Genetically engineered living bacteria and methods of construction thereof

Abstract

The present invention relates to a genetically engineered live bacterium comprising at least one effector gene encoding a medical effector and at least one genetic modification that shortens the life span of the bacterium. Upon administration to a subject, the bacterium survives for a time sufficient to allow the medical effector to exert at least one medical effect and dies within a time sufficient to minimize pathogenesis to the subject. The bacterium provides effective treatment of a disease or amelioration of a condition while ensuring biosafety for medical use.

Description

[0001] References to sequence lists

[0002] This application contains a sequence list in computer-readable form, which is incorporated herein by reference in its entirety. Technical Field

[0003] This invention relates to genetically engineered live bacteria and methods for constructing them. In particular, this invention relates to providing genetically engineered live bacteria that can effectively treat and / or prevent diseases or conditions. Background Technology

[0004] Naturally occurring or artificially modified bacteria have been used as vaccines or drugs to target a variety of diseases, including infectious diseases and, more recently, cancer. Besides efficacy, safety is the most important concern when using bacteria for medical purposes. To address this, numerous efforts have been made to kill target bacteria or to genetically modify bacteria to give them the ability to preferentially or selectively grow in lesions.

[0005] There is a great need for a new type of bacteria that can effectively treat diseases or improve symptoms while ensuring biosafety. Summary of the Invention

[0006] In view of the foregoing background, in some example embodiments, the aim is to provide an alternative bacterium to overcome at least one of the disadvantages of the prior art.

[0007] In one aspect, a genetically engineered live bacterium is provided, comprising at least one effector gene encoding a medical effector; and at least one genetic modification that shortens the lifespan of the bacterium such that, after administration to a subject, the bacterium survives for a period sufficient to allow the medical effector to exert at least one medical effect and dies for a period sufficient to minimize pathogenesis in the subject. In some embodiments, the bacteria are derived from a virulent strain.

[0008] In some example embodiments, the medical effector is an antigen that can elicit at least one immune response in the subject sufficient to treat the target disease or condition.

[0009] In some example embodiments, the medical effector is a therapeutic factor that can induce at least one immune response and / or reduce the size of the target lesion in a subject to a degree sufficient to treat the target disease or condition.

[0010] In some example embodiments, the immune response is initiated by CD4+ and / or CD8+ T cells.

[0011] In some example embodiments, the medical effector is an antigen or a therapeutic factor expressed from a homologous gene of a bacterium.

[0012] In some example embodiments, the medical effector is an antigen or a therapeutic factor expressed from a heterologous gene.

[0013] In some example embodiments, the heterologous gene further includes a leader sequence and / or a termination region in the bacteria to improve heterologous expression.

[0014] In some example embodiments, the therapeutic factor is a cytotoxin that causes cell lysis in the target lesion.

[0015] In some example embodiments, the target disease or condition is cancer or tumor, and the medical effector causes tumor suppression or lysis in the subject.

[0016] In some example embodiments, the time sufficient to minimize the pathogenesis is less than 48 hours.

[0017] In some example embodiments, the bacteria are unable to replicate or colonize within the subject.

[0018] In some example embodiments, the gene modification is the deletion or mutation of at least one essential gene or auxotrophic gene from the bacterial chromosome.

[0019] In some example embodiments, the bacteria are auxotrophs of diaminopimelic acid.

[0020] In some example embodiments, the gene is modified to remove aspartate-semialdehyde dehydrogenase (asd) from the bacterial chromosome.

[0021] In some example embodiments, the bacteria have a survival time that can be controlled by exposing the bacteria to one or more regulatory effectors that regulate the bacterial survival time when administered in vivo.

[0022] In some example embodiments, the modulating effector is diaminopimelic acid.

[0023] In some example embodiments, the medical effector is a homologous peptide expressed by genes selected from the group consisting of: chuA, yjaA, tspE4C2, sat, sfa, papG, fyuA, iutA, hlyACBD, yfcV, and pks island.

[0024] In some example embodiments, the medical effector is a cytotoxic agent selected from the group consisting of: exolysin A (ExlA) of Pseudomonas aeruginosa, non-hemolytic enterotoxin (Nhe) of Bacillus cereus, hemolysin, and vacuole toxin of Helicobacter pylori, and combinations thereof.

[0025] In some example embodiments, the medical effector is an anticancer factor selected from the group consisting of CpG, cyclic dinucleotides, and tumor antigens.

[0026] In some example embodiments, the bacteria are derived from the genera Escherichia, Salmonella, Shigella, Listeria, Bacteroides, Bifidobacterium, Clostridium, Lactobacillus, or Lactococcus.

[0027] In some example embodiments, the bacteria are derived from Escherichia coli.

[0028] In some example embodiments, the bacteria are derived from strain SH3, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number 19836.

[0029] In some example embodiments, the bacteria express a sequence that has at least about 80%, 85%, 90%, 95%, or 100% sequence identity with all or a fragment of SEQ ID NO:35.

[0030] In some example embodiments, the bacteria are derived from strain mp107, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number 19835.

[0031] In some example embodiments, the bacteria are administered intravenously. In some example embodiments, the bacteria are formulated for intravenous administration.

[0032] In some example embodiments, when administered intravenously, the time sufficient to minimize the pathogenesis is less than 48 hours.

[0033] In some example embodiments, the bacteria are applied topically. In some example embodiments, the bacteria are formulated for topical application.

[0034] In some example embodiments, when applied topically at the injection site, bacteria survive for up to 5 days at the injection site but die within 48 hours outside the injection site. In some embodiments, bacteria are removed from normal tissues and organs.

[0035] In some example embodiments, the bacteria are at a density of 7.5 × 10⁻⁶.9 The bacteria were administered at a dose equivalent to cfu / kg mice. In some example embodiments, the bacteria were administered at a dose of 7.5 × 10⁻⁶. 9 Administer intravenously at a dose equivalent to cfu / kg mice.

[0036] In some example embodiments, the disease is cancer or a tumor, and the bacteria are administered intratumorally.

[0037] In some example embodiments, the bacteria are present at a rate of approximately 100-200 mm per gram of tumor tissue. 3 5×10 8 The bacteria are administered intratumorally at an equivalent dose of CFU. In some example embodiments, the bacteria are administered per gram of tumor (approximately 100-200 mm). 3 4x10 9 The bacteria are administered intratumorally at an equivalent dose of CFU. In some example embodiments, the bacteria are administered per gram of tumor (approximately 100-200 mm). 3 At least 5×10 8 The equivalent dose of CFU is administered intratumorally.

[0038] On the other hand, a live bacterium of the genus *Escherichia coli* is provided, the live bacterium containing a gene deletion of aspartate-semialdehyde dehydrogenase (asd) from the chromosome of the bacteria; wherein the bacteria are derived from a virulent strain.

[0039] In some example embodiments, bacteria express at least one effector gene encoding a medical effector.

[0040] In some example embodiments, the bacteria are derived from strain SH3, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number 19836.

[0041] In some example embodiments, the bacteria further include a gene encoding exolysin A (ExlA) of Pseudomonas aeruginosa.

[0042] In some example embodiments, the gene has at least about 80%, 85%, 90%, 95%, or 100% sequence identity with all or part of SEQ ID NO:35.

[0043] In some example embodiments, the bacteria are derived from strain mp107, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number 19835.

[0044] In another aspect, an immunogenic composition is provided, the immunogenic composition comprising bacteria as described in any one of the preceding claims.

[0045] On the other hand, a live bacterial vaccine is provided, the live bacterial vaccine comprising bacteria according to any one of the exemplary embodiments and optional adjuvants.

[0046] In another aspect, a method for treating a disease or condition is provided, the method comprising administering to a subject a composition containing an effective amount of bacteria as described in any of the exemplary embodiments.

[0047] In some example embodiments, the disease is a tumor or cancer.

[0048] On the other hand, a method for constructing genetically engineered live bacteria is provided, the method comprising the steps of: genetically engineering the bacteria to have a short lifespan, such that the bacteria, after being administered to a subject, survive for a time sufficient to allow a medical effector to exert at least one medical effect and die for a time sufficient to minimize the pathogenesis of the subject, wherein the bacteria are derived from a virulent strain.

[0049] In some example embodiments, the method further includes the step of: genetically engineering the bacteria to express at least one medical effector.

[0050] Other example implementations are also discussed in this article.

[0051] This disclosure offers numerous advantages. In some embodiments, because the provided bacteria are live bacteria from the subject's body, medical efficacy is ensured by maintaining the integrity and functionality of their effector molecules.

[0052] In some example embodiments, short-lived bacteria are preferred over killed or inactivated bacteria because these short-lived bacteria can survive in the body for a period of time after administration to exert a better medical effect.

[0053] In some embodiments, because the provided bacteria are derived from virulent or pathogenic strains and retain all or at least some of their virulence factors for use as medical effectors, their therapeutic efficacy is far superior to that of non-pathogenic strains. Many antigens and virulence factors of these virulent strains offer a variety of therapeutic potentials, such as inducing disease-specific immunity or directly killing cancer cells. In some embodiments, only a small amount of short-lived bacteria injected intratumorally or intravenously is sufficient to effectively inhibit tumor progression or cure the tumor.

[0054] In some embodiments, because the provided bacteria have a short lifespan, the potential risk of genetic mutation is minimized and biosafety for medical use is ensured.

[0055] In some embodiments, because the provided bacteria have a short lifespan and high immunogenicity and therapeutic efficacy, the bacteria can achieve satisfactory therapeutic effects even when administered intravenously. In some embodiments, intravenous or systemic administration of small amounts of short-lived bacteria is sufficient to achieve satisfactory tumor suppression. The bacteria do not need to be designed to specifically target or colonize targets such as tumors, nor do they need to be limited to local or intratumoral administration, but can still achieve good efficacy in treating diseases.

[0056] In some embodiments, short-lived bacteria are preferred over genetically modified, lesion-specific bacteria because short-lived bacteria do not easily mutate to the point of losing their short-lived survival characteristics, while lesion-specific bacteria are prone to mutation to the point of losing their lesion-targeting ability.

[0057] In some embodiments, short-lived bacteria can be used as carriers or media for vaccines or therapeutics to treat or prevent a variety of diseases or improve certain conditions. In some embodiments, short-lived bacteria can be used for diagnostic purposes. Attached Figure Description

[0058] Figure 1A The number of viable cells of short-lived bacteria grown in vitro for 0 hours, 24 hours, and 48 hours in LB medium according to an example embodiment is shown.

[0059] Figure 1B The number of viable cells of short-lived bacteria grown in vitro for 0 hours, 24 hours, and 48 hours in LB medium supplemented with diaminopimelic acid (DAP) according to an example embodiment is shown.

[0060] Figure 1C The number of viable cells of short-lived bacteria grown in vitro for 0 hours, 24 hours, and 48 hours in a homogenized mixed organ suspension according to an example embodiment is shown.

[0061] Figure 1D The number of viable cells of short-lived bacteria after subcutaneous injection in mice at 1, 2, 5, and 11 days according to an example embodiment is shown.

[0062] Figure 2A The percentage of cell killings of the short-lived bacterium mp107 and the control strain MG1655 against the mouse Lewis lung cancer cell line (LLC) according to the example embodiment is shown.

[0063] Figure 2B The percentage of cell killings of the short-lived bacterium mp107 and the control strain MG1655 against the human lung cancer cell line (A549) according to the example embodiment is shown.

[0064] Figure 2CThe inhibition of mouse tumor volume by intratumoral (it) injection of control strain MG1655, short-lived bacterium SH3, and short-lived bacterium mp107 expressing ExlA (using two different doses) according to example embodiments is shown. (*P<0.05, ***P<0.001). Error bars, SEM.

[0065] Figure 3A The following is an illustration of a short-lived bacterium mp107 expressing ExlA (at a concentration of 7.5 x 10⁻⁶) administered intravenously (iv) to PBS according to an example embodiment. 9 Inhibition of mouse lung cancer at a dose of cfu / kg mice (***P<0.001). Error bars, SEM.

[0066] Figure 3B Flow cytometry results showing the percentage of CD4+ T cells in mouse tumors treated with mp107 or control strain MG1655 according to the example embodiment are shown. (***P<0.001). Error bars, SEM.

[0067] Figure 3C Flow cytometry results showing the percentage of CD8+ T cells in mouse tumors treated with mp107 or control strain MG1655 according to the example embodiment are shown. (***P<0.001). Error bars, SEM.

[0068] Figure 4 A schematic diagram of the plasmid pExlA according to an example embodiment is shown.

[0069] Figure 5 A schematic diagram of the plasmid pExlA2 according to an example embodiment is shown.

[0070] Figure 6A Hemolytic analysis of Escherichia coli strains SH3 and SH4 according to example embodiments is shown.

[0071] Figure 6B Hemolysis analysis of Escherichia coli control strains MG1655 and MG1655 / pExlA2 according to example embodiments is shown.

[0072] Figure 7 The example embodiment is shown with 2x10 8 Percentage weight loss in mice after intravenous injection of CFU / mice at doses of mp105, mp106, or mp107. PBS was used as a negative control. Error bars, SEM.

[0073] Figure 8Increased tumor volume (mm3) in mice carrying subcutaneous LLC tumors after intravenous injection of mp105, mp106, or mp107 according to example embodiments is shown. PBS was used as a negative control. Error bars, SEM.

[0074] Figure 9 Increased tumor volume (mm3) in mice carrying subcutaneous LLC tumors was shown after administration of intravenous (iv) or a combination of intravenous and intratumoral (iv+it) mp105 according to example embodiments. PBS was used as a negative control. Error bars, SEM.

[0075] Figure 10A and Figure 10B The following are examples illustrating the subcutaneous injection of two doses of mp105 (at 1x10⁻¹) according to an example embodiment. 8 Quantification of Salmonella typhimurium in the liver and lungs 14 days after administration of CFU / mouse or PBS. Bacteria in organs were quantified by counting colony-forming units and validated by colony PCR.

[0076] Microbial Preservation

[0077] Bacterial strain SH2 was deposited on June 10, 2021, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, China (100101), with accession number 22685. Bacterial strain SH3 was deposited on May 18, 2020, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, China (100101), with accession number 19836. Bacterial strain mp107 was deposited on May 18, 2020, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, China (100101), with accession number 19835. Bacterial strain SH4 was deposited on May 18, 2021, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, China (100101), with accession number 22557. Bacterial strain mp105 was deposited on May 18, 2021, at the same location (CGMCC), with accession number 22555. Bacterial strain mp106 was deposited on May 18, 2021, at the same location (CGMCC), with accession number 22556. Detailed Implementation

[0078] As used herein and in the claims, “comprising” means including the following elements but excluding others.

[0079] As used herein and in the claims, the singular forms “a / an” and “the” include plural referents unless the context clearly indicates otherwise. For example, as used above, “a” gene means one or more genes, which may be the same or different.

[0080] As used herein, the term “about” is understood to mean within the normal tolerance range in the field and not exceeding ±10% of the specified value. By way of example only, about 50 means from 45 to 55, including all values ​​in between. As used herein, the phrase “about” also includes the specific value, for example, about 50 includes 50.

[0081] As used herein and in the claims, an "immunogenic composition" is a composition that effectively (e.g., in a suitable form and amount) elicits an immune (immunological) response against a disease or condition. In some embodiments, the immunogenic composition is a vaccine that effectively prevents cancer or tumors.

[0082] As used herein and in the claims, an "effective amount" is an amount that effectively achieves the desired effect of at least a measurable amount. For example, the amount may effectively elicit an immune response, and / or it may effectively elicit a protective response against a pathogen carrying the target peptide. In some embodiments, the amount may effectively elicit an immune response against cancer or tumor.

[0083] As used herein and in the claims, “subject” means an animal, such as a mammal, including, but not limited to, primates (e.g., humans), cattle, sheep, goats, horses, dogs, cats, rabbits, rats, mice, etc.

[0084] As used herein and in the claims, the “pathogenesis” of bacteria refers to one or more biological mechanisms that cause a disease state in a host or subject.

[0085] As used herein and in the claims, a “non-toxic” strain (e.g., non-invasive, commensal, or symbiotic) is a strain that will not cause disease or have harmful pathogenic effects on a subject. Such bacteria can be naturally occurring bacteria, GRAS (“Generally Recognized As Safe”) bacteria, or probiotics. On the other hand, a “toxic” strain has at least one virulence factor that may cause disease or have harmful pathogenic effects on a subject and is generally not considered safe.

[0086] In some example embodiments, the “virulent” strains can be genetically modified so that even if they retain or have certain additional virulence factors, they do not cause disease or have any harmful pathogenic effects on the subject or host.

[0087] "Virulent factors" are molecules produced by bacteria that can enhance the bacteria's ability to harm the host or host cells (e.g., tumors within the host). Examples of virulence factors include cytotoxins, toxins, hemolysins, proteases, destructive enzymes, and factors that facilitate bacterial colonization, entry and exit from cells, and acquisition of nutrients.

[0088] As used herein, the terms “treat,” “(treating),” or “treatment” refer to the following methods of: relieving, eliminating, or improving symptoms of a disease or condition in a preventive and / or therapeutic manner; preventing additional symptoms; improving or preventing the basal metabolic cause of symptoms; inhibiting a disease or condition; halting the progression of a disease or condition; alleviating a disease or condition; causing the remission of a disease or condition; reducing the condition caused by a disease or condition; or terminating the symptoms of a disease or condition.

[0089] As used herein and in the claims, "short-lived" bacteria, or bacteria with a "short lifespan," refers to bacteria that survive in vivo on a subject for only a short period of time after administration, such as from a few hours (e.g., 1 to 3 hours) to a few days (e.g., 1 to 3 days), depending on the quantity of bacteria administered and the manner of administration. In some embodiments, "short-lived" bacteria cannot replicate or colonize in the subject's body after administration.

[0090] As used herein and in the claims, bacterial “death” means the permanent cessation of bacterial life.

[0091] As used herein and in the claims, "attenuated" bacteria refers to bacteria that have reduced virulence or infectivity compared to the parent form or strain.

[0092] As used herein and in the claims, a "medical effector" refers to a pharmaceutical agent that exerts at least one medical effect on a disease or condition. Examples of medical effectors include, but are not limited to, therapeutic factors, antigens, peptides, and cytotoxins.

[0093] As used herein and in the claims, “medical effect” on a subject’s disease or condition means causing biological changes that treat the subject’s disease or condition. Examples of medical effects include, but are not limited to, inducing an immune response, causing cell lysis within a disease lesion, inhibiting biological pathways, binding to receptors, inhibiting receptors, inhibiting cellular processes in target cells or organisms, and inhibiting or reducing the production of one or more factors that cause or maintain a disease or condition. Cellular processes include, but are not limited to, DNA replication, RNA translation, cell division, and maintaining cellular homeostasis.

[0094] In some example embodiments, there is a great need to develop a novel bacterium that has the advantages of both killed and live bacteria, while avoiding their respective disadvantages.

[0095] In some example embodiments, the bacteria provided are short-lived bacteria. When administered in vivo, these short-lived bacteria survive on a timescale of several hours. The lifespan of short-lived bacteria can be artificially altered by supplementing the bacterial suspension with specific compounds or molecules. Because the short-lived bacteria are alive upon administration, the effector molecules they produce retain their integrity and functionality. Because the short-lived bacteria die in the body within hours or days after administration, the pathogenesis is minimized.

[0096] In some example embodiments, pharmaceutical compositions comprising genetically engineered bacteria are provided.

[0097] In some example embodiments, short-lived bacteria can be generated by deleting one or more essential genes. Alternatively, auxotrophic bacteria can be genetically constructed by mutating or deleting relevant auxotrophic genes. The resulting mutant bacteria may have varying, relatively short lifespans. Some of these resulting mutant bacteria may die rapidly within the body, depending on the nutrient composition of their growth environment. Even if the growth environment contains residual amounts of nutrients or compounds on which the bacteria temporarily depend for survival, the bacteria can survive for a longer period.

[0098] Numbered Examples - Group 1

[0099] 1. A genetically engineered live bacterium, comprising

[0100] At least one effector gene encoding at least one medical effector; and

[0101] At least one genetic modification that shortens the lifespan of the bacteria, such that, after administration to a subject, the bacteria survive for a time sufficient to allow the medical effector to exert at least one medical effect and die for a time sufficient to minimize the pathogenesis of the disease in the subject.

[0102] The bacteria mentioned therein are derived from virulent strains.

[0103] 2. The bacteria as described in Example 1, wherein the medical effector is an antigen that can elicit at least one immune response in the subject sufficient to treat the target disease or condition.

[0104] 3. The bacteria as described in Example 1, wherein the medical effector is a therapeutic factor that can induce at least one immune response and / or reduce the size of the target lesion in the subject to a degree sufficient to treat the target disease or condition.

[0105] 4. The bacteria as described in Example 2 or 3, wherein the immune response is initiated by CD4+ and / or CD8+ T cells.

[0106] 5. The bacteria as described in Example 1, wherein the medical effector is an antigen or a therapeutic factor expressed from a homologous gene of the bacteria.

[0107] 6. The bacteria as described in Example 1, wherein the medical effector is an antigen or a therapeutic factor expressed from a heterologous gene.

[0108] 7. The bacteria as described in Example 6, wherein the heterologous gene further comprises a leader sequence and / or a termination region in the bacteria that improves heterologous expression.

[0109] 8. The bacteria as described in Example 3 or 6, wherein the therapeutic factor is a cytotoxin that causes cell lysis in the target lesion.

[0110] 9. The bacteria as described in Example 2 or 3, wherein the target disease or condition is cancer or tumor, and wherein the medical effector causes tumor suppression in the subject.

[0111] 10. The bacteria as described in Example 1, wherein the bacteria are not capable of replicating or colonizing within the subject.

[0112] 11. The bacteria as described in Example 1, wherein the gene modification is the deletion or mutation of at least one essential gene or auxotrophic gene from the chromosome of the bacteria.

[0113] 12. The bacteria as described in any of the preceding embodiments, wherein the bacteria is an auxotroph of diaminopimelic acid.

[0114] 13. The bacteria as described in any of the preceding embodiments, wherein the genetic modification is the deletion of aspartate-semialdehyde dehydrogenase (asd) from the chromosome of the bacteria.

[0115] 14. The bacteria as described in any of the foregoing embodiments, wherein the bacteria have a survival time that can be controlled by exposing the bacteria to one or more regulatory effectors, the regulatory effectors regulating the survival time of the bacteria when administered in vivo.

[0116] 15. The bacteria as described in Example 14, wherein the regulatory effector is diaminopimelic acid.

[0117] 16. The bacteria as described in any of the preceding embodiments, wherein the medical effector is a homologous peptide expressed by a gene selected from the group consisting of: chuA, yjaA, tspE4C2, sat, sfa, papG, fyuA, iutA, hlyACBD, yfcV, and pks island.

[0118] 17. The bacteria as described in any of the preceding embodiments, wherein the medical effector is a cytotoxin selected from the group consisting of: exolysin A (ExlA) of Pseudomonas aeruginosa, non-hemolytic enterotoxin (Nhe) of Bacillus cereus, hemolysin, and vacuole toxin of Helicobacter pylori, and combinations thereof.

[0119] 18. The bacteria as described in any of the preceding embodiments, wherein the medical effector is an anticancer factor selected from the group consisting of: CpG, cyclic dinucleotides, and tumor antigens.

[0120] 19. The bacteria as described in any of the foregoing embodiments, wherein the bacteria are derived from Escherichia, Salmonella, Shigella, Listeria, Bacteroides, Bifidobacterium, Clostridium, Lactobacillus, or Lactococcus.

[0121] 20. The bacteria as described in any of the foregoing embodiments, wherein the bacteria are derived from Escherichia coli.

[0122] 21. The bacteria as described in any of the preceding embodiments, wherein the bacteria are derived from strain SH3, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number 19836.

[0123] 22. The bacteria as described in any of the preceding embodiments, wherein the bacteria expresses a sequence having at least about 80%, 85%, 90%, 95%, or 100% sequence identity with all or a fragment of SEQ ID NO:35.

[0124] 23. The bacteria as described in any of the preceding embodiments, wherein the bacteria are derived from strain mp107, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number 19835.

[0125] 24. The bacteria as described in any of the preceding embodiments, wherein the bacteria are formulated for intravenous administration.

[0126] 25. The bacteria as described in any of the preceding embodiments, wherein when administered intravenously, the time sufficient to minimize the pathogenesis is less than 48 hours.

[0127] 26. The bacteria as described in any of the preceding embodiments, wherein the bacteria are formulated for topical application.

[0128] 27. The bacteria as described in any of the preceding embodiments, wherein when applied topically at the injection site, the bacteria survive for up to 5 days at the injection site, but die within 48 hours outside the injection site.

[0129] 28. The bacteria as described in Example 24, wherein the bacteria are at a density of 7.5 x 10⁻⁶. 9 Administer at a dose equivalent to cfu / kg mice.

[0130] 29. The bacteria as described in any of the foregoing embodiments, wherein the disease is cancer or tumor, and the bacteria are administered intratumorally.

[0131] 30. The bacteria as described in Example 29, wherein the bacteria are at a density of about 100-200 mm. 3 Each gram of tumor must contain at least 5 x 10 8 Administered at an equivalent dose of CFU.

[0132] 31. A live bacterium of the genus *Escherichia coli*, said live bacterium comprising...

[0133] The gene for aspartate-semialdehyde dehydrogenase (ASD) is deleted from the chromosome of the bacteria.

[0134] The bacteria mentioned therein are derived from virulent strains.

[0135] 32. The bacteria as described in Example 31, wherein the bacteria express at least one effector gene encoding a medical effector.

[0136] 33. The bacteria as described in Example 31, wherein the bacteria are derived from strain SH3, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number 19836.

[0137] 34. The bacteria as described in Example 31, wherein the bacteria further comprises a gene encoding exolysin A (ExlA) of Pseudomonas aeruginosa.

[0138] 35. The bacteria as described in Example 34, wherein the gene has at least about 80%, 85%, 90%, 95% or 100% sequence identity with all or a fragment of SEQ ID NO:35.

[0139] 36. The bacteria as described in Example 31, wherein the bacteria are derived from strain mp107, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number 19835.

[0140] 37. An immunogenic composition comprising bacteria as described in any of the foregoing embodiments.

[0141] 38. A live bacterial vaccine comprising bacteria as described in any of the foregoing embodiments and optionally an adjuvant.

[0142] 39. A method of treating a disease or ailment, comprising administering to a subject a composition comprising an effective amount of bacteria as described in any of the foregoing embodiments.

[0143] 40. The method as described in Example 39, wherein the disease is a tumor or cancer.

[0144] 41. A method for constructing genetically engineered live bacteria, the method comprising the following steps:

[0145] Bacteria are genetically engineered to have a short lifespan, such that, after administration to a subject, the bacteria survive for a time sufficient to allow the medical effector to exert at least one medical effect and die within a time sufficient to minimize the pathogenesis of the disease in the subject, wherein the bacteria are derived from a virulent strain.

[0146] 42. The method as described in Example 41, further comprising the following steps:

[0147] The bacteria are genetically engineered to express at least one therapeutic effector.

[0148] Numbered Examples - Group 2

[0149] 1. A genetically engineered live bacterium, comprising

[0150] At least one effector gene encoding at least one medical effector; and

[0151] At least one genetic modification that shortens the lifespan of the bacteria, such that the live bacteria, after being administered to a subject, survive for a sufficiently long period of time that allows the medical effector to exert at least one medical effect and die after a period of time that minimizes the pathogenesis of the disease in the subject;

[0152] The bacteria mentioned therein are derived from virulent strains.

[0153] 2. The bacteria as described in Example 1, wherein the medical effector is an antigen that can elicit at least one immune response in the subject sufficient to treat the target disease or condition.

[0154] 3. The bacteria as described in Example 1, wherein the medical effector is a therapeutic factor that can induce at least one immune response and / or reduce the size of the target lesion in the subject to a degree sufficient to treat the target disease or condition.

[0155] 4. The bacteria as described in Example 2 or 3, wherein the immune response is initiated by CD4+ and / or CD8+ T cells.

[0156] 5. The bacteria as described in Example 1, wherein the medical effector is an antigen or a therapeutic factor expressed from a homologous gene of the bacteria.

[0157] 6. The bacteria as described in Example 1, wherein the medical effector is an antigen or a therapeutic factor expressed from a heterologous gene.

[0158] 7. The bacteria as described in Example 6, wherein the heterologous gene further comprises a leader sequence and / or a termination region in the bacteria that improves heterologous expression.

[0159] 8. The bacteria as described in Example 3 or 6, wherein the therapeutic factor is a cytotoxin that causes cell lysis in the target lesion.

[0160] 9. The bacteria as described in Example 2 or 3, wherein the target disease or condition is cancer or tumor, and wherein the medical effector causes tumor suppression in the subject.

[0161] 10. The bacteria as described in Example 1, wherein the bacteria are not capable of replicating or colonizing within the subject.

[0162] 11. The bacteria as described in Example 1, wherein the gene modification is the deletion or mutation of at least one essential gene or auxotrophic gene from the chromosome of the bacteria.

[0163] 12. The bacteria as described in any of the preceding embodiments, wherein the bacteria is an auxotroph of diaminopimelic acid.

[0164] 13. The bacteria as described in any of the preceding embodiments, wherein the genetic modification is the deletion of aspartate-semialdehyde dehydrogenase (asd) from the chromosome of the bacteria.

[0165] 14. The bacteria as described in any of the foregoing embodiments, wherein the bacteria have a survival time that can be controlled by exposing the bacteria to one or more regulatory effectors, the regulatory effectors regulating the survival time of the bacteria when administered in vivo.

[0166] 15. The bacteria as described in Example 14, wherein the regulatory effector is diaminopimelic acid.

[0167] 16. The bacteria as described in any of the preceding embodiments, wherein the medical effector is a homologous peptide expressed by a gene selected from the group consisting of: chuA, yjaA, tspE4C2, sat, sfa, papG, fyuA, iutA, hlyACBD, yfcV, and pks island.

[0168] 17. The bacteria as described in any of the preceding embodiments, wherein the medical effector is a cytotoxin selected from the group consisting of: exolysin A (ExlA) of Pseudomonas aeruginosa, non-hemolytic enterotoxin (Nhe) of Bacillus cereus, hemolysin, and vacuole toxin of Helicobacter pylori, and combinations thereof.

[0169] 18. The bacteria as described in any of the preceding embodiments, wherein the medical effector is an anticancer factor selected from the group consisting of: CpG, cyclic dinucleotides, and tumor antigens.

[0170] 19. The bacteria as described in any of the foregoing embodiments, wherein the bacteria are derived from Escherichia, Salmonella, Shigella, Listeria, Bacteroides, Bifidobacterium, Clostridium, Lactobacillus, or Lactococcus.

[0171] 20. The bacteria as described in any of the foregoing embodiments, wherein the bacteria are derived from Escherichia coli.

[0172] 21. The bacteria as described in any of the preceding embodiments, wherein the bacteria are derived from strain SH3, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number 19836.

[0173] 22. The bacteria as described in any of the preceding embodiments, wherein the bacteria expresses a sequence having at least about 80%, 85%, 90%, 95%, or 100% sequence identity with all or a fragment of SEQ ID NO:35.

[0174] 23. The bacteria as described in any of the preceding embodiments, wherein the bacteria are derived from strain mp107, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number 19835.

[0175] 24. The bacteria as described in any of the preceding embodiments, wherein the bacteria are formulated for intravenous administration.

[0176] 25. The bacteria as described in any of the preceding embodiments, wherein when administered intravenously, the time sufficient to minimize the pathogenesis is less than 2 days, 5 days, or 11 days.

[0177] 26. The bacteria as described in any of the preceding embodiments, wherein the bacteria are formulated for topical application.

[0178] 27. The bacteria as described in any of the preceding embodiments, wherein when applied topically at the injection site, the bacteria survive for up to 5 days at the injection site, but die within 48 hours outside the injection site.

[0179] 28. The bacteria as described in Example 24, wherein the bacteria are at a density of 7.5 x 10⁻⁶. 9 Administer at a dose equivalent to cfu / kg mice.

[0180] 29. The bacteria as described in any of the foregoing embodiments, wherein the disease is cancer or tumor, and the bacteria are administered intratumorally.

[0181] 30. The bacteria as described in Example 29, wherein the bacteria are at a density of about 100-200 mm. 3 Each gram of tumor must contain at least 5 x 10 8 Administered at an equivalent dose of CFU.

[0182] 31. The bacteria as described in any one of Examples 1 to 20, wherein the at least one effector gene comprises a cytotoxin gene and a partial DNA fragment encoding a hemolysin III gene.

[0183] 32. The bacteria as described in Example 31, wherein the cytotoxin is exolysin A (ExlA) of Pseudomonas aeruginosa.

[0184] 33. The bacteria as described in any one of Examples 31 or 32, wherein the bacteria are derived from strain mp106, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number 22556.

[0185] 34. The bacteria as described in any of the foregoing embodiments, further comprising at least one virulence gene modification that reduces the virulence of the bacteria.

[0186] 35. The bacteria as described in Example 34, wherein the at least one virulence gene modification is the deletion or mutation of at least one virulence gene from the chromosome of the bacteria.

[0187] 36. The bacteria as described in any one of Examples 34 or 35, wherein the virulence gene modification is a deletion of the hlyCABD operon from the chromosome of the bacteria.

[0188] 37. The bacteria as described in any one of Examples 36, wherein the bacteria are derived from strain SH4, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number 22557.

[0189] 38. The bacteria as described in any one of Examples 34 to 37, wherein the bacteria expresses a sequence having at least about 80%, 85%, 90%, 95%, or 100% sequence identity with all or a fragment of SEQ ID NO:40.

[0190] 39. The bacteria as described in any one of Examples 34 to 37, wherein the bacteria expresses a first sequence having at least about 80%, 85%, 90%, 95% or 100% sequence identity with all or fragments of SEQ ID NO:41 and / or a second sequence having at least about 80%, 85%, 90%, 95% or 100% sequence identity with all or fragments of SEQ ID NO:42.

[0191] 40. The bacteria as described in any one of Examples 38 or 39, wherein the bacteria are derived from strain mp105, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number 22555.

[0192] 41. The bacteria as described in any one of Examples 31 to 40, wherein the bacteria are in a concentration of 2 x 10⁻⁶. 8 Administer at a dose equivalent to cfu / mouse.

[0193] 42. The bacteria as described in any one of Examples 34 to 40, wherein the bacteria are formulated for administration by a combination of intravenous injection and intratumoral injection.

[0194] 43. The bacteria as described in Example 42, wherein the intratumoral injection has a 7.5 x 10 7 The equivalent dose of CFU / mouse, and the intravenous injection contains 3x10 7 CFU / mouse equivalent dose.

[0195] 44. A live bacterium of the genus *Escherichia coli*, said live bacterium comprising...

[0196] The gene for aspartate-semialdehyde dehydrogenase (ASD) is deleted from the chromosome of the bacteria.

[0197] The bacteria mentioned therein are derived from virulent strains.

[0198] 45. The bacteria as described in Example 44, wherein the bacteria express at least one effector gene encoding a medical effector.

[0199] 46. ​​The bacteria as described in Example 44, wherein the bacteria are derived from strain SH3, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number 19836.

[0200] 47. The bacteria as described in Example 44, wherein the bacteria further comprises a gene encoding exolysin A (ExlA) of Pseudomonas aeruginosa.

[0201] 48. The bacteria as described in Example 47, wherein the gene has at least about 80%, 85%, 90%, 95% or 100% sequence identity with all or a fragment of SEQ ID NO:35.

[0202] 49. The bacteria as described in Example 44, wherein the bacteria are derived from strain mp107, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number 19835.

[0203] 50. The bacteria as described in Example 44, wherein the at least one effector gene comprises a cytotoxin gene and a partial DNA fragment encoding a hemolysin III gene.

[0204] 51. The bacteria as described in Example 50, wherein the cytotoxin is exolysin A (ExlA) of Pseudomonas aeruginosa.

[0205] 52. The bacteria as described in any one of Examples 50 or 51, wherein the bacteria are derived from strain mp106, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number 22556.

[0206] 53. The bacteria as described in any one of Examples 44 to 52, further comprising at least one virulence gene modification that reduces the virulence of said bacteria.

[0207] 54. The bacteria as described in Example 53, wherein the at least one virulence gene modification is the deletion or mutation of at least one virulence gene from the chromosome of the bacteria.

[0208] 55. The bacteria as described in any one of Examples 53 or 54, wherein the virulence gene modification is a deletion of the hlyCABD operon from the chromosome of the bacteria.

[0209] 56. The bacteria as described in Example 55, wherein the bacteria are derived from strain SH4, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number 22557.

[0210] 57. The bacteria as described in any one of Examples 53 to 56, wherein the bacteria expresses a sequence having at least about 80%, 85%, 90%, 95%, or 100% sequence identity with all or a fragment of SEQ ID NO:40.

[0211] 58. The bacteria as described in any one of Examples 53 to 56, wherein the bacteria expresses a first sequence having at least about 80%, 85%, 90%, 95% or 100% sequence identity with all or fragments of SEQ ID NO:41 and / or a second sequence having at least about 80%, 85%, 90%, 95% or 100% sequence identity with all or fragments of SEQ ID NO:42.

[0212] 59. The bacteria as described in any one of Examples 57 or 58, wherein the bacteria are derived from strain mp105, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number 22555.

[0213] 60. The bacteria as described in any one of Examples 50 to 59, wherein the bacteria are in a concentration of 2 x 10⁻⁶. 8 Administer at a dose equivalent to cfu / mouse.

[0214] 61. The bacteria as described in any one of Examples 53 to 59, wherein the bacteria are formulated for administration by a combination of intravenous injection and intratumoral injection.

[0215] 62. The bacteria as described in Example 61, wherein the intratumoral injection has a 7.5 x 10 7 The equivalent dose of CFU / mouse, and the intravenous injection contains 3x10 7 CFU / mouse equivalent dose.

[0216] 63. An immunogenic composition comprising bacteria as described in any of the foregoing embodiments.

[0217] 64. A live bacterial vaccine comprising bacteria as described in any of the foregoing embodiments and optionally an adjuvant.

[0218] 65. A method of treating a disease or ailment, comprising administering to a subject a composition comprising an effective amount of bacteria as described in any of the foregoing embodiments.

[0219] 66. The method as described in Example 65, wherein the disease is a tumor or cancer.

[0220] 67. A method for constructing genetically engineered live bacteria, the method comprising the following steps:

[0221] Bacteria are genetically engineered to have a short lifespan, such that, after administration to a subject, the bacteria survive for a time sufficient to allow the medical effector to exert at least one medical effect and die within a time sufficient to minimize the pathogenesis of the disease in the subject, wherein the bacteria are derived from a virulent strain.

[0222] 68. The method as described in Example 67, further comprising the following steps:

[0223] The bacteria are genetically engineered to express at least one therapeutic effector.

[0224] 69. Use of a composition comprising an effective amount of bacteria as described in any of the foregoing embodiments in the manufacture of a medicament for treating a disease or ailment.

[0225] 70. The use as described in Example 69, wherein the disease is a tumor or cancer.

[0226] In some embodiments, a genetically engineered live bacterium is provided, comprising at least one effector gene encoding a medical effector; and at least one genetic modification that shortens the lifespan of the bacterium such that, after administration to a subject, the bacterium survives for a period sufficient to allow the medical effector to exert at least one medical effect and dies after a period sufficient to minimize pathogenesis in the subject. The bacterium is derived from a virulent strain.

[0227] In some embodiments, virulent strains can provide higher baseline levels of immunogenicity and therapeutic potential compared to non-pathogenic or non-toxic bacteria.

[0228] In some embodiments, the time is sufficient to allow the medical effector to exert at least one medical effect against at least one disease or condition. The effect may persist long after the bacteria have died and been cleared from the subject's body.

[0229] In some example embodiments, the medical effect is a preventive and / or therapeutic effect.

[0230] In some example embodiments, the time required for the medical effectors of bacteria to initiate preventive and / or therapeutic effects is less than 48 hours.

[0231] Example 1

[0232] Materials and methods

[0233] (1) Methods for constructing short-lived bacteria

[0234] Deletion or mutation of essential genes or auxotrophic genes

[0235] In order to produce short-lived bacteria, at least one essential gene or auxotrophic gene may be deleted or mutated. In some example embodiments, virulent bacterial strains are used for mutation.

[0236] In this example embodiment, *E. coli* strain SH2 was isolated and purified from a fecal sample provided by a healthy volunteer. The fecal sample was resuspended in PBS buffer and spread on LB agar supplemented with 1 mM isopropyl β-D-thiogalactoside (IPTG) and X-gal (0.06 mg / ml). *E. coli* formed blue colonies and were distinguishable from other bacterial species. SH2 is an isolate from fecal *E. coli*. Strain SH2 was deposited at the China General Microbiological Culture Collection Center (CGMCC) on June 10, 2021, with accession number 22685.

[0237] In this example embodiment, the asd gene, an essential gene encoding aspartate-semialdehyde dehydrogenase, is deleted from the chromosome of *E. coli* strain SH2. The Lambda(λ)-Red recombination system was used to delete the asd gene from the bacterial chromosome of *E. coli*. Two primers were used to generate the deletion:

[0238] asd-F (forward primer):

[0239] TCACTTGCGACTTTGGCTGCTTTTTGTATGGTGAAAGATGTGCCAAATAGGCGTATCACGAGGC(SEQID NO:1)

[0240] asd-R (reverse primer):

[0241] GCACTAGCAGGGGCGGCATCGCGCCCCAGATTTAATGAATAAAGATAGTGAACCTCTTCGAGGGAC (SEQ ID NO: 2)

[0242] Using the chloramphenicol resistance gene (cat) as a template, a DNA fragment containing the loxP-cat-loxP chloramphenicol resistance cassette was amplified by polymerase chain reaction (PCR). This fragment was homologous (45 nt) to the region directly flanked by the asd gene. Primers asd-F and asd-R were used for this PCR. Electroporated competent *E. coli* were transformed with plasmid pSim6, and expression of the λ recombinant protein was induced on the plasmid at 42°C. The PCR fragment was introduced into *E. coli* carrying pSim6 via electroporation. After incubation at 37°C overnight following λ-red induction, recombinant colonies were selected for chloramphenicol resistance. Resistant colonies were isolated and validated by colony PCR using primers asd-F2 (forward) TAGGTTTCCGAGCGGATCCA (SEQ ID NO:3) and Cm-R3 (reverse) CCTCTTACGTGCCGATCAACG (SEQ ID NO:4), which were designed to flank the asd gene. The validation PCR size was 505 bp. The asd deletion was further confirmed by phenotypic testing; in this test, correct colonies did not grow on LB medium but readily grew on LB medium supplemented with DAP (50 μg / ml). After confirming the asd deletion, single colonies were selected and transformed using the 705Cre plasmid carrying the kanamycin resistance gene. Expression of the Cre recombinase from the plasmid was induced at 37°C and spread on Luria-Bertani (LB) agar without any antibiotics. Single colonies were then streaked on both LB agar and LB agar supplemented with chloramphenicol. Single colonies that grew on LB agar but not on LB agar supplemented with chloramphenicol were selected. This mutant strain with the asd gene deletion but without the loxp-cat-loxp box was named SH3. Strain SH3 was deposited at the China General Microbiological Culture Collection Center (CGMCC) on May 18, 2020, with accession number 19836.

[0243] Identification of virulence genes in mutant strains

[0244] Virulence genes within SH3 were detected by colony PCR. To design primers, conserved sequence regions were first identified in different *E. coli* strains through evaluation of multiple sequence alignment. Primers were then designed to be specific to these conserved regions. All primers used are listed in Table 1.

[0245]

[0246]

[0247] Table 1. Primers used for detecting virulence genes in SH3

[0248] In vitro bacterial growth assay

[0249] Overnight cultures of 10 μl of bacterial SH3 were subcultured (time 0) in 1 ml of LB broth with or without 50 μg / ml DAP. After incubation for 24 and 48 hours, the bacteria were serially diluted and viable bacteria were quantified by counting colony-forming units on both Luria-Bertani (LB) agar and LB agar supplemented with 50 μg / ml DAP.

[0250] In vitro bacterial survival assay

[0251] Female C57BL / 6J mice aged six to eight weeks were euthanized. Organs (including liver, lung, heart, kidney, and spleen) were removed and homogenized separately. Equal volumes of each of the individual organ suspensions were combined to form a mixed organ suspension. The suspension mixture was used for in vitro viability assays. 5 μl of overnight bacterial culture was subcultured in 500 μl of organ suspension (time 0). Viable bacteria were quantified by counting colony-forming units on LB agar supplemented with 50 μg / ml DAP at 24 and 48 hours.

[0252] In vivo bacterial survival assay

[0253] Bacterial suspensions with or without 5 μg / ml DAP (approximately 1 x 10⁻⁶) 9 CFU (Colonyx flavum) was subcutaneously injected into the flank of six- to eight-week-old female C57BL / 6J mice (average weight approximately 20 g). Tissue samples from the injection site and from key organs (including liver, lung, heart, kidney, and spleen) were then removed to determine colony-forming units (CFU) at different time points. Approximately 1 gram of each tissue sample was homogenized in 1 ml of PBS buffer. The resulting tissue suspensions were serially diluted, plated on LB agar supplemented with 50 μg / ml DAP, and incubated overnight at 37°C. The CFU of the diluted tissue suspensions were counted, and the bacterial count was calculated based on the dilution factor.

[0254] The same in vivo bacterial survival assay was repeated using a method similar to that described above, wherein the bacterial suspension (approximately 5 x 10⁻⁶) was used. 8CFU (Colonyx flavulate) was injected into the tail vein of six- to eight-week-old female C57BL / 6J mice (average weight approximately 20 g). Tissue samples from the injection site and from key organs (including liver, lung, heart, kidney, and spleen) were then removed to determine colony-forming units (CFU) at different time points. Approximately 1 gram of each tissue sample was homogenized in 1 ml of PBS buffer. The resulting tissue suspensions were serially diluted, plated on LB agar supplemented with 50 μg / ml DAP, and incubated overnight at 37°C. The CFU of the diluted tissue suspensions were counted, and the bacterial count was calculated based on the dilution factor.

[0255] Example 2

[0256] (2) Short-lived bacteria as carriers of medical effectors

[0257] Constructing short-lived bacteria expressing cytotoxins through gene cloning

[0258] Encoders with promoters and terminators were synthesized. Exolysin A (ExlA) of Pseudomonas aeruginosa PA7 Figure 4 ) The exlA gene (SEQ ID NO:35) (Genbank: CP000744.1) was cloned into the pBAD-DEST49 plasmid (Invitrogen, catalog number 12283-016) using the CloneEZ seamless cloning technology (GenScript) according to the manufacturer's instructions. The recombinant plasmid pExlA was validated by sequencing analysis. Subsequently, the recombinant plasmid pExlA was introduced into the asd-deleted mutant SH3 cells via electroporation, and validation was performed by colony PCR using primers oxb-F (forward: CTGTTGTGACCGCTTGCTCT) (SEQ ID NO:33) and exlA-R (reverse: GAGGTGGAAGACAGGATTGTC) (SEQ ID NO:34). After plasmid transformation was confirmed, a single colony was selected. The resulting mutant strain containing the recombinant plasmid was named mp107. The strain mp107 was deposited at the China General Microbiological Culture Collection Center (CGMCC) on May 18, 2020, with accession number 19835.

[0259] In vitro cytotoxicity assay

[0260] Mouse Lewis lung cancer (LLC) cell line and human lung cancer cell line (A549) were used for in vitro cytotoxicity assays. Cells were grown in growth medium (DMEM + 10% FBS + 1% Gln + 1% P / S) at a concentration of 1 x 10⁻⁶ cells per well. 4Each cell line was seeded into 96-well plates. When the cells reached 80% confluence, they were co-cultured with bacteria mp107 at a moi of 100 (i.e., 100 bacteria per cell) in antibiotic-free medium supplemented with 5 μg / ml DAP. Escherichia coli reference strain MG1655 was used as a control. As a control, the control bacteria were also co-cultured with 1X phosphate-buffered saline (PBS) buffer. After 3 hours of incubation, the bacterial cells were washed three times with PBS and stained with 1% crystal violet for 5 min. Cells stained with crystal violet were considered viable as dead cells had been removed by washing. The stained cells were gently washed with PBS and then destained with 95% ethanol. The amount of crystal violet staining in the destained solution (optical density (OD) at 595 nm) was measured at 595 nm using a microtiter plate reader, reflecting the number of viable cancer cells. Use the following formula to calculate the percentage of cells killed by the co-cultured bacteria (or the percentage of cells killed (%)): (OD of the control) 595 - Processed OD 595 ) / Control OD 595 )×100%.

[0261] In vivo antitumor evaluation of short-lived bacteria when applied topically

[0262] Six- to eight-week-old female C57BL / 6J mice were used for tumor implantation into the mouse Lewis lung cancer cell line (LLC). Specifically, 1×10⁻⁶ cells of the cancer cell line were implanted... 6 Individual cells were subcutaneously injected into the flank and abdomen of each mouse. Seven to twelve days after cell line implantation, when the average tumor volume reached approximately 100-200 mm², [the cells were implanted]. 3 At that time, control bacteria MG1655, short-lived bacteria SH3, and mp107 were administered at a dose of 5 x 10⁻⁶ per gram of tumor tissue. 8 CFU was injected into each tumor of each mouse at a dose specified. A negative control was prepared by injecting PBS, and 4 x 10⁻⁶ CFU was injected per gram of tumor. 9 CFU was used to prepare a high-dose mp107 group. Following intratumoral (IT) injection, tumor size was measured approximately twice weekly (from day 0 to day 20) using a digital caliper. Differences in tumor growth inhibition rate (TGI) between the treatment and control groups were assessed.

[0263] The effects of medical effectors on the survival time of short-lived bacteria, SH3 and mp107, supplemented with 5 μg / ml DAP were used to evaluate their regulation in vivo.

[0264] In vivo antitumor evaluation of short-lived bacteria during systemic administration

[0265] Six- to eight-week-old female C57BL / 6J mice were used for tumor implantation into the mouse Lewis lung cancer cell line (LLC). Specifically, 1×10⁻⁶ cells of the cancer cell line were implanted... 6 Individual cells were subcutaneously injected into the flank and abdomen of each mouse. Seven to twelve days after cell line implantation, when the average tumor volume reached approximately 100-200 mm², [the cells were observed]. 3 At that time, the short-lived bacteria mp107 were passed through a flow rate of 7.5 x 10⁻⁶. 9 The dose of cfu / kg was administered systemically to each mouse via the tail vein. A negative control was prepared by injection of PBS. Following intravenous (iv) bacterial injection, tumor size was measured approximately twice weekly (from day 0 to day 20) using a digital caliper. Differences in tumor growth inhibition rate (TGI) between the treatment and control groups were assessed.

[0266] Biodistribution of short-lived bacteria in mice

[0267] Following in vivo antitumor evaluation, mice were euthanized. Tumor tissue and tissues from key organs (including liver, lung, heart, kidney, and spleen) were then removed to determine colony-forming units (CFU) at different time points. Approximately 1 gram of each tissue was homogenized in 1 ml of PBS buffer. The resulting tissue suspensions were serially diluted, plated on LB agar supplemented with 50 μg / ml DAP, and incubated overnight at 37°C. The CFU of the diluted tissue suspensions were counted, and the bacterial count was calculated based on the dilution factor.

[0268] Flow cytometry

[0269] Tumor tissue was decomposed using 37.5 μg / mL Liberase™ (Roche) and 8,000 U / mL DNase I, bovine pancreas (Merck Millipore). Cell suspensions were filtered through a 200 μM cell filter and washed with PBS. Cells were then stained against markers using the following antibodies: BB700 rat anti-mouse CD4 clone RM4-5 (RUO) (BD), Ms CD3e FITC 145-2C11 (BD), Ms CD4 BV510 RM4-5 (BD), MsCD8a APC-Cy7 53-6.7 (BD), and BV510 rat anti-mouse CD45RB (BD). Stained cells were analyzed using a Life Attune NxT flow cytometer (Life Technologies) according to the manufacturer's instructions.

[0270] result

[0271] Example 3

[0272] Construction of short-lived bacteria

[0273] A mutant strain with a gene deletion from the chromosome was prepared and named SH3 according to the method described in Example 1. Four phylogenetic groups (A, B1, B2, and D) of the *E. coli* strain were present, and the phylogenetic type could be determined by PCR detection of the chuA and yjaA genes in the *E. coli* chromosome and the DNA fragment TSPE4.C2. The primer pairs used were chuA-F (GACGAACCAACGGTCAGGAT) (SEQ ID NO:23) and chuA-R (TGCCGCCAGTACCAAAGACA) (SEQ ID NO:24), yjaA-F (TGAAGTGTCAGGAGACGCTG) (SEQ ID NO:25) and yjaA-R (ATGGAGAATGCGTTCCTCAAC) (SEQ ID NO:26), and TspE4C2-F (GAGTAATGTCGGGGCATTCA) (SEQ ID NO:27) and TspE4C2-R (CGCGCCAACAAAGTATTACG) (SEQ ID NO:28). The sizes of the obtained PCR products were 279 bp, 211 bp, and 152 bp, respectively. If the *E. coli* strain was positive for both chuA and yjaA, the strain was identified as phylogenetic group B2. Phylogenetic typing showed that SH3 belongs to phylogenetic type B2 *E. coli*. Further PCR detection of *E. coli* virulence genes showed that SH3 was positive for polyketide synthase genomic islands (pks islands) (these islands are pathogenicity islands encoding giant modular nonribosomal peptides and polyketide synthases) and other virulence genes or operons such as chuA, yjaA, tspE4C2, sat, sfa, papG, fyuA, iutA, hlyACBD, and yfcV. The results indicate that SH3 is an *E. coli* strain with multiple virulence factors, thus providing a higher baseline level of immunogenicity and therapeutic efficacy compared to strains engineered from non-pathogenic or non-virulent strains.

[0274] Results of in vitro bacterial growth assays of short-lived bacteria

[0275] Now for reference Figure 1A and Figure 1B In vitro growth assays showed that the asd-deficient mutant SH3 could not survive in growth medium (LB) without DAP supplementation. Figure 1A However, it grows readily when DAP is added to the growth medium (approximately 8 x 10⁸ after 24 hours).7 CFU and approximately 5x10 after 48 hours 7 cfu)( Figure 1B These results indicate that short-lived bacteria with gene modifications that lack essential genes cannot survive in vitro in the absence of necessary supplementation.

[0276] Results of in vitro bacterial survival assays for short-lived bacteria

[0277] Now for reference Figure 1C In in vitro studies, poor survival of the asd mutant SH3 was also observed (no growth after 24 or 48 hours). In this study, the asd mutant SH3 was incubated in a homogenized mixed organ suspension, and viable bacteria were quantified by counting colony-forming units on LB agar supplemented with DAP (50 μg / ml). Figure 1C The results showed that, in the absence of necessary supplementation, short-lived bacteria with gene modifications that lacked essential genes could not survive in vitro.

[0278] Results of in vivo bacterial survival assays for short-lived bacteria

[0279] To determine whether the asd mutant SH3 can survive in vivo for a short period of time, approximately 1 x 103 asd mutant SH3 was used. 9 CFU was administered subcutaneously to mice.

[0280] Now for reference Figure 1D Without DAP supplementation, the viable bacterial count of SH3 increased from approximately 1 x 10⁻⁶ two days after injection. 9 CFU decreased to approximately 2.7 x 10⁻⁶. 8 Approximately 27% of the SH3 cells remained viable at the injection site. After 5 days, the viable bacterial count continued to decline significantly. After 11 days, no viable bacterial count was detected, indicating that the genetically modified bacteria with the essential gene deletion have a short lifespan and are unable to replicate or colonize in vivo.

[0281] Results of in vivo bacterial survival assays for short-lived bacteria

[0282] The in vivo bacterial survival assay results also showed that SH3 was present only at the subcutaneous injection site and could survive for up to 5 days after 2, 5 and 11 days from the time of injection, regardless of whether DAP was replenished or not in the bacterial suspension, but was not present in all other tested organs (including liver, lung, spleen, heart and kidney).

[0283] The results showed that short-lived bacteria were localized within the subcutaneous injection site, thus making them safe for local application.

[0284] Short-lived bacteria SH3 (approximately 5 x 10⁻⁶)8 CFU was further injected into the tail vein of six- to eight-week-old female C57BL / 6J mice to further evaluate the safety of the short-lived bacteria when administered systemically. Mice treated with the short-lived bacteria did not die following intravenous injection. In contrast, 100% of mice treated with wild-type bacteria died within 48 hours. Furthermore, SH3 was not detected in any organ of any mouse treated with the short-lived bacteria when examined 6 days after intravenous (iv) injection.

[0285] Notably, in all these in vivo evaluations, the mutation rate of the asd-deficient mutant SH3 was 0%. That is, 100% of the SH3 cells isolated from the injection site maintained their dependence on DAP in order to survive and grow, indicating that even if the genetically modified bacteria retain their virulence factors, these bacteria are safe to use regardless of whether they are administered locally or systemically.

[0286] In summary, these data demonstrate the surprising safety of short-lived bacteria with virulence factors when used in vivo, whether administered topically or systemically. Unbound by any theoretical constraints, the temporary survival of these short-lived bacteria within the subject or host prevents the development of systemic infection or disease, even if the bacteria possess multiple virulence factors. Therefore, these bacteria can serve as safe and highly effective carriers or mediators for the preparation of vaccines or therapeutics to treat or prevent various diseases or improve certain conditions. For example, short-lived mutant bacteria such as SH3 can be used as platforms for developing live therapeutics.

[0287] Regulating the survival time of short-lived bacteria

[0288] Still referencing Figure 1D The bacterial suspension was replenished with DAP to a final concentration of 5 μg / ml, and in vivo bacterial viability assays were performed. With DAP supplementation, the viable count of SH3 decreased only slightly from approximately 1 x 10⁻⁶ days after injection. 9 CFU decreased to approximately 6.27x10. 8 CFU. In other words, approximately 62.7% of the asd mutant SH3 cells survived for 2 days at the injection site after injection. Figure 1D This percentage was significantly higher than that of SH3 in the absence of DAP. Therefore, the results indicate that the survival time of short-lived bacteria can be modulated by supplementing regulatory effectors. Advantageously, the survival time of mutant short-lived bacteria can be controlled by regulatory effectors. Although the survival time of SH3 at the injection site increased with the addition of 5 μg / ml DAP, SH3 was absent in any key organs of any mouse when examined 2, 5, and 11 days after injection.

[0289] Example 4

[0290] Construction results of short-lived bacteria expressing heterologous virulence factors

[0291] In this example embodiment, under the control of the constitutive promoter oxb18, the short-lived bacterium SH3 obtained from Example 2 was further transformed with a plasmid expressing the cytotoxin, Pseudomonas aeruginosa exolysin A (ExlA). The sequence containing the oxb18 promoter, the pelB leader sequence, the exlA gene of Pseudomonas aeruginosa PA7, and the terminator (rrnB transcription termination region), as shown in SEQ ID NO:35, was cloned into plasmid pBAD-DEST49 to form the recombinant plasmid pExlA (…). Figure 4 The purified and validated recombinant strain was named mp107.

[0292] Results of in vitro cytotoxicity assays of short-lived bacteria expressing cytotoxins

[0293] Now for reference Figure 2A The cytotoxicity of mp107 was evaluated in vitro. The percentage of cell line and bacteria was determined after co-culturing in growth medium supplemented with DAP (5 μg / ml) for 3 hours. Both were P < 0.001 (independent t-test). The data showed that the short-lived bacterium mp107 exhibited a surprisingly high percentage of cell line killing (approximately 92%) in LLC cells, while the control bacterium MG1655 had only about 13% killing percentage. Figure 2A The data also showed that mp107 had a surprisingly high kill percentage against A549 cells (approximately 90%), while the control bacterium MG1655 had only about 30% kill percentage. Figure 2B These results show that mp107 is toxic or lethal to mouse and human lung cancer cells, suggesting that short-lived bacteria expressing heterologous virulence factors such as cytotoxins may have high efficacy in treating cancers such as lung cancer.

[0294] Results of in vivo antitumor evaluation of short-lived bacteria when applied topically

[0295] Now for reference Figure 2B A syngeneic mouse cancer model was constructed in which mice carried subcutaneous tumors formed from Lewis lung cancer cells (LLC). To improve the survival time of short-lived bacteria within tumors in vivo, in vivo antitumor efficacy was evaluated using a bacterial suspension supplemented with 5 μg / ml DAP before administration to the tumors in mice. For the control strain MG1655, the short-lived bacterium SH3, and the short-lived bacterium mp107 expressing exolysin A, these bacteria were administered at a dose of 5 x 10⁻⁶ per gram of tumor. 8 The CFU dosage was used for injection; for the mp107 (high dose) group, the injection dose was 4 x 10⁻⁶ per gram of tumor. 9 CFU. Figure 2BThe data showed that throughout the treatment period (from day 3 to day 20), tumor growth in the SH3 group was significantly inhibited compared to the control MG 1655 group and the PBS group (no bacterial injection). Compared to the reference strain MG1655 (p = 0.0002), the short-lived bacterium SH3 showed a higher level of tumor inhibition, indicating that SH3 bacteria with virulence factors have higher anticancer efficacy compared to control bacteria. The data also showed that throughout the treatment period (from day 3 to day 20), tumor growth in the mp107 group was significantly inhibited compared to the SH3 group. Further data showed that, on its own, the short-lived bacterium mp107 expressing additional cytotoxins was more effective in inhibiting tumor growth than the short-lived bacterium SH3 (p = 0.03), indicating that the exlA-encoded cytotoxin confers additional anticancer capabilities on short-lived bacteria. When the injection dose was increased to 4 x 10⁻⁶ per gram of tumor... 9 At higher CFU levels, the anticancer efficacy of mp107 also increased accordingly. Twenty days after intratumoral injection of the bacteria, the competitive response rate of high-dose mp107 reached 75% (6 out of 8 mice), indicating an additive or even synergistic effect in anticancer efficacy from short-lived bacteria SH3 (the mp107 treatment group) that further express heterologous virulence factors such as cytotoxin ExlA. Comparison of tumor growth inhibition rate (TGI) showed significant differences between each group in the treatment and control groups.

[0296] Results of in vivo antitumor evaluation of short-lived bacteria during systemic administration

[0297] Now for reference Figure 3A The short-lived bacterium mp107 was intravenously injected into the tail vein of mice (7.5 x 10⁻⁶). 9 CFU / kg mice). Throughout the treatment period (from day 2 to day 30), intravenous injection of short-lived bacteria significantly inhibited tumor growth compared to the PBS control group. 44.4% (4 out of 9 mice) of mice treated with mp107 had tumors cured by day 30, indicating that when the concentration was 7.5 x 10⁻⁶ CFU / kg, tumor growth was significantly reduced. 9 When administered as a single systemic dose of cfu / kg mice, these short-lived bacteria were effective in treating cancer.

[0298] Biodistribution of short-lived bacteria in mice

[0299] At the end of the experiment, the bacterial biodistribution in the treated mice was analyzed. The short-lived bacterium mp107 was not detected in tumors or any critical organs (including the lungs, liver, spleen, heart, or kidneys), indicating that these short-lived bacteria do not colonize tumor tissue or the subjects. Since the tumors do not contain bacteria, the data suggest that the tumor suppression observed after intravenous injection of these short-lived bacteria was caused by indirect mechanisms such as immune mechanisms.

[0300] Results of flow cytometry

[0301] Now for reference Figure 3B and Figure 3C Flow cytometry was used to analyze intratumoral lymphocytes. Data showed that CD4+ T cells and CD8+ T cells in tumors of mice treated with the short-lived bacterium mp107 increased by 19-fold and 12-fold, respectively, compared to those in mice treated with the control bacterium MG1655, indicating that these short-lived bacteria elicited a T cell response in the treated mice. These data suggest that the short-lived bacterium mp107, expressing the heterologous protein ExlA, induces anti-cancer immunity, thereby inhibiting tumor growth.

[0302] These data suggest that short-lived bacteria expressing certain antigens could also be used as vaccines against diseases such as cancer.

[0303] Example 5

[0304] Materials and methods

[0305] (3) Methods for constructing short-lived bacteria

[0306] Deletion or mutation of virulence genes

[0307] To further improve the safety of using short-lived bacteria, additional genetic modifications can be used to further reduce their virulence. In this example embodiment, the hlyCABD operon encoding the α-hemolysin of bacterial (Escherichia coli) strain SH3 is deleted or mutated to generate a new bacterial strain SH4.

[0308] In this example embodiment, the Lambda (λ)-Red recombination system is used to induce a deletion of the hlyCABD operon from the bacterial chromosome of *E. coli* strain SH3. Two primers are used to generate the deletion:

[0309] M-hly-F (positive):

[0310] TTGGTTTGCTTTTTTTTACCTGCCACCGCAATGAATGCTTTTTTTAATAGGCGTATCACGAGGC(SEQID NO:36)

[0311] M-hly-R (reverse):

[0312] TTAACGCTCATGTAAACTTTCTGTTACAGACTCTTCCAGAGGACTTAGTGAACCTCTTCGAGGGAC(SEQ ID NO:37)

[0313] Primers M-hly-F and M-hly-R were used to amplify the chloramphenicol resistance cassette by PCR. Using the chloramphenicol resistance gene (cat) as a template, a DNA fragment containing the loxP-cat-loxP chloramphenicol resistance cassette, homologous (45 nt) to the region directly flanked by the hlyCABD operon, was amplified by PCR. Primers M-hly-F and M-hly-R were used for this PCR. Bacterial strain SH3 was transformed with plasmid pSim6, and expression of the λ recombinant protein was induced on the plasmid at 42°C. The PCR fragment was introduced into SH3 cells carrying pSim6 via electroporation. After λ-red induction, recombinants were selected for chloramphenicol resistance and verified by colony PCR. The chloramphenicol resistance cassette was then removed using the 705 Cre method according to the manufacturer's instructions (Gene Bridges, Germany). In summary, expression of the Cre recombinase from the plasmid was induced in the transformants at 37°C, and the bacteria were then spread on LB agar without any antibiotics. After overnight incubation at 37°C, single colonies were streaked on both LB agar and LB agar supplemented with chloramphenicol. Single colonies that grew on LB agar but not on LB agar supplemented with chloramphenicol were selected. The mutant strain with both the hlyCABD operon deletion and the asd gene deletion but without the loxp-cat-loxp box was named SH4. Bacterial strain SH4 was deposited at the China General Microbiological Culture Collection Center (CGMCC) on May 18, 2021, with accession number 22557.

[0314] Example 6

[0315] (4) Short-lived bacteria as carriers of medical effectors

[0316] Constructing short-lived bacteria expressing fragments of cytotoxin and hemolysin III through gene cloning.

[0317] The exlA gene (SEQ ID NO:41) encoding exolysin A of Pseudomonas aeruginosa and partial DNA fragments of the hly III gene (SEQ ID NO:42) encoding hemolysin III were synthesized and cloned into the pBAD-DEST49 plasmid (Ingentech, catalog number 12283-016) according to the manufacturer's instructions using CloneEZ seamless cloning technology (GenScript). This formed the recombinant plasmid pExlA2. Figure 5 The recombinant plasmid pExlA2 was validated by sequencing analysis. Subsequently, the recombinant plasmid pExlA2 was introduced into bacterial strains SH4 and SH3 via electroporation, and validated by colony PCR. After confirmation of transformation, individual colonies were selected for each bacterial strain. The mutant strains SH4 and SH3 transformed with the recombinant plasmid pExlA2 were named mp105 and mp106, respectively. Strain mp105 was deposited at the China General Microbiological Culture Collection Center (CGMCC) on May 18, 2021, with accession number 22555. Strain mp106 was deposited at the China General Microbiological Culture Collection Center (CGMCC) on May 18, 2021, with accession number 22556.

[0318] Example 7

[0319] Hemolysis test

[0320] The recombinant plasmid pExlA2 was introduced into the control bacterial strain MG1655 via electroporation and verified by colony PCR. After confirming the transformation, a single colony was selected. The MG1655 strain transformed with plasmid pExlA2 was named MG1655 / pExlA2.

[0321] Overnight cultures of bacterial strains SH3 and SH4, and control bacterial strains MG1655 and MG1655 / pExlA2, were respectively aspirated onto LB agar supplemented with diaminopimelic acid (DAP, 50 μg / ml) and 10% (v / v) rabbit blood, and then incubated at 37°C for 8 to 10 hours. At the endpoint, the hemolytic ability of the corresponding bacterial strains was observed. The observation of agar becoming clear indicated hemolysis due to erythrocyte rupture.

[0322] Example 8

[0323] In vivo evaluation of the safety and anticancer efficacy of short-lived bacteria after injection

[0324] Six- to eight-week-old female C57BL / 6J mice were used for tumor implantation into the mouse Lewis lung cancer cell line (LLC). Specifically, 1x10⁻¹¹ LLC cell lines were implanted into the tumors. 6Individual cells were subcutaneously injected into the flank and abdomen of each mouse. Seven to twelve days after cell line implantation, when the average tumor volume reached approximately 50-200 mm... 3 Bacterial strains (mp105, mp106, and / or mp107) were administered intravenously (iv) into the tail vein of each mouse, or a combination of intravenous and intratumoral injection (iv+it) into each mouse. PBS buffer was injected in the same manner as a negative control. Body weight was measured on days 4, 6, 8, and 11 post-injection. Tumor size was measured 2 to 3 times weekly using a digital caliper following bacterial injection.

[0325] Example 9

[0326] Species identification

[0327] The bacteria to be identified were isolated from the tissue and purified through subculture. Then, following the manufacturer's instructions, genomic DNA was isolated from each bacterial strain using the Tiangen Genomic DNA Kit (Tiangen Biotech, Beijing) and species identification was determined by 16S ribosomal DNA (rDNA) sequence analysis. Specifically, the genomic DNA was used as a template for PCR amplification using primers 27F and 1492R. The PCR products were then sequenced and BLAST-aligned in GenBank.

[0328] 27F (positive):

[0329] AGAGTTTGATCCTGGCTCAG(SEQ ID NO:38)

[0330] 1492R (reverse):

[0331] TACGGCTACCTTGTACGACTT(SEQ ID NO:39)

[0332] Example 10

[0333] Evaluation of short-lived bacteria as therapeutic and preventative vaccines

[0334] In this example, female C57BL / 6J mice with bacterial infection were used to demonstrate and evaluate the ability of mp105 to alleviate bacterial infection. Bacteria isolated from mouse organs (including liver and lungs) were analyzed for species identification according to the method described in Example 9. 16S rDNA sequencing indicated that the mice were naturally infected with *S. typhimurium*. To examine whether mp105 could treat existing *S. typhimurium* infection and / or prevent subsequent bacterial infections, mice were subcutaneously injected with two doses of mp105 (1x10⁻¹²). 8 CFU / mouse or PBS, 14 days apart. 14 days after injection, administer 2x10... 7 The CFU / mouse dose was used to challenge mice with the pathogenic *Escherichia coli* strain CFT073 to establish additional infection. Five days post-challenge, mice were euthanized, and bacterial infection in key organs such as the liver, lungs, heart, kidneys, and spleen was analyzed by plate counting of colony-forming units (CFU) and PCR validation of colonies. Because *Salmonella typhimurium* strains are negative for the hlyCABD operon, while CFT073 carries the operon, PCR was used to differentiate between the two bacterial types. Primers used for PCR were hly-F and hly-R.

[0335] hly-F (positive):

[0336] ACTCAGCAGGACAAAGCACG(SEQ ID NO:5)

[0337] hly-R (reverse):

[0338] GAGGCCAATGAGTTTCTCTG (SEQ ID NO: 6).

[0339] result

[0340] Example 11

[0341] Results of constructing attenuated short-lived bacteria

[0342] A mutant strain with a gene deletion of the hlyCABD operon from the chromosome of SH3 was prepared according to the method described in Example 5 and named SH4. The deletion of the hlyCABD operon encoding α-hemolysin can improve the safety of using SH4 as an example of a short-lived bacterium for various applications such as cancer therapy and vaccines against microbial infections.

[0343] Example 12

[0344] Construction results of attenuated short-lived bacteria expressing cytotoxins

[0345] According to the method described in Example 6, the short-lived bacteria SH4 obtained from Example 5 and SH3 obtained from Example 2 were further transformed using plasmids expressing cytotoxin, Pseudomonas aeruginosa exolysin A (SEQ ID NO:41), and a partial DNA fragment of the hlyIII gene encoding hemolysin III (SEQ ID NO:42). The sequence containing the oxb 18 promoter, pelB leader sequence, the exlA gene of Pseudomonas aeruginosa PA7, a partial DNA fragment of the hemolysin III encoding gene, and a terminator (rrnB transcription termination region) as shown in SEQ ID NO:40 was cloned into plasmid pBAD-DEST49 to form recombinant plasmid pExlA2. The resulting mutant strains SH4 and SH3, transformed with recombinant plasmid pExlA2, were named mp105 and mp106, respectively.

[0346] Example 13

[0347] Results of hemolysis test

[0348] Now for reference Figure 6A The results showed that SH4 lost its ability to induce hemolysis after the hlyCABD operon, which encodes α-hemolysin, was deleted from the SH3 genome, indicating that SH4 lacks the ability to produce α-hemolysin. In contrast, SH3 retained its ability to induce hemolysis.

[0349] Now for reference Figure 6B The hemolysis assay results showed that neither MG1655 nor MG1655 / pExlA2 induced hemolysis. The results indicate that despite the presence of a partial DNA fragment encoding the hemolysin III gene, hemolysin III was not produced from the plasmid. Surprisingly, For tumor therapy in vivo The results of the assessment (As detailed in Example 15 below) This indicates that the expression of this fragment enhances the anti-cancer effect.

[0350] In conclusion, since mp105 was obtained from SH4 converted using pExlA2, and the example short-lived bacterium mp105 also lacks the ability to produce hemolysin, it is speculated that this short-lived bacterium is safer for use in subjects for various applications such as cancer therapy.

[0351] Example 14

[0352] Results of in vivo evaluation of the safety and anticancer efficacy after injection of short-lived bacteria

[0353] Now for reference Figure 7A syngeneic mouse cancer model was established in which mice carried subcutaneous tumors formed from Lewis lung cancer cells (LLC). The percentage change in body weight loss for each mouse treated with bacteria mp105, mp106, and mp107, respectively, is shown, according to the method described in Example 8. (In 2x10...) 8 The bacterial strains were administered intravenously at a dose of CFU / mouse. Generally, although all mice treated with the bacteria experienced some degree of weight loss after intravenous injection, mice treated with mp105 experienced significantly less weight loss than those treated with mp106 or mp107. In particular, the difference in weight loss on days 4 and 8 between mp105-treated and mp106-treated mice was statistically significant (independent t-test, P < 0.05). These results further suggest that the example short-lived bacterium mp105, due to at least the absence of the hlyCABD operon, possesses better anticancer efficacy compared to mp106 or mp107 and is safer for in vivo administration in subjects.

[0354] Example 15

[0355] Results of in vivo evaluation of tumor therapy mediated by short-lived bacteria

[0356] Now for reference Figure 8 The anticancer efficacy of mp105, mp106, and mp107 was compared according to the method described in Example 8. In vivo data showed that tumor volume growth was significantly slower with mp106 than with mp107, especially on day 21 post-treatment, indicating a modest improvement in anticancer efficacy compared to mp107. These results suggest that pExlA2 confers even better anticancer capabilities on bacteria than pExlA. Surprisingly, mp105 was significantly superior to both mp106 (p = 0.04) and mp107 (p = 0.031) in inhibiting tumor growth. At the end of the experiment, 37.5% of the tumors in mice treated with mp105 were cured. The cure rates in the mp106-treated group and the mp107-treated group were 12.5% ​​and 11.1%, respectively, lower than the cure rate in mice treated with mp105. These results collectively demonstrate that, compared to mp106 and mp107, the example short-lived bacterium mp105 is not only safer but also even more effective against cancer.

[0357] Example 16

[0358] Results of in vivo evaluation of the anticancer efficacy mediated by short-lived bacteria administered via different routes.

[0359] Now for reference Figure 9Different routes of administration of mp105 were compared according to the method described in Example 8. The combination of intratumoral and intravenous injection of mp105 in cancer therapy was compared with intravenous injection alone. The doses for intratumoral and intravenous injection were 7.5 x 10⁻⁶. 7 CFU / mouse and 3x10 7 CFU / mouse. Figure 9 The results showed that, compared with mice receiving intravenous (iv) injection of mp105 alone, mice carrying subcutaneous LLC tumors and receiving a combination of intravenous and intratumoral injections of mp105 (iv+it) exhibited a surprising reduction in tumor volume on day 12 post-treatment. These results indicate that the combination of the two administration routes (i.e., intravenous and intratumoral injection) significantly improved the anticancer efficacy of the exemplary short-lived bacterium mp105 compared with intravenous injection alone. This suggests that, for clinical application, the exemplary short-lived bacterium mp105 can be directly injected into the primary cancer lesion while simultaneously administered intravenously to control metastatic lesions.

[0360] Example 17

[0361] Results of the evaluation of short-lived bacteria as therapeutic and preventative vaccines

[0362] Now for reference Figure 10A and Figure 10B The ability of the short-lived bacterium mp105 to be used as a vaccine against microbial infections was evaluated. mp105 is a short-lived bacterium genetically engineered from Escherichia coli type B2 with multiple virulence factors and antigens, which has shown high immunogenicity in previous examples. This, along with heterologous expression of exlA and further attenuation due to the deletion of hlyCABD, makes mp105 a safe live vaccine for use in subjects. Figure 10A and Figure 10B The results showed that two subcutaneous injections of mp105 significantly reduced Salmonella typhimurium in the key organs tested, including the liver and lungs. Compared with PBS, mp105 reduced the number of Salmonella typhimurium in the liver by 73.6% ( Figure 10A ), and the amount in the lungs decreased by 64.6% ( Figure 10BThis indicates that the example short-lived bacterium mp105 functions as an effective therapeutic vaccine against existing bacterial infections. Furthermore, CFT073 was detected in the liver (100 CFU / 10 mg liver tissue) of one PBS-treated mouse, in the heart (3 CFU / 10 mg heart tissue) of one PBS-treated mouse, and in the lung (15 CFU / 10 mg liver tissue) of one PBS-treated mouse. In other words, 50% of the PBS-treated mice were infected with CFT073. Conversely, CFT073 was not detected in any mice in the mp105-treated group (chi-square test, P = 0.046). This suggests that the example short-lived bacterium mp105 may also function as a preventative vaccine against potential bacterial infections.

[0363] Exemplary embodiments of this disclosure have thus been fully described. Although the description refers to specific embodiments, those skilled in the art will appreciate that the invention can be practiced with variations in these specific details. Therefore, this disclosure should not be construed as limiting itself to the embodiments set forth herein.

[0364] For example, it is evident that medical effectors that can be used to treat a disease or symptom in a subject can be intrinsic effectors of the selected bacterial strain. These medical effectors may be overexpressed or repressed depending on the specific design of the gene modification. Heterologous expression of medical effectors derived from other strains or sources can also be used.

[0365] For example, the essential gene aspartate semialdehyde dehydrogenase (asd) can be deleted from the chromosome as described above, but other essential genes or auxotrophic genes can also be deleted or mutated to produce short-lived bacteria. These essential genes can be, but are not limited to, asd, csrA, thyA, dapA, dapB, ribF, ispH, folA, ftsL, murE, mraY, lpxC, secA, can, heml, map, rpsB, and tsf. Appropriate primer sequences can be designed based on the relevant genes involved.

[0366] For example, gene deletions from chromosomes, as described above, are accomplished using the Lambda (λ)-Red recombination system, but other gene modification techniques known in the art, such as restriction endonuclease cloning, can also be used.

[0367] For example, while the bacterial strain used above is *Escherichia coli*, other bacterial strains, including both Gram-positive and Gram-negative bacteria, may also be used. Examples include, but are not limited to, *Bacillus*, *Escherichia*, *Salmonella*, *Shigella*, and *Listeria*. Other bacteria, such as *Bacteroides*, *Bifidobacterium*, *Clostridium*, *Lactobacillus*, and *Lactococcus*, may also be used.

[0368] For example, the gene modification described above is gene deletion, but other gene modifications such as gene mutation can also be used. Two or more gene modifications can be introduced to produce short-lived bacteria.

[0369] For example, the regulatory effector mentioned above is DAP. However, depending on the relevant gene modifications employed, other regulatory effectors may be used. In some embodiments, the regulatory effector is non-toxic and can be safely used in subjects.

[0370] For example, an example embodiment of the expression of the cytotoxin ExlA is described above, but other constructs of short-lived bacteria that heterologously express other proteins or cytotoxins with therapeutic effects may also be used. Other proteins may be anticancer effectors or combinations thereof that can be used in cancer therapy. Example anticancer effectors may be the expression of one or more genes selected from, but not limited to, the group consisting of: exolysin A (ExlA) from Pseudomonas aeruginosa, non-hemolytic enterotoxin (Nhe) from Bacillus cereus, hemolysin, and vacuole toxin from Helicobacter pylori.

[0371] For example, the example of heterologous expression of ExlA from Pseudomonas aeruginosa in Escherichia coli is described above, but expression of one or more homologous or heterologous genes of other medical effectors may also be used.

[0372] For example, the constitutive promoter oxb18 is as described above, but the expression of medical effectors can be driven by other constitutive or inducible promoters. Example inducible promoters can be induced based on tumor-specific microenvironments such as hypoxia or hypoglycemia.

[0373] For example, other appropriate leader and terminator sequences or other sequences or motifs can be introduced into medical effector gene sequences to improve protein expression in bacteria.

[0374] For example, the gene exlA, as described above, is expressed in plasmid pBAD, but other suitable plasmids can also be used, and the gene can be incorporated into the chromosome instead of being expressed in a plasmid. Medical effector genes can be expressed in plasmids, but if said genes are inserted into a bacterial chromosome, they can also be expressed on chromosomes.

[0375] For example, short-lived bacteria such as SH3, SH4, mp107, mp105, and mp106 in the above example embodiments can be used to treat diseases or conditions in subjects. However, short-lived bacteria can also be used as vaccines for the prevention of cancer or infectious diseases, or for diagnosis.

[0376] For example, the gene expression of short-lived bacteria used to treat cancer can be other medical effectors or anticancer factors such as CpG, cyclic dinucleotides, antigens, or other cytotoxins such as non-hemolytic enterotoxin (Nhe) of Bacillus cereus, hemolysin, and vacuole toxin of Helicobacter pylori, or combinations of these anticancer factors. sequence list <110> New Portal Limited <120> Genetically engineered live bacteria and their construction methods <130> N026.004.PCTCN <150> PCT / CN2020 / 100695 <151> 2020-07-07 <160> 42 <170> PatentIn version 3.5 <210> 1 <211> 64 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <220> <221> Unclassified features <222> (1)..(64) <223> Asd-F primers <400> 1 tcacttgcga ctttggctgc tttttgtatg gtgaaagatg tgccaaatag gcgtatcacg 60 aggc 64 <210> 2 <211> 66 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <220> <221> Unclassified features <222> (1)..(66) <223> Asd-R primers <400> 2 gcactagcag gggcggcatc gcgccccaga tttaatgaat aaagatagtg aacctcttcg 60 agggac 66 <210> 3 <211> 20 <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(20) <223> asd-F2 <400> 3 taggtttccg agcggatcca 20 <210> 4 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <220> <221> Unclassified features <222> (1)..(21) <223> Cm-R3 (reverse) <400> 4 cctcttacgt gccgatcaac g 21 <210> 5 <211> 20 <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <223> hly operator-F <400> 5 actcagcagg acaaagcacg 20 <210> 6 <211> 20 <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(20) <223> hly operator-R <400> 6 gaggccaatg agtttctctg 20 <210> 7 <211> 20 <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(20) <223> vat-F <400> 7 gaactagccc gaagggtatg 20 <210> 8 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(23) <223> vat-R <400> 8 tggagatcag atgaactgtg ttc 23 <210> 9 <211> 20 <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(20) <223> pks-left-F <400> 9 aatcaaccca gctgcaaatc 20 <210> 10 <211> 20 <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(20) <223> pks-left-R <400> 10 cacccccatc attaaaaacg 20 <210> 11 <211> 20 <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(20) <223> pks-right-F <400> 11 agccgtatcc tgctcaaaac 20 <210> 12 <211> 20 <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(20) <223> pks-right-R <400> 12 tcggtatgtc cggttaaagc 20 <210> 13 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(22) <223> papG-F <400> 13 gcgctaataa tcattatgcg gc 22 <210> 14 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(21) <223> papG-R <400> 14 caatatcatg agcagcgttg c 21 <210> 15 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(22) <223> sat-F <400> 15 ggataaggac tttaatccgc tg 22 <210> 16 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(21) <223> sat-R <400> 16 ttgatcgcgt tatccacgtt g 21 <210> 17 <211> 20 <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(20) <223> fyrA-F <400> 17 tgacacggct ttatcctctg 20 <210> 18 <211> 19 <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(19) <223> fyrA-R <400> 18 gttgttggct gatgccgag 19 <210> 19 <211> 20 <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(20) <223> iutA-F <400> 19 aagctggaag gcgtgaaagt 20 <210> 20 <211> 20 <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(20) <223> iutA-R <400> 20 taacccgggc tgtagtacag 20 <210> twenty one <211> twenty two <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(22) <223> yfcV-F <400> twenty one gagtaagttt gccaaaacag cc 22 <210> twenty two <211> twenty one <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(21) <223> yfcV-R <400> twenty two ctggaaatct ttcggtgtgg t 21 <210> twenty three <211> 20 <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(20) <223> chuA-F <400> twenty three gacgaaccaa cggtcaggat 20 <210> twenty four <211> 20 <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(20) <223> chuA-R <400> twenty four tgccgccagt accaaagaca 20 <210> 25 <211> 20 <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(20) <223> yjaA-F <400> 25 tgaagtgtca ggagacgctg 20 <210> 26 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(21) <223> yjaA-R <400> 26 atggagaatg cgttcctcaa c 21 <210> 27 <211> 20 <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(20) <223> TspE4C2-F <400> 27 gagtaatgtc ggggcattca 20 <210> 28 <211> 20 <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(20) <223> TspE4C2-R <400> 28 cgcgccaaca aagtattacg 20 <210> 29 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(23) <223> sfa-F <400> 29 ccctcgtgga gcctttttta tat 23 <210> 30 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(21) <223> sfa-R <400> 30 cactgttaac ctcttctggt c 21 <210> 31 <211> 20 <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(20) <223> iutA-F <400> 31 aagctggaag gcgtgaaagt 20 <210> 32 <211> 20 <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(20) <223> iutA-R <400> 32 taacccgggc tgtagtacag 20 <210> 33 <211> 20 <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(20) <223> oxb-F <400> 33 ctgttgtgac cgcttgctct 20 <210> 34 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> . <220> <221> Unclassified features <222> (1)..(21) <223> exlA-R <400> 34 gaggtggaag acaggattgt c 21 <210> 35 <211> 5567 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <220> <221> Unclassified features <222> (1)..(286) <223> OXB18 promoter and ribosome binding site <220> <221> Unclassified features <222> (287) (352) <223> The start codon is ATG, followed by the pelB leader sequence. <220> <221> Unclassified features <222> (353)..(5387) <223> The exlA gene of PA7 in Pseudomonas aeruginosa that does not have a start codon <220> <221> Unclassified features <222> (5388)..(5545) <223> rrnB transcription termination region <400> 35 atctaagctg ttgtgaccgc ttgctctagc cagctatcga gttgtgaacc gatccatcta 60 gcaattggtc tcgatctagc gataggcttc gatctagcta tgtagaaacg ccgtgtgctc 120 gatcgcttta taaggtccac agtagctgct ataattgctt caacagaaca tattgactat 180 ccggtattac ccggcagatc tttgtcgatc ctaccatcca ctcgacacac ccgccagcgg 240 ccgctgccaa gcttccgagc tctcgaattc aaaggaggta cccaccatga aatacctgct 300 gccgaccgct gctgctggtc tgctgctcct cgctgcccag ccggcgatgg cccatagaga 360 caatcctgtc ttccacctct ccccccgggg aaaactccgt tgcctgatcg ccggcctgct 420 gctggcgccc cacctgcccc aggctttcgc cggcgggctg gaggcggccg gcgggccggg 480 cggcacgccg caactgctca accagggcgg cgtgcccatc gtcaatatcg tcgcgccgaa 540 cgccgccggc ctgtcgcaca accagttcct cgactacaac gtcgaccgcc agggcctggt 600 cctcaacaat gcgctgcaag ccggcgcctc gcagctcgcc ggacaactgg cggccaaccc 660 gcagctgcgc ggcgacgccg ccagtgccat cctcaacgaa gtgatcagcc gcaacgcctc 720 ggcgatcaac ggcccgcagg aaatcttcgg ccaggccgcc gactacatcc tggccaaccc 780 caacggcatc tcggtgaacg gcggcagctt catcaacacg ccccatgcca gcctgctggt 840 cggccgtccg gaactggccg acggcaagct gcaggcgctg aacaccaacg acgccgtcgg 900 cgccctgcag atccagggcc agggcctgag caaccgggat ggcagcatcg ccctgctggc 960 gccgcgagtc gacagccaag gcaagatcga ggcgtcggcc gagctcgacc tgaccgtcgg 1020 tcgcaaccgc atcgactacc cgagcggcaa ggtcgagcgc gacccgtccg gcgacgtccg 1080 tccgggcgag cggcgcatcg acgccagcct gttcggcgcc atgcaggccg gacgcatcaa 1140 catcctcagc accgccgagg gcgccggcgt gcgcgtcggc ccggtcggga tcgacggcag 1200 ggacggcgtc gacctgcgct ccgccggcga cctgtcgatc agcggccagg cgcttcccga 1260 caacagcctg aacgccttgc gcgcggcgat ccgcagcgac agcggcaacg tcggcctgca 1320 tgcccgcggc gacctgagcc tggccgccgc cgacgtcagc ggcggcaggg tcgacctcaa 1380 gtccgggcgc aacctgaccc tgggcagcgt ggaaagccgc aacctgcggg aaagccgcga 1440 gcgctggagc aacagcacca tcggcatcac ctgggaaacc tacgaccgca cgcgtaccgt 1500 caccgattcg aagcagcacg gcagccggat cgatgcccgc gccgacgcga gcctggccgc 1560 gcggggcgac agcgaactga gggcggcgac ggtcaaggcc ggcgctaccc tgaaagtctc 1620 cagcggcggc gatacccgtc ttctcgccgc caccgagacc cgcaccgaac gcgaccaggg 1680 cgcgcaccgc aagcacctgt ggaaagccaa ctgggacaag ggcagcagcg agcaacgcag 1740 cgtggccagc agcctcgaag gcgcgcgggt cgaactcggc ggcggccggc gcctgaatct 1800 ggaaggcgcc gacgtggcca gccgcggcga cctcgacctg caagccaaga gcgtcgacat 1860 cggcagcgcc agccgcagcc acagcagccg cgacaacagc tactccggcg acctggtcgg 1920 cggcagcttc ttcggcagcc acggcgatgg cgacagcggc aagaccctgc aacagggcag 1980 ccgggtcaag gccgacggcg cactgacggt gaccgccgat gcggtcgagg tgcgcggcag 2040 ccaggtacgc ggcgcgcgca aggccgaggt agtcagcggg aaaggctcgc tgcgcatcga 2100 cggcgtggag gaaaccgccc acagcaacag ctacagcaag gacagcaagt tcttcggcat 2160 cgccaaggac gagagtcgcc agcgcagcaa ggacagcagc aaccgcgcca gcgaagtacg 2220 ctcggacagc aacctgaccc tgcgcagcgc cgccgacatc gccattcgcg gctcccgggt 2280 cgaggctggc ggcgccctcg ccgccgaggc caagggcaac ctggagatag cctcggcgca 2340 ggagcgccac gacggcaacg acagccgcca cacccgcggc ttcgacgcct atgccggcga 2400 gcagacccca ggcagccgcc aataccgcgc cggggtgcgc taccaggacc agcggaccag 2460 cgtccgccgc gaggaaaccc gcaacagcgg ctccagcctg ggcggcgcct ccctggccgt 2520 gaaggccggc ggcgatctca ccgtgaaggg ggccgagctg aaggccagcg cgggcgacgc 2580 cagcctctcc gggaagaacg tcgccctgct cgccgagcag gacagcaaga cccgcagcag 2640 cgaacagacc accaccggcg gcggcttcta ctataccggc ggcctggacc gtgccggcag 2700 cggtatcgaa gtcggccacc agcggatcga cgagaacgac gccgaaagcc atgcgcgcac 2760 cagccaggtg aacgcgacgg gcaatctcag gatcgacgcc gcccagggca gcctgacgac 2820 gcagggcgcg cgcctggagg ccggcgacag cctggcggtc gccgccggca cggtcgacaa 2880 ccaggccgcc cgcgacagcc agagcagcca gcgccacgac agcggctgga gcggcgacat 2940 cggcgccaac ctcgagtacc gcggcatcgc ccggccgatc gagaaggcgg tcgaaggcgt 3000 cgcccagcgc aaggtccacc agcccggcct gctcgacaac ctggagcagc cgaacgtcgg 3060 cgtcgacctc gagatcagcc accgcgacag ccgcggcgag caacaggcga gccaggcgca 3120 ggtcagcagc ttcgcgggcg gccaggtcga actgaaggtc ggcgacgccc tgcgggacga 3180 gggcacccgt taccaggctc gcagcggagg cctcctcatc gacgccgcca ggcatgacgc 3240 cagggcggcg gagaacacct ccggcagcca tgagcagagc ctcgacgcca aggtcggcgg 3300 gcgcctctac accaccaccg gccaggacct gaacctgcgc ctgagcggca ttggcggcag 3360 cagcgagaac agcgccagcc agaccaccgc ggtggtcggc gaatacgccg cgaagcaggg 3420 cgtcgagatc cgcctcggcg gagacggcct ctaccagggc agccgcttcg acggcggcga 3480 agccggggtc aggctcagcg ccggcggcaa cctggccctg gaacaggcca acgaccggca 3540 gagcgccagc agcgccagcc tgcgtggcga cgccgcgttg agcggcggca tggcccccag 3600 cgccaacggc aaagggctga acgccagcgc cggcctgcaa ctcgaccaca aggccggcga 3660 cagccgggac agccaggcgc gggtcgccga catccaggcc aagggcgcgg tggagctgcg 3720 cagcggcggc gatctggtcc tgcaaggcag caatatcggc agcgcggcag cgaagaccgg 3780 cgacatagtc ctggccgccg gcggcaagct cgacctgcag gccgcccgcg atagccaccg 3840 ggccggggga aacaacctcg gcggcggctt cagcctaggc ggcggcagcg ttcgcgacgc 3900 cgaaacgagc agcaagaacg gcagcgtcag cggcaacttc aacatcggcc gggtcgacga 3960 ggaacgtcac gcgctgaacg gcggcaacct gcacagcgcg accaaggcca gcctttccag 4020 cgccgcagac gacgccaccg cggtacgcct gcaaggcact cgcatcgaag ccgcccaggt 4080 cagcctcgaa gccggcaacg gcggcattct ccaggagtcc gccgaatcca gcgagcggcg 4140 cgacaactgg ggcgtgctgc tcggtgccgg ggccaacggc ggcaagacca ccggcgcgcc 4200 gagcgactac cggagcgact atgccgtcca ggcccgcgcc aaggtcgatg tcgatgtcct 4260 gcgcagccag acccagggcg acagcgtcat ccaggccgac cgggtaatcc tggcgagcca 4320 gggcgacacc cgcctggagg gcgcgcgcat cgacgcggca caggtggacg ggcgcatcgg 4380 cggcgacctg cgggtggaga gccgccagga ccgcgcggag ggcgtgaagg tcaacgtcga 4440 cgcgcgcctg ggcgtggaga agaaccagcc cggcctggtg aacaagctgg cgagcaagac 4500 cggaccgttg aaggacaagc tggaaaccaa ggccgagaat gctttcgaca agcaccgcgg 4560 caagttggag aacggcatcg accgtaatgt cgagcggctc ggcaaggccg gggacaacct 4620 cctcgccaaa gccgaaaagg ccaaggagcg cctgggcgag aagctggtcc gcagcggcag 4680 ctacgaggtc aacccggagc cgcgcggcgc cttcgccagc aagctggaca gggccagggg 4740 ctatctggcg gagaaaggcg aagcgctcgg cgaccggctg tccggcctca agcagcgcct 4800 gtcgccgaac aagaccggta gctatgtggt gaacgacaag cagacggccg gcgccaaggt 4860 cggcaatgcc gccgagaacg tgctgttcgg cgacaagagc ggcgaagcct cggtaacccc 4920 gacgctgtac ctggacgtca gccacgtcag ccgcaactac gtcaccgagg cctccggcat 4980 caccggcagg cagggcgtga acctgcaggt gggcgcagcg acccagctga ccggcgcacg 5040 gatcagcgcc agcgacggca aggtcgacct cggcggctcg cgcgtggaaa cccgcgccct 5100 ggccggcaag gactaccgcg ccgatctcgg cctgaacgtc tccaggtcgc cggtggacct 5160 ggccttcggt atcaaggacg agttcagcca ggagcacgac caggcgaccc gcgacgacca 5220 ggccttcaac ctcggcgccc tgcgcgtcgg cggacgcaac cgcgaccagc agttgcaggc 5280 cggcatcgag cagaaggccg actaatgagt ttaaacggtc tccagcttag gtaacagcct 5340 gatacagatt aaatcagaac gcagaagcgg tctgataaaa cagaatttgc ctggcggcag 5400 tagcgcggtg gtcccacctg accccatgcc gaactcagaa gtgaaacgcc gtagcgccga 5460 tggtagtgtg gggtctcccc atgcgagagt agggaactgc caggcatcaa ataaaacgaa 5520 aggctcagtc gaaagactgg gcctttcgtt ttatctgttg tttgtcg 5567 <210> 36 <211> 64 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <220> <221> Unclassified features <222> (1)..(64) <223> M-hly-F <400> 36 ttggtttgct tttttttacc tgccaccgca atgaatgctt tttttaatag gcgtatcacg 60 aggc 64 <210> 37 <211> 66 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <220> <221> Unclassified features <222> (1)..(66) <223> M-hly-R <400> 37 ttaacgctca tgtaaacttt ctgttacaga ctcttccaga ggacttagtg aacctcttcg 60 agggac 66 <210> 38 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <220> <221> Unclassified features <222> (1)..(20) <223> 27F <400> 38 agagtttgat cctggctcag 20 <210> 39 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <220> <221> Unclassified features <222> (1)..(21) <223> 1492R <400> 39 tacggctacc ttgtacgact t 21 <210> 40 <211> 6305 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <220> <221> Unclassified features <222> (1)..(286) <223> OXB18 promoter and ribosome binding site <220> <221> Unclassified features <222> (287) (352) <223> The start codon is ATG, followed by the pelB leader sequence. <220> <221> Unclassified features <222> (353)..(5355) <223> The exlA gene of PA7 in Pseudomonas aeruginosa that does not have a start codon <220> <221> Unclassified features <222> (5356)...(5421) <223> The start codon is ATG, followed by the pelB leader sequence. <220> <221> Unclassified features <222> (5422)..(6125) <223> A partial DNA fragment of the hemolysin III coding gene that does not have a start codon <220> <221> Unclassified features <222> (6126)...(6305) <223> rrnB transcription termination region <400> 40 atctaagctg ttgtgaccgc ttgctctagc cagctatcga gttgtgaacc gatccatcta 60 gcaattggtc tcgatctagc gataggcttc gatctagcta tgtagaaacg ccgtgtgctc 120 gatcgcttta taaggtccac agtagctgct ataattgctt caacagaaca tattgactat 180 ccggtattac ccggcagatc tttgtcgatc ctaccatcca ctcgacacac ccgccagcgg 240 ccgctgccaa gcttccgagc tctcgaattc aaaggaggta cccaccatga aatacctgct 300 gccgaccgct gctgctggtc tgctgctcct cgctgcccag ccggcgatgg cccatagaga 360 caatcctgtc ttccacctct ccccccgggg aaaactccgt tgcctgatcg ccggcctgct 420 gctggcgccc cacctgcccc aggctttcgc cggcgggctg gaggcggccg gcgggccggg 480 cggcacgccg caactgctca accagggcgg cgtgcccatc gtcaatatcg tcgcgccgaa 540 cgccgccggc ctgtcgcaca accagttcct cgactacaac gtcgaccgcc agggcctggt 600 cctcaacaat gcgctgcaag ccggcgcctc gcagctcgcc ggacaactgg cggccaaccc 660 gcagctgcgc ggcgacgccg ccagtgccat cctcaacgaa gtgatcagcc gcaacgcctc 720 ggcgatcaac ggcccgcagg aaatcttcgg ccaggccgcc gactacatcc tggccaaccc 780 caacggcatc tcggtgaacg gcggcagctt catcaacacg ccccatgcca gcctgctggt 840 cggccgtccg gaactggccg acggcaagct gcaggcgctg aacaccaacg acgccgtcgg 900 cgccctgcag atccagggcc agggcctgag caaccgggat ggcagcatcg ccctgctggc 960 gccgcgagtc gacagccaag gcaagatcga ggcgtcggcc gagctcgacc tgaccgtcgg 1020 tcgcaaccgc atcgactacc cgagcggcaa ggtcgagcgc gacccgtccg gcgacgtccg 1080 tccgggcgag cggcgcatcg acgccagcct gttcggcgcc atgcaggccg gacgcatcaa 1140 catcctcagc accgccgagg gcgccggcgt gcgcgtcggc ccggtcggga tcgacggcag 1200 ggacggcgtc gacctgcgct ccgccggcga cctgtcgatc agcggccagg cgcttcccga 1260 caacagcctg aacgccttgc gcgcggcgat ccgcagcgac agcggcaacg tcggcctgca 1320 tgcccgcggc gacctgagcc tggccgccgc cgacgtcagc ggcggcaggg tcgacctcaa 1380 gtccgggcgc aacctgaccc tgggcagcgt ggaaagccgc aacctgcggg aaagccgcga 1440 gcgctggagc aacagcacca tcggcatcac ctgggaaacc tacgaccgca cgcgtaccgt 1500 caccgattcg aagcagcacg gcagccggat cgatgcccgc gccgacgcga gcctggccgc 1560 gcggggcgac agcgaactga gggcggcgac ggtcaaggcc ggcgctaccc tgaaagtctc 1620 cagcggcggc gatacccgtc ttctcgccgc caccgagacc cgcaccgaac gcgaccaggg 1680 cgcgcaccgc aagcacctgt ggaaagccaa ctgggacaag ggcagcagcg agcaacgcag 1740 cgtggccagc agcctcgaag gcgcgcgggt cgaactcggc ggcggccggc gcctgaatct 1800 ggaaggcgcc gacgtggcca gccgcggcga cctcgacctg caagccaaga gcgtcgacat 1860 cggcagcgcc agccgcagcc acagcagccg cgacaacagc tactccggcg acctggtcgg 1920 cggcagcttc ttcggcagcc acggcgatgg cgacagcggc aagaccctgc aacagggcag 1980 ccgggtcaag gccgacggcg cactgacggt gaccgccgat gcggtcgagg tgcgcggcag 2040 ccaggtacgc ggcgcgcgca aggccgaggt agtcagcggg aaaggctcgc tgcgcatcga 2100 cggcgtggag gaaaccgccc acagcaacag ctacagcaag gacagcaagt tcttcggcat 2160 cgccaaggac gagagtcgcc agcgcagcaa ggacagcagc aaccgcgcca gcgaagtacg 2220 ctcggacagc aacctgaccc tgcgcagcgc cgccgacatc gccattcgcg gctcccgggt 2280 cgaggctggc ggcgccctcg ccgccgaggc caagggcaac ctggagatag cctcggcgca 2340 ggagcgccac gacggcaacg acagccgcca cacccgcggc ttcgacgcct atgccggcga 2400 gcagacccca ggcagccgcc aataccgcgc cggggtgcgc taccaggacc agcggaccag 2460 cgtccgccgc gaggaaaccc gcaacagcgg ctccagcctg ggcggcgcct ccctggccgt 2520 gaaggccggc ggcgatctca ccgtgaaggg ggccgagctg aaggccagcg cgggcgacgc 2580 cagcctctcc gggaagaacg tcgccctgct cgccgagcag gacagcaaga cccgcagcag 2640 cgaacagacc accaccggcg gcggcttcta ctataccggc ggcctggacc gtgccggcag 2700 cggtatcgaa gtcggccacc agcggatcga cgagaacgac gccgaaagcc atgcgcgcac 2760 cagccaggtg aacgcgacgg gcaatctcag gatcgacgcc gcccagggca gcctgacgac 2820 gcagggcgcg cgcctggagg ccggcgacag cctggcggtc gccgccggca cggtcgacaa 2880 ccaggccgcc cgcgacagcc agagcagcca gcgccacgac agcggctgga gcggcgacat 2940 cggcgccaac ctcgagtacc gcggcatcgc ccggccgatc gagaaggcgg tcgaaggcgt 3000 cgcccagcgc aaggtccacc agcccggcct gctcgacaac ctggagcagc cgaacgtcgg 3060 cgtcgacctc gagatcagcc accgcgacag ccgcggcgag caacaggcga gccaggcgca 3120 ggtcagcagc ttcgcgggcg gccaggtcga actgaaggtc ggcgacgccc tgcgggacga 3180 gggcacccgt taccaggctc gcagcggagg cctcctcatc gacgccgcca ggcatgacgc 3240 cagggcggcg gagaacacct ccggcagcca tgagcagagc ctcgacgcca aggtcggcgg 3300 gcgcctctac accaccaccg gccaggacct gaacctgcgc ctgagcggca ttggcggcag 3360 cagcgagaac agcgccagcc agaccaccgc ggtggtcggc gaatacgccg cgaagcaggg 3420 cgtcgagatc cgcctcggcg gagacggcct ctaccagggc agccgcttcg acggcggcga 3480 agccggggtc aggctcagcg ccggcggcaa cctggccctg gaacaggcca acgaccggca 3540 gagcgccagc agcgccagcc tgcgtggcga cgccgcgttg agcggcggca tggcccccag 3600 cgccaacggc aaagggctga acgccagcgc cggcctgcaa ctcgaccaca aggccggcga 3660 cagccgggac agccaggcgc gggtcgccga catccaggcc aagggcgcgg tggagctgcg 3720 cagcggcggc gatctggtcc tgcaaggcag caatatcggc agcgcggcag cgaagaccgg 3780 cgacatagtc ctggccgccg gcggcaagct cgacctgcag gccgcccgcg atagccaccg 3840 ggccggggga aacaacctcg gcggcggctt cagcctaggc ggcggcagcg ttcgcgacgc 3900 cgaaacgagc agcaagaacg gcagcgtcag cggcaacttc aacatcggcc gggtcgacga 3960 ggaacgtcac gcgctgaacg gcggcaacct gcacagcgcg accaaggcca gcctttccag 4020 cgccgcagac gacgccaccg cggtacgcct gcaaggcact cgcatcgaag ccgcccaggt 4080 cagcctcgaa gccggcaacg gcggcattct ccaggagtcc gccgaatcca gcgagcggcg 4140 cgacaactgg ggcgtgctgc tcggtgccgg ggccaacggc ggcaagacca ccggcgcgcc 4200 gagcgactac cggagcgact atgccgtcca ggcccgcgcc aaggtcgatg tcgatgtcct 4260 gcgcagccag acccagggcg acagcgtcat ccaggccgac cgggtaatcc tggcgagcca 4320 gggcgacacc cgcctggagg gcgcgcgcat cgacgcggca caggtggacg ggcgcatcgg 4380 cggcgacctg cgggtggaga gccgccagga ccgcgcggag ggcgtgaagg tcaacgtcga 4440 cgcgcgcctg ggcgtggaga agaaccagcc cggcctggtg aacaagctgg cgagcaagac 4500 cggaccgttg aaggacaagc tggaaaccaa ggccgagaat gctttcgaca agcaccgcgg 4560 caagttggag aacggcatcg accgtaatgt cgagcggctc ggcaaggccg gggacaacct 4620 cctcgccaaa gccgaaaagg ccaaggagcg cctgggcgag aagctggtcc gcagcggcag 4680 ctacgaggtc aacccggagc cgcgcggcgc cttcgccagc aagctggaca gggccagggg 4740 ctatctggcg gagaaaggcg aagcgctcgg cgaccggctg tccggcctca agcagcgcct 4800 gtcgccgaac aagaccggta gctatgtggt gaacgacaag cagacggccg gcgccaaggt 4860 cggcaatgcc gccgagaacg tgctgttcgg cgacaagagc ggcgaagcct cggtaacccc 4920 gacgctgtac ctggacgtca gccacgtcag ccgcaactac gtcaccgagg cctccggcat 4980 caccggcagg cagggcgtga acctgcaggt gggcgcagcg acccagctga ccggcgcacg 5040 gatcagcgcc agcgacggca aggtcgacct cggcggctcg cgcgtggaaa cccgcgccct 5100 ggccggcaag gactaccgcg ccgatctcgg cctgaacgtc tccaggtcgc cggtggacct 5160 ggccttcggt atcaaggacg agttcagcca ggagcacgac caggcgaccc gcgacgacca 5220 ggccttcaac ctcggcgccc tgcgcgtcgg cggacgcaac cgcgaccagc agttgcaggc 5280 cggcatcgag cagaaggccg actaatgagt ttaaacggtc tccagcttag atttcagga 5340 gctaaggaag ctaaaatgaa atacctgctg ccgaccgctg ctgctggtct gctgctcctc 5400 gctgcccagc cggcgatggc caatacttat gtaagggaac cagttaatgc atttactcac 5460 ttaggtggag cgatattatc atttattgcg tttagcta tgcttgtgaa agttctatc 5520 aagatgccat catttgctgc aattacagct gttattttgt ttggtattgg aatgatggtc 5580 ctttatacgg cgtcagctgt atatcatagt gttgtggcca atgaacgtgt tatatacttc 5640 tttaggaagc tagatcattc tatgattttt atattaattg caggtacata tgcacccttt 5700 tgcttaatta cattaaattc agcaagtggt ttgctattat tttgtttagt ctatgcaact 5760 gcgatttgtg gcattgtatt taaaatgttt tggtttaatt gtccaaggtg gttatcgaca 5820 gcaatttata ttacgatggg ttggttaatt gttttattct ttgcaccgtt agctgagaat 5880 ttaagtacag gaggcattat tttcttagta cttggtggca ttttttatac aattggtgga 5940 tttatttatg gaacaaagcc aaaatggtta gagtttaaat atatggggca tcatgaaatt 6000 tttcatgttt ttgtattatt aggtagtctt gcgcattttc taagtgtata ttgttacgta 6060 atttaaaggt aacagcctga tacagattaa atcagaacgc agaagcggtc tgataaaaca 6120 gaatttgcct ggcggcagta gcgcggtggt cccacctgac cccatgccga actcagaagt 6180 gaaacgccgt agcgccgatg gtagtgtggg gtctccccat gcgagagtag ggaactgcca 6240 ggcatcaaat aaaacgaaag gctcagtcga aagactgggc ctttcgtttt atctgttgtt 6300 tgtcg 6305 <210> 41 <211> 5019 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <220> <221> Unclassified features <222> (1)..(66) <223> The start codon is ATG, followed by the pelB leader sequence. <220> <221> Unclassified features <222> (67)..(5019) <223> The exlA gene of PA7 in Pseudomonas aeruginosa that does not have a start codon <400> 41 atgaaatacc tgctgccgac cgctgctgct ggtctgctgc tcctcgctgc ccagccggcg 60 atggcccata gagacaatcc tgtcttccac ctctcccccc ggggaaaact ccgttgcctg 120 atcgccggcc tgctgctggc gccccacctg ccccaggctt tcgccggcgg gctggaggcg 180 gccggcgggc cgggcggcac gccgcaactg ctcaaccagg gcggcgtgcc catcgtcaat 240 atcgtcgcgc cgaacgccgc cggcctgtcg cacaaccagt tcctcgacta caacgtcgac 300 cgccagggcc tggtcctcaa caatgcgctg caagccggcg cctcgcagct cgccggacaa 360 ctggcggcca acccgcagct gcgcggcgac gccgccagtg ccatcctcaa cgaagtgatc 420 agccgcaacg cctcggcgat caacggcccg caggaaatct tcggccaggc cgccgactac 480 atcctggcca accccaacgg catctcggtg aacggcggca gcttcatcaa cacgccccat 540 gccagcctgc tggtcggccg tccggaactg gccgacggca agctgcaggc gctgaacacc 600 aacgacgccg tcggcgccct gcagatccag ggccagggcc tgagcaaccg ggatggcagc 660 atcgccctgc tggcgccgcg agtcgacagc caaggcaaga tcgaggcgtc ggccgagctc 720 gacctgaccg tcggtcgcaa ccgcatcgac tacccgagcg gcaaggtcga gcgcgacccg 780 tccggcgacg tccgtccggg cgagcggcgc atcgacgcca gcctgttcgg cgccatgcag 840 gccggacgca tcaacatcct cagcaccgcc gagggcgccg gcgtgcgcgt cggcccggtc 900 gggatcgacg gcagggacgg cgtcgacctg cgctccgccg gcgacctgtc gatcagcggc 960 caggcgcttc ccgacaacag cctgaacgcc ttgcgcgcgg cgatccgcag cgacagcggc 1020 aacgtcggcc tgcatgcccg cggcgacctg agcctggccg ccgccgacgt cagcggcggc 1080 agggtcgacc tcaagtccgg gcgcaacctg accctgggca gcgtggaaag ccgcaacctg 1140 cgggaaagcc gcgagcgctg gagcaacagc accatcggca tcacctggga aacctacgac 1200 cgcacgcgta ccgtcaccga ttcgaagcag cacggcagcc ggatcgatgc ccgcgccgac 1260 gcgagcctgg ccgcgcgggg cgacagcgaa ctgagggcgg cgacggtcaa ggccggcgct 1320 accctgaaag tctccagcgg cggcgatacc cgtcttctcg ccgccaccga gacccgcacc 1380 gaacgcgacc agggcgcgca ccgcaagcac ctgtggaaag ccaactggga caagggcagc 1440 agcgagcaac gcagcgtggc cagcagcctc gaaggcgcgc gggtcgaact cggcggcggc 1500 cggcgcctga atctggaagg cgccgacgtg gccagccgcg gcgacctcga cctgcaagcc 1560 aagagcgtcg acatcggcag cgccagccgc agccacagca gccgcgacaa cagctactcc 1620 ggcgacctgg tcggcggcag cttcttcggc agccacggcg atggcgacag cggcaagacc 1680 ctgcaacagg gcagccgggt caaggccgac ggcgcactga cggtgaccgc cgatgcggtc 1740 gaggtgcgcg gcagccaggt acgcggcgcg cgcaaggccg aggtagtcag cgggaaaggc 1800 1860 1920 gccagcgaag tacgctcgga cagcaacctg accctgcgca gcgccgccga catcgccatt 1980 cgcggctccc gggtcgaggc tggcggcgcc ctcgccgccg aggccaaggg caacctggag 2040 atagcctcgg cgcaggagcg ccacgacggc aacgacagcc gccacacccg cggcttcgac 2100 gcctatgccg gcgagcagac cccaggcagc cgccaatacc gcgccggggt gcgctaccag 2160 gaccagcgga ccagcgtccg ccgcgaggaa acccgcaaca gcggctccag cctgggcggc 2220 gcctccctgg ccgtgaaggc cggcggcgat ctcaccgtga aggggccga gctgaaggcc 2280 agcgcgggcg acgccagcct ctccgggaag aacgtcgccc tgctcgccga gcaggacagc 2340 aagacccgca gcagcgaaca gaccaccacc ggcggcggct tctactatac cggcggcctg 2400 gaccgtgccg gcagcggtat cgaagtcggc caccagcgga tcgacgagaa cgacgccgaa 2460 agccatgcgc gcaccagcca ggtgaacgcg acgggcaatc tcaggatcga cgccgcccag 2520 ggcagcctga cgacgcaggg cgcgcgcctg gaggccggcg acagcctggc ggtcgccgcc 2580 ggcacggtcg acaaccaggc cgcccgcgac agccagagca gccagcgcca cgacagcggc 2640 tggagcggcg acatcggcgc caacctcgag taccgcggca tcgcccggcc gatcgagaag 2700 gcggtcgaag gcgtcgccca gcgcaaggtc caccagcccg gcctgctcga caacctggag 2760 cagccgaacg tcggcgtcga cctcgagatc agccaccgcg acagccgcgg cgagcaacag 2820 gcgagccagg cgcaggtcag cagcttcgcg ggcggccagg tcgaactgaa ggtcggcgac 2880 gccctgcggg acgagggcac ccgttaccag gctcgcagcg gaggcctcct catcgacgcc 2940 gccaggcatg acgccagggc ggcggagaac acctccggca gccatgagca gagcctcgac 3000 gccaaggtcg gcgggcgcct ctacaccacc accggccagg acctgaacct gcgcctgagc 3060 ggcattggcg gcagcagcga gaacagcgcc agccagacca ccgcggtggt cggcgaatac 3120 gccgcgaagc agggcgtcga gatccgcctc ggcggagacg gcctctacca gggcagccgc 3180 ttcgacggcg gcgaagccgg ggtcaggctc agcgccggcg gcaacctggc cctggaacag 3240 gccaacgacc ggcagagcgc cagcagcgcc agcctgcgtg gcgacgccgc gttgagcggc 3300 ggcatggccc ccagcgccaa cggcaaaggg ctgaacgcca gcgccggcct gcaactcgac 3360 cacaaggccg gcgacagccg ggacagccag gcgcgggtcg ccgacatcca ggccaagggc 3420 gcggtggagc tgcgcagcgg cggcgatctg gtcctgcaag gcagcaatat cggcagcgcg 3480 gcagcgaaga ccggcgacat agtcctggcc gccggcggca agctcgacct gcaggccgcc 3540 cgcgatagcc accgggccgg gggaaacaac ctcggcggcg gcttcagcct aggcggcggc 3600 agcgttcgcg acgccgaaac gagcagcaag aacggcagcg tcagcggcaa cttcaacatc 3660 ggccgggtcg acgaggaacg tcacgcgctg aacggcggca acctgcacag cgcgaccaag 3720 gccagccttt ccagcgccgc agacgacgcc accgcggtac gcctgcaagg cactcgcatc 3780 gaagccgccc aggtcagcct cgaagccggc aacggcggca ttctccagga gtccgccgaa 3840 tccagcgagc ggcgcgacaa ctggggcgtg ctgctcggtg ccggggccaa cggcggcaag 3900 accaccggcg cgccgagcga ctaccggagc gactatgccg tccaggcccg cgccaaggtc 3960 gatgtcgatg tcctgcgcag ccagacccag ggcgacagcg tcatccaggc cgaccgggta 4020 atcctggcga gccagggcga cacccgcctg gagggcgcgc gcatcgacgc ggcacaggtg 4080 gacgggcgca tcggcggcga cctgcgggtg gagagccgcc aggaccgcgc ggagggcgtg 4140 aaggtcaacg tcgacgcgcg cctgggcgtg gagaagaacc agcccggcct ggtgaacaag 4200 ctggcgagca agaccggacc gttgaaggac aagctggaaa ccaaggccga gaatgctttc 4260 gacaagcacc gcggcaagtt ggagaacggc atcgaccgta atgtcgagcg gctcggcaag 4320 gccggggaca acctcctcgc caaagccgaa aaggccaagg agcgcctggg cgagaagctg 4380 gtccgcagcg gcagctacga ggtcaacccg gagccgcgcg gcgccttcgc cagcaagctg 4440 gacagggcca ggggctatct ggcggagaaa ggcgaagcgc tcggcgaccg gctgtccggc 4500 ctcaagcagc gcctgtcgcc gaacaagacc ggtagctatg tggtgaacga caagcagacg 4560 gccggcgcca aggtcggcaa tgccgccgag aacgtgctgt tcggcgacaa gagcggcgaa 4620 gcctcggtaa ccccgacgct gtacctggac gtcagccacg tcagccgcaa ctacgtcacc 4680 gaggcctccg gcatcaccgg caggcagggc gtgaacctgc aggtgggcgc agcgacccag 4740 ctgaccggcg cacggatcag cgccagcgac ggcaaggtcg acctcggcgg ctcgcgcgtg 4800 gaaacccgcg ccctggccgg caaggactac cgcgccgatc tcggcctgaa cgtctccagg 4860 tcgccggtgg acctggcctt cggtatcaag gacgagttca gccaggagca cgaccaggcg 4920 acccgcgacg accaggcctt caacctcggc gccctgcgcg tcggcggacg caaccgcgac 4980 cagcagttgc aggccggcat cgagcagaag gccgactaa 5019 <210> 42 <211> 711 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <220> <221> Unclassified feature <222> (1)..(66) <223> The start codon is ATG, followed by the pelB leader sequence. <220> <221> Unclassified features <222> (67) (711) <223> A partial DNA fragment of the hemolysin III coding gene that does not have a start codon <400> 42 atgaaatacc tgctgccgac cgctgctgct ggtctgctgc tcctcgctgc ccagccggcg 60 atggccaata cttatgtaag ggaaccagtt aatgcattta ctcacttagg tggagcgata 120 ttatcattta ttgcgttatt agctatgctt gtgaaagttt ctatcaagat gccatcattt 180 gctgcaatta cagctgttat tttgtttggt attggaatga tggtccttta tacggcgtca 240 gctgtatatc atagtgttgt ggccaatgaa cgtgttatat acttctttag gaagctagat 300 cattctatga tttttatatt aattgcaggt acatatgcac ccttttgctt aattacatta 360 aattcagcaa gtggtttgct attattttgt ttagtctatg caactgcgat ttgtggcatt 420 gtatttaaaa tgttttggtt taattgtcca aggtggttat cgacagcaat ttatattacg 480 atgggttggt taattgtttt attctttgca ccgttagctg agaatttaag tacggaggc 540 attattttct tagtacttgg tggcattttt tatacaattg gtggatttat ttatggaaca 600 aagccaaaat ggttagagtt taaatatatg gggcatcatg aaatttttca tgtttttgta 660 ttattaggta gtcttgcgca ttttctaagt gtatattgtt acgtaattta a 711

Claims

1. A genetically engineered live bacterium, comprising At least one effector gene that encodes at least one medical effector; At least one gene modification; and At least one virulence gene modification, The bacteria mentioned therein are derived from a virulent strain of Escherichia coli; The effector genes mentioned above include partial DNA fragments of the exolysin A (ExlA) cytotoxin gene and the hemolysin III encoding gene of Pseudomonas aeruginosa. The genetic modification described herein comprises the deletion of aspartate-semialdehyde dehydrogenase (ASD) from the chromosome of the bacteria, which shortens the lifespan of the bacteria such that, after administration to a subject, the live bacteria survive for a sufficiently long period to allow the medical effector to exert at least one medical effect and die after a period that minimizes the pathogenesis for the subject; and The virulence gene modification described therein involves the deletion of the hlyCABD operon from the chromosome of the bacteria, which weakens the virulence of the bacteria.

2. The bacteria of claim 1, wherein the therapeutic effector is an antigen or a therapeutic factor expressed from a heterologous gene.

3. The bacteria of claim 2, wherein the heterologous gene further comprises a leader sequence and / or a termination region in the bacteria that improves heterologous expression.

4. The bacteria of claim 1, wherein the medical effector causes cancer or tumor suppression in the subject.

5. The bacteria of claim 1, wherein the bacteria is an auxotroph of diaminopimelic acid.

6. The bacteria of claim 1, wherein the bacteria have a survival time that can be controlled by exposing the bacteria to one or more regulatory effectors, the regulatory effectors regulating the survival time of the bacteria when administered in vivo.

7. The bacteria of claim 6, wherein the regulatory effector is diaminopimelic acid.

8. The bacteria of claim 1, wherein the medical effector is a homologous peptide expressed by a gene selected from the group consisting of: chuA, yjaA, tspE4C2, sat, sfa, papG, fyuA, iutA, yfcV, and pks island.

9. The bacteria of claim 1, wherein the medical effector is a cytotoxin selected from the group consisting of: non-hemolytic enterotoxin (Nhe) of Bacillus cereus, hemolysin, and vacuole toxin of Helicobacter pylori, and combinations thereof.

10. The bacteria of claim 1, wherein the therapeutic effector is an anticancer factor selected from the group consisting of CpG, cyclic dinucleotides, and tumor antigens.

11. The bacteria of claim 1, wherein the disease is cancer or tumor.

12. The bacteria of claim 1, wherein the bacteria are derived from strain SH4, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number 22557.

13. The bacteria of claim 1, wherein the bacteria expresses a sequence having at least about 80%, 85%, 90%, 95%, or 100% sequence identity with all or a fragment of SEQ ID NO:

40.

14. The bacteria of claim 1, wherein the bacteria expresses a first sequence having at least about 80%, 85%, 90%, 95% or 100% sequence identity with all or fragments of SEQ ID NO:41 and / or a second sequence having at least about 80%, 85%, 90%, 95% or 100% sequence identity with all or fragments of SEQ ID NO:

42.

15. The bacteria as claimed in claim 13 or 14, wherein the bacteria are derived from strain mp105, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number 22555.

16. An immunogenic composition comprising the bacteria as claimed in claim 1.

17. A live bacterial vaccine comprising the bacteria as described in claim 1 and optionally an adjuvant.

18. Use of the bacterium as described in claim 1 in the preparation of a pharmaceutical composition for treating tumors or cancer.

19. A method for constructing genetically engineered live bacteria, the method comprising the following steps: Genetically engineered bacteria, wherein the bacteria comprise: At least one effector gene that encodes at least one medical effector; At least one gene modification; and At least one virulence gene modification; The bacteria mentioned therein are derived from a virulent strain of Escherichia coli; The effector genes mentioned above include partial DNA fragments of the exolysin A (ExlA) cytotoxin gene and the hemolysin III encoding gene of Pseudomonas aeruginosa; The genetic modification described herein comprises the deletion of aspartate-semialdehyde dehydrogenase (ASD) from the chromosome of the bacteria, which shortens the lifespan of the bacteria such that, after administration to a subject, the live bacteria survive for a sufficiently long period to allow the medical effector to exert at least one medical effect and die after a period that minimizes the pathogenesis for the subject; and The virulence gene modification described therein involves the deletion of the hlyCABD operon from the chromosome of the bacteria, which weakens the virulence of the bacteria.

Images