Use of a potato tuber sprouting gene to regulate plant growth and increase above ground biomass

Abstract

The application provides a use of a potato tuber germination gene in regulating plant growth and increasing plant aboveground biomass, and belongs to the technical field of transgenics. The function of the StGATA4L gene in the growth and development of crops has not been reported, and the use of the gene in regulating plant flowering, promoting early flowering and multiple flowering, and changing plant type, promoting axillary bud growth, losing apical dominance, increasing plant height and stem thickness, and promoting stem lignification is provided. The application is expanded to indirectly have the use of improving seed yield and aboveground biomass.

Description

Technical Field

[0001] This invention relates to the field of transgenic technology, and more particularly to the use of a potato tuber sprouting gene in regulating plant growth and increasing aboveground biomass. Background Technology

[0002] The GATA family encodes a class of transcription factors that recognize and have a high affinity for (A / T)GATA (A / G) sequences. Their DNA-binding domains generally possess a type IV zinc finger structure (CX2CX17-20CX2C, finger). Animals have six GATA family members, each containing two fingers. The C-terminal finger is primarily responsible for recognizing the base sequence, while the N-terminal finger regulates the DNA-binding ability of the C-finger by binding to GATA-interacting proteins. This family plays important roles in germ layer differentiation, hematopoietic system and heart formation, thymus and intestinal development, and tumorigenesis. Compared to animals, plants have a much larger GATA family, each containing only one finger. Arabidopsis and rice have 29 and 28 GATA family members, respectively. Based on the conservation of the starting amino acid sequence, the GATA DNA-binding region, the conservation of the protein region outside the GATA DNA-binding region, and the exon-intron structure, they are divided into four and six subfamilies, respectively.

[0003] The B subfamily is involved in controlling physiological processes such as chlorosis, seed germination, hypocotyl elongation, phyllotaxis, floral organ initiation, secondary meristem formation, flowering time, and senescence. The B subfamily (II-GATA) has been the most extensively studied in Arabidopsis GATA. These subfamily members possess a leucine-leucine-methionine (LLM) region at the C-terminus of their GATA DNA-binding region or a HANABA TARANU (HAN) region at the N-terminus. There are six B-type GATA members containing the LLM region: GATA15, GATA16, GATA17, GATA17-like, GNC (GATANitrate-inducible, Carbon-metabolism-involved GATA21), and CGA1 / GNL (Cytokinin-induced GATA1 / GNC-like). Analysis of insertion mutants of these six genes indicates that they play a role in controlling physiological processes such as chlorosis, hypocotyl elongation, phyllotaxis, floral organ initiation, secondary meristem formation, flowering time, and senescence. The LLM region is considered a key reason for their functional diversity. GNC and GNL are known to participate in downstream processes of auxin, cytokinin, gibberellin and light signals to regulate physiological processes such as seed germination, greening, senescence and flowering time. GNC and GNL mutants have defects in greening and chloroplast formation, and their germination and flowering are slightly earlier than those of wild type.

[0004] HAN (AtGATA3) is expressed at the boundaries of meristem and organ primordia, as well as at the boundaries of different floral organs. Knockout plants exhibit smaller size, sepal fusion, and a reduced number of floral organs, while overexpressing HAN results in stunted growth, imbalanced cell division, and loss of meristem activity. Gene chip analysis of Arabidopsis thaliana with transient HAN overexpression revealed that HAN suppresses hundreds of genes involved in hormone responses and floral organ differentiation, and also suppresses HAN and three other GATA genes: HANL2, GNC, and GNL, forming a negative feedback regulation. HAN can form homologous and heterologous polymers with the proteins encoded by these three genes, and in vivo, HAN was detected to directly bind to its own promoter and the promoter of GNC. In the process of controlling floral development through the GATA family and hormone regulatory network, HAN is presumed to be a key repressor. B-type GATA members containing the HAN region, including HAN in Arabidopsis thaliana, and in monocotyledonous plants such as rice NECK LEAF1, maize TASSEL SHEATH1, and barley THIRD OUTER GLUME, are considered to play a dominant role in embryonic and floral development. Studies in Arabidopsis thaliana have shown that downstream signals from auxin, cytokinin, and gibberellin can cross-regulate GATA expression, thereby affecting chloroplast formation, nitrogen assimilation and starch synthesis, flowering time, and senescence. The auxin signaling response factor (ARF) can specifically bind to the promoters of GNC and GNL to inhibit their expression, controlling chlorophyll formation, flowering time, and senescence. GNC and GNL are important targets of regulation by downstream GA signaling regulators DELLA and PIF (phytochrome-interacting factor). Chromatin immunoprecipitation indicates that these two genes are direct targets of the PIF transcription factor, and their expression is upregulated in the pif mutant, meaning that PIF inhibits GNC and GNL expression. Constitutive activation of GA signaling can suppress GNC and GNL expression, thus partially restoring the dwarf phenotype in the arf2 mutant. Therefore, there is an overlap between auxin and gibberellin signaling in the regulation of GNC and GNL. CTK signal transduction can activate the expression of six B-type GATA genes containing LLM regions, indicating that B-GATA plays a role in the CTK response and that there is also transcriptional cross-regulation among these genes.

[0005] The potato GATA transcription factor family has 33 members, but there is limited research on the function of these members. Current research on StGATA12 shows that overexpression of this gene increases leaf area, stem diameter, and tuber formation per plant, suggesting that the gene plays a regulatory role in chlorophyll synthesis and hormone balance.

[0006] The inventors previously analyzed the differences in potato tubers under dormancy, sprouting, and sprout suppression states using transcriptomics and proteomics, and for the first time discovered the gene StGATA4L that regulates potato tuber sprouting. Currently, there are no research reports on the function of the StGATA4L gene, nor are there any studies on using the overexpression of this gene to promote axillary bud growth, change plant type, and increase aboveground yield.

[0007] Based on this, the following technical solutions are proposed. Summary of the Invention

[0008] This invention provides the use of a potato tuber sprouting gene in regulating plant growth and increasing aboveground biomass.

[0009] Preferably, the potato tuber sprouting gene is the StGATA4L gene, and the regulation method is to overexpress the StGATA4L gene in the plant.

[0010] Preferably, the nucleotide sequence of the StGATA4L gene is shown in sequenceIDNumber 1, and the amino acid sequence is shown in sequenceIDNumber 2.

[0011] Preferably, the regulation of plant growth includes regulating plant flowering and regulating plant shape.

[0012] Preferably, the regulation of plant flowering involves overexpression of the StGATA4L gene in the plant, which promotes early flowering at the plant apex and increases the number of flowers.

[0013] Preferably, the regulation of plant architecture involves overexpression of the StGATA4L gene in the plant, which promotes axillary bud growth, loss of apical dominance, increased plant height and stem diameter, and promoted stem lignification.

[0014] Preferably, the plant is tobacco.

[0015] This invention addresses the previously unreported function of the StGATA4L gene in crop growth and development, providing information on its applications in regulating plant flowering, promoting early and abundant flowering, altering plant architecture, promoting axillary bud growth, eliminating apical dominance, increasing plant height and stem diameter, and promoting stem lignification. Furthermore, it expands its applications to indirectly increase seed yield and aboveground biomass. Attached Figure Description

[0016] Figure 1 The cloning band of the StGATA4L gene in Example 1;

[0017] Figure 2 The amino acid sequence of the StGATA4L gene cloned in Example 1 is compared with the amino acid sequences of AtGATA2 and AtGATA4.

[0018] Figure 3 The overexpression vector pBI121-StGATA4L constructed in Example 1 was identified by double digestion with BamHI and SmaI.

[0019] Figure 4 Subcellular localization of StGATA4L in Example 2;

[0020] Figure 5 The expression characteristics of StGATA4L in different parts of potato plants in Example 3 are shown below: F: flower bud, YL: young terminal leaf, L: mature terminal leaf, P: petiole, S: stem segment, R: root, ST: stolon with bud, YT: young tuber formed by swelling at the top of stolon, TD: dormant mature tuber, showing the sample taken with the bud eye as the center, TS: sprouting tuber with a bud length of 2-3 mm, showing the sample taken with the bud eye as the center, B: bud on tuber, 8-10 mm;

[0021] Figure 6 The diagram shows the cis-acting elements of the StGATA4L promoter in Example 4. The red background indicates elements that respond to light signals, the yellow background indicates that the corresponding negative chain region is an element that responds to light signals, and the green background indicates cis-acting elements expressed in the endosperm.

[0022] Figure 7 The results of screening for transgenic tobacco in Example 5 are as follows: 1: Infected leaves dedifferentiated in a kanamycin-containing medium to form green positive callus; 2: Plants formed by further differentiation of positive callus; 3: Rooting screening on a kanamycin-containing medium. The left side is the non-transgenic control, which could not root, and the right side is the transgenic line, which could root normally.

[0023] Figure 8 To detect the expression level of StGATA4L in transgenic tobacco plants in Example 5, A: Electrophoresis image, K326 is the non-transgenic control, OE-1 to OE-3 are transgenic lines, and GAPDH is used as an internal control; B: qRT-PCR detection of the expression level of StGATA4L in transgenic lines, with the ΔCt value of the non-transgenic control K326 as a control, using 2 –ΔΔCt Methods for calculating relative expression levels;

[0024] Figure 9 The results of qRT-PCR detection of the expression level of StGATA4L transgenic homozygous line OE-3 in Example 6 are as follows:

[0025] Figure 10 The flowering time of the T3 generation of OE-3 in Example 6 was compared with that of the control K326.

[0026] Figure 11This section compares the axillary bud growth of the T3 generation of line OE-3 in Example 6 with the control K326. 1-3 represent the axillary buds of the non-transgenic control K326 at 30, 45, and 60 days after emergence, respectively, all of which did not grow. 4-6 represent the axillary buds of OE3-T3 at 30, 45, and 60 days after emergence, which gradually grew into plants and changed the tobacco plant type. The arrows indicate that the axillary buds grew into plants. 7-9 represent the thickening and lignification of the stems of OE3-T3 axillary buds after they grew into plants (90 days).

[0027] Figure 12 The morphology of OE3-T3 plant in Example 6 is shown. Detailed Implementation

[0028] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0029] Example 1

[0030] Construction of an overexpression vector containing the transcription factor StGATA4L gene

[0031] Primers used for constructing CDS coding sequences and overexpression vectors for cloning genes

[0032] StGATA4L-P1 GGATCC AATATGGATGTCTACGGACGG(sequenceIDNumber 3)

[0033] StGATA4L-P2 CCCGGG ATATAGATGACATCAGCAGAC(sequenceIDNumber 4)

[0034] Primers with restriction enzyme sites were designed based on the transcriptome sequencing results for CDS sequence cloning. Using the potato variety Fiurita as material, RNA was extracted from buds of the tubers using the trizol method, reverse transcribed into cDNA, and then the CDS sequence was amplified. A two-step PCR was performed. The reaction volume was 25 μL, with the following components added sequentially: 16 μL ddH2O, 2.5 μL 10×PCR buffer, 0.5 μL each of forward and reverse primers (10 μM), 2.0 μL dNTP Mixture (2.5 mM each), 1.0 μL cDNA, 0.5 μL TaKaRa Ex Taq, and 2.0 μL MgCl2. After mixing and slight centrifugation, the reaction was performed according to the following cycle program: 9℃ for 3 min, 95℃ for 30 s and 68℃ for 1.5 min, 35 cycles, 68℃ for 10 min, and incubation at 4℃. After agarose gel electrophoresis, the target band was recovered and purified using the AxyPrep DNA gel extraction kit.Figure 1 ).

[0035] The purified product was ligated into the cloning vector pUCm-T Vector and transformed into *E. coli* using the heat shock method. Positive clones were obtained through colony and plasmid PCR and enzyme digestion screening. Sequencing confirmed the 777bp CDS sequence of the StGATA4L gene, which differed from the published sequence by only two bases, but did not affect the codons or amino acid sequences. The StGATA4L amino acid sequence has 258 amino acids, showing the highest similarity to the *Arabidopsis* GATA family members AtGATA2 and AtGATA4, but only 56.0% and 54.3% respectively. The amino acid sequences of the zinc finger region are identical in all three. Figure 2 ).

[0036] Plasmids were extracted, and the overexpression vector pBI121 and the cloning vector plasmid were digested with restriction endonucleases BamHI and SmaI. The digested fragments were then gel-cleaved and ligated using T4-DNA ligase. The digestion reaction was carried out at 30°C for 6 h, and the ligation reaction at 4°C for 24 h. The digestion system (50 μL) consisted of: 10×T Buffer 5.0 μL, 0.1% BSA 5.0 μL, BamHI / SmaI 1.2 / 1.0 μL, plasmid 30.0 μL, and ddH2O 7.8 μL. The ligation system (20 μL) consisted of: T4 DNA ligase 2.0 μL, 10×Buffer 2.0 μL, pBI121 vector 4.0 μL, and target fragment 12.0 μL. The ligation product was an overexpression vector pBI121-StGATA4L driven by the CaM35S strong promoter to express the target gene. This vector was transformed into competent *E. coli* cells, and plasmids were extracted from single colonies. Positive clones were obtained by enzyme digestion identification. Figure 3 The cells were transformed into competent Agrobacterium tumefaciens GV3101 cells for use in tobacco infection and transformation.

[0037] Example 2

[0038] Subcellular localization of StGATA4L protein

[0039] Design primers GAGFP-P1 to introduce the restriction enzyme sites HindⅢ and BamHI. AAGCTT ATGGATGTCTACGGACGG(sequenceIDNumber 5),GAGFP-P2 GATCC-The gene sequence was CG-GCAGACCGGATAGTGATGT(sequenceIDNumber6), and the terminator of the gene sequence was removed. Two bases were added to balance the codons and ensure that the reading frame of the GFP fluorescent sequence linked later was correct. The resulting vector pEGFP-GATA4L, which fused the target gene and the fluorescent protein gene, was then transformed into Agrobacterium and prepared for use in tobacco infection and transformation.

[0040] Agrobacterium containing the vector pEGFP-GATA4L and positive control bacteria were cultured overnight at 28°C with shaking. The bacteria were collected by centrifugation at 12,000 rpm for 1 min, the supernatant was discarded, and the bacteria were resuspended in tobacco conversion broth. 2 mL of tobacco conversion broth was added to a 5 mL centrifuge tube, followed by an inoculation with a certain amount of the resuspended bacterial solution, and the OD was adjusted. 600 The concentration was 0.8. Tobacco conversion liquid (100mL): dd H2O 98mL, 1mol / L morpholine ethanesulfonic acid MES 1mL (final concentration 10mM), 1mol / L MgCl2 1mL (final concentration 10mM), 10mmol / L acetylsyl syringone (AS) 1mL (final concentration 100μM).

[0041] Using leaves of *N. benthamiana* as recipients, 1 mL of bacterial suspension was drawn up with a needle-free syringe and injected onto the lower epidermis of the tobacco plant. After injection, the tobacco was placed in an empty dish, watered appropriately, and cultured in a greenhouse for 3 days before fluorescence observation. Leaflets of tobacco seedlings were cut into 0.5 cm × 0.5 cm pieces, laid flat on a glass slide, covered with a coverslip, and the excitation wavelength was set to 480 nm and the emission wavelength to 510 nm. The images were then scanned and photographed under a laser scanning confocal microscope to observe the distribution of GFP green fluorescence in the tissue, compared with the autofluorescence of chlorophyll red fluorescence. Results are as follows: Figure 4 As shown, the StGATA4L protein is located in the cell nucleus and is a transcription factor.

[0042] Example 3

[0043] Spatiotemporal Representation Characteristics Analysis of StGATA4L

[0044] Potted potato seed stock (Ferula ferruginata) was sampled 30 days after emergence when the above-ground parts began to bud and the underground runners began to swell. Samples were frozen at -80℃ for later RNA extraction. Sampling sites included: young leaves, mature leaves, petioles, stem segments, flower buds, roots, runners, enlarged young tubers (10mm in diameter), dormant tubers harvested after two-thirds of the plant's leaves turned yellow, sprouted tubers with 2mm buds, and buds with 10mm buds. RNA was extracted from each site using the Trizol method and stored at -80℃ for later use. The RNA was reverse transcribed into cDNA, and the expression level of StGATA4L in each site was quantitatively detected using fluorescence. The quantitative fluorescence primers were P1-GGTTGTTACTACGATGCTCT (sequence ID Number 7), P2-AATTATTGGATGTATCTTCCAC (sequence ID Number 8), and the internal control selection gene EF1αL was selected using primers P1-CTTGTACACCACGCTAAGGAG (sequence ID Number 9) and P2-GTCAATGCAAACCATTCCTTG (sequence ID Number 10). The ΔCt value of mature dormant tubers was used as a control. –ΔΔCt The relative expression level is calculated using this method.

[0045] like Figure 5 As shown, StGATA4L was not expressed in young or mature leaves; it was expressed at very low levels in flower buds, petioles, stem segments, roots, young tubers, and dormant tubers; however, it was expressed at high levels in bud tissue, and the expression level was higher the more vigorous the bud activity (buds > sprouting tubers > stolons with buds). It is speculated that StGATA4L plays an important role in bud germination: as StGATA4L expression decreases in the apical buds of stolons, the buds enter dormancy, accumulate sugars and convert them into starch, gradually swelling to form tubers, where StGATA4L expression further decreases, and the tubers enter a deep dormancy state; with increasing storage time, StGATA4L expression increases, the bud primordia gradually break dormancy and germinate, with StGATA4L expression reaching high values ​​in rapidly growing buds, and decreasing with bud differentiation, being not expressed or only expressed at very low levels in differentiated organs such as leaves, petioles, stem segments, and roots. This result further confirms that this gene is involved in regulating plant bud germination.

[0046] Example 4

[0047] DNA was extracted from potato varieties Feuerita and Mira. Following the method described by Liu et al. (Liu Yao-Guang, Chen Yuanling. High-efficiency thermal asymmetric interlaced PCR for amplification of unknown flanking sequences. BioTechniques, 2007, 43:649–656), the promoter region of the StGATA4L gene was cloned using hiTAIL-PCR (thermal asymmetric interlaced PCR). Based on the 5′ flanking untranslated region sequence of StGATA4L, a nested primer set consisting of three outward-pointing specific primers (SP1, SP2, SP3), along with LAD1-LAD4 degenerate primers and AC primers, was designed for three rounds of PCR amplification.

[0048] SP1GAAGAGCATCGTAGTAACAACC(sequenceIDNumber 11)

[0049] SP2 AGGTGGTTGGTAATGGTGATTGAG(sequenceIDNumber 12)

[0050] SP3 GACATCCATATTCTCCGATTAATGC(sequenceIDNumber 13)

[0051] LAD1 AGGTGGTTGGTAATCC AAGCTT VNVNNNGGAA(sequenceIDNumber 14)

[0052] LAD2 AGGTGGTTGGTAATCC AAGCTT BBNNNGGTT(sequenceIDNumber 15)

[0053] LAD3 AGGTGGTTGGTAATCC AAGCTT VVNVNNNCCAA(sequenceIDNumber 16)

[0054] LAD4 AGGTGGTTGGTAATCC AAGCTT BDNVNNNCGGT(sequenceIDNumber 17)

[0055] AC AGGTGGTTGGTAATCC(sequenceIDNumber 18)

[0056] Pre-amplification reaction, 20 μL system:

[0057]

[0058] Primary TAIL-PCR reaction, 25 μL system:

[0059]

[0060] Secondary TAIL-PCR reaction, 25 μL system:

[0061]

[0062] The procedure for the three rounds of PCR reaction is as follows:

[0063]

[0064] Fragments amplified from gel-reclaimed FR and MR DNA templates were ligated into cloning vectors. The reaction mixture (10 μL) consisted of: 0.5 μL pMD19-T Vector, 4.0 μL Insert DNA, 5.0 μL Solution I, and 0.5 μL dH2O. After ligation at 16°C for 12 h, the cells were transformed into *E. coli* DH5α. Positive clones were detected by enzyme digestion. The 20 μL digestion mixture consisted of: 0.5 μL Hind III, 1.0 μL 0.1% BSA, 2.0 μL 10×M Buffer, 1.5 μL dH2O, and 15.0 μL plasmid. After digestion at 30°C for 12 h, 8 μL of the digestion product was mixed with 2 μL 5×LB gel electrophoresis to detect positive clones. Plasmids were sent to the company for sequencing and cloning. Sequence differences between varieties were compared using DNAMAN, and promoter cis-acting elements were predicted and analyzed online using PlantCare (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ).

[0065] Using DNA from varieties FR and MR as templates, the upstream promoter region of the StGATA4L gene was amplified using hiTAIL-PCR. Of the four degenerate primers, only LAD3 amplified a clear band after three rounds of PCR. After gel extraction and recovery, a fragment of approximately 1200 bp was obtained. Sequencing of positive clones showed that a 1126 bp sequence was amplified upstream of the StGATA4L gene from both FR and MR. This sequence showed 99% similarity between the two varieties, indicating that the promoter region of this gene is conserved. Comparison with the gene sequence published by NCBI showed that the 1126 bp sequence included a 5'139 bp untranslated region, an 843 bp promoter region, and an unpublished 144 bp upstream region. Analysis of the 987 bp sequence upstream of the transcription start site on the PlantCare website, a promoter cis-acting element prediction website, showed that it has multiple cis-acting elements, including nine that respond to light signals (…). Figure 6 (marked in red and yellow), 3 are cis-acting elements required for endosperm expression (… Figure 6 (Green marker) indicates multiple transcription factor binding sites or cis-acting elements involved in responses to stresses such as drought, salt, cold, and hypoxia. The promoter sequence of the StGATA4L gene contains multiple light-responsive elements, suggesting that light stimulation is required for the gene to function.

[0066] Example 5

[0067] StGATA4L gene genetic transformation and screening of transgenic plants

[0068] 1. Primers used for screening transgenic plants and detecting gene expression

[0069] Primers used for transgenic screening

[0070] nptⅡ-P1 GCTATGACTGGGCACAACAG(sequenceIDNumber 19)

[0071] nptⅡ-P2 ATACCGTAAAGCACGAGGAA(sequenceIDNumber 20)

[0072] Primers for detecting the expression level of StGATA4L in transgenic tobacco

[0073] qGATA4L-P1 GGTTGTTACTACGATGCTCT(sequenceIDNumber 21)

[0074] qGATA4L-P2 AATTATTGGATTGTATCTTCCAC(sequenceIDNumber 22)

[0075] Primers for detecting the expression level of tobacco internal reference gene

[0076] NtGAPDH-P1 GGTGTCCACAGACTTCGTGG(sequenceIDNumber 23)

[0077] NtGAPDH-P2 GACTCCTCACAGCAGCACCA(sequenceIDNumber 24)

[0078] NtEF1a-P1 AGCTTCACCTCCCAGGTCATC(sequenceIDNumber 25)

[0079] NtEF1a-P2 AGAACGCCTGTCAATCTTGG(sequenceIDNumber 26)

[0080] 2. Obtaining tobacco lines overexpressing StGATA4L

[0081] Tobacco leaves were used as the genetic transformation recipients. The plant growth regulators (PGRs) used included 6-benzyladenine (6-BA) and indoleacetic acid (IAA). After preparing a stock solution of PGR, it was sterilized by filtration through a 0.22 μm filter and stored at -20°C for later use. MS solid medium required the addition of 6 g / L agar, and the pH was adjusted to 6.0 with Tris base. All media were autoclaved at 121°C for 20 min. Once the medium cooled to approximately 60°C, the filtered and sterilized PGR and the antibiotics kanamycin (Kan), cephalosporin (Cef), and carbenicillin (Car) were added (Table 1).

[0082] Table 1. Required additives for plant regeneration (mg·L) -1 )

[0083]

[0084] A single colony of Agrobacterium containing the vector pBI121-StGATA4L, constructed in Example 1, was inoculated into 5 mL of liquid YEB (containing 50 mg·L⁻¹). -1 Kan and 50 mg·L -1 Rifampicin (Rif) was added and the culture was incubated overnight at 28°C and 200 rpm. The next day, the bacterial culture was diluted 1:200 in fresh liquid YEB and incubated for 12 hours under the same conditions until OD was observed. 600=0.5 when removed and set aside. Cut tobacco leaves, trimming the edges, into 0.5cm square leaf discs, and lay them flat on the pre-medium (20 discs / plate) with the underside of the leaves facing up. Pre-culture at 22±1℃ in the dark for 2 days. Take the shaken bacterial suspension, centrifuge at 5000rpm for 3 minutes, discard the supernatant, and resuspend the bacteria in liquid MS for inoculation. Collect the leaves in sterile bottles on a laminar flow hood, add Agrobacterium suspension and inoculate for 8 minutes. Shake continuously to ensure adequate contact. Discard the Agrobacterium suspension, transfer the leaves to sterile filter paper to absorb excess moisture, and transfer to a co-medium layered with filter paper. Co-culture in the dark for 36 hours. After co-culture, collect the leaves in sterile bottles and add 100mg·L⁻¹ of Agrobacterium suspension. -1 Cef cells were rinsed three times in sterile water, dried, and then transferred to selection medium (20 cells / plate). Culture conditions: 14 h light / 10 h dark, light intensity 60 μmol / m². -2 s -1 , 22±1℃.

[0085] The selection medium was changed approximately every 14 days. After 30-50 days, resistant buds (about 1-2 cm long) would regenerate, which were then cut and transferred to rooting selection medium for screening. Lines that could normally develop roots (generally starting to grow after 7-10 days) could be preliminarily considered to have been transferred with the target gene. The lines were cut into multiple segments with axillary buds and then transferred to ordinary MS medium for propagation, for further detection and experimentation. RNA was extracted from the leaves of transgenic tobacco lines using the Trizol method, reverse transcribed into cDNA, and the expression level of the target gene in the transgenic lines was detected by quantitative real-time analysis, using the tobacco GAPDH gene as an internal control gene.

[0086] After infection with Agrobacterium, tobacco leaf discs dedifferentiated in the selection medium to form green positive calluses, which further differentiated into shoots. These shoots, when inoculated into a medium containing Kan, rooted and grew normally, indicating that the strain had been transformed with a Kan-resistant exogenous fragment. The corresponding non-transgenic plant K326, lacking Kan resistance, could not root or grow normally. A series of transgenic tobacco lines were obtained through rooting selection. Figure 7 The three tobacco lines tested by RT-PCR and qRT-PCR all successfully transformed with the exogenous gene StGATA4L, and were able to transcribe it normally into mRNA. No similar gene expression was observed in the control K326. The transgenic line OE-3 showed the highest relative expression level, 1.67 times that of OE-2. This difference in expression level may be related to the different insertion locations of the exogenous gene into the tobacco genome. Figure 8 ).

[0087] Example 6

[0088] Transgenic tobacco plantlets grown in vitro on normal MS medium showed no significant difference in morphology compared to the control K326. When the transgenic line OE-3 was potted in a closed greenhouse, a small number of axillary buds developed into plants, and the growth period was prolonged; however, the growth vigor was not significantly different from that of K326. Germination tests were conducted on homozygous T2 generation seeds, with treatments including the addition of gibberellin to promote germination and abscisic acid to inhibit germination. However, the response of OE3-T2 seeds to each treatment was not significantly different from that of the control K326, indicating that the StGATA4L gene does not participate in regulating the seed germination process.

[0089] OE3-T2 tobacco seedlings were transplanted to a greenhouse. Most axillary buds began to develop into plants after the main stem flowers withered and produced seeds, showing significantly better overall growth than K326. The homozygous T3 generation seeds were then sown and transplanted again. Leaf samples were taken from the plants, and the expression level of the StGATA4L gene was detected by qRT-PCR, using EF1a as an internal control and the ΔCt value of the non-transgenic control K326 as a control. A 2... –ΔΔCt The relative expression level was calculated using the method. No StGATA4L gene was expressed in K326, while the relative expression level in OE3-T3 homozygous plants was as high as 1300, nearly 10 times higher than that of the T0 generation. Figure 9 Meanwhile, the flowering time of the main stem, axillary bud growth, plant height, and stem diameter of the OE3-T3 strain were all significantly increased compared to the non-transgenic control K326. The non-transgenic control K326 seedlings, even after reaching a height of over 100cm at 50 days post-emergence, still had not yet budded; while the T3 homozygous line overexpressing StGATA4L budded and flowered at only about 90cm in height at 35 days post-emergence. Figure 10 This means that flowering occurred more than 15 days earlier. In the non-GMO control K326, no axillary buds grew at 30, 45, and 60 days after emergence. Figure 11 ,1-3); while OE3-T3 seedlings showed growth of all axillary buds on the main stem within 30 days of emergence, gradually forming new branches, which significantly altered the plant type of tobacco. Figure 11 (4-6), arrows indicate axillary buds growing into plants; simultaneously, the stems of OE3-T3 axillary buds that have grown into plants will thicken and lignify to provide sufficient support for the growth of branches and leaves. Figure 11 (7-9, 90 days). Mature tobacco plants such as Figure 12 As shown in Table 2, the plant height, main stem diameter, number of flowers per plant, seed weight, and dry weight of tobacco leaves are compared. Compared with K326, the plant height of OE3-T3 increased by 89.66%, reaching 2.9m, and the main stem diameter increased by 32.11% to 44.98mm. Because OE3-T3 formed many new branches, the number of flower buds and leaves also increased significantly, resulting in a 196.66% increase in dry weight of harvested tobacco leaves per plant and a 256.43% increase in harvested seed weight.

[0090] Table 2 Comparison of plant height, main stem diameter, number of flowers per plant, seed weight, and dry weight of tobacco leaves

[0091]

[0092] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The use of a potato tuber sprouting gene in regulating plant growth and increasing aboveground biomass; The potato tuber sprouting gene is StGATA4L The gene, the method of regulation is to... StGATA4L The gene is overexpressed in the plant; the plant is tobacco. The StGATA4L The nucleotide sequence of the gene is shown in SEQ ID NO.1; The regulation of plant growth includes regulating plant flowering and regulating plant shape; The regulation of plant flowering aims to induce early flowering at the plant apex and increase the number of flowers. The regulation of plant architecture involves promoting axillary bud growth, eliminating apical dominance, increasing plant height and stem diameter, and promoting stem lignification.

Images