Application of Kinesin 12 in the preparation of drugs for treating neuroinflammation
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-07-15
- Publication Date
- 2026-08-11
AI Technical Summary
然而,Kif15在神经炎症方面特别是对TNF-α的作用还未曾见报道
[0018] This invention, through consulting the GEO online database, discovered that Kif15 expression shows an increasing trend during the development of neurodegenerative diseases such as Alzheimer's disease. Furthermore, by designing substances that intervene in Kif15 expression to reduce Kif15 expression in microglia, it was verified that knocking down Kif15 can significantly inhibit TNF-α expression in microglia, thus demonstrating that Kif15 can be used to screen or prepare drugs for the treatment of neuroinflammation.
Smart Images

Figure CN115920042B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of Kinesin 12 in the preparation of drugs for the treatment of neuroinflammatory diseases. Background Technology
[0002] Neuroinflammation is an immune response activated by microglia and astrocytes in the central nervous system (brain and spinal cord). Scientific research shows that the secretion of inflammatory factors in neuroinflammation does not only originate from lymphocytes; microglia and astrocytes also secrete inflammatory factors. The factors causing this secretion are relatively complex: CNS damage, brain infection, toxin stimulation, and autoimmune diseases can all lead to abnormal secretion of inflammatory factors. Transient neuroinflammatory signal transduction plays a protective role during development and tissue repair after injury, while chronic neuroinflammation is associated with the progression of neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), and multiple sclerosis.
[0003] Microglia are resident immune cells of the central nervous system, and pathological neuroinflammation associated with neurodegeneration is primarily mediated by microglia. When stimulated by pathological factors, microglia are activated and produce large amounts of pro-inflammatory factors such as tumor necrosis factor-α (TNF-α) and interleukin-1β (IL-1β), exacerbating the inflammatory response. Evidence suggests that multiple cytokines, including interleukins, TNF-α, TGF-β, and IFN-γ, are involved in the pathogenesis of neurodegenerative diseases and may serve as diagnostic or therapeutic targets for neurodegenerative disorders. For example, studies have found elevated levels of pro-inflammatory factors (IL-1β, TNF-α) and anti-inflammatory cytokines (IL-1ra, IL-10) in the cerebrospinal fluid and plasma of Alzheimer's disease patients. Several TNF-α biopharmaceuticals have reduced Aβ deposition, behavioral impairment, and inflammation in animal models of Alzheimer's disease, indicating that TNF-α is a detrimental factor in the Alzheimer's disease process and could serve as a reliable target for the disease. Therefore, developing more drugs targeting TNF-α could be a direction for treating neurodegenerative diseases.
[0004] Kinesin 12, also known as Kinesin family member 15 (Kif15), belongs to the kinesin family. It is a positive-terminal oriented kinesin that functions to form a bipolar spindle and mediates many developmental processes. Evidence suggests that Kif15 plays an important role in various malignant tumors, such as pancreatic cancer, liver cancer, lung adenocarcinoma, and breast cancer. However, the role of Kif15 in neuroinflammation, particularly its effect on TNF-α, has not been reported. Summary of the Invention
[0005] The purpose of this invention is to provide the application of Kinesin 12 in the preparation of drugs for the treatment of neuroinflammatory diseases.
[0006] The CDS region nucleotide sequence of Kif15:
[0007] Mus musculus kinesin family member 15(Kif15),mRNA
[0008] NCBI Reference Sequence:NM_010620.1
[0009] GenBank Graphics
[0010] >NM_010620.1:54-4217Mus musculus kinesin family member 15(Kif15),mRNA
[0011]
[0012] The protein sequence of Kif15:
[0013] kinesin-like protein Kif15[Mus musculus]
[0014] NCBI Reference Sequence:NP_034750.1
[0015] GenPept Identical Proteins Graphics
[0016] >NP_034750.1kinesin-like protein Kif15[Mus musculus]
[0017]
[0018] This invention, through consulting the GEO online database, discovered that Kif15 expression shows an increasing trend during the development of neurodegenerative diseases such as Alzheimer's disease. Furthermore, by designing substances that intervene in Kif15 expression to reduce Kif15 expression in microglia, it was verified that knocking down Kif15 can significantly inhibit TNF-α expression in microglia, thus demonstrating that Kif15 can be used to screen or prepare drugs for the treatment of neuroinflammation. Attached Figure Description
[0019] Figure 1 This study investigated the expression changes of Kif15 during the development and progression of Alzheimer's disease.
[0020] Figure 2 Results of qRT-PCR (A) and western blotting (B) after treating microglia with Kif15siRNA.
[0021] Figure 3 Results of ELISA (A), Western blotting (B), and immunocytochemical experiments (C) after treating microglia with Kif15 siRNA. Detailed Implementation
[0022] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, but this should not be construed as limiting the present invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and substance of the invention are within the scope of the present invention. Experimental methods and reagents not specifically described in the embodiments are performed according to conventional conditions in the art.
[0023] Example 1
[0024] Kif15 expression patterns in neurodegenerative diseases
[0025] Taking Alzheimer's disease (GEO Profiles: GDS810 / 219306 retrieved from the online GEO database) as an example, the results are as follows: Figure 1 As shown, the expression of Kif15 gradually increases during the development of Alzheimer's disease.
[0026] Example 2
[0027] I. Primary Culture of Microglia
[0028] The ICR suckling mice used in the experiment were provided by the Experimental Animal Center of Nantong University. The following procedures were followed for the one-day-old ICR suckling mice: The mice were disinfected by spraying with 75% alcohol, decapitated, and the skin and skull were removed with forceps. The brains were separated and immersed in Hanks' solution containing 2% penicillin and streptomycin. The brain membranes were removed to remove the hippocampus, and all hemispheres were transferred to 15mL centrifuge tubes. 3mL of 0.25% trypsin was added. The mixture was inverted 10 times, incubated at 37℃ for 10 minutes, and 1.5mL of 400U / mL DNase I was added. Digestion was terminated by adding 4.5mL of DMEM / F12 complete medium. The tubes were centrifuged at 1500rpm for 5 minutes, the supernatant was discarded, and the cells were resuspended in 5mL of DMEM / F12 complete medium. After counting, the cells were divided into 5×10⁻⁶ cells. 6 Microglia were seeded in T75 flasks containing 20 mL of DMEM / F12 complete medium (with added GM-CSF). After 14 days of routine culture, the T75 flasks were shaken at 180 rpm for 15 min to collect microglia for later use.
[0029] II. siRNA electroporation of microglia
[0030] Count the microglia cultured to generation P1, take a certain amount of cells and mix with siRNA, mix thoroughly, so that the final concentration is 2.0 × 10⁻⁶ cells per 100 μL tube. 6 Microglia were injected with 200 nM siRNA, with a cell volume of 90 μL and an siRNA volume of 10 μL. Electroporation was then performed according to the NEPA21 (NEPAGENE) microglia electroporation procedure (275 V, 1.5 ms).
[0031] The Kif15 siRNA is shown below:
[0032] Chain of Justice: CAGCUAUAAUUGCAAAUGUTT(Seq_1)
[0033] Antonym chain: ACAUUUGCAAUUAUAGCUGTT(Seq_2).
[0034] Ctrl siRNA:
[0035] Justice Chain: UUCUCCGAACGUGUCACGUTT(Seq_3)
[0036] Antonym chain: ACGUGACACGUUCGGAGAATT(Seq_4).
[0037] III. LPS (lipopolysaccharide)-induced activation of microglia
[0038] siRNA treatment for 48 h was followed by treatment with 50 ng / ml LPS (Cat. L2630, Sigma) for 4 h to induce microglial activation. Activated microglia were collected for RNA or protein extraction, and cells were fixed with 4% paraformaldehyde (PFA) for immunocytochemistry. The culture supernatant was stored at -80°C for later use (ELISA experiments).
[0039] IV. Extraction of Cellular RNA
[0040] (1) Add 20 μL of β-mercaptoethanol to each milliliter of RTL lysis buffer, mix well, and prepare immediately before use.
[0041] (2) Discard the culture medium, add 350 μL of RTL lysis buffer / β-mercaptoethanol to each well, pipette to fully lyse the cells, and collect them into 1.5 mL RNase-free EP tubes.
[0042] (3) Add an equal volume of RNA Binding Buffer to the lysis buffer and vortex for 15 seconds.
[0043] (4) Put HiPure RNA Mini Column I into a 2mL collection tube, transfer all the mixture to a centrifuge, and centrifuge at 8000g for 1min.
[0044] (5) Discard the filtrate, add 500 μL Buffer RW1 to the centrifuge column, let stand for 3 min and then centrifuge.
[0045] (6) Discard the filtrate, add 500 μL Buffer RW2 to the centrifuge column, let stand for 3 min, and centrifuge at 8000g for 1 min.
[0046] (7) Repeat (6) once.
[0047] (8) Discard the filtrate and centrifuge the empty column at 10000g for 3 min.
[0048] (9) Transfer the centrifuge column to a 1.5 mL RNase-free EP tube, add 20 μL RNase-free Water to the center of the column membrane, let stand for 1 min, and centrifuge at 10000 g for 1 min.
[0049] (10) Detect the OD value and concentration of RNA and store at -80℃ for later use.
[0050] V. RNA reverse transcription to synthesize cDNA
[0051] Using a reverse transcription kit (Vazyme R312-01), 500 ng of RNA was reverse transcribed into cDNA. The procedure was performed on ice, with each reaction volume being 20 μL, in the following order: 5×gDNA wiper Mix, 2 μL; 10×RT Mix, 2 μL. III. Enzyme Mix, 2 μL; Random hexamers, 1 μL; Total RNA, 500 ng; the remainder was made up with RNase-free H2O. The reaction program was: 37℃ for 15 min, 85℃ for 5 sec, 4℃ to infinity.
[0052] VI. Real-time quantitative PCR (qRT-PCR)
[0053] Design qRT-PCR primer sequences based on primer design principles.
[0054] Kif15qRT-PCR primers
[0055] Kif15-F:CCACTGAGCAGCTGAACATG(Seq_5)
[0056] Kif15-R: TCCAGCTGCCTCATCTTCAA(Seq_6)
[0057] The cDNA obtained from the reverse transcription reaction was diluted 1:5 with ddH2O and subjected to the following qRT-PCR reaction according to the Novizan kit (Q712) instructions: 2×Taq Pro Universal SYBR qPCR Master Mix, 5 μL; Primer F (10 μM), 0.5 μL; Primer R (10 μM), 0.5 μL; Template DNA / cDNA, 1 μL; the remainder was brought to 10 μL with ddH2O. The reaction mixture was thoroughly mixed, and the Real-time PCR program was as follows: Pre-denaturation: 95℃ for 30 sec; Denaturation: 95℃ for 10 sec; Annealing and extension: 60℃ for 30 sec; Cycle number: 40; Melting curve: 95℃ for 15 sec, 60℃ for 1 min, 95℃ for 15 sec. The reaction was set up with 3 replicates, and 18S rRNA was used as the internal control. After the program was completed, the melting and amplification curves were examined. Data with large errors were discarded, and statistical analysis was performed on the data according to specific experimental requirements.
[0058] VII. Identification of siRNA interference efficiency
[0059] Microglia were transfected with Kif15 siRNA and its control Ctrl (Control) siRNA, respectively. After 48 hours, the cells were harvested, and RNA was extracted according to the kit instructions for qRT-PCR. Protein was extracted for Western blotting. The results are as follows: Figure 2 As shown, after 48 hours of siRNA treatment, Kif15siRNA significantly reduced the expression of Kif15 in microglia. (Kif15siRNA vs. Ctrrl siRNA).
[0060] 8. ELISA, Western blotting, and immunofluorescence assays to detect TNF-α expression after Kif15 knockdown
[0061] (1) Elisa experiment
[0062] Cell culture supernatant stored at -80℃ was analyzed according to the ELISA kit (Multi Sciences Biotech, China) instructions to detect the level of the cytokine TNF-α in the supernatant. All reagents were warmed before use. After the reaction was terminated, the optical density (OD) value was measured at an absorption wavelength of 450 nm using a microplate reader (Biotek Synergy2, USA). The results are as follows: Figure 3 As shown in Figure A, knocking down Kif15 significantly reduces the secretion of TNF-α cytokine by microglia.
[0063] (2) Western blotting and immunocytochemistry experiments
[0064] Microglia were lysed using RIPA buffer (Thermo Fisher Scientific, Waltham, MA, USA), and total protein was quantified using a BCA kit. After SDS-PAGE electrophoresis, proteins were transferred to 0.2 μm PVDF membranes. After blocking with 5% skim milk, the membranes were incubated overnight with primary antibodies (TNF-α (1:1000, Cat.Ab183218, abcam), Kif15 (1:500, Cat.55407-1-AP, proteintech), and GAPDH (1:2000, Cat.60004-1-Ig, proteintech)). After washing with TBST, the membranes were incubated with the corresponding secondary antibodies at room temperature for 2 h. After ECL (Cat:#180-5001, Tanon), the membranes were developed with X-ray film, scanned, and analyzed using ImageJ software. GAPDH was used as an internal control.
[0065] Microglia cultured in 24-well plates were fixed with 4% PFA for 30 min, then blocked with blocking buffer containing 10% normal goat serum at 37°C for 60 min. Incubation with TNF-α antibody (1:5000, Cat.Ab183218, abcam) overnight at 4°C was followed by incubation with the corresponding secondary antibody (488-conjugated goat anti-rabbit IgG, 1:400, Jackson ImmunoResearch) and monoclonal anti-β-tubulin-Cy3 antibody (1:1000, Cat.C4585, Sigma). Cells were then counterstained with DAPI (1:2500, Cat.D9542, Sigma), washed with PBS, and mounted. Images were taken using a Leica DM18 fluorescence microscope and analyzed using ImageJ software. Results are shown below. Figure 3 As shown in BC, knocking down Kif15 significantly reduced the expression of TNF-α in microglia.
Claims
1. Use of a Kinesin 12 inhibitor, which is an siRNA with the following sequence: sense strand: CAGCUAUAAUUGCAAAUGUTT antisense strand: ACAUUUGCAAUUAUAGCUGTT, for the preparation of a medicament for the treatment of neuroinflammation.
Citation Information
Patent Citations
Transparent cell kidney cancer diagnostic kit based on genes KIF14, KIF15 and KIF 20A and use method of diagnostic kit
CN107460250A
Purpose of KIF15 inhibitor to preparation of liver cancer treatment medicine
CN107789624A