followed by 5 min on ice. Add 600 μL of LB broth to a centrifuge tube and incubate with shaking at 28°C for 2-3 h to revive the cells. Spread 60 μL of the bacterial culture onto YEP solid medium containing Kan resistance (50 mg / mL) and Rif resistance (50 mg / mL), and incubate on an inverted plate at 28°C for 2-3 days until white colonies appear. After PCR detection of single colonies, select positive clones for shaking culture.

[0116] (2) Arabidopsis inflorescence immersion

[0117] The above positive clones were inoculated into 10 mL of YEP (50 μg / mL rifampin + 100 μg / mL kanamycin) liquid medium and incubated at 28°C with shaking (160 rpm) for 12 h. 2 mL of the culture medium was then transferred to 200 mL of YEP (50 μg / mL rifampin + 100 μg / mL kanamycin) for mass culture, and incubated at 28°C with shaking (160 rpm) for 12 h. The OD concentration of the culture medium was... 600To achieve a concentration of 1.8-2.2 μg / mL, take 50 mL of culture medium and centrifuge in a 50 mL centrifuge tube at 5000 rpm for 5 min at 4℃. Vigorously suspend the precipitate in conversion buffer (MS 2.2 g, 5% sucrose, pH adjusted to 5.8, mixed with 0.2% Silwet L-77). Dilute the precipitate to 1.0 μg / mL. Prepare approximately 200 mL of this buffer for inoculating Arabidopsis thaliana. Immerse the aerial parts of newly flowering Arabidopsis thaliana in the conversion buffer for 3 min, wrap the plants with plastic wrap, and incubate in the dark for 12-16 h. Remove the plastic wrap and place the plants in an incubator for further cultivation until seeds are harvested.

[0118] (3) Homozygous screening

[0119] T0 generation Arabidopsis seeds were placed in centrifuge tubes, disinfected with 1 mL of 70% alcohol for 5 min, then disinfected with 1 mL of 2.6% sodium hypochlorite solution for 10 min, and then rinsed 5 times with sterile water. The seeds were evenly sown on selection medium (1 / 2 MS + 50 mg / L hygromycin), purified at 4℃ for 2 days, and then cultured in an artificial climate incubator until four cotyledons emerged. Green, normally growing positive plants were transplanted into soil for cultivation. After maturity, T1 generation seeds were collected individually. T1 generation seedlings were screened using the same method. The ratio of positive to non-positive plants in each T1 generation line was calculated. Positive plants from lines with a ratio of approximately 3:1 were transplanted into soil for cultivation to obtain T2 generation seeds. T2 generation seedlings were screened using the same method to obtain T3 generation seeds.

[0120] (4) PCR identification of positive plants

[0121] RNA was extracted from leaves of positive Arabidopsis thaliana plants. Total RNA was treated with RNase R and reverse transcribed to synthesize cDNA. PCR identification was performed using divergent primers PecircCDPK-F and PecircCDPK-R. PecircCDPK was found in all positive plants, indicating successful transformation of PecircCDPK into Arabidopsis thaliana.

[0122] Example 5: Analysis of PecircCDPK gene expression under drought stress

[0123] This embodiment provides an analysis of PecircCDPK gene expression levels under drought stress. The specific steps are as follows:

[0124] (1) Material handling

[0125] Moso bamboo seeds were collected from Guangxi Zhuang Autonomous Region and placed in a constant temperature and light incubator with day and night temperatures of 25℃ / 18℃ and a photoperiod of 16h / 8h light / dark. After about three months of cultivation, drought stress was simulated using 20% ​​PEG 6000. Leaves from the same part of the plant at 0h (P1), 6h (P2), 12h (P3), 24h (P4), and 48h (P5) were taken and rapidly frozen in liquid nitrogen and stored at -80℃.

[0126] (2) Synthesis of cDNA template

[0127] Total RNA was extracted from bamboo leaves using Trizol Reagent reagent, linear RNA was removed using RNase R enzyme, and A was measured using a UV spectrophotometer. 260 With A 280 The ratio of [missing information] and RNA concentration were determined. The first strand of cDNA was synthesized using a reverse transcription kit from Takara, and the synthesized product was stored at -20°C.

[0128] (3) Real-time quantitative PCR

[0129] The expression of the target gene was detected by real-time quantitative PCR (qRT-PCR). The UBQ gene was used as an internal reference gene, UBQ-F: 5'-AATAGCTGTCCCTGGAGGAGTTT-3' (SEQ ID NO.15), UBQ-R: 5'-TCTTGTTTGACACCGAAGAGGAG-3' (SEQ ID NO.16);

[0130] PecircCDPK-F: 5'-TTCAAGGCAATGGACAGA-3', PecircCDPK-R: 5'-AGGAGCAACTCCATGGTCAC-3'.

[0131] The 10 μL reaction system is as follows:

[0132]

[0133] Reaction program: 95℃ for 30s; 95℃ for 15s, 60℃ for 60s, 60℃ for 60s, 40 cycles.

[0134] All other reaction parameters were set to system defaults. Three biological replicates were used for each reaction, employing Roche. 480 instrument analysis data, using 2 -ΔΔCT The data from three biological experiments were analyzed and plotted using Excel.

[0135] (4) Experimental Results and Analysis

[0136] The expression pattern of the PecircCDPK gene was analyzed by real-time quantitative PCR. The results showed that PecircCDPK was downregulated in leaves under drought stress. Figure 3 ).

[0137] Example 6: Drought Resistance Analysis of Arabidopsis thaliana Transgenic with PecircCDPK Gene

[0138] This embodiment provides an analysis of drought resistance in Arabidopsis thaliana transgenic with the PecircCDPK gene. The specific steps are as follows:

[0139] The root length changes of transgenic and wild-type plants were observed under different concentrations of drought treatment. On 1 / 2 MS medium supplemented with 0% PEG, the growth of WT and transgenic overexpression plants was basically the same, with relatively fewer roots, indicating that a small number of long roots were sufficient for water absorption. Under 4% PEG treatment, the total root length of overexpression lines 1 and 3 was observed to be greater than that of WT, while the root length of WT roots was significantly shorter. Under a high concentration of 8% PEG treatment, most plants in OE-1 and OE-2 had root lengths greater than WT, while the root length of all plants in OE-3 was greater than that of WT, and the root length of WT roots became even shorter. Regarding the number of roots, under 6% and 8% PEG treatments, the number of roots in transgenic plants was observed to be greater than that of WT. Figure 4 ).

[0140] Transgenic and WT lines grown to 3-4 weeks of age were selected, with three plants from each line chosen as a sample. Leaves of similar growth were cut and placed in petri dishes, and weighed and recorded at different time points. Overall, the leaf water loss rate gradually increased with time. In the first 360 minutes, the water loss rate of transgenic plants was lower than that of WT at all time points. However, by measuring the relative water content of the leaves, it was found that the water content of the transgenic lines was increased and significantly higher than that of WT. Figure 5 ).

[0141] Tests on free proline content and antioxidant enzyme activity in transgenic and wild-type Arabidopsis thaliana under drought stress. Under normal growth conditions, there were no significant differences in free proline content (Pro content), malondialdehyde content (MIDA content), superoxide dismutase activity (SOD activity), and peroxidase activity (POD activity) between wild-type and transgenic Arabidopsis thaliana.

[0142] After drought treatment, the free proline content in both transgenic and wild-type Arabidopsis thaliana increased significantly. The increase in free proline content in transgenic lines OE-1 and OE-2 was significantly greater than that in the wild-type control (CK), reaching 17.2 and 17.1 times the pre-treatment levels, respectively. Furthermore, the free proline content in transgenic lines OE-1 and OE-2 was significantly higher than that in the wild-type control (CK) after treatment. The malondialdehyde (MDA) content in both transgenic and wild-type Arabidopsis thaliana increased significantly, but the increase in transgenic Arabidopsis thaliana was smaller, at 2.22 times (OE-1), 2.23 times (OE-2), and 2.74 times (CK) respectively. Meanwhile, the MDA content in wild-type Arabidopsis thaliana was significantly higher than that in transgenic Arabidopsis thaliana. The activities of superoxide dismutase (SOD) and peroxidase (POD) in both transgenic and wild-type Arabidopsis thaliana increased significantly compared to those without drought stress. The peroxidase activity in the leaves of transgenic Arabidopsis thaliana was significantly higher than that of wild-type. Figure 6 ).

[0143] To further explore whether the increased drought resistance of transgenic Arabidopsis thaliana is related to genes involved in the CDPK pathway, the expression level of AtCDPK13, the Arabidopsis gene with the highest homology to the parental gene PecircCDPK, was detected using RT-qPCR. The results showed that the expression level of the AtCDPK13 gene was increased in transgenic lines compared to WT. Furthermore, the expression level of the AtCDPK13 gene in OE-1 and OE-2 was significantly higher than that in WT. Figure 7 ).

[0144] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. Related to drought resistance PecircCDPK Genes, characterized by, The PecircCDPK The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. Containing the contents of claim 1 PecircCDPK Gene-based biomaterials, characterized in that, The biological material is recombinant DNA, expression cassette, transposon, plasmid vector, viral vector, engineered bacteria, or non-renewable plant parts.

3. The claim 1 PecircCDPK The use of the gene or the biomaterial of claim 2 in achieving any one or more of the following: 1) Improve plant drought resistance; 2) Preparation of drought-resistant plants; 3) Prepare substances to enhance plant drought resistance; The plants mentioned include Arabidopsis thaliana or bamboo.

4. The application according to claim 3, characterized in that, Using the PecircCDPK Genetically modified plants are prepared from the genes or the biological materials described.

5. A method for improving the drought resistance of plants, characterized in that, include: Using genetic engineering techniques to overexpress [the gene] in plants PecircCDPK Gene; The PecircCDPK The nucleotide sequence of the gene is shown in SEQ ID NO.1; the plant includes Arabidopsis thaliana or moso bamboo.

6. The method according to claim 5, characterized in that, The overexpression method is selected from the following 1) to 5), or any combination of 1) to 5): 1) By importing a plasmid containing the gene; 2) By increasing the copy number of the aforementioned genes on plant chromosomes; 3) By altering the promoter sequence of the aforementioned genes on plant chromosomes; 4) By operatively linking a strong promoter to the gene; 5) By introducing enhancers.

7. The method according to claim 6, characterized in that, The PecircCDPK gene was transferred into Arabidopsis thaliana plants using Agrobacterium-mediated transformation to obtain transgenic Arabidopsis thaliana plants overexpressing the gene.

8. The method according to claim 7, characterized in that, The method of transferring the PecircCDPK gene into Arabidopsis thaliana plants using Agrobacterium-mediated transformation involves constructing the PecircCDPK gene into the plant expression vector pCAMBIAsuper1300-GFP, transforming it into Agrobacterium, then infecting Arabidopsis thaliana inflorescences, and screening for transgenic Arabidopsis thaliana plants.

9. The use of the transgenic plants obtained by the method according to any one of claims 5-8 in drought-resistant plant breeding.

10. The application according to claim 9, characterized in that, Breeding methods include transgenic, hybridization, backcrossing, self-pollination, or asexual reproduction.

Images